CN101429251A

CN101429251A - Antineoplastic amalgamation protein, preparation method and uses thereof

Info

Publication number: CN101429251A
Application number: CNA2007101663115A
Authority: CN
Inventors: 郑玉玲; 江华; 姜永强; 郝淮杰
Original assignee: Institute of Microbiology and Epidemiology of AMMS
Current assignee: Institute of Microbiology and Epidemiology of AMMS
Priority date: 2007-11-06
Filing date: 2007-11-06
Publication date: 2009-05-13
Anticipated expiration: 2027-11-06
Also published as: CN101429251B

Abstract

The invention discloses an anti-tumor fusion protein. The fusion protein contains two tandem repeat sequences VNTR2 of mycobacterium tuberculosis heat shock protein HSP65 and human mucin MUC1. The invention also discloses a method for preparing the fusion protein, which comprises the following steps of acquiring HSP65 protein-coding genes, preparing a single tandem repeat sequence VNTR1 of human MUC1 protein, preparing HSP65-MUC1 VNTR1 genes, preparing a recombinant expression vector containing HSP65-MUC1 VNTR2 genes, expressing HSP65-MUC1 VNTR2 fusion protein, and the like. The invention also discloses application of the fusion protein to resisting tumors. The fusion protein can inhibit the growth of MUC1 positive tumor cells, and has broad application prospects.

Description

A kind of antineoplastic amalgamation protein, Preparation Method And The Use

Technical field

The present invention relates to a kind of fusion rotein, be specifically related to the fusion rotein of a kind of people of containing MUC1, also relate to the encoding gene of this fusion rotein, and the preparation method of this fusion rotein and medical use.

Background technology

Mucoprotein 1 (MUC1) is that a kind of molecular weight is greater than linear transmembrane glycoprotein (the Meseguer M of the macromole of 200KD, Pellicer A, Simon C.MUC1 and endometrial receptivity[J] .Molecular HumanReproduction, 1998,4 (12): 1089-1098.), be distributed widely in multiple epithelioglandular nearly tube chamber faces such as mammary gland, ovary, respiratory tract, gi tract, urogenital system, be polar contribution.At canceration surface epithelial cell height unconventionality expression, and corresponding change takes place in structure, its polypeptide core extracellular fragment contains 20 amino acid whose tandem repetitive sequences, and (Variable numbers tandem repeats, VNTR), this sequence number does not wait from 30 to 200.Discover, can produce at the specific immune reaction CTL identification epi-position of expressing the MUC1 tumour cell in mouse and the human body and be positioned at VNTR (Jerome K R, Barnd DL, Bendt K M, et al.Cytotoxic T lymphocytes derived from patients with breast adenocarcinoma recognize anepitope present on the protein core of a mucin molecule preferentially expressed by malignantcells[J] .Cancer Res.1991,51 (11): 2908-2916; Apostolopoulos V, Loveland B E, Pietersz G A, et al.CTL in mice immunized with human mucin 1 are MHC-restricted[J] .J Immunol.1995,155 (11): 5089-5094.).Mycobacterium tuberculosis heat shock protein(HSP) 65 (HSP65) belongs to HSP70 family, very strong immunogenicity (Silva C L is arranged, Lowrie D B.A single mycobaterial protein (HSP65) expressedby a transgenic antigen-presenting cell vaccinates mice against tuberculosis[J] .Immunology, 1994,82 (2): 244-248.).Discovering Mycobacterium tuberculosis heat shock protein(HSP) 65 in recent years, independent HSP65 albumen can inducing antitumor immunity, suppress growth of tumor, but its inhibition to tumour produces the nonspecific immune response realization by inducing, its tumor-inhibiting action produces fast, but a little less than the effect, the time of keeping is also shorter, and is therefore unsatisfactory to the final inhibition effect of tumour.(Li?D?P，Li?H，Zhang?P?Y，et?al.Heat?shock?fusion?protein?induces?both?specific?and?nonspecificanti-tumor?immunity[J].Eur?J?Immunol，2006，36(5)：1324-1336.)。

