CN101235387A - Adenoids viral vectors for constructing endogenesis promoter to regulate and control exogenous gene - Google Patents

Abstract

The invention discloses an adenovirus hominis AdCN205-IL-24 of double-tareting tumour, which utilizes E3 area 6.7K and adenovirus hominis vector plasmid pCN204which is missed by gp19K to carry tumor treatment gene IL-24 to recombinant in the isogeny with missed 24bp and pCN103 which carries hTERT promoter in BJ5183, and gets virus AdCN205-IL-24 through transfecting in 293 cell. And meanwhile, the invention discloses a constructing method of virus AdCN205-IL-24 and a usage for preparing medicine for treating tumour. The double-tareting tumour virus AdCN205-IL-24 which is constructed by the invention can be used to treat various tumors, which can develop effective anti-cancer new drugs for treating tumors.

Description

Make up the novel adenoidism poisonous carrier of endogenesis promoter regulation and control foreign gene

Technical field

The invention belongs to field of gene, specifically, is structure and the application that utilizes the novel adenoidism poisonous carrier of adenovirus self E3 district promoter regulation exogenous gene expression.

Background technology

Gene therapy is a kind of biological high-technology scheme of rising nearly more than ten years, and in whole gene therapy scheme, the therapy of tumor scheme accounts for more than 60%, and gene therapy once was considered to human hope of finally conquering tumour.Be divided into virus type and non-virus type two big classes as Vectors in Gene Therapy at present.Virus vector comprises: adenovirus, adeno-associated virus, retrovirus, slow virus and simplexvirus etc.Virus vector transfection efficiency height, expression time is long, but immunogenicity is strong, and certain risk is arranged.Non-virus carrier comprises: the DNA of naked DNA, liposome and other material parcel.Non-virus carrier then immunogenicity is little and security good, but transfection efficiency is low, and gene stability is poor, and expression time is short.Use at most still virus vector at present.Wherein adenovirus is the most frequently used virus vector, adenoviral gene group total length 36Kb, divide early gene (E) and late gene (L), if early gene E1 district (about 4Kb) disappearance is fallen (also adding the excalation of E3 district 3.6Kb sometimes), then be called first-generation gene therapy vector, this is the carrier of using always.S-generation Adv also has E4, E2A district disappearance reducing its immunogenicity except that disappearance such as E1 district, but few people's usefulness now.It then is that all genes of Adv are all removed that the third generation does not have enteric adenovirus Gutless Adv (abbreviating GL-Adv as) carrier, only keep the reverse terminal repetition order (ITR) at two ends and assembled base because of, it does not have antigenicity, can not fallen by cleaning antibody, so long-term efficacy is arranged.But more than be replication-defective adenoviral vector, thus target is poor, little to tumour toxicity, gene expression amount is low, clinical test results is still also unsatisfactory up to now.

Discover that recently the tumor proliferation adenovirus is one of adenovirus carrier through transforming, research data shows that such carrier is the most potential virus vector (W.C.Russell, 2000; Paul R etc., 2005), transforming viral genome by genetic engineering technique makes its infection in tumour cell, duplicates and the dissolved cell interaction energy strengthens effectively, and this effect weakens even disappears in normal somatic cell, improved virus vector is optionally killed tumour cell and is not influenced normal cell, such carrier has obtained target to a certain degree, thisly can be referred to as tumor proliferation virus or oncolytic virus of proliferation (Alemany R, 2000 in the virus of specifically inside tumor cell ground propagation and killing tumor cell; Kirn D, 2001).Some tumor proliferation adenovirus has entered the clinical III phase pilot study stage, and viral therapy can combine with traditional chemicotherapy separately, for a new treatment approach has been opened up in the treatment of late tumor patient.

Yet present tumor proliferation virus vector generally all is by the exogenous promoter expression alien gene, and exogenous promoter commonly used (as HCMV) all exists certain defective in the process of startup and regulating and expressing foreign gene.Duplicate expression although foreign gene can be special in tumour cell, also exist in normal cell and express, this queries to the security of result of treatment and gene therapy undoubtedly; On the other hand, when utilizing exogenous promoter startup and regulation and control antioncogene to insert carrier, because the limitation of carrier capacity causes the significant gene of some results of treatment reasonably not used.The expression that studies show that startup of endogenous promotor and regulation and control external source goal gene is compared the very big advantage that exists with the exogenous promotor of use.The endogenous promotor can make foreign gene express in tumour cell, thereby result of treatment is significantly improved, and side effect obviously reduces, and the endogenous promotor also can improve the expressing quantity (Hawkins.K, 2003) of therapeutic gene significantly simultaneously.

