CN101260407B - Increase of plants drought resistance by using mouse nitrous oxide synthetase gene - Google Patents
Increase of plants drought resistance by using mouse nitrous oxide synthetase gene Download PDFInfo
- Publication number
- CN101260407B CN101260407B CN200810036342A CN200810036342A CN101260407B CN 101260407 B CN101260407 B CN 101260407B CN 200810036342 A CN200810036342 A CN 200810036342A CN 200810036342 A CN200810036342 A CN 200810036342A CN 101260407 B CN101260407 B CN 101260407B
- Authority
- CN
- China
- Prior art keywords
- nitric oxide
- plant
- point
- oxide synthase
- inducible nitric
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a mouse inducible nitric oxide synthase gene which is transformed into a plant to improve the capability of drought resistance of the plant. The invention respectively uses two restriction endonucleases which are BamHI and SacI to digest the mouse inducible nitric oxide synthase gene with site-directed mutagenesis, has the digested mouse inducible nitric oxide synthase gene (muiNOS) connected with a pYPX 245 (AY178049) plant expression vector containing a double 35S promoter through T4DNA joinase, and acquires a recombinant plasmid pYPXmuiNOS containing the target gene muiNOS by digestion identification and sequence analysis. Finally, the mouse inducible nitric oxide synthase gene is transformed into the plant to acquire a transgenic plant with the capability of drought resistance.
Description
Technical field
The invention belongs to field of crop genetic breeding, specifically utilize Agrobacterium that mouse nitrous oxide synthetase gene is transformed in the plant, make it in plant, to efficiently express, improve the drought-resistant ability of plant.
Background technology
Arid is one of main environment factor that influences growth and development of plants, and arid can influence the moisture state of plant, and plant hydropenia is sustained an injury.According to statistics, world's arid, semiarid zone account for 34.9% of land area, and arid accounts for the first place to the influence of world crop output in many natural adverse circumstances, and its harm is equivalent to other disaster sum.China arid, semiarid zone account for 52% of area, national irrigation district year about 30,000,000,000 cubes of lack of water.Because of lack of water is received grain 350 ~ 40,000,000,000 kilogram less; Particularly China's relationship and primary grain producing such as North China, northeast and northwest are the serious area of China's lack of water.In China western part and northern territory, drought stress has also seriously influenced the growth of surface vegetation, has caused more and more serious ecological problem.As: grassland degeneration, soil desertification etc.Therefore it is very important to understand the mechanism of preserving moisture under the drought stress in the cell.Under the drought stress condition, plant can abduction delivering some genes, through studying these, possibly find plant to the adaptation of drought stress and resist mechanism, and theoretical support is provided for the plant drought genetically engineered by drought stress institute inductive gene.In recent years; From plants such as Arabidopis thaliana, clone some in succession and received drought-induced gene; Like protein kinase gene, photosynthetic gene, osmoregulation gene, functional protein gene etc., the drought stress signal experiences a series of transmittance process, induces the expression of these specific genes at last.Also from higher plant, isolate simultaneously the gene of the encoding transcription factor of the arid related gene expression of a series of regulation and control; Through between the transcription factor and and other GAP-associated protein GAP between interaction, activate or suppress arid etc. and coerce the genetic expression of factor inductive.
Nitrogen protoxide (NO) is a kind of very important bioactive molecules of discovered in recent years, and it is prevalent in protozoon, bacterium, yeast, the plant-animal.NO can be used as the second messenger of a kind of key in the animal physiological metabolic process, participates in that blood vessel is lax, nerve conduction and innate immunity reaction.NO is a kind of gas molecule with radical character, and it can obtain an electronics or lose an electronics to form NO
+And NO
-Because NO has a unpaired electronics, so it is easy to and oxygen (O
2), ultra oxygen (O
-2) and other compound react, under the competent situation of oxygen supply NO can with O
-2Reaction generates peroxo-nitrous acid (ONOO
-).After 1996, increasing research shows that NO participates in a lot of plant physiology metabolism and regulates.NO can be used as the signaling molecule of plant stress-resistance reaction, the growing of the respiration of involved in plant, photomorphogenesis simultaneously, seed germination, root, fruit tissue ripe and old and feeble.But on the whole; The research in most of fields still is in the starting stage; A lot of problems such as the relation of effect, NO and stress resistance of plant, NO and the plant endogenous hormones of NO in growth and development of plants, the molecular mechanism of action of NO etc., all remain further deeply to be inquired into.