Recent study is found, heat shock protein(HSP) 65 (HSP65)-MUC1 epitope peptide fusion rotein (HSP65-MUC1), (Mucin 1 to stimulate body to produce tumour antigen mucoprotein 1, MUC1) specificity cell toxicity T lymphocyte (CTL), suppress the growth of MUC1 positive tumor, therefore become the tumor vaccine (Wang Xueju of treatment and prevention MUC1 high expression level tumour, Wang Zhibo, Wei Hongfei, Deng the enhancement [J] of .C type CpG single stranded oligonucleotide to the tumor vaccine tumor killing effect. cell and molecular immunology magazine, 2007,23 (4): 338-342.).Studies show that further that heat-shock protein-polypeptide compound can intersect by antigen offer to enter endogenous antigen and offers approach, activation is at the special cellullar immunologic response of antigen peptide (Castellino F, Boucher P E, Eichelberg K, et al.Receptor-mediated up take of Antigen:Heatshock protein complexes results in major histo-compatibility complex class I antigenpresentation via two distinct processing pathways[J] .J Exp Med, 2000,11 (191): 1957-1964.), its reason may be that HSP65 has activated fast nonspecific immunity and replys, and has activated persistent specific immune response by albumen or the peptide that merges then.

Summary of the invention

For more efficiently tumor prevention and treatment biotechnological formulation are provided, the present invention discloses a kind of new antitumoral fusion rotein HSP65-MUC1 VNTR according to above-mentioned principle ₂, this fusion rotein contains heat shock protein(HSP) HSP65 and 2 tandem repetitive sequence VNTR of the mucoprotein MUC1 polypeptide nuclear core extracellular fragment of people of tubercule bacillus ₂VNTR wherein ₂Aminoacid sequence is: HMSTAPPAHGVTSAPDTRPAPGSTAPPEFSTAPPAHGVTSAPDTRPAPGSTAPP, see sequence 1 in the sequence table, its gene coded sequence is CATATGTCTACCGCTCCGCCGGCTCACGGTGTTACCTCTGCTCCGGACACCCGTCC GGCTCCGGGTTCTACCGCTCCGCCGGAATTCTCTACCGCTCCGCCGGCTCACGGTG TTACCTCTGCTCCGGACACCCGTCCGGCTCCGGGTTCTACCGCTCCGCCG, sees sequence 10 in the sequence table.The bacille Calmette-Guerin vaccine tubercle bacillus gene group that the encoding gene of HSP65 is announced referring to GenBank in the fusion rotein of the present invention (hsp65 genehttp: //www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? cmd=Retrieve﹠amp; Db=Nucleotide﹠amp; List_uids=149999﹠amp; Dopt=GenBank﹠amp; WebEnv=0Wv7VvoPbtVWCqYZSu5q1dhVPJAjickJmp84Z2tqGvw_O_o3k LNWctdl_63Oj16anVsEDsVlo5ph6x%40255F5A486FDBC4B0_0067SID ﹠amp; WebEnvRq=1) and the research of Xiao Ling etc. (summer flies for Xiao Ling, Wei Yazhi, etc. the preparation [J] of the structure of tubercule bacillus Hsp65 and EGFP fusion gene and DC vaccine. cell and molecular immunology magazine, 2005,21 (1): 13-16.).

The invention also discloses the recombinant expression vector of expressing above-mentioned fusion rotein, this carrier contains the tandem repetitive sequence VNTR2 of tubercule bacillus heat shock protein(HSP) HSP65 and the mucoprotein MUC1 of people.This recombinant vectors can select prokaryotic expression carrier, preferred pET28a (+).

The invention also discloses the preparation method of HSP65-MUC1VNTR2 fusion rotein, comprise the steps:

At first be obtaining of BCG HSP65 encoding sequence.The upstream and downstream primer of research and design tubercule bacillus heat shock protein(HSP) 65 genes of bacille Calmette-Guerin vaccine tubercle bacillus gene group of announcing according to GenBank and Xiao Ling etc.Cultivate the bacille Calmette-Guerin vaccine tubercule bacillus with the logical potato culture of Soviet Union, extract the tubercle bacillus gene group.With the genome is template, and amplification obtains the HSP65 full length gene, is connected to cloning vector, carry out double digestion, subclone is to expression vector then, and this expression vector can be prokaryotic expression carrier, preferred pET28a (+), cloning vector can be the T carrier, wherein preferred pMD18-T.