The adenoidism poisonous carrier that the present invention makes up is to utilize E3 endogenous promoter regulation, expression alien gene, E3 district 6.7k and gp19k gene have been removed simultaneously, following advantage is arranged in theory: at first, remove E3 district 6.7k and gp19k gene, the result can make the bale capacity of virus strengthen, for the therapeutic gene that inserts macromolecule has been opened up new platform.Second, 6.7k and gp19k gene that this experimental selection is removed, it is E3 district at the adenovirus multi-gene expression, this district keeps the function of a plurality of genes of potential expression, this experiment utilizes the E3 district in the process of virus infection, characteristics (Wold.WS etc. at different time and a plurality of genes of horizontal expression, 1995), improved the intensity of endogenesis promoter in the later stage, this system that us are made up is easy to the high level expression foreign gene more, it is reported that this endogenesis promoter is better than the ability (Hawkins.K etc., 2001) of exogenous promoter HCMV expression alien gene.The 3rd, although at present the function of E3 district 6.7k also is not very clear since E3 district 6.7k and gp19k gene the two be the gene that links to each other, and by translating, so can be when removing gp19k with the two common removal with a kind of mRNA.Removal gp19k gene helps virus breeds in tumour cell, and increases Normocellular security.Gp19k albumen and MHC-I in adenovirus hominis (Major HistocompatibilityComplex I) molecule is attached to cell surface (Wold.WS etc., 1999), can effectively escape the supervision and the removing of specificity cell toxicity T lymphocyte (CTL), thereby weaken cellular immunization at adenovirus.The mode of escaping the CTL supervision in tumour cell has a variety of, as passing through the TGF β in the tumour cell, FasL etc., can make tumour cell escape CTL discovers, these existence that gp19k has been described are not absolutely necessary, but its removal really can bring benefit to normal cell, when removing the gp19k gene, the existence meeting of virus in normal cell discovered by CTL, and it is very fast with virus sweep, this just makes virus can not express, duplicate (LK Hawkins, 2001) in normal cell.Actually but or the independent effect of adenovirus has changed the susceptibility of CTL to virus with the therapeutic gene acting in conjunction in tumour cell, also to just have conclusion clinically.

Summary of the invention

The invention provides a kind of construction process that utilizes the replicative adenovirus vector plasmid of adenovirus E3 district endogenous promoter regulation, expression alien gene.

Another order of the present invention has provided and has made up two targets and carry green fluorescent protein or the method for the tumor proliferation adenovirus of interleukin-22 4.

Another object of the present invention is to provide a kind of new purposes of utilizing the two monogenic virus of A dCN205-IL-24 of target of adenovirus endogenous promoter regulation foreign gene to be used for the treatment of tumour.

For achieving the above object, the invention provides a kind of target anticancer virus of A dCN205-IL-24, this virus is carrier with the adenovirus pCN204 of E3 district disappearance 6.7k and two genes of gp19k, and carry oncotherapy gene IL-24, transform reorganization with disappearance 24bp with the pCN103 electricity that carries the hTERT promotor simultaneously and obtain pCN205-IL-24, afterwards the two monogenic novel replicative adenovirus AdCN205-IL-24 of target of homologous recombination acquisition in cell.