When plant received drought stress, wide variation had taken place in the concentration of activity in vivo oxygen.Remove the enzyme that reactive oxygen species is poisoned, for example NADPH-GSSG reductase, superoxide-dismutase and ascorbate peroxidase enzyme increase in the reaction to drought stress; Reduce leaf water content and stomatal closure subsequently and all can produce ultra-oxygen anion free radical; The photorespiration activity is also followed the active increase of glycolate oxidase in arid process, improves the synthetic of hydrogen peroxide.
A large amount of tests having confirmed that NO participates in the formation of active oxygen radical, and with the degeneration-resistant reaction of active oxygen synergy inducing plant.NO can suppress the activity of katalase and the ascorbase of tobacco.NO is through suppressing the degeneration-resistant reaction that aconitase comes involved in plant, be on the one hand since the plastosome aconitase by the NO inactivation after, reduce electron transport chain stream of electrons, thereby reduce the generation of active oxygen (ROS) through plastosome; Owing to cause citric acid concentration rising in the cell after the aconitase activity inhibited, induce and the active rising of degeneration-resistant relevant alternating oxidation enzyme (AOX), and the latter also can reduce the generation of ROS on the other hand.Jiang etc. observe owing to ABA induces the nadph oxidase increased activity and make the rising of ROS level in the corn drought stress response, and this shows close relation between ABA, ROS and the NO (plant 2002).When Zhang etc. influence under the osmotic stress wheat seeds sprouting and active oxygen metabolism in the research exogenous NO gas; Find that NO donor sodium nitroprusside (SNP) is through promoting the accumulation of katalase (CAT), the active rising of ascorbate peroxidase enzyme (APX) and proline content under the osmotic stress; The activity of lipoxygenase inhibitor (LOX) improves the resistance of oxidation (Botany Gazette 2003) in the wheat seeds sprouting process under the osmotic stress.
NO possibly regulate the drought resisting reaction of plant through dormin.Drought stress is synthesizing at position inducing plant hormone dormins (ABA) such as root system of plant, blades rapidly.As far back as the sixties in last century, but the synthetic ABA of Wright etc. proof osmotic stress inducing cell, when receiving environment-stress such as arid, low temperature, salt damage when plant (Nature Journal 1969), cell run-up ABA.The drought resistance power is relevant between ABA accumulation and plant variety, and ABA content can be used as one of evaluation index that drought resistance identifies.