Be the proteic single tumor-necrosis factor glycoproteins VNTR of people MUC1 then ₁Preparation.VNTR sequence (the http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi of the people MUC1 that announces according to GenBank? cmd=Retrieve﹠amp; Db=Nucleotide﹠amp; List_uids=37053﹠amp; Dopt=GenBank﹠amp; WebEnv=0LRqGB9Y1EV-m5vbaRsN8Qzq1NmK8QKExjjwwV9gU8ycMSdbJ _ cXMAp4ba--16nCdD3kFfqrAoy_X_%40255F5A486FDBC4B0_0067SID﹠ amp; WebEnvRq=1), optimization design upstream and downstream splicing primer.The single tumor-necrosis factor glycoproteins that splices the MUC1VNTR that is carried out pcr amplification with different primers respectively.The PCR product that amplifies is carried out gel respectively reclaim the back and be connected with the pMD18-T carrier, will connect product Transformed E .coli then, the extracting plasmid DNA is cut through PCR and enzyme and to be accredited as male and to clone and check order.

Carry out HSP65-MUC1 VNTR then ₂-pET28a construction of recombinant plasmid.Correct MUC1 VNTR is identified in order-checking ₁-pMD18-T positive colony extracts plasmid.Earlier to MUC1VNTR ₁-pMD18-T plasmid and HSP65-pET28a plasmid carry out double digestion, and purifying reclaims enzyme and cuts product, again with the MUC1 VNTR of T4 ligase enzyme with recovery ₁Gene is connected with HSP65-pET28a.To connect product Transformed E .coli then, through PCR and enzyme cut identify correct after, the extracting plasmid is to HSP65-MUC1VNTR ₁-pET28a plasmid and MUC1 VNTR ₁-PMD18-T carries out double digestion, the samely enzyme is cut product reclaims connection.Connect product Transformed E .coli, cut through PCR and enzyme that to be accredited as the male recon be HSP65-MUC1 VNTR ₂-pET28a extracts plasmid Transformed E .coli.HSP65-MUC1VNTR ₂-pET28a makes up synoptic diagram and sees accompanying drawing 3.

Then carry out HSP65-MUC1 Expression of Fusion Protein and purifying.To contain expression plasmid HSP65-MUC1 VNTR ₂The E.coli of-pET28a cultivates, and adds IPTG and induces.Centrifugal then collection thalline carries out ultrasonication, gets supernatant after centrifugal; Sample is gone up to the Q post, then with the target protein wash-out in supernatant dilution back.Concentrate and to contain the target protein elutriant, last sample is to Saphacryl ^TmThe s-200 gel column, wash-out.

HSP65-MUC1 VNTR ₂Proteic Westernblot detects.The equal conditions inductive is contained expression plasmid HSP65-MUC1 VNTR ₂After handling simultaneously, the E.coli of-pET28a and plasmid pET28a carries out the SDS-PAGE electrophoresis.After electrophoresis finishes, albumen being transferred to pvdf membrane, is one anti-with the mouse-anti people MUC1mAb that buys, and the sheep anti mouse of HRP mark is two anti-, to expressed HSP65-MUC1 VNTR ₂Albumen carries out Westernblot and detects.By detecting, prove that the fusion rotein that is obtained is HSP65-MUC1VNTR ₂

The invention also discloses HSP65-MUC1VNTR ₂The anticancer usage of fusion rotein.With HSP65-MUC1VNTR disclosed by the invention ₂Fusion rotein with auxiliary material combinations such as suitable dilution agent, excipient, can prepare the antitumor drug of various formulations as activeconstituents.Pharmaceutical dosage form is preferably injection.The present invention is by experimentation on animals, in the mouse body to HSP65-MUC1VNTR ₂The tumor inhibition effect of fusion rotein has carried out preliminary study.Studies show that the tumor killing effect of generation is better by multiple spot subcutaneous injection administration.Albumen dosage is carried out the gradient experiment to be found, the fusion rotein of high dosage (10 μ g/ only) and low dosage (2.5 μ g/ only) all can suppress the growth of MUC1 positive tumor, but than high dose group, low dosage more can effectively suppress tumor growth, has compared utmost point significant difference with control group.The high dosage inhibiting rate that this result shows is lower than low dosage and may causes that immunological tolerance is relevant with it.The present invention has carried out preventative research to the effect of the inhibition MUC1 male tumour cell of HSP65-MUC1 fusion rotein, result of study shows can reach 72% to MUC1 positive B 16 cell inhibiting rates, even there is 50% mouse not see tumor growth, and the tumor formation rate of control group is 100%, and the tumor suppression effect is obvious.The present invention can stimulate mouse to produce cellullar immunologic response by discovering HSP65-MUC1 VNTR2 fusion rotein, thus the anti-biologic activity of expressing the tumor growth of MUC1 of performance, and the tumor growth of MUC1 is expressed in inhibition.Tracing it to its cause may be that HSP65 has activated fast nonspecific immunity and replys, and has activated persistent specific immune response by albumen or the peptide that merges then.Therefore, the malignant tumor patient of epidermis being originated based on the HSP65 peptide fusion protein of tumor associated antigen MUC1 will be a kind of methods of treatment very likely.