The invention provides the construction process of virus of A dCN205-IL-24, its step comprises:

A, with plasmid pGEM-11Zf (+) with HindIII and SphI double digestion, simultaneously to plasmid pTG3602 with HindIII and SphI double digestion, glue reclaims the purpose fragment, the two connects and obtains pCN201;

B, with plasmid pCN201 with HindIII and SpeI double digestion, reclaim the purpose segment, synthetic linker1 is inserted, obtain pCN202;

C, with plasmid pCN202 with SunI (BsiWI) and MunI (MfeI) double digestion, the order fragment of gel recovery, this is to have removed E3 district 6.7k/gp19k gene; Synthetic linker2 is inserted, and this makes that behind the carrier disappearance E3 district 6.7k/gp19k gene, carrier contains multiple clone site, is convenient to insert foreign gene to make up plasmid pCN203;

D, with MluI and SpeI double digestion skeleton plasmid pCN203, simultaneously to plasmid pTG3602 with MluI and SpeI double digestion, gel reclaims the purpose fragment, the two is connected make up can be at the vector plasmid pCN204 of E3 district insertion foreign gene;

E, utilize plasmid pCA13-IL-24 to be template, with the primer PCR of the IL-24 gene IL-24 that obtains medical treatment; Use deep plasmid pCN204 of NruI enzyme simultaneously, the two connection is built into plasmid pCN204-IL-24;

F, with MluI and NdeI double digestion plasmid pCN204-IL-24, reclaim the purpose fragment, use SrfI single endonuclease digestion pCN103 simultaneously, precipitation reclaims big fragment, and the mode that these two fragment electricity consumptions transform is recombinated in BJ5183, obtains two target plasmids;

G, with the plasmid pCN205-IL-24 PacI single endonuclease digestion that obtains, precipitation reclaims big fragment transfection HEK293 cell strain, produces by homologous recombination to have the AdCN205-IL-24 virus that infectivity contains antioncogene IL-24.

The method that makes up virus of the present invention can be used to develop the PTS of effective treatment tumour.

Beneficial effect of the present invention:

1, the invention provides the vector plasmid construction process that can carry foreign gene in the E3 district, convenient scientific research is from now on used, and provides novel vector for developing new cancer therapy drug;

2, the invention provides the virus formulation method of carrying antioncogene IL-24, this method is easy to grasp;

3, the invention provides the recombinant adenovirus that carries antioncogene IL-24, prove through cell experiment, anticancer factor IL-24 can express in tumour cell specifically, and does not express in normal cell.Prove through cell and animal experiment, can be used for the treatment of kinds of tumors;

4, the gene-virus AdCN205-IL-24 of the present invention's structure, be a kind of pair of target tumor specificity virus, can optionally in tumour cell, duplicate propagation and express entrained tumor-inhibiting factor IL-24, so this gene-virus has very high target anticancer effect;

Description of drawings

Fig. 1. be the structure synoptic diagram of plasmid pCN205-IL-24 of the present invention.

Fig. 2. be the structure synoptic diagram of virus of A dCN205-IL-24 of the present invention.

Fig. 3. the expression synoptic diagram of anticancer factor IL-24 in virus of A dCN205-IL-24 normal cell or the tumour cell

Fig. 4. the replication synoptic diagram of virus of A dCN205-IL-24 in normal cell or tumour cell

5 days survival rate that Fig. 5 .MTT method detects tumour cell and normal cell after the different virus of 10m.o.i. (multiplicityofinfection) is handled.

Fig. 6. virus of A dCN205-IL-24 is in the result schematic diagram of nude mouse internal therapy tumor cell transplantation knurl

Embodiment

The invention will be further described below in conjunction with specific embodiment, should be understood that following examples only are used to the present invention is described and are not used in the scope of the present invention that limits.

Embodiment 1, the E3 district carries the structure of the cancer target virus of A dCN205-IL-24 of tumor suppressor gene IL-24

A, Remove the structure of the vector plasmid pCN204 in E316.7K/gp19K district:

The pTG3602 plasmid contains adenovirus hominis 5 types (Ad5) complete genome sequence.With plasmid pTG3602 HindIII and SphI double digestion, glue reclaims the fragment of these clauses and subclauses of 4896bp, it is cloned into among the purpose vector plasmid pGEM-11Zf (+) that is recovered to behind HindIII and the SphI double digestion, (the concrete operations step sees Molecular Cloning:A Laboratory Manual, 3 for details to obtain pCN201 ^RdEd., Joseph Sambrook and David W.Russell);

Design following primer earlier:

Linker1sense primer: (containing the HindIII-MluI-SpeI site)