Zhao etc. use the wheat tip of a root that exsomatizes to study as material, 20min behind the discovery drought stress, and the NO synthase activity obviously increases; ABA begins accumulation behind the 60min.This accumulation can be blocked by NO synthetase inhibitors or NO scavenging agent; And exogenous NO gas donor Nitroprusside ion can induce the accumulation of ABA equally in the tip of a root, and these presentation of results NO participates under the water stress in the wheat tip of a root plant hormone ABA synthetic (Australian plant physiology magazine 2001).Lamattinat etc. discover that the relative water content (RWC) that the pretreated plant leaf of SNP keeps is higher behind drought stress, transpiration rate and stomatal aperture descend, and the ion seepage reduces; These effects of SNP all can be reversed (plant physiology 2004) by the special scavenging agent cPTIO of NO.NO possibly pass through the degeneration-resistant reaction of cGMP (cGMP) approach involved in plant.In the zooblast; Guanylate cyclase plays a crucial role in the NO signal conductive process, and NO can cause increasing sharply of cGMP second signal through combining with heme iron or making cysteine residues that the guanylate cyclase that the S-nitrosylation activates solubility in the born of the same parents take place; NO activates ring type ADP-ribose (cADPR) synthetic enzyme through cGMP then; Make cADPR synthetic in a large number, cADPR can combine with the cellular calcium passage, promotes calcium particle from the organoid that stores, to discharge.There is the signal conduction mode similar with animal in NO in plant materials.Utilize NO processing tobacco leaf or suspension system cell all can bring out a large amount of accumulation of endogenous cGMP; And cADPR can induce the release of calcium among the vacuole, and NO handles the broad bean stomata guard cell also can increase calcium ion concn in the tenuigenin.There are some researches show; ABA inductive stomatal closure phenomenon realizes through calcium ion among the NO adjusting stomata guard cell; The switch of pore depends on potassium ion and the chlorine ion concentration in the cell; The active potassium-channel activity with the inhibition inward rectification of chloride channel that ABA improves outward rectification all relies on calcium ion, and NO scavenging agent cPTIO can stop ABA to induce stomatal closure.There are some researches show that NO and ABA can independently induce stomatal closure separately, but also have positive coopertive effect, NO is the key signal molecule that a mediation ABA induces stomatal closure.Above result of study shows that all NO possibly be the next important adjusting molecule of plant drought stress.As a small molecules that perviousness is very strong, it is long apart from shuttling back and forth at iuntercellular and striding the film diffusion that it can pass the several layers cell, and irritation cell is made and being replied.In its functionating process, NO can constitute the signal network of a complicacy with other signaling molecules such as cGMP, Ca2+, H2O2, ROS and SA etc., and regulates and control a lot of gene transcription.
Up to now, the result of study of NO mostly is through exogenous NO gas or adds in vitro tests such as NO donor and obtain that the result of some contradictions often appears in the former study report.The present invention improves the drought resisting performance of plant through changing plant endogenous content of nitric oxide.
Summary of the invention
The purpose of this invention is to provide a kind of mouse inducible nitric oxide synthase gene, this gene transformation is gone in the plant then, improves the drought-resistant ability of plant.
This gene is eliminated 591 BamHI point of contacts in the inducible nitric oxide synthase gene, 763 and 1070 EcoRI point of contacts, and the point of contact of 399,540 and 1008 SacI is so can not be cut by BamHI, EcoRI and SacI restriction enzyme.
The mouse inducible nitric oxide synthase gene (muiNOS) that the present invention will contain 3435bp (NM_010927) (U.S. state-run biotechnology information center) is transformed; Utilize rite-directed mutagenesis method (Peng2006; Using microbe and biotechnology) general 591 BamHI point of contacts wherein, 763 and 1070 EcoRI point of contacts, 399; Eliminate at 540 and 1008 SacI point of contacts, obtains goal gene muiNOS.Method is following: design positive and negative two primers at above-mentioned 6 restriction enzyme sites respectively:
591 BamHI point of contact mutant primers: 591Z:5 ' CCTCGCTGCA, TCGGCAGG AT, GCAG; 591F5 ' CAGGTTGGAC, CACTGCATCC, TGCCGATG.
763 EcoRI point of contact mutant primers: 763Z:5 ' CAGGCTCTGG, ACTTCACAGC, TCATCC; 763F:5 ' GCTGTGAAGT, CCAGAGCCTG, AAG.
1070 EcoRI point of contact mutant primers: 1070Z:5 ' GTGGCCTCGA, CTTCCCAGC C, TGC; 1070F:5 ' CTGGGAAGTC, GAGGCCACCC, ACCTCCAG.
399 SacI point of contact mutant primers: 399Z:5 ' CAAGCCTACC, CCTCTGGAGG, AGGTCC TG; 399F:5 ' CAATGGCATG, AGGCAGGACC, TCCTC.
540 SacI point of contact mutant primers: 540Z:5 ' CTCACTCTGG, ATGACCTCAT, C; 540F:5 ' TGGCAAAGAT, GAGGTCATCC, AGAGTG.
1008 SacI point of contact mutant primers: 1008Z:5 ' GAGTGGTTCC, AGGAGGTC GG, GTTG; 1008F:5 ' CACTTCAACC, CGACCTCCTG, GAACCAC.