The present invention utilizes prokaryotic expression system, cuts, is connected with enzyme by gene overlap, makes up HSP65-MUC1 VNTR ₂-pET28a expression vector with 2 repeated fragments and the HSP65 gene fusion of VNTR in the people MUC1 gene, is induced by IPTG and to be realized HSP65-MUC1 VNTR ₂The simple, fast and efficient solubility expression of fusion rotein in e. coli bl21 (DE3).The expression strain E.coli.BL21 (DE3) that adopts in this research is the gene of cloning by expression on the PET serial carrier efficiently, bacterial strain E.coli BL21 (DE3) lacks the lon proteolytic enzyme and the ompT outer membrane protein enzyme of protein degradation in the purge process simultaneously, and expressed target protein has advantages of higher stability.Fusion rotein HSP65-MUC1 VNTR2 disclosed by the invention is at expression in escherichia coli amount height, the target protein expression amount accounts for more than 60% of whole bacterial protein content, be higher than the expression amount (Hu Rong in the reported in literature, research based on the therapeutic vaccine of the MUC1 of heat shock protein(HSP), the 51st page of 2002 grades of Military Medical Science Institute's master thesis), the document adopts identical expression system, and the expressing quantity of the HSP65-MUC1 VNTR1 of preparation is lower, only accounts for 30% of whole bacterial protein.In addition, fusion rotein HSP65-MUC1 VNTR2 is a solubility expression, well kept this fusion rotein activity, obtain the HSP65-MUC1 VNTR2 fusion rotein of purity more than 95% easily in conjunction with simple purification procedures, it is folding that the sequence that this fusion rotein is described is beneficial to the space, and biologic activity is good.Consider the bigger present situation of clinical required dosage of this series products, adopt fusion rotein sequence of the present invention and expression system to be easy to prepare this fusion rotein of clinical dosage, be beneficial to industrialization production.

The present invention also estimates at the restraining effect of MUC1 positive tumor cell this fusion rotein.To the bio-evaluation of fusion rotein of the present invention, find that it can activate MUC1 peptide specific cellullar immunologic response in vivo, suppress the growth of MUC1 male tumour cell, to compare with documents, this fusion rotein has unique tumor suppression effect.Albumen dosage is carried out the gradient experiment find, the fusion rotein of low dosage (2.5 μ g/ only) can effectively suppress tumor growth, obtains best tumor suppression effect.2.5 μ g/ dosage group to mouse inoculation cell count up to (2～3) * 10 ⁶The tumour inhibiting rate of the positive B16 cell of individual MUC1 can reach 72%, and anticancer effect is better than other HSP65-MUC1 fusion rotein of Isodose.And in the documents, the cell count of every mouse inoculation is few, is 1 * 10 ⁵The positive B16 cell of individual MUC1 is only just obtained best tumor suppression effect at high dosage 40 μ g/.(Eur?J?Immunol，2006，36(5)：1324-1336.)。Therefore, it is lower that fusion rotein of the present invention is obtained the required dosage of best tumor suppression effect, may have better potential applicability in clinical practice.

Description of drawings

Fig. 1 is pcr gene amplification figure.

