CN101254301B - Preparation of HSP65 recombination protein and use thereof - Google Patents
Preparation of HSP65 recombination protein and use thereof Download PDFInfo
- Publication number
- CN101254301B CN101254301B CN2007101338689A CN200710133868A CN101254301B CN 101254301 B CN101254301 B CN 101254301B CN 2007101338689 A CN2007101338689 A CN 2007101338689A CN 200710133868 A CN200710133868 A CN 200710133868A CN 101254301 B CN101254301 B CN 101254301B
- Authority
- CN
- China
- Prior art keywords
- hsp65
- protein
- tumor
- plasmid
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides a recombinant protein Hsp65 which has an anti-tumor effect and is derived from a heat shock protein 65 (the registry number of the international gene bank is M17705) of mycobacteriium bovine. The protein can significantly inhibit the formation of the nascent blood vessels which are arranged in the interior and the periphery of a tumor, effectively inhibit the transfer of the tumor cells and have the effects of the prevention and the treatment of the formation of the tumor after being acted on the body. The anti-tumor protein can be used for the prevention and the treatment of melanoma, breast cancer, liver cancer, prostate cancer, lung cancer and other tumors in the medical field. A method for preparing the recombinant protein Hsp65 is a process including the DNA extraction of BCG genome, the acquisition of Hsp65 gene, the construction of recombinant plasmid and the corresponding recombinant genetic engineering bacteria and finally obtainment of the Hsp65 gene.
Description
Technical field
The invention belongs to medical domain, relate to the pharmaceutical use of a kind of recombinant protein and described recombinant protein, more particularly, relate to the recombinant protein of tumors such as a kind of treatment and prevention melanoma, breast carcinoma, pulmonary carcinoma.
Technical background
Bacillus calmette-guerin vaccine (BCG) is that bacillus tuberculosis bovis is transplanted the live vaccine that goes down to posterity and obtain for several times continuously through all the year round on synthetic medium, Hsp65 (Heat shock protein 65kD) is the heat shock protein that comes from bacillus calmette-guerin vaccine, be one of major antigen of bacillus calmette-guerin vaccine, international gene bank accession number is M17705.
Bacillus calmette-guerin vaccine promptly is used to the treatment of malignant tumor as a kind of biological response modifier as far back as the sixties.The perfusion of BCG intravesical has been acknowledged as the first-selected therapy of treatment superficial bladder cancer, can eliminate cancer in situ, the residual cancer of postoperative effectively, and the prevention of recurrence effect is arranged.In addition, it is for malignant melanoma, rectal cancer, and breast carcinoma, hepatocarcinoma etc. all have therapeutic effect definitely, and its antitumor action mainly can cause local stronger immunoreation.The BCG complicated component except that the performance antitumor action, also can cause a series of toxic and side effects.Simultaneously, along with BCG in the extensive use of treatment aspect the tumor, its caused side effect also begins to be paid close attention to by people, unsuitable BCG treatment may produce the deleterious blocking antibody to the host, tumor cell is protected exempts from destruction, the bacterial strain of this immunocompetent inhibition and BCG and the kind of tumor are relevant, by analyzing 2602 dabbling side effect of routine BCG intravesical and complication, found that about 90% patient has irritation sign of bladder, hematuria appears in 50% patient, 25% patient has low grade fever, cold like symptoms, granulomatous prostatitis appears in small number of patients (＜5%), BCG pneumonia or hepatitis, arthritis, pyemia, epididymitis, erythra, the ureter infraction, contracture of bladder, renal abscess and leukopenia.The toxic and side effects of BCG has limited its clinical practice to a certain extent.Various biologic artifacts; from escherichia coli, yeast, fruit bat to plant cell, mammalian cell; when being subjected to the unfavorable or harmful factor of surrounding and influencing; can produce and a series ofly make of short duration fast cellular metabolism for the change that conforms and regulate; expression of the interior normal genes of cell is suppressed during this; some special genes then are activated and express, and come down to a kind of autoprotection reaction that cell is made to external world.This phenomenon is called heat shock response, and this group special gene is exactly a heat shock gene, and the albumen that is produced is exactly heat shock protein (HSPs).Heat-shock protein family is the family of a high conservative, and different according to its molecular weight size and amino acid sequence homology can be divided into: HSP110, HSP90, HSP70, HSP65, HSP60 etc.HUMAN HEAT SHOCK PROTEINS Hhsp HSP70 60 (rHSP60) and mycobacterium tuberculosis heat shock protein 65 (mHsp65) have and are higher than 55% homology.The tumor that studies show that numerous species can overexpression, secretion heat shock protein 60 (HSP60).Generation, development and the transfer characteristic of this and tumor have certain relation, and clinically, HSP60 can be as the diagnosis index of infantile tumour, and therefore, HSP60 might become a target of immunotherapy of tumors, but endogenic HSP60 immunogenicity is poor.
