CN101220358A - Modulation of cytokinin activity in plants - Google Patents

Abstract

This invention relates generally to the field of plant molecular biology. More specifically, this invention relates to methods and reagents for the temporally- and/or spatially-regulated expression of genes that affect metabolically effective levels of cytokinins in plants, particularly in plant seeds and related female reproductive tissue. This invention further relates to transgenic plants having enhanced levels of cytokinin expression wherein the transgenic plant exhibits useful characteristics, such as improved seed size, decreased tip kernel abortion, increased seed set during unfavorable environmental conditions, or stability of yield. The present invention also provides compositions and methods for regulating expression of heterologous nucleotide sequences in a plant. Compositions comprise novel nucleotide sequences for seed-preferred promoters known as eep1 and eep2. A method for expressing a heterologous nucleotide sequence in a plant using the promoter sequences disclosed herein is provided. The method comprises transforming a plant cell to comprise a heterologous nucleotide sequence operably linked to one of the promoters of the present invention and regenerating a stably transformed plant from the transformed plant cell.

Description

The adjusting of cytokine activity in the plant

The application is that international filing date is that to enter China, application number be dividing an application of 200480015535.0 the application for a patent for invention that is entitled as " adjusting of cytokine activity in the plant " for the International Application PCT/US2004/010064 on April 2nd, 2004.

Technical field

The present invention relates generally to the molecular biology of plants field.More specifically, the present invention relates to be used for method and reagent in time or space adjusted genetic expression, described gene is influencing phytokinin in plant in the metabolism, comprise seed and produce level of significance in the female parent tissue (comprising that female inflorescence, ovary, female Xiao Hua, aleuron, bennet and bennet form the zone) that these seeds produce.

Background technology

Phytokinin is the plant hormone of a large amount of physiological processes in the involved in plant.Plant is to regulate by the relative equilibrium of modification activities and non-activity phytokinin to the response part that environment association compels.For example, during compeling, abiotic association (comprises, but be not limited to, arid, density, cold, salinity and/or soil compression situation), the cytokinin oxidase activity that increases makes balance move towards the direction that helps the non-activity phytokinin, thereby cause the plant production power (Jones and the Setter that reduce InCSSA Special Publication No.29, pp.25-42.American Society of Agronomy, Madison, WI. (1999)).On the contrary, the phytokinin equilibrated target operation that helps the active cells mitogen can cause the productivity that increases, even under abiotic association compels, increase productivity (Morris, R.O.1997. by for example increasing cell fission, induce stomatal opening, suppress organ senescence and/or suppressing apical dominance InCellular and Molecular Biology of Plant Seed Development, pp.117-148.Kluwer Academic Publishers. (1997)).In the corn that suffers the adverse environment situation, the showed cell mitogen reduces, and seed size reduces, the abortion increase is examined on the top and seed-setting reduces (Cheikh and Jones, Plant Physiol.106:45-51 (1994) thereby cause; People such as Dietrich, Plant Physiol Biochem 33:327-336 (1995)).Therefore, these studies show that compeling the next method that improves seed-setting and seed size of condition in association is that active cells mitogen storehouse is remained on more than the critical threshold level.

First naturally occurring phytokinin in 1963 by purifying (Letham from the immature nuclear of corn (Zea mays), D.S., Life Sci.8:569-573 (1963)) comes out and be accredited as 6-(4-hydroxy-3-methyl-trans-2-alkenyl amino) purine, more generally be called zeatin today.All naturally occurring phytokinin seemingly have ramose 5 carbon N generally ⁶Substituent purine derivative.(referring to: McGaw, B.A., In:Plant Hormonesand their Role in Plant Growth and Development, ed.P.J.Davies, Martinus Nijhoff Publ., Boston, 1987, Chap B3, Pgs.76-93 quotes its content description references as a setting).Although identified about 25 different naturally occurring phytokinin, be considered to have especially the active N that is ⁶(Δ ²-isopentene group) adenosine (iP), zeatin (Z), diHZ, benzyladenine (BAP) and its 9-ribosyl (and under the situation of Z and iHZ, its O-glucosyl) derivative.Yet this activity is greatly diminished in 7-and 9-glucosyl and 9-alanyl conjugate.The compound of these back may be the reflection of inactivation or controlling mechanism.

The metabolism of phytokinin is complicated in the plant.Known phytokinin biosynthesizing and degraded are the rapid bio-chemical pathways of multistep.At least two main phytokinin biosynthetic pathways gain public acceptance.First approach relates to the transfer RNA (tRNA) as intermediate.From the beginning second approach relate to (directly) biosynthesizing.Under first kind of situation, known tRNAs contains the base (some phytokinin is wherein arranged) of various excessive groomings.Known these modifications occur in tRNA polymkeric substance level as post transcriptional modificaiton.Ramose 5 carbon N ⁶Substituting group derives from the mevalonic acid tetra-sodium, and described mevalonic acid tetra-sodium carries out decarboxylation, dehydration and isomerization to produce Δ ²-isopentenyl pyrophosphate (iPP).Relevant adenosine residue condensation on the latter and the tRNA.May further modify then.Final described tRNAs is hydrolyzed into it and forms base, forms obtainable free phytokinin storehouse thus.