Wherein A is the pcr amplification of HSP65 gene, the 1:HSP65 gene; 2: negative control; 3: positive control; M:DL2000;

B is MUC1 VNTR ₁Splicing (Splicing) PCR, 1: the contrast; 2:MUC1 VNTR ₁Gene; M:DL2000;

C is recombinant vectors HSP65-MUC1 VNTR ₂Restriction analysis, 1:Nde I+Hind III double digestion HSP65-MUC1 VNTR ₂-PET28a; M:DL2000

Fig. 2 is HSP65-MUC1 VNTR ₂Protein expression, purifying and evaluation figure.Wherein

A is fusion rotein HSP65-MUC1 VNTR ₂Expression in E.coli, 1:BL21/HSP65-MUC1 VNTR ₂-pET28a positive colony; The 2:BL21/pET28a negative control; M: low molecular weight protein (LMWP) marker;

B is protein HSP65-MUC1VNTR ₂Purifying, 1: full cell lysate; 2: the protein HSP65-MUC1 VNTR of purifying ₂M: low molecular weight protein (LMWP) marker;

C is protein HSP65-MUC1VNTR ₂Westernblot analyze the SDS-PAGE of 1:BL21/pET28a negative control; 2:HSP65-MUC1 VNTR ₂SDS-PAGE; The Western blot of 3:BL21/pET28a analyzes; 4:HSP65-MUC1 VNTR ₂Westernblot analyze; M: low molecular weight protein (LMWP) marker

Fig. 3 is HSP65-MUC1 VNTR ₂-pET28a makes up synoptic diagram.

Embodiment

Embodiment 1HSP65-MUC1 VNTR ₂Expression of Fusion Protein

One. material

Bacterial strain, cell strain and plasmid bacterial strain E.coli DH5 α, E.coli BL21 (DE3), expression plasmid pET28a (+), stable transfection people MUC1 mouse B16 cell (Eur J Immunol, 2006,36 (5): 1324-1336.); Cloning vector pMD18-T, LA Taq enzyme, restriction endonuclease Nco I, Nde I, EcoR I, Hind III, T4 dna ligase, DNA marker DL2000 are available from TaKaRa company.Bacterial genomes DNA extraction test kit TIANamp Bacteria DNA Kit is a Time Inc. available from the sky; The plasmid extraction test kit is available from Axygen Biosciences company; Sc-7313 is available from Zymed company for mouse-anti people MUC1 monoclonal antibody (mAb); The sheep anti-mouse antibody of horseradish peroxidase (HRP) mark is available from Bioisystech Co., Ltd of middle China fir Golden Bridge; The low Mr Marker of protein rises positive Bioisystech Co., Ltd available from Shanghai; Glue reclaims test kit available from the general biotechnology center in road, Beijing.Experiment mice is C57BL/6, and is female, quality 18～22g, and the SPF level is available from Military Medical Science Institute's Experimental Animal Center.

Two. method

1.BCG obtaining of HSP65 encoding sequence

The upstream primer of research and design tubercule bacillus heat shock protein(HSP) 65 genes of bacille Calmette-Guerin vaccine tubercle bacillus gene group of announcing according to GenBank and Xiao Ling etc.: 5 '-GGC ccatgg CCAA GACAATTGCG-3 ' (containing Nco I restriction enzyme site) shown in sequence in the sequence table 2, downstream primer: 5 '-GGC catatg CATGCCACCCAT-3 ' (containing the NdeI restriction enzyme site) is shown in sequence in the sequence table 3.Cultivate the bacille Calmette-Guerin vaccine tubercule bacillus, extraction tubercle bacillus gene group with the logical potato culture of Soviet Union in 37 ℃～39 ℃.With the genome is template, and pcr amplification obtains the HSP65 full length gene, and reaction system is 50 μ l, after reaction conditions is 95 ℃ of pre-sex change 5min, and 94 ℃ of sex change 1min, 59 ℃ of renaturation 1min, 72 ℃ are extended 1min, 35 circulations, 72 ℃ are extended 7min.The HSP65 gene that pcr amplification obtains after identifying, 1% agarose electrophoresis is used

Gel extraction kit carries out glue and reclaims purified pcr product, is connected to the pMD18-T carrier, and reaction system is 10 μ L, and dna fragmentation and pMD18-T carrier mol ratio are 10:1,16 ℃ of connections of spending the night.With the HSP65-pMD18-T cloning vector transformed competence colibacillus cell DH5 α that obtains, cultivate the back and extract plasmid according to a conventional method, order-checking is identified correct, carries out double digestion with Nco I and Nde I, and subclone is to prokaryotic expression carrier pET28a (+).