Summary of the invention
The objective of the invention is to disclose a kind of purposes that comes from the recombinant protein Hsp65 of mycobacterium tuberculosis var bovis (Mycobacteriium bovine) heat shock protein.
Another object of the present invention provides the method for producing this recombinant protein HSP65.
The objective of the invention is to be achieved through the following technical solutions: a kind of heat shock protein Hsp65 that comes from mycobacterium tuberculosis var bovis, the recombinant protein Hsp65 that its international gene bank accession number is M17705 is used for the Use and preparation method of anti-tumor drug in preparation, preparation method includes the extraction step of bcg genomic dna, the obtaining step of Hsp65 gene, construction recombination plasmid and corresponding recombination engineering bacteria step, Hsp65 recombiant protein obtaining step.
Purpose of the present invention can also further realize by following technology solution: a kind of heat shock protein Hsp65 that comes from mycobacterium tuberculosis var bovis is used for the purposes of melanoma, breast carcinoma, hepatocarcinoma, carcinoma of prostate, lung cancer drugs in preparation, its beneficial effect is embodied in the important antigen of recombinant protein HSP65 as bacillus calmette-guerin vaccine (BCG), and it also is anti-tumor protein matter more safely and effectively that various tumor diseases are had the obvious treatment effect.As a specific embodiment of the present invention, this anti-tumor protein matter of normal saline and purification is injected two groups of tumor model animals respectively through subcutaneous administration, observe and find to inject the experimental group animal of the experimental group animal of this oncoprotein matter than injecting normal saline, inside tumor and new vessels minimizing on every side in the animal body, tumor volume and tumor weight average have minimizing, and the transfer of tumor cell is obviously suppressed.Medically, this vaccine can be used for preparing the medicine of tumors such as prevention and treatment melanoma, breast carcinoma, hepatocarcinoma, carcinoma of prostate, pulmonary carcinoma.
The present invention is about the preparation method of recombinant protein HSP65, in the obtaining step of Hsp65 gene, the polymerase chain reaction system is 100pmol P1,100pmol P2,2 μ g BCG genomic DNAs, 2 μ lDntp (10mM), the PFU archaeal dna polymerase of 5 μ l 10 * PFU buffer and 5 units totally is 50 μ l, and thermal starting is adopted in the polymerase chain reaction, add the PFU archaeal dna polymerase behind 94 ℃ of degeneration 10min again, actual conditions is: 94 ℃ of 10min; 94 ℃ of 60s, 62 ℃ of 60s, 72 ℃ of 3min, period 30; 72 ℃ of 10min; In construction recombination plasmid and the corresponding recombination engineering bacteria step, the expression vector plasmid is the pET-28a plasmid, and employing alkali cracking method extracting, obtain the pET-28a plasmid with the double digestion method then, the extension increasing sequence of pET-28a plasmid and Hsp65 is gone out soluble fusion protein at expression in escherichia coli, obtain recombination engineering bacteria E.coli BL21/pET-28a-Hsp65; In the reorganization Hsp65 albumen obtaining step, recombination engineering bacteria E.coli BL21/pET-28a-Hsp65 is obtained recombinant protein Hsp65 through fermentation-centrifugation-ion-exchange chromatography purification, wherein Fa Jiao temperature is 36-38 ℃, PH6.8-7.2; Precipitation adopts salting out method, uses ammonium sulfate precipitation; Anion exchange resin DEAE cellulose purification obtains the Hsp65 recombiant protein, and through the SDS-PAGE electrophoresis detection, it is pure to reach electrophoresis.As a specific embodiment of the present invention, the gene order of this anti-tumor protein matter derives from bacillus calmette-guerin vaccine, and its international gene bank accession number is M17705.Clone the complete sequence of bacillus calmette-guerin vaccine heat shock protein 65 (Hsp65) by the PCR method, and be inserted into efficiently among the expression vector pET-28a, transformed into escherichia coli BL21 obtains the recombination engineering bacteria of Hsp65, is called for short E.coli BL21/pET-28a-Hsp65.Through simple abduction delivering and separation and purification, can obtain a large amount of this anti-tumor protein matter Hsp65 easily.
Details are as follows for its technology path:
1. the extraction of bacillus calmette-guerin vaccine (BCG) genomic DNA
Operating procedure is with reference to " fine works molecular biology experiment guide "
2.Hsp65 the acquisition of gene
Gene order according to known Hsp65, by two oligonucleotide primers of Computer Design, be template with the genomic DNA of BCG, obtain the complete sequence of Hsp65 by the PCR method, and introduced the Ncol recognition site at 5 ' end of this sequence, introduced the HindIII recognition site at 3 ' end.