Utilize the primer in adjacent site and the primer at gene two ends to amplify small segment respectively, amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min.Totally 25 circulations, after PCR finished, segment reclaimed with 10% acrylamide gel, and it is that template is mixed that above-mentioned 7 recovery segments are got 10-100ng, is that primer splices above-mentioned segment with muiNOSZ and muiNOSF, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.
The present invention uses the mouse inducible nitric oxide synthase gene of BamHI and two digestion with restriction enzyme rite-directed mutagenesises of SacI respectively; Through measuring, 591 BamHI point of contact sequences change into: GGATGC, and 763 EcoRI point of contact sequences change into: GACTTC; 1070 EcoRI point of contact sequences change into: GACTTC; 399 SacI point of contact sequences change into: GACCTC, 540 SacI point of contact sequences change into: GACCTC, 1008 SacI point of contact sequences change into: GAGGTC.Then; 37 ℃ of enzymes are cut 2h; The mouse inducible nitric oxide synthase gene (muiNOS) that enzyme is cut through the T4DNA ligase enzyme is connected with pYPX245 (AY178049) (the U.S. state-run biotechnology information center) plant expression vector that contains two 35S promoters, and enzyme is cut the recombinant plasmid pYPXmuiNOS that evaluation and sequencing have obtained to contain goal gene muiNOS.This expression vector also comprises gus reporter gene and band intron kalamycin resistance marker gene (Chinese patent ZL 00 1 19754.8).
The present invention utilizes electric shocking method that plasmid is imported in the agrobacterium tumefaciens, and the agrobacterium tumefaciens bacterial strain comprises EHA105, LBA4404, GV3101, AGL-1 (available from American Type Culture Collecti).(Liu Qiao complete 1998 with mouse inducible nitric oxide synthase gene transformation paddy rice for agriculture bacillus mediated method; The plant physiology journal), in the plants such as tobacco and tomato (USP 6323396); (Clough 1998 in Arabidopis thaliana with the gene transformation of mouse inducible nitric oxide synthase for the conversion of the sticking flower of Agrobacterium method; The phytology magazine), verified the tolerance of transgenic plant to arid.
Beneficial effect of the present invention
1. mouse inducible nitric oxide synthase gene can continue in plant, to express, and the NO that this enzyme produces has persistence to the resistance of plant.
2. mouse inducible nitric oxide synthase genetic safety is stable, has fewer environmental impacts.
Description of drawings
Fig. 1 mouse inducible nitric oxide synthase genetic modification method figure.
Fig. 2 mouse inducible nitric oxide synthase gene plant expression vector establishment.
The raising that paddy rice shows drought-resistant ability behind Fig. 3 transformed mouse inducible nitric oxide synthase gene.
Embodiment
Embodiment 1:
The genetic modification of mouse inducible nitric oxide synthase
At first obtain mouse nitrous oxide synthetase gene.Get about 100 gram mouse, slaughter the back liquid nitrogen flash freezer, place and preserve in-70 ℃ of refrigerators in order to extracting total RNA.CDNA synthetic agent box is the Clontech Company products; The DNA post reclaims test kit and purchases Amersham company; Reagent RNA extraction agent box RNeasy Plant MiniKit is the QIAGEN Company products; Various restriction enzymes and T4 DNA Ligase are all available from Shanghai Takara company.Total RNA adopts the RNeasy Plant Mini Kit of QIAGEN company to extract.
Mouse cDNA's is synthetic synthetic by the SMART cDNA Library Construction Kit of Clontech company specification sheets operation carrying out first chain.With synthetic cDNA first chain is template; With muiNOSZ:5 ' AAGGATCCATGGCTTGCCCCTGGAAGTTTCTCTTC and muiNOSF:AAGAGCTCTCAGAGCCTCGTGGCTTTG GGCTCCTC is primer; Utilize PCR to carry out the cDNA amplification, amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 3min.Totally 25 circulations.After PCR finishes, phenol: the chloroform extracting, the absolute ethyl alcohol that adds 2 times of volumes again precipitates, and deposition obtains the mouse nitrous oxide synthetase gene fragment with 30 μ l water dissolution.