2. the acquisition of the single tumor-necrosis factor glycoproteins of people MUC1 albumen VNTR

The VNTR sequence of the people MUC1 that announces according to GenBank, establish upstream meter splicing primer: 5 '-TCTACCGCTCCGCCGGCTCACGGTGTTACC TCTGCTCCGGACACC-3 ' (seeing sequence 4 in the sequence table), downstream splicing primer: 5 '-CGGCGGAGCGGTAGAACCAGGAGCAGGACG GGTGTCCGGAGCAGA-3 ' (seeing sequence 5 in the sequence table), wherein line part is an overlap.The single tumor-necrosis factor glycoproteins that splices the MUC1VNTR that is carried out pcr amplification with 2 groups of primers respectively.The 1st group of upstream primer: 5 '-GGGTTAAC catatg TCTACCGCTCCGCCGGCTCAC-3 ' (seeing sequence 6 in the sequence table) (containing the NdeI restriction enzyme site), downstream primer: 5 '-CGgaattcCGGCGGAGCGGTAGAACCAGG-3 ' (seeing sequence 7 in the sequence table) (containing EcoR I restriction enzyme site); The 2nd group of upstream primer: 5 '-GGGTTAACgaattcTCTACCGCTCCGCCGGCTCAC-3 ' (seeing sequence 8 in the sequence table) (containing EcoR I restriction enzyme site), downstream primer: 5 '-CG aagctt TTA CGGCGGAGCGGTAGAACCAGG-3 ' (seeing sequence 9 in the sequence table) (containing Hind III restriction enzyme site).The PCR product that amplifies is carried out back the connection in 16 ℃ with pMD18-T carrier (mol ratio 10:1) of gel recovery respectively to spend the night, 10 μ L are connected product Transformed E .coli DH5 α, the extracting plasmid DNA is cut through PCR and enzyme and to be accredited as the male clone and to send the order-checking of three rich biotech firms.

The PCR reaction system is 50 μ L, and reaction conditions is 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, and 59 ℃ of renaturation 30s, 72 ℃ are extended 20s, 25 circulations, 72 ℃ are extended 7min.

3.HSP65-MUC1 VNTR ₂-pET28a construction of recombinant plasmid

Correct MUC1 VNTR is identified in order-checking ₁-pMD18-T positive colony carries out plasmid according to the plasmid extraction kit operation instructions and extracts.Earlier with Nde I, EcoR I to containing the MUC1 VNTR of Nde I, EcoR I restriction enzyme site ₁-pMD18-T plasmid and HSP65-pET28a plasmid carry out double digestion 4h, and purifying reclaims enzyme and cuts product, again with the MUC1 VNTR of T4 ligase enzyme to reclaiming ₁Gene spends the night in 16 ℃ with HSP65-pET28a (mol ratio 10: 1) and is connected.10 μ L are connected product Transformed E .coli DH5 α, through PCR and enzyme cut identify correct after, extracting plasmid again is with EcoR I, the extractive HSP65-MUC1VNTR of Hind III ₁-pET28a plasmid and the MUC1VNTR that contains EcoR I, Hind III restriction enzyme site ₁-PMD18-T carries out double digestion, and enzyme is cut product and as above reclaimed, and connects.Connect product Transformed E .coli DH5 α, cut through PCR and enzyme that to be accredited as the male recon be HSP65-MUC1VNTR ₂-pET28a extracts plasmid Transformed E .coli BL21 (DE3).

4.HSP65-MUC1 Expression of Fusion Protein and purifying

To contain expression plasmid HSP65-MUC1 VNTR ₂The E.coli BL21 (DE3) of-pET28a is cultured to logarithmic phase in 30 ℃, adds IPTG to final concentration 1mmol/L, induces 4h.The centrifugal 10min of 8000r/min collects thalline, with the resuspended precipitation of aseptic 5mmol/L PB, ultrasonication intestinal bacteria, and 4 ℃, 12, the centrifugal 10min of 000r/min gets supernatant; With 5mmol/L PB pH7.2 with 4 times of supernatant dilutions after, last sample contains the damping fluid of 500mmol/LNaCl with the target protein wash-out with 5mmol/L PB again to the Q post of usefulness 5mmol/L PB pH7.2 pre-equilibration.Contain and go up sample to Saphacryl after the target protein elutriant concentrates ^TmThe s-200 gel column contains 150mmol/LNaCl pH7.0 wash-out with 50mmol/L PB.