3. construction recombination plasmid pET28a-Hsp65 and corresponding recombination engineering bacteria
The Hsp65 sequence through Ncol, is inserted behind the HindIII double digestion equally through Ncol, in the pET-28a vector plasmid of HindIII cutting, formed recombiant plasmid pET28a-Hsp65, the recombinant plasmid transformed e. coli bl21 obtains the recombination engineering bacteria.
4. engineering bacterium fermentation and the proteic acquisition of reorganization Hsp65
With LB is basal medium, and the Semen Maydis pulp culture medium is a fermentation medium, and fermentation parameter is as follows: temperature 36-38 ℃, and pH6.8-7.2.The centrifugal collection engineering bacteria in fermentation back, multigelation cracking thalline, centrifugal acquisition supernatant soluble protein, ammonium sulfate precipitation, contain purer purpose fusion rotein in the 35%-40% ammonium sulfate precipitation, again dissolving is after the ion-exchange chromatography purification is used sds polyacrylamide gel electrophoresis to precipitation, and it is pure that the proteic purity of Hsp65 reaches electrophoresis.
Beneficial effect of the present invention is the important antigen of recombinant protein HSP65 as bacillus calmette-guerin vaccine (BCG), and various tumor diseases are had the obvious treatment effect, and toxic and side effects is little, is anti-tumor protein matter more safely and effectively.
Description of drawings
Fig. 1 plasmid pET28a-Hsp65 structure chart
The abduction delivering of Fig. 2 SDS-PAGE electrophoresis showed Hsp65.
Amalgamation and expression and the purification of Fig. 3 SDS-PAGE electrophoresis showed Hsp65.
Fig. 4 Hsp65 is to the inhibitory action of tumor angiogenic.
Fig. 5 Hsp65 is to the prevention and the therapeutical effect of murine melanoma, the size of each immune group mouse interior tumor.
Fig. 6 Hsp65 suppresses the effect that mouse melanin tumor cell shifts.
The broad-spectrum anti-tumor effect of Fig. 7 Hsp65.Legend
H22; ■ EMT-6;
B16-f10
The antitumor action of Fig. 8 Hsp65-X.Legend
RM-1;
Lewis
The specific embodiment
Below the present invention will be further described by drawings and Examples
A kind of heat shock protein Hsp65 that comes from mycobacterium tuberculosis var bovis, the recombinant protein Hsp65 that its international gene bank accession number is M17705 is used for the Use and preparation method of anti-tumor drug in preparation, the preparation method of relevant recombinant protein Hsp65 has comprised the extraction step of bcg genomic dna, the obtaining step of Hsp65 gene, construction recombination plasmid and corresponding recombination engineering bacteria step and Hsp65 recombiant protein obtaining step.
In the obtaining step of Hsp65 gene, by the extension increasing sequence of polymerase chain reaction acquisition Hsp65, mixed in molar ratio such as primer employing, P1, P2 are the nucleotide sequence of primer.
P1：5’TTC?GCC?ATG?GCC?AAG?ACA?ATT?GCG?TAC?G?3’
Wherein 5 ' introduce Nco I enzyme action point position,
P2：5’TTC?CGA?AGC?TTA?GAA?ATC?CAT?GCC?ACC?CAT?G?3’
Wherein 3 ' introduce HindIII enzyme action point position.
In the obtaining step of Hsp65 gene, the polymerase chain reaction system is 100pmol P1,100pmol P2,2 μ g BCG genomic DNAs, 2 μ l Dntp (10mM), the PFU archaeal dna polymerase of 5 μ, 1 10xPFU buffer and 5 units, totally be 50 μ l, thermal starting is adopted in the polymerase chain reaction, adds the PFU archaeal dna polymerase behind 94 ℃ of degeneration 10min again, and actual conditions is: 94 ℃ of 10min; 94 ℃ of 60s, 62 ℃ of 60s, 72 ℃ of 3min, period 30; 72 ℃ of 10min.
In construction recombination plasmid and corresponding recombination engineering bacteria step, select for use the pET-28a plasmid as the expression vector plasmid, and employing alkali cracking method extracting, obtain the pET-28a plasmid with the double digestion method then, the extension increasing sequence of pET-28a plasmid and Hsp65 is gone out soluble fusion protein at expression in escherichia coli, obtain recombination engineering bacteria E.coli BL21/pET-28a-Hsp65.
In reorganization Hsp65 albumen obtaining step, recombination engineering bacteria E.coliBL2l/pET-28a-Hsp65 is obtained recombinant protein Hsp65 through fermentation-centrifugation-ion-exchange chromatography purification, wherein Fa Jiao temperature is 36-38 ℃, PH6.8-7.2; Precipitation adopts salting out method, uses ammonium sulfate precipitation; Anion exchange resin DEAE cellulose purification obtains the Hsp65 recombiant protein, and through the SDS-PAGE electrophoresis detection, it is pure to reach electrophoresis.