Secondly mouse nitrous oxide synthetase gene is carried out rite-directed mutagenesis, mutation method such as Fig. 1.Utilize the rite-directed mutagenesis method with 591 BamHI, 763 and 1070 EcoRI point of contacts, and eliminate at 399,540 and 1008 SacI point of contacts.
591 BamHI point of contact mutant primers: 591Z:5 ' CCTCGCTGCA, TCGGCAGG AT, GCAG; 591F5 ' CAGGTTGGAC, CACTGCATCC, TGCCGATG.
763 EcoRI point of contact mutant primers: 763Z:5 ' CAGGCTCTGG, ACTTCACAGC, TCATCC; 763F:5 ' GCTGTGAAGT, CCAGAGCCTG, AAG.
1070 EcoRI point of contact mutant primers: 1070Z:5 ' GTGGCCTCGA, CTTCCCAGC C, TGC; 1070F:5 ' CTGGGAAGTC, GAGGCCACCC, ACCTCCAG.
399 SacI point of contact mutant primers: 399Z:5 ' CAAGCCTACC, CCTCTGGAGG, AGCTCC TG; 399F:5 ' CAATGGCATG, AGGCAGGACC, TCCTC.
540 SacI point of contact mutant primers: 540Z:5 ' CTCACTCTGG, ATGACCTCAT, C; 540F:5 ' TGGCAAAGAT, GAGGTCATCC, AGAGTG.
1008 SacI point of contact mutant primers: 1008Z:5 ' GAGTGGTTCC, AGGAGGTC GG, GTTG; 1008F:5 ' CACTTCAACC, CGACCTCCTG, GAACCAC.
Getting 1 μ l mouse nitrous oxide synthetase gene amplified fragments is template, with muiNOSZ and 339F; 339Z and 540F; 540Z and 591F; 591Z and 763F; 763Z and 1008F; 1008Z and 1073F; 1073Z and muiNOSF carry out pcr amplification, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min.Totally 25 circulations, after PCR finished, segment reclaimed with 10% acrylamide gel, and it is that template is mixed that above-mentioned 7 recovery segments are got 10-100ng, is that primer splices above-mentioned segment with muiNOSZ and muiNOSF, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.
After PCR finished, phenol: the chloroform extracting, the absolute ethyl alcohol that adds 2 times of volumes again precipitated.Each adds SacI and the BamHI enzyme is cut digestion, and it is disconnected that the DNA post reclaims the enzyme section.Enzyme cut handle fragment well and carry out directed cloning, in the efficient transformed into escherichia coli DH5 α competence (precious biological Dalian Bioisystech Co., Ltd).
Embodiment 2:
Mouse inducible nitric oxide synthase plant expression vector construction
The plasmid that above-mentioned clone is contained transformed mouse inducible nitric oxide synthase gene fragment; Carry out double digestion with BamHI and SacI respectively; Reclaim dna fragmentation; Through the T4DNA ligase enzyme mouse inducible nitric oxide synthase gene is connected (U.S. state-run biotechnology information center) with the pYPX245 plasmid that contains two 35S promoters, BamHI and SacI double digestion, fragment length is 3435bp.Utilize the dna sequencing appearance to carry out sequencing, obtained to contain the recombinant plasmid pYPXmuiNOS of mouse inducible nitric oxide synthase gene.As illustrate 2.This expression vector also comprises gus reporter gene and band intron kalamycin resistance marker gene (Chinese patent ZL 00 1 19754.8).