Three. the result

1. Mycobacterium tuberculosis HSP65 gene amplification

With the Mycobacterium tuberculosis genome is template, at the 1600bp place one bright band is arranged through electrophoresis showed through pcr amplification, conforms to purpose fragment (1623bp) size (Figure 1A).With the fragment that obtains insert the pMD18-T carrier check order the back show with GenBank go up Mycobacterium tuberculosis heat shock protein(HSP) 65 genes of login sequence (hsp65 genehttp: //www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? cmd=Retrieve﹠amp; Db=Nucleotide﹠amp; List_uids=149999﹠amp; Dopt=GenBank﹠amp; WebEnv=0Wv7VvoPbtVWCqYZSu5q1dhVPJAjickJmp84Z2tqGvw_O_o3k LNWctdl_63Oj16anVsEDsVlo5ph6x%40255F5A486FDBC4B0_0067SID ﹠amp; WebEnvRq=1) unanimity.

2. overlapping PCR obtains people MUC1 VNTR ₁Sequence

Utilize overlapping PCR to obtain MUC1 VNTR ₁After the fragment, more respectively to MUC1 VNTR ₁Fragment is carried out pcr amplification, and the result carries out agarose gel electrophoresis, and being presented at 100bp has a bright band (Figure 1B), with _APurpose fragment (97bp) size conforms to; Checking order the fragment insertion pMD18-T carrier that obtains afterwards, its gene coded sequence of demonstration is GGGTTAACCATATGTCTACCGCTCCGCCGGCTCACGGTGTTACCTCTGCTCCGGAC ACCCGTCCGGCTCCGGGTTCTACCGCTCCGCCGGAATTCCG.

3.HSP65-MUC1 VNTR ₂Expression and the purifying of albumen in intestinal bacteria

The MUC1 VNTR that order-checking is correct ₁After-pMD18-T plasmid and HSP65-pET28a plasmid such as method are partly carried out 2 endonuclease digestions, are connected and transformed DH5 α, the single positive bacterium colony extraction plasmid of picking carries out enzyme with Nde I, Hind III and cuts evaluation, the result shows the positive, and HSP65-MUC1VNTR is described ₂-pET28a protokaryon construction of recombinant expression plasmid is finished (Fig. 1 C).Behind recombinant plasmid transformed E.coliBL21 (DE3), after IPTG induces, carry out the SDS-PAGE electrophoresis, the Coomassie brilliant blue coloration result shows, the negative control that only contains empty carrier with the equal conditions inductive is compared, positive colony has the band (Fig. 2 A) of clauses and subclauses at the Mr66000 place, the target protein expression amount accounts for more than 60% of whole bacterial protein content, is that expression amount is the highest in the reported in literature.Behind Q post and gel-filtration purifying, obtain purity higher H SP65-MUC1 VNTR ₂Fusion rotein, purity of protein is at (Fig. 2 B) more than 95%.

Embodiment 2 HSP65-MUC1 VNTR ₂Detection of fusion proteins

One, material: with embodiment 1.

Two, method: adopt Western blot method to HSP65-MUC1 VNTR ₂Fusion rotein detects.The equal conditions inductive is contained expression plasmid HSP65-MUC1 VNTR ₂The E.coli BL21 (DE3) of-pET28a and plasmid pET28a respectively gets 200 μ L, carries out the SDS-PAGE electrophoresis after handling simultaneously.After electrophoresis finishes, albumen being transferred to pvdf membrane, is one anti-with the mouse-anti people MUC1mAb sc-7313 (1:500) that buys, and the sheep anti mouse of HRP mark (1:2000) is two anti-, to expressed HSP65-MUC1 VNTR ₂Fusion rotein carries out the Westernblot checking.

Three, result: anti-expressed albumen is identified as with mouse-anti people MUC1mAb sc-7313, with the bacterial strain that only contains the pET28a empty plasmid as negative control, the result is presented at the Mr66000 place, and to contain the bacterial strain of expression plasmid positive, and negative control does not have band (Fig. 2 C) to occur, illustrates that the target protein of expressing contains MUC1 VNTR ₂

Embodiment 3 HSP65-MUC1 VNTR ₂Fusion rotein tumor prevention experiment in animal body

One, material: with embodiment 1.