Material
(1) bacterial strain and plasmid:
Host bacterium Escherichia coli BL21 (DE3) is a genetic engineering common tool strain, at the laboratory relevant with genetic engineering research preservation is arranged all generally.
Plasmid pET28a is available from Novagen company.
Bacillus calmette-guerin vaccine is produced by Shanghai biological product company, contains mycobacterium tuberculosis var bovis (Mycobacterium bovis) in these goods.
(2) enzyme and reagent:
Molecular cloning toolenzyme and reagent, bacterial genomes, plasmid extraction test kit are Pu Luomaige (Promega) company product, and it is Shanghai China Shun bio-engineering corporation product that PCR reclaims test kit.
(3) culture medium:
The LB culture medium, the document Sambrook J that sees reference that fills a prescription, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual 2nd ed. NY:Cold Spring HarborLaboratory Press, 1989.This book is the classical works of technique for gene engineering, in many libraries of the universities collection is arranged all.
The Semen Maydis pulp culture medium contains: Semen Maydis pulp 25g/L, beef extract 15g/L, monosodium glutamate 10g/L.
(4) Cellouse-DEAE DE-52 is a Whatman company product.
Method
Recovery, connection and the transformed into escherichia coli of extracting genome DNA, plasmid extraction, polymerase chain reaction, endonuclease digestion, dna segment: in the genetic engineering research field, these all are the routine operation methods, referring to Sambrook J, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual2nd ed.NY:Cold Spring Harbor Laboratory Press, 1989, pp.16-340.
The mensuration of expression of recombinant proteins amount: referring to Sambrook J, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual 2nd ed.NY:Cold Spring HarborLaboratory Press, 1989, method is carried out.
The structure of embodiment 1 pET28a-Hsp65 recombination engineering bacteria
1. the extraction of bacillus calmette-guerin vaccine (BCG) genomic DNA
The concrete operations step is with reference to " fine works molecular biology experiment guide ".
(1) gets the medical BCG of 50mg, with PBS (phosphate buffer) washing 3 times.
(2) add 250 μ l TE (thioesterase) (pH8.0), suspend again, and then add 150 μ l10%SDS (sodium lauryl sulphate), mixing, 37 ℃ are shaken 1h (120rpm) on shaking table.
(3) multigelation 2 times under-20 ℃ and room temperature.
(4) add isopyknic chloroform/isoamyl alcohol, mixing, 10000rpm, 5min.
(5) get supernatant, the isopyknic chloroform of reuse/isoamyl alcohol extracting once, 10000rpm, 5min.
(6) add 0.6 times of isopropyl alcohol, mix gently, can see filamentous DNA floccule.
(7)2000rpm，2min。
(8) with 450 μ l, 70% washing with alcohol.
(9)2000rpm，2min。
(10) abandon supernatant, precipitate dries up in superclean bench slightly, is dissolved in then among the 50 μ l TE.
(11) get 5 μ l 0.8%Agarose electrophoresis detection, above last sample hole, a bright band is arranged, show that successful extracting is to the BCG genomic DNA.
2.Hsp65 the acquisition of gene
According to the gene order of known Hsp65,, synthetic by Shanghai Bo Ya Bioisystech Co., Ltd by two oligonucleotide primers P1 of Computer Design and P2.
Article two, the primer nucleotide sequence is as follows:
P1：5’TTCGCCATGGCCAAGACAATTGCGTAC?G?3’；
P2：5’TTCCGAAGCTTAGAAATCCATGCCACCCAT?G?3’
Primer P1 has introduced the Ncol restriction enzyme site, and primer P2 has all introduced the HindIII restriction enzyme site.
With oligonucleotide fragment P1 and P2 by a certain percentage (equimolar amounts) mix as template, the BCG genomic DNA carries out pcr amplification and obtains the Hsp65 gene segment as template.
The PCR reaction system is: 100pmol P1,100pmol P2,2 μ g BCG genomic DNAs, 2 μ lDntp (deoxy-ribonucleoside triphosphate) (10mM), the PFU archaeal dna polymerase of 5 μ l10 * PFU buffer and 5 units totally is 50 μ l.PCR adopts thermal starting, adds the PFU archaeal dna polymerase behind 94 ℃ of degeneration 10min again, and actual conditions is: 94 ℃ of 10min; 94 ℃ of 60s, 62 ℃ of 60s, 72 ℃ of 3min, period 30; 72 ℃ of 10min.
3. the structure of the structure of recombiant plasmid pET28a-Hsp65 and corresponding recombination engineering bacteria
With the fragment of Hsp65 after the amplification purification, carry out double digestion with Ncol, HindIII, reclaim the enzyme action product with PCR product purification test kit behind the enzyme action.