Embodiment 3:
Agrobacterium is cultivated and Plant Transformation
Agrobacterium strains is agrobacterium tumefaciens EHA105, LBA4404, GV3101, AGL-1 bacterial strain.Plasmid imports in the Agrobacterium (available from American Type Culture Collecti) through electric shocking method.Picking list bacterium contains overnight cultures in the YEB substratum of 50mg/l Rifampin to 25ml; Get 5ml bacterium liquid and be transferred in the 100mlYEB substratum that contains the 50mg/l Rifampin, be cultured to OD600=0.7-0.8, bacterium liquid was placed 10 minutes on ice; The centrifugal 10min of 5000rpm; 4 ℃, collect thalline, add the 100ml aseptic double-distilled water and clean twice.Add 4ml 10% glycerine suspension thalline, forward the 50ml centrifuge tube to.The centrifugal 10min of 5500rpm, 4 ℃.Collect thalline, add 500 μ l, 10% glycerine suspension thalline, forward the 1.5ml centrifuge tube to.Get 70 μ l competent cells, add 1 μ l recombinant plasmid pYPXmuiNOS.With the yellow rifle head mixing of decaptitating, forward in the 0.1cm electric shock cup.Shock parameters: 200 Ω, 1.7KV, 2.5F (Bio Rad Laboratories) adds 800 μ l SOC nutrient solutions immediately after the electric shock.Cultivate after 1 hour, get 100 μ l and be coated with resistance plate screening transformant, 28 ℃ of cultivations.
The sticking flower of Arabidopis thaliana method transforms
The agrobacterium strains list bacterium colony that contains the purpose plasmid connects bacterium to 5 and milliliter contains in the corresponding antibiotic LB substratum 28 ℃ and cultivated 2 days.5 milliliters of bacterium liquid being forwarded in 500 milliliters the liquid LB substratum to 28 ℃ and cultivate 16-24 hour (OD=1.5-2.0). liquid can be preserved 30 days at 4 ℃.Centrifugal collection thalline under the room temperature, centrifugal 10 minutes of 4000g.Fresh sucrose solution with equal-volume 5% suspends.Transfer in the beaker behind the Silwet-77 mixing of adding 0.02%.Each bacterial strain changes the 2-3 alms bowl with 300 milliliters of conversions.After 7 days, transform again 1 time.Arabidopis thaliana is inverted the back immerses 10 seconds in the bacterium liquid.Lotus throne and inflorescence all will infect.After infecting transformed plant bacterium liquid air is done 3-5 second.With preservative film that the transformed plant circle is good, kept flat 16-24 hour.Be not placed under high temperature and the high light after the conversion.Open preservative film, keep certain humidity, seed is received in regrowth after 1 month.Utilize 50 μ g/mL Totomycin to carry out the transformed plant screening.
Tobacco and tomato conversion
Select fuller seed, the alcohol wash with 75% 1 minute, Youxiaolin adds 1 soil temperature sterilization 10 minutes, and seed is layered on the MSO substratum, and 28 degree are cultivated and are waited to germinate.With the tobacco spire, tomato cotyledon or hypocotyl are cut into 1cm2, put into the substratum of MSO+NAA1 (1ug/ml)+BA2 (4ug/ml), and 22 degree were cultivated 1 day.Centrifugal 5000g is centrifugal 8 minutes behind the Agrobacterium cultivation OD0.8-1.0, and sterile water wash once after the suspension of equal-volume MS nutrient solution is infected 8 minutes, blots in the substratum that is placed on MSO+NAA1+BA2, and 22 degree were cultivated 3 days altogether.Change screening culture medium MSO+IAA1 (0.1ug/ml)+ZT (2ug/ml)+Cb (500ug/ml)+Km (50ug/ml) then over to and cultivate 2-3 week; Change division culture medium MSO+IAA1 (0.1ug/ml)+ZT (2ug/ml)+Cb (500ug/ml)+Km (100ug/ml) again over to and cultivate 2-3 week, change root media 1/2MS+IAA1 (0.1ug/ml) at last over to and cultivate.