5＞↓AGCTTGGGACGCGTCGGGGATCCGCGAATTCGGATATCGGA?↓＜3

Linkerl antisense primer: (containing the HindIII-MluI-SpeI site)

5＞↑CTAGTCCGATATCCGAATTCGCGGATCCCCGACGCGTCCCA?↑＜3

Get linkerl sense primer and linkerl antisense primer, be prepared into the storage liquid of 100uM respectively, respectively get primer 5ul, add the 20ul distilled water, 95 ℃ 5 minutes, forward at once in 60 ℃ the water-bath, close water-bath, after waiting it to naturally cool to room temperature it is cloned into among HindIII and the SpeI double digestion plasmid pCN201, obtain pCN202, this plasmid adds the fragment of being convenient to behind the linkerl to contain the E3 district and scales off from carrier and recombinate that (the concrete operations step sees Molecular Cloning:A Laboratory Manual, 3 for details ^RdEd., Joseph Sambrook and David W.Russell);

Design following primer earlier:

Linker2sense primer: (contain the BsiwI-NcoI-ClaI-KpnI-MfeI site

5＞↓GTACGCAAACCATGGCATGCCATCGATGGTCGCGAGGGGTACCCCC?↓＜3

Linker2antisense primer: BsiwI-NcoI-ClaI-KpnI-MfeI site

5＞↑AATTGGGGGTACCCCTCGCGACCATCGATGGCATGCCATGGCATGC?↑＜3

With plasmid pCNZ202 SunI (BsiWI) and MunI (MfeI) double digestion, glue reclaims the order fragment of 6427bp, synthetic linker2 is cloned into recovery purpose fragment, obtain plasmid pCN203, this plasmid has successfully excised E3 district 6.7k and gpl9k gene, and added multiple clone site accordingly, be convenient to add different therapeutic genes;

With MluI and SpeI double digestion skeleton plasmid pCN203, reclaim big segment, to go into this fragment with the fragment cloning that MluI and SpeI double digestion pTG3602 reclaim 2690bp, and obtain pCN204, the fragment that adds this section 2690bp is the needs in order to recombinate with pCNl03.

B, The structure of plasmid pCN204-IL-24

Design following primer earlier:

The IL-24sense primer:

5＞AATCCATGGATGAATTTTCAACAGAGGCTGC＜3

The IL-24antisense primer:

5＞GGGGTACCTCAGAGCTTGTAGAATTTCTGC＜3

With the template of pCAl 3-IL-24 plasmid (Singapore dollar medical biotechnology institute of Institutes Of Technology Of Zhejiang, Hangzhou) for the PCR reaction, primer I L-24sense and IL-24antisense carry out the PCR reaction, and the 628bp fragment is reclaimed in the leakage of electricity swimming.The clone advances the pCN204 plasmid that the NruI enzyme was cut, called after plasmid pCN204-IL-24.The plasmid pCN204-IL-24 that obtains is IL-24 gene order wherein after measured, and the result is consistent with gross data, shows the plasmid construction success.

C, The structure of target plasmid pCN205-IL-24

With MluI and NdeI double digestion plasmid pCN204-IL-24, reclaim big segment 6377bp, use SrfI single endonuclease digestion pCN103 (Spain) simultaneously, precipitation reclaims big fragment, adopt the electric mode that transforms in the BJ5183 homologous recombination these two fragments, obtain to contain the gene order pCN205-IL-24 that removes adenovirus hominis 5 types (Ad5) E3 district 6.7k and gp19k gene and lack 24bp.

D, The structure of the novel replicative adenovirus AdCN205-IL-24 of endogenesis promoter regulation and control foreign gene

HEK293 cell (biochemical and cell research institute of the Shanghai Chinese Academy of Sciences, Shanghai) is to transform the human embryonic kidney cell by the 5 type adenovirus DNAs of shearing to form.It contains the E1 district of expressing 5 type adenovirus, and adenovirus DNA has high transfection efficiency to it.

With pCN205-IL-24 PacI single endonuclease digestion, precipitation reclaims big fragment, and cotransfection 293 cell strains have infective recombinant adenovirus AdCN205-IL-24 that contains foreign gene by the homologous recombination generation, and concrete grammar is referring to the operation instructions of Qiagen company.Virus plaque occurs about 7 days, collect and increase, extract the DNA of recombinant adenovirus, carry out the DNA restriction analysis, pcr analysis is determined the adenopathy strain that reorganization is correct.