Adopt alkaline lysis that pET28a is carried out extracting, the plasmid that extracting obtains also carries out double digestion with Ncol and HindIII.Endonuclease reaction finishes the back and reclaims the enzyme action product with PCR product purification test kit.
The Hsp65 dna fragmentation that obtains after the above-mentioned enzyme action recovery is connected with pET28a plasmid fragment.Connect product transformed into escherichia coli Escherichia coli BL21 (DE3), screening contains the recombiant plasmid of Hsp65 antigen-4 fusion protein gene, claims pET28a-Hsp65, sees accompanying drawing 1.By the PCR checking, select correct recombiant plasmid.
Entrust Shanghai Bo Ya Bioisystech Co., Ltd to carry out the sequence analysis of nucleic acid this plasmid, further verify the correctness of Hsp65 antigen-4 fusion protein gene and reading frame thereof.
Picking list colony inoculation contains 50 μ g/ml kanamycin LB fluid mediums from the pET28a-Hsp65 flat board, spend the night in 37 ℃ of constant-temperature shaking culture, plant in the fresh Semen Maydis pulp fluid medium (50 μ g/ml kanamycin) in the switching of 1% ratio, cultivate after 4 hours for 37 ℃, the adding final concentration is that the alpha-lactose of 0.5mmol/L is induced the escherichia coli expression t7 rna polymerase, thereby continues to cultivate expressed fusion protein Hsp65.Induce the back 4 hours bacterium liquid that takes a morsel, centrifugal recovery thalline, SDS-PAGE electrophoresis show through thin slice scan has more realized the proteic expression of Hsp65, and destination protein accounts for about 30% of total bacterial protein, the results are shown in accompanying drawing 2,1. standard molecular weight albumen among the figure; 2-5. the whole protein of the e. coli bl21 of load pET28a-Hsp65 plasmid after lactose-induced 4,6,8,10 hours expressed; 6. the whole protein of the e. coli bl21 of load pET28a-Hsp65 plasmid before lactose-induced expressed; 7. the whole protein of the e. coli bl21 of load pET28a plasmid before lactose-induced expressed.
The separation and purification of embodiment 3 recombiant protein Hsp65
Engineering bacteria behind the abduction delivering is through centrifugal recovery thalline, thalline is suspended in cellular lysate liquid (pH8.0, the 50mM phosphate buffer, 0.02% lysozyme) in, 37 ℃ were stirred 30 minutes, added DNase (deoxyribonuclease) and DNA were digested to solution not till the thickness centrifugal recovery supernatant, with sulphuric acid amine fractional precipitation, destination protein is mainly in the 35%-40% ammonium sulphate precipitation.Sedimentary fusion rotein is dissolved in ion exchange buffer (20mM Tris-HCl again, pH8.0) in, dialysis desalting, get supernatant after centrifugal and carry out anion exchange chromatography, DEAE cellulose (cellexl) DE-52 post (2.6 * 40cm), with ion exchange buffer (10mM Tris-HCl, pH8.0)/the NaCl gradient elution, Fractional Collections carries out the SDS-PAGE electrophoresis detection, Hsp65 is in the eluting peak of 140-170mM NaCl, prepare the purity of sample with SDS-PAGE electrophoretic examinations, the results are shown in accompanying drawing 3, the e. coli bl21 cell whole protein of 1. load pET28a-Hsp65 plasmids among the figure (lactose-induced back); 2. the cracking postprecipitation albumen of the e. coli bl21 of load pET28a-Hsp65 plasmid (lactose-induced back); 3.0 the albumen of～20% ammonium sulfate precipitation; 4. standard molecular weight albumen; 5.20 the albumen of～35% ammonium sulfate precipitation; 6.35 the albumen of～40% ammonium sulfate precipitation; 7. the recombiant protein Hsp65 of purification.
The pharmacodynamic study of embodiment 4 anti-tumor protein matter
1.Hsp65 inhibitory action to the tumor angiogenic
With aseptic normal saline Hsp65 being diluted to final concentration is 1 μ g/ μ l.Get 4-5 C57BL/6J male mice in age in week, establish Hsp65 subcutaneous administration group and normal saline negative control group, every group each 8.Other gets 4-5 BALB/c female mice in age in week, establishes Hsp65 subcutaneous administration group and normal saline negative control group, every group each 8.Subcutaneous injection mice behind administration albumen and the Freund adjuvant equal proportion mixing is used Freund's complete adjuvant for the first time, uses incomplete Freund afterwards.During administration, the Hsp65 albumen of subcutaneous injection 100 μ l (0.5 μ g/ μ l is in normal saline).The normal saline of normal saline group injection same amount.Later on every 2 all booster immunizations once, the C57BL/6J mice has carried out booster immunization altogether five times; BALB/c mouse has been carried out booster immunization altogether 3 times.Last immunity back the 8th day is in each group C57BL/6J mouse web portion intradermal vaccination 50ul (2*10
8Individual/ml) B16-F10 mouse melanin tumor cell, in each group BALB/c mouse abdominal part intradermal vaccination 50ul (2*10
8Individual/ml) EMT-6 mouse mastopathy cell, observed and recorded tumor growth situation.Behind tumor cell inoculation the 14th day, put to death after all animals eyeball got blood, carefully strip mice band tumor skin, examine under a microscope inside tumor and around the hypertrophy situation of new vessels, see accompanying drawing 4, A.B16-F10 normal saline group among the figure; B.B16-F10 Hsp65 group; C.EMT-6 normal saline group; D.EMT-6 Hsp65 group.As can be seen, than the normal saline negative control group, the hypertrophy that reaches inner new vessels around the tumor of Hsp65 administration group mice is obviously suppressed.