Rice conversion
The N6 substratum is a minimum medium, the seed that shells, and 12-15 days the rataria in pollination back is inoculated into (the N6 substratum of evoked callus in the N6D2 substratum after surface sterilization; Lactoalbumin hydrolysate 500mg/L, sucrose 30g/L, 2; 4-D 2mg/L, plant gel 2.5g/L, pH5.8); Cultivate and get callus after 4-7 days and transform.Centrifugal 5000g is centrifugal 8 minutes behind the Agrobacterium cultivation OD0.8-1.0, and DDH2O cleans once, and equal-volume MS nutrient solution blots in the substratum that is placed on MSO+NAA1+BA2 after suspending and infecting 8 minutes, and 22 degree were cultivated 3 days altogether.Change over to then screening culture medium (add cephalo Cb (500ug/ml) and Totomycin HAT (50ug/ml), the callus after the conversion contain and the resistance substratum on cultivated for 3~4 generations, change over to (2mg/L KT) in the division culture medium; Young shoot grows to 2mm and transfers to root media (1/2MS+0.5mg/L IBA).Add 500mg/L enzymic hydrolysis milk-protein (CH) in the above substratum respectively, 0~700mg/L Stimulina or l-arginine, sucrose 30~80g/L, agar 6g is several.pH?5.8。Subculture cycle is 25d.Flaxen embryo callus is changed in the division culture medium, and differentiation is sprouted about 30d.Intensity of illumination 1500~2000lx, 12~14h/d.
From the resistant plant that obtains, get a part of leaf; Intrusion contains in the staining fluid of X-GLUC; The screening blade becomes blue transfer-gen plant and carries out Molecular Detection, extracts the total DNA of blade, with reference to the method for " molecular cloning "; With muiNOSZ and muiNOSF is that primer detects transfer-gen plant being carried out PCR, and amplification condition is: 94 ℃ of preheating 1min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 4min.Totally 25 circulations.Whether the gene that makes eye bright from molecular level Shanghai Stock Exchange imports.
Embodiment 4:
Drought resisting analysis behind the mouse inducible nitric oxide synthase gene-transformed plant
To transform the plant selfing and isozygoty for 3 generations, obtain to isozygoty transformant, collect seed.After planting, be transplanted in the minimum medium, cultivated 20 days, do not water, behind the plant wilt, normally water the drought resisting effect of making plant more by the time.Diagram 3 shows that the mouse inducible nitric oxide synthase obviously improves the drought resisting performance of monocotyledon rice.
Claims (3)
1. mouse inducible nitric oxide synthase gene; It is characterized in that the sequence of said mouse inducible nitric oxide synthase gene is to utilize the rite-directed mutagenesis method to eliminate 591 BamHI point of contacts, 763 and 1070 EcoRI point of contacts and 399,540 and 1008 SacI point of contact gained in the nitrous oxide synthetase gene shown in SEQ ID No 1;
Wherein, said 591 BamHI point of contact sequences change into: GGAT
GC;
Said 763 EcoRI point of contact sequences change into: GA
CTTC;
Said 1070 EcoRI point of contact sequences change into: GA
CTTC;
Said 399 SacI point of contact sequences change into: GA
CCTC;
Said 540 SacI point of contact sequences change into: GA
CCTC;
Said 1008 SacI point of contact sequences change into: GAG
GTC.
2. the preparation method of mouse inducible nitric oxide synthase gene as claimed in claim 1 is characterized in that this method comprises the steps:
A. utilize the rite-directed mutagenesis method will the nitrous oxide synthetase gene shown in SEQ ID No 1 in 591 BamHI, 763 and 1070 EcoRI point of contacts and 399,540 and 1008 SacI point of contacts eliminate;
B. the plasmid that above-mentioned clone is contained transformed mouse inducible nitric oxide synthase gene fragment; Carry out double digestion with BamHI and SacI respectively; Reclaim dna fragmentation, mouse inducible nitric oxide synthase gene is connected acquisition recombinant plasmid pYPXmuiNOS with the pYPX245 plasmid that contains two 35s promotors with the T4 dna ligase;
C. above-mentioned improved mouse inducible nitric oxide synthase gene is connected with plant expression vector, has obtained to contain the recombinant plasmid of mouse inducible nitric oxide synthase gene.