Virus plaque purifying, amplification, evaluation: 293 cells are laid on 6 orifice plates, and cell adds and contains different extent of dilution (10 near covering with behind the 24h ^-6-10 ^-9) virus, infect after 2 hours shop, every hole 3ml low melting point glue (10%FBS, 1.25%Agarose) just visible plaque about 9 days.The single plaque of picking adds near a small amount of amplicon virus in 24 orifice plates that cover with 293 cells.Viral DNA obtains with Qiagen Blood Kit, utilizes round pcr, identified gene virus of A d206.It is synthetic to identify that the primer is given birth to the worker by Shanghai.

PCN101 positive control sense primer (wild-type 608bp～626bp)

5＞CCAGTCTTTTGGACCAGC＜3

PCN101 positive control antisens primer

5＞TCTGCTGTGCGTAACTTG＜3

The IL-24sense primer:

5＞AATCCATGGATGAATTTTCAACAGAGGCTGC＜3

The IL-24antisense primer:

5＞GGGGTACCTCAGAGCTTGTAGAATTTCTGC＜3

As template, simultaneously with wild-type virus DNA in contrast, IL-24sense primer and IL-24antisense primer carry out PCR and react with the viral DNA of Qiagen Blood Kit extracting gained.The PCR condition: 94 ℃ * 1min, 55 ℃ * 1min, 72 ℃ * 2min15s.The PCR product is detected, only contain gene, do not contain wild-type adenovirus DNA, the success of plaque purifying as the PCR product.Repeat this process once, obtain the correct adenovirus AdCN205-IL-24 that recombinates.

Adenovirus AdCN205-IL-24 is breeding in a large number in 293 cells, uses the caesium chloride density gradient centrifugation purified virus.Concrete operation method is seen the operation instructions of Microbix Biosystem Inc..

Embodiment 2, virus of A dCN205-IL-24 expression alien gene capability analysis

With 2 * 10 ⁵Normal cell or tumour cell/hole be laid on 12 orifice plates, behind the 24h cell attachment, add the virus of A dCN205-IL-24 of 10MOI, infect hepatoma cell strain BEL7404, colon cancer cell SW620, people's normal liver cell QSG7701, normal people's pneumonocyte MRC-5 respectively.Discard original fluid behind the 2h, add the 1ml fresh medium.Tumour cell is respectively 6,12,18,24,30,36,42,48,72,96 and 120h collecting cell and nutrient solution, centrifugal absorption supernatant.By with the quadrat method normal cell respectively 24,48,72,96 and 120h collect sample.Survey the total amount of human IL-2 4 in every milliliter of supernatant liquor with double fastener heart ELISA method, thereby compare human IL-2 4 expression difference in tumour cell and normal cell.The result as shown in Figure 3.

Embodiment 3, virus of A dCN205-IL-24 replication analysis in normal cell or tumour cell

With 3 * 10 ⁵Normal cell or tumour cell be laid on 6 orifice plates, behind the 24h, virus of A dCN205-EGFP, the AdCN205-IL-24, Ad-IL-24, AdCN103 and the Ad-Wt that add 5MOI infect hepatoma cell strain BEL7404, SMMC7721, Hep3B colon cancer cell line SW620 and human embryonic lung cell's strain NHLF, normal liver cell's strain QSG7701 respectively.After infecting 6h, wash twice, add new training liquid with PBS, behind the 48h, collecting cell supernatant and cell ,-20 ℃ with 37 ℃ of multigelations 3 times with releasing virus.The centrifuging and taking supernatant detects virus titer.293 cells are laid on 60mmdish, and cell adds and contains different extent of dilution (10 near covering with behind the 24h ^-1-10 ^-8) virus, 37 ℃ were infected after 2 hours, shop 8ml low melting point glue (5%FBS, 1.25%Agarose).Numeration about 9 days.Calculate the virus numbers that every PFU virus produces.The result as shown in Figure 4.