2.Hsp65 prevention and therapeutical effect to murine melanoma
With aseptic normal saline Hsp65 being diluted to final concentration is 1 μ g/ μ l.Get 4-5 C57BL/6J male mice in age in week, establish Hsp65 subcutaneous administration group and normal saline negative control group, every group each 10.Subcutaneous injection mice behind administration albumen and the Freund adjuvant equal proportion mixing is used Freund's complete adjuvant for the first time, uses incomplete Freund afterwards.During administration, the Hsp65 albumen of subcutaneous injection 100 μ l (0.5 μ g/ μ l is in normal saline).The normal saline of normal saline group injection same amount.Later on once, carry out booster immunization altogether 6 times every 2 all booster immunizations.Last immunity back the 8th day is in each group right side of mice front subcutaneous vaccination 0.1ml (10
7Individual/mL) B16-F10 mouse melanin tumor cell, observed and recorded tumor growth situation.Behind tumor cell inoculation the 14th day, put to death after all animals eyeball got blood, strip tumor tissues, weigh, respectively organize the size of tumor.Every group of tumor size seen accompanying drawing 5.A.As can be seen, than the normal saline negative control group, the growth of tumor of Hsp65 subcutaneous administration group has obtained obvious inhibition, and tumour inhibiting rate is 72.91%.
Get 8-10 C57BL/6J male mice in age in week, establish Hsp65 subcutaneous administration group and normal saline negative control group, every group each 10, in each group right side of mice front subcutaneous vaccination 0.1ml (10
7Individual/mL) B16-F10 mouse melanin tumor cell.Administration in second day behind the inoculated tumour cell: with aseptic normal saline Hsp65 being diluted to final concentration is 1 μ g/ μ l, gets 50ul and Freund's complete adjuvant equal-volume mixing, subcutaneous injection 100ul, the normal saline of normal saline group injection same amount.Behind the inoculated tumour cell the 8th day, administration for the second time: with aseptic normal saline Hsp65 being diluted to final concentration was 1 μ g/ μ l, gets 50ul and incomplete Freund equal-volume mixing, subcutaneous injection 100ul, and the normal saline group is injected the normal saline of same amount.Behind the tumor cell inoculation the 14th day, put to death after all animals eyeball got blood, strip tumor tissues, weigh, respectively organize the size of tumor.Every group of tumor size seen accompanying drawing 5, A. normal saline negative control group among the figure; B.Hsp65 subcutaneous administration group; C.Hsp65-AII6 subcutaneous administration group.According to B as can be seen, than the normal saline negative control group, the growth of tumor of Hsp65 subcutaneous administration group has obtained obvious inhibition, and tumour inhibiting rate is 52.03%.
4.Hsp65 suppress the effect that mouse melanin tumor cell shifts
With aseptic normal saline Hsp65 being diluted to final concentration is 1 μ g/ μ l.Get 4-5 C57BL/6J male mice in age in week, establish Hsp65 subcutaneous administration group and normal saline negative control group, every group each 10.Subcutaneous injection mice behind administration albumen and the Freund adjuvant equal proportion mixing is used Freund's complete adjuvant for the first time, uses incomplete Freund afterwards.During administration, the Hsp65 albumen of subcutaneous injection 100 μ l (0.5 μ g/ μ l is in normal saline).The normal saline of normal saline group injection same amount.Later on once, carry out booster immunization altogether 6 times every 2 all booster immunizations.Last immunity back the 8th day is in each group right side of mice tail vein injection 0.2ml (1.25*10
5Individual/mL) B16-F10 mouse melanin tumor cell.Behind tumor cell inoculation the 24th day, put to death after all animals eyeball got blood, observe the transfer case of tumor cell in pulmonary, see accompanying drawing 6, A. normal saline negative control group among the figure; B.Hsp65 subcutaneous administration group.As can be seen, than the normal saline negative control group, the transfer of Hsp65 subcutaneous administration group tumor cell has obtained obvious inhibition.