Two, method: tested the 0th day, with 30 C57BL/6 mouse be divided at random 10 μ g/ only, 2.5 μ g/ only 2 dosage groups and physiological saline control group, 10 every group, every mouse administration volume 0.2ml.Respectively at the 1st, 8,22 day outside of belly four limbs subcutaneous administration, got in the 29th day and to be inoculated in the 13rd day MUC1-B16 cell burrknot of C57BL/6 mouse, grind, dilute with aseptic PBS 1:6, be mixed with tumor cell suspension, cell count is (2～3) * 10 ⁶The individual administration group mouse right fore that is inoculated in is subcutaneous.In the 41st～44 day, put to death mouse, cut open and get the tumour of respectively organizing mouse, weigh the tumour inhibiting rate of each group of statistics.Tumour inhibiting rate=(1-experimental group knurl weight-average value/control group knurl weight-average value) * 100%.Tumour inhibiting rate is carried out homogeneity test of variance and variance test, and significant difference is with P＜0.05 expression, and utmost point significant difference is with P＜0.01 expression.Used statistical software is SPSS13.0.

Three, result: the 14th day execution mouse claims knurl heavy behind inoculated tumour, the result is carried out statistical analysis, the result shows the dosage group to 2.5 μ g/, the MUC1-B16 growth of tumor has been subjected to obvious inhibition, average tumor is about 0.5g, tumor control rate has reached 72.08%, has compared extremely significant difference (p＜0.01) with control group, has 50% (5) mouse not see tumor growth when experiment finishes.When 10 a μ g/ dosage group finished in experiment, average knurl heavily was about 1.17g, and inhibiting rate is about 37%, compare with control group and do not have significant difference (p〉0.05).The average knurl of physiological saline group focuses on when experiment finishes and reaches 1.877g, illustrates that tumor growth is good.

Sequence table

＜110〉Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL

＜120〉a kind of antineoplastic amalgamation protein, Preparation Method And The Use

<130>

<160>10

<170>PatentIn?version3.2

<210>1

<211>54

<212>PRT

<213>

<400>1

<210>2

<211>23

<212>DNA

<213>

<400>2

<210>3

<211>21

<212>DNA

<213>

<400>3

<210>4

<211>45

<212>DNA

<213>

<400>4

<210>5

<211>45

<212>DNA

<213>

<400>5

<210>6

<211>35

<212>DNA

<213>

<400>6

<210>7

<211>29

<212>DNA

<213>

<400>7

<210>8

<211>35

<212>DNA

<213>

<400>8

<210>9

<211>32

<212>DNA

<213>

<400>9

<210>10

<211>162

<212>DNA

<213>

<400>10

Claims

1. antineoplastic amalgamation protein is characterized in that containing two tandem repetitive sequence VNTR of tubercule bacillus heat shock protein(HSP) HSP65 and the mucoprotein MUC1 of people ₂, VNTR ₂Aminoacid sequence see sequence 1 in the sequence table.

2. fusion rotein according to claim 1, wherein the gene order of VNTR2 is seen sequence 10 in the sequence table.

3. recombinant expression vector of expressing claim 1 or 2 described fusion roteins is characterized in that containing the tandem repetitive sequence VNTR2 of tubercule bacillus heat shock protein(HSP) HSP65 and the mucoprotein MUC1 of people.

4. according to the described recombinant expression vector of claim 3, expression vector wherein is prokaryotic expression carrier pET28a (+).

5. the preparation method of claim 1 or 2 described fusion roteins comprises the steps:

(1) amplification HSP65 gene is connected to cloning vector, and enzyme is cut the back subclone to expression vector;

(2) preparation people's MUC1 albumen single tandem repetitive sequence VNTR1 gene fragment and contains the HSP65 expression carrier and is connected, and acquisition contains the recombinant expression vector of HSP65-MUC1 VNTR1 gene;

(3) repeat above step, MUC1 VNTR1 gene is connected with the recombinant expression vector that contains HSP65-MUC1 VNTR1 gene, make up the recombinant expression vector that contains HSP65-MUC1 VNTR2 gene;

(4) recombinant expression vector that will contain HSP65-MUC1 VNTR2 gene is expressed, and obtains HSP65-MUC1 VNTR2 fusion rotein.

6. according to the described method of claim 5, cloning vector wherein is pMD18-T, and expression vector is prokaryotic expression carrier pET28a (+), and expression strain is e. coli bl21 (DE3).

7. claim 1 or 2 described fusion roteins are in the purposes of preparation in the antitumor drug.

8. according to the described purposes of claim 7, wherein said tumour is a MUC1 male tumour.

9. according to the described purposes of claim 7, wherein said pharmaceutical dosage form is an injection.