As seen from Figure 4, in tumour cell, the replication of virus of A d-Wt, AdCN205-EGFP and AdCN205-IL-24 is roughly the same.And in normal cell, the replication of AdCN205-EGFP and AdCN205-IL-24 significantly reduces, and Ad-wt is not obvious at tumour cell and Normocellular replication difference, does not have selectivity; And AdCN205-EGFP and AdCN205-IL-24 can optionally duplicate in tumour cell.Ad-IL-24 all can not massive duplication in tumour cell and normal cell owing to there not being replication.

Embodiment 4, virus of A dCN205-IL-24 detects in external kill capability to normal cell and tumour cell

The survival rate of cell after virus treated detected by mtt assay.Step is as follows: with liver cancer cell strain BEL7404, SMMCC7721, Hep3B, colon cancer cell line SW620, normal human embryonic lung cell's strain NHLF and normal liver cell's strain L-02 spread into 96 orifice plates with the amount in 10000 every holes, cultivate the virus that adds 10MOI after 24 hours respectively, infecting the nutrient solution that will contain virus 1 to 5 day every day removes, change the normal nutrient solution that contains 5mg/ml MTT into, cultivating the nutrient solution that will contain MTT after 4 hours removes, with the DMSO cracking, be that reference is measured 595nm place absorbancy after shaking up 30 minutes with 655nm place absorbancy.

Cell survival rate (%)=A595 (sample)/A595 (contrast) * 100%.

The result as shown in Figure 5, virus of A dCN205-IL-24 has very strong lethal effect to tumour cell, and very little to normal cytotoxicity, has tumor-selective.

Embodiment 5, virus of A dCN205-IL-24 is in nude mouse internal therapy tumor cell transplantation knurl

With the 4-5 nude mice subcutaneous vaccination hepatoma cell strain BEL7404 in age in week, laggard action thing grouping in 12 days.The treatment group gives 1 * 10 ⁹The AdCN205-IL24 of pfu treats, five groups of contrast components, and the 1st group is phosphoric acid buffer (PBS) treatment group, the 2nd, treat with AdCN205-EGFP, AdCN205-IL-24 and the Ad-Wt virus of same dose respectively for 3,4 groups, test-results as shown in Figure 6.

As seen from Figure 6, virus of A dCN205-IL-24 reaches the target venereal disease poison of not expressing IL-24 with respect to wild-type virus can suppress growth of tumor better, prolongs the tumor bearing nude mice life cycle.

Claims (4)

1. two target tumor adenovirus AdCN205-IL-24, it is characterized in that, this virus is with the adenovirus carrier plasmid pCN204 of E3 district disappearance 6.7K and gp19K, and carry oncotherapy gene IL-24, with disappearance 24bp and the pCN103 that carries the hTERT promotor in BJ5183, dye at 293 transit cells again and obtain virus of A dCN205-IL-24.

2. the construction process of a tumor targeting gene-virus AdCN205-IL-24 is characterized in that may further comprise the steps:

A, the method for cutting connection with enzyme make up the vector plasmid pCN204 that E3 district lacks 6.7K and gp19K gene;

B, oncotherapy gene IL-24 is cloned the into multiple clone site of vector plasmid pCN204, be built into plasmid pCN204-IL-24;

C, with MluI and NdeI double digestion plasmid pCN204-IL-24, reclaim big segment 6377bp, reclaim big fragment with SrfI single endonuclease digestion pCN103 precipitation simultaneously, electricity transforms in the BJ5183 homologous recombination, obtains pCN205-IL-24;

D, with pCN205-IL-24 PacI single endonuclease digestion, precipitation reclaims big fragment, cotransfection 293 cell strains produce by homologous recombination and to have infective recombinant virus AdCN205-IL-24 that contains antioncogene IL-24.

3. method as claimed in claim 2 is characterized in that, employed E3 district disappearance 6.7K and gp19K vector plasmid are pCN204 in the steps A; The disappearance 24bp that uses among the step C and the pCN103 and the electricity that carry the hTERT promotor transform the pCN205-IL-24 that homologous recombination obtains; The method of packaging virus among the step D.

4. described pair of target tumor adenovirus of claim 1 AdCN205-IL-24 is used to prepare the purposes of the medicine for the treatment of tumour.

Images