5.Hsp65 the broad-spectrum anti-tumor effect
Method is substantially with the preventive effect of Hsp65 to murine melanoma.Difference is: administration number of times reduces, and behind the immune Hsp65 albumen, all a booster immunization is three times for the first time; Tumor cell and corresponding host's difference, total breast carcinoma (EMT-6) (BALB/c), hepatocarcinoma (H22) (BALB/c).Hsp65 albumen is to the visible accompanying drawing 7 of the antitumous effect of each model mouse.
6.Hsp65-X antitumor action
Introducing one section segment at random of forming by 18 aminoacid by engineered means at the proteic C end of Hsp65.Investigate this albumen to carcinoma of prostate (RM-1), the inhibitory action of pulmonary carcinoma (Lewis).The basic same above Hsp65 of method is to the preventive effect of EMT-6, H22.But only booster immunization twice, and the host is the C57BL/6J male mice.Hsp65-X is to the visible accompanying drawing 8 of the antitumous effect of each model mouse.
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of requirement of the present invention.
Claims (5)
1. a heat shock protein Hsp65 who comes from mycobacterium tuberculosis var bovis is used for the purposes of the medicine of melanoma, breast carcinoma, hepatocarcinoma, carcinoma of prostate in preparation, and the international gene bank accession number of this recombinant protein Hsp65 is M17705.
2. a kind of preparation method that comes from the heat shock protein Hsp65 of mycobacterium tuberculosis var bovis described in the claim 1, it includes the extraction step of bcg genomic dna, the obtaining step of Hsp65 gene, construction recombination plasmid and corresponding recombination engineering bacteria step, Hsp65 recombiant protein obtaining step is characterized in that:
In the obtaining step of described Hsp65 gene, be the extension increasing sequence that obtains Hsp65 by the polymerase chain reaction, mixed in molar ratio such as primer employing, the nucleotide sequence of primer is:
P1：5’TTC?GCC?ATG?GCC?AAG?ACA?ATT?GCG?TAC?G?3’
Wherein 5 ' introduce NcoI enzyme action point position,
P2：5’TTC?CGA?AGC?TTA?GAA?ATC?CAT?GCC?ACC?CAT?G?3’
Wherein 3 ' introduce HindIII enzyme action point position.
3. a kind of preparation method that comes from the heat shock protein Hsp65 of mycobacterium tuberculosis var bovis according to claim 2, it is characterized in that: in the obtaining step of Hsp65 gene, the polymerase chain reaction system is 100pmol P1,100pmol P2,2 μ g BCG genomic DNAs, 2 μ l Dntp (10mM), the PFU archaeal dna polymerase of 5 μ l 10 * PFU buffer and 5 units, totally be 50 μ l, thermal starting is adopted in the polymerase chain reaction, add the PFU archaeal dna polymerase behind 94 ℃ of degeneration 10min again, actual conditions is: 94 ℃ of 10min; 94 ℃ of 60s, 62 ℃ of 60s, 72 ℃ of 3min, period 30; 72 ℃ of 10min.
4. a kind of preparation method that comes from the heat shock protein Hsp65 of mycobacterium tuberculosis var bovis according to claim 2, it is characterized in that: in construction recombination plasmid and corresponding recombination engineering bacteria step, the expression vector plasmid is the pET-28a plasmid, and employing alkali cracking method extracting, obtain the pET-28a plasmid with the double digestion method then, the extension increasing sequence of pET-28a plasmid and Hsp65 is gone out soluble fusion protein at expression in escherichia coli, obtain recombination engineering bacteria E.coli BL21/pET-28a-Hsp65.