3. the purposes of mouse inducible nitric oxide synthase gene according to claim 1 is characterized in that, is used for Plant Transformation, improves the drought-resistant ability of plant.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN200810036342A CN101260407B (en) | 2008-04-21 | 2008-04-21 | Increase of plants drought resistance by using mouse nitrous oxide synthetase gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN200810036342A CN101260407B (en) | 2008-04-21 | 2008-04-21 | Increase of plants drought resistance by using mouse nitrous oxide synthetase gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101260407A CN101260407A (en) | 2008-09-10 |
CN101260407B true CN101260407B (en) | 2012-08-29 |
Family
ID=39961105
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN200810036342A Expired - Fee Related CN101260407B (en) | 2008-04-21 | 2008-04-21 | Increase of plants drought resistance by using mouse nitrous oxide synthetase gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101260407B (en) |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6198020B1 (en) * | 1998-02-26 | 2001-03-06 | Pioneer Hi-Bred International, Inc. | Nitric oxide as an activator of the plant pathogen defense systems |
-
2008
- 2008-04-21 CN CN200810036342A patent/CN101260407B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
Cloning and characterization of inducible nitric oxide synthase from mouse macrophages;QW Xie et al.;《Science》;19920410;第256卷(第5054期);225-228 * |
QW Xie et al..Cloning and characterization of inducible nitric oxide synthase from mouse macrophages.《Science》.1992,第256卷(第5054期),225-228. |
Also Published As
Publication number | Publication date |
---|---|
CN101260407A (en) | 2008-09-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
ES2902007T3 (en) | Herbicide tolerant protein, encoding gene and use thereof | |
US6969782B2 (en) | Method of producing transgenic plants having improved amino acid composition | |
RU2692553C2 (en) | Herbicide resistance protein, its coding gene and application thereof | |
CN101704885A (en) | Protein for controlling heading stage and seed size of paddy rice and encoding gene thereof | |
EP3434778A1 (en) | Application of herbicide-tolerant protein | |
CN104611308B (en) | Herbicide resistance protein, its encoding gene and purposes | |
CN108624596A (en) | It is a kind of regulation and control Legume nodule growth gene GmSPX5 and its application | |
CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
CN104611306B (en) | Herbicide resistance protein, its encoding gene and purposes | |
CN101979551B (en) | Cloning and application of promoter sequence of corn malate dehydrogenase gene | |
CN105925590B (en) | Herbicide resistance protein, its encoding gene and purposes | |
CN112430584A (en) | Du pear ubiquitin ligase gene, encoding protein and application thereof in plant drought-resistant genetic improvement | |
CN114480416B (en) | Application of tsaoko AtDRM2 gene in improving cold resistance of plants | |
CN101260407B (en) | Increase of plants drought resistance by using mouse nitrous oxide synthetase gene | |
CN112063597B (en) | Maize multi-copper oxidase coding gene ZmDEK559-2 and application thereof | |
CN103305538A (en) | Ascorbate peroxidase gene in lycium chinense miller cytoplasm and application thereof | |
CN107090462A (en) | A kind of NF Y classes nuclear transcription factor-2 gene ZmNF YA13, the albumen of its coding and its application | |
JP2007306917A (en) | Method for increasing the resistance of rice plant to pathogenic microorganism and pathogenic microorganism-resistant rice transformant | |
CN113789308B (en) | Expression vector and application thereof in improving soybean biomass | |
CN114853859B (en) | Tea tree aquaporin gene CsAQP95 and application thereof | |
CN110760522B (en) | AK209 gene and its coded protein and application in resisting stress and increasing yield | |
CN113755508B (en) | Paraquat resistance gene EiKCS and application thereof | |
CN102604989B (en) | Methyltransferase gene in betaine synthetic pathway and application thereof | |
CN114381462B (en) | Application of tsaoko AtDRM1 gene in improving heat resistance of plants | |
US20160108414A1 (en) | Growth-related enox proteins from plants with yield enhancement potential, sequences and methods |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120829 Termination date: 20150421 |
|
EXPY | Termination of patent right or utility model |