5. a kind of preparation method that comes from the heat shock protein Hsp65 of mycobacterium tuberculosis var bovis according to claim 2, it is characterized in that: in reorganization Hsp65 albumen obtaining step, recombination engineering bacteria E.coli BL21/pET-28a-Hsp65 is obtained recombinant protein Hsp65 through fermentation-centrifugation-ion-exchange chromatography purification, wherein Fa Jiao temperature is 36-38 ℃, pH6.8-7.2; Precipitation adopts salting out method, uses ammonium sulfate precipitation; Anion exchange resin DEAE cellulose purification obtains the Hsp65 recombiant protein, and through the SDS-PAGE electrophoresis detection, it is pure to reach electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101338689A CN101254301B (en) | 2007-10-24 | 2007-10-24 | Preparation of HSP65 recombination protein and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101338689A CN101254301B (en) | 2007-10-24 | 2007-10-24 | Preparation of HSP65 recombination protein and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101254301A CN101254301A (en) | 2008-09-03 |
| CN101254301B true CN101254301B (en) | 2010-12-22 |
Family
ID=39889623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101338689A Expired - Fee Related CN101254301B (en) | 2007-10-24 | 2007-10-24 | Preparation of HSP65 recombination protein and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101254301B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994518A (en) * | 2012-12-04 | 2013-03-27 | 山东信得科技股份有限公司 | Method for preparing porcine circovirus 2 open reading frame 2 (ORF2) protein |
| CN108611310A (en) * | 2018-04-28 | 2018-10-02 | 中国药科大学 | A kind of recombination Hsp65 and STEAP1186-193The structure of the genetic engineering bacterium of fusion protein |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1831012A (en) * | 2006-01-12 | 2006-09-13 | 中国药科大学 | Immunological adjuvant with immunity vegulating agent for treating and preventing diabetic from insulin-dependent |
-
2007
- 2007-10-24 CN CN2007101338689A patent/CN101254301B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1831012A (en) * | 2006-01-12 | 2006-09-13 | 中国药科大学 | Immunological adjuvant with immunity vegulating agent for treating and preventing diabetic from insulin-dependent |
Non-Patent Citations (3)
| Title |
|---|
| Boon Huei Tan et.al..Immunomodulating Activity of Mycobacterial HeatShockProtein 65 in Tumor Cells.Immunobiology203.2001,203786-799. * |
| Ramesh Vemulapalli et.al..Brucella abortus Strain RB51 as a Vector forHeterologousProtein Expression and Induction of SpecificTh1 TypeImmune Responses.Infection and Immunity68 6.2000,68(6),3290-3296. |
| Ramesh Vemulapalli et.al..Brucella abortus Strain RB51 as a Vector forHeterologousProtein Expression and Induction of SpecificTh1 TypeImmune Responses.Infection and Immunity68 6.2000,68(6),3290-3296. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101254301A (en) | 2008-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101254301B (en) | Preparation of HSP65 recombination protein and use thereof | |
| CN103555762A (en) | AFP and GM-CSF dual-gene co-expression recombinant vector as well as preparation method and application of recombinant vector | |
| CN103614414A (en) | AFP (Alpha Fetoprotein) and IL-2 (Interleukin-2) double-gene co-expressing recombinant vector as well as preparation method and application thereof | |
| CN102993278B (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN102234624B (en) | Genetic engineering strain for expression and generation of bacillus subtilis arginase, and constructing method thereof | |
| CN107090426A (en) | Restructuring mGM-CSF and the genetic engineering bacterium of GnRH fusion proteins a kind of structure | |
| CN101015689A (en) | Tumour polypeptide vaccine based on angiotensin II | |
| CN101429251A (en) | Antineoplastic amalgamation protein, preparation method and uses thereof | |
| CN105420174A (en) | Establishment of genetically engineered bacterium expressing recombined VEGF fusion protein | |
| CN114438111B (en) | Construction of PP2 strict anaerobic salmonella strain and application thereof in tumor treatment | |
| Ishikawa | Intracellular symbiont as a major source of the ribosomal RNAs in the aphid mycetocytes | |
| CN107383205A (en) | Pig albumin interferon-' alpha ' interleukin-22 fusion protein, preparation method and its encoding gene, a boar long-acting interferon | |
| CN107090425A (en) | Restructuring mGM-CSF and the genetic engineering bacterium of GRP6 fusion proteins a kind of structure | |
| CN103555763B (en) | IL-2 and MART-1 double gene coexpression recombinant vectors and its preparation method and application | |
| CN108611310A (en) | A kind of recombination Hsp65 and STEAP1186-193The structure of the genetic engineering bacterium of fusion protein | |
| CN104622903B (en) | The stem cell medicine and preparation method thereof of anti-malignant mela noma | |
| CN112159479B (en) | Mycoplasma gallisepticum multi-antigen epitope fusion protein pMG-mEA and application thereof | |
| CN101991864B (en) | Leptospira interrogans DNA (Deoxyribose Nucleic Acid) vaccine as well as construction method and application thereof | |
| CN101837134B (en) | Chronic myeloid leukemia DNA vaccine BCR/ABL-pIRES-SEA and preparation method and application thereof | |
| CN108864300A (en) | Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a breeder long-acting interferon | |
| CN116656583B (en) | Tumor-targeted helicobacter pylori mutant strain and gastric cancer-resistant outer membrane vesicle composition | |
| CN115925888B (en) | Alpaca-derived nano-antibody specifically combined with human papilloma virus HPV and application thereof | |
| CN101974557A (en) | Bifidobacterium pBES-tk recombinant vector for targeted therapy of solid tumor and application thereof | |
| WO2008089690A1 (en) | Preparation process of recombinant human p43 protein | |
| CN101514365A (en) | Mark of Ganoderma lucidum seed strain or fruiting body molecule thereof, and acquisition method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101222 Termination date: 20141024 |
|
| EXPY | Termination of patent right or utility model |