Selectively, found that from the beginning catalysis form the enzyme of phytokinin, promptly do not have the tRNA intermediate.The ipt gene that is applied in the present invention's practice is exactly such gene.The formation of supposing the free cell mitogen is from [9R5 ' P] iP.Thereby this compound can be produced the zeatin derivative that can continue to take place many further metabolism incidents with stereospecificity ground hydroxylation apace.This class incident includes but not limited to that (1) put together, and integrates ribonucleoside, ribonucleotide, glucoside and amino acid; (2) hydrolysis; (3) reduction; (4) oxidation.Although each enzyme in these approach is the candidate as the effector of phytokinin level, has only with the rate-limiting step involved enzyme and in the present invention's practice, have special effectiveness.

Such enzyme is prenyltransferase (ipt).People such as van Larebeke ( Nature252:169-170 (1974); Also referring to people such as Barry, Proc.Nat ' l. Acad.Sci. (USA)The isolating gene of coding ipt has been described people such as 81:4776-4780 (1984) and Strabala, Mol.Gen.Gen.216 (2-3): 388-394 (1989)).Also be reported in the Arabidopis thaliana and separated ipt gene (people such as Takei, J Biol Chem.276 (28): 26405-26410 (2001); People such as Kakimoto, Plant Cell Physiol.42 (7): 677-685 (2001) and WO 2002/072818; People such as Sun, Plant Physiol 131:167-176 (2003)).The present invention includes and regulate suitably from the ipt genetic expression of (comprising other species, for example corn) of any source.

Based on the verifiable effect of phytokinin in hundreds of experiments of a plurality of plant species that jump, improve the transgenic method of active cells mitogen in the corn and can compel to improve under the condition its productivity in normal and/or abiotic association.Yet the storehouse that increases the active cells mitogen simply can't automatically cause the enhanced plant-growth.In fact, shown that improving the phytokinin level can produce deleterious effect to plant phenotype.

For example by use from Agrobacterium tumefaciens (A.tumefaciens)May be operably coupled to ipt gene on 35S or the NOS promotor, people such as Smigocki ( Proc.Nat ' l. Acad.Sci. (USA)85:5131-5135 (1988)) be presented at that the stem organ takes place and the zeatin level on general effect.It is to be noted that the activity control of promotor the degree that observed form is replied, and the generation of the phytokinin of not regulated can cause undesired pleiotropy effect.About the construct of identifying above, undesired effect is included in the formation that suppresses root in the tobacco fully and hinders the not cucumber seedling growth of survival.(people such as Smigocki ( With On); People such as Klee, Annual Rev.Plant Physiol.38:467-486 (1987)).

Then carry out expressing the trial of ipt gene in more in check mode.People such as Medford ( The Plant Cell1:403-413 (1989)) report will Edaphic bacillusThe control that the ipt gene places thermal induction type promotor down and the tobacco plant expressing said gene of taking root in transgenosis.The level of phytokinin significantly improves after thermal treatment, and observed effect comprises that height, xylem content and blade size significantly reduce in transgenic plant.In tobacco and Arabidopis thaliana, with respect to wild-type plant, root growth, the root development of confusion and the axillary bud growth of increase that the transgenic plant performance is slower.In addition, the experiment construct is also unsatisfactory, even because plant also shows and the relevant phenotype of excessive phytokinin level under the thermoinducible situation of shortage, comprise height, blade area and wide the reducing of stem.Further find, in wild-type and transgenic plant, all observe some change and may be owing to thermal induction self.

Schmulling, people such as T. ( FEBS Letters249 (2): 401-406 (1989)) be used in Fruit bat (Drosophila)Under the control of hsp70 promotor Edaphic bacillusIpt gene transformation tobacco, described promotor provide extremely low-level expression and promptly increase expression after heat shocks under normal temps.The overwhelming majority is subjected to the transgenic plant callus of heat shock to become greener, has higher cytokinin concentration, and comparison is faster according to callus Growth speed.From heat shock transgenic calli regenerated plant be described to " quite normal " and these plants the phytokinin level with in wild-type plant, record identical.From the aftergrowth of inductive transgenic calli not with all do not have difference to impinging upon on plant phenotype or the cell fission cellulose content.Second experiment produces the callus transgenic plant of the ipt gene that drives by its natural promoter.From the stem of these callus regenerations, high phytokinin level suppresses the formation of root.Sow these stems that are connected on the wild-type tobacco stem and show small blade and repressed, highly branched habit.Therefore, conversion has caused negative phenotypic alternation or has not had effect.

PCT patent application publication number WO91/01323 and U.S. Patent number 5 on February 7th, 1991,177,307 and 4,943, in 674, showed the ripe characteristic of change with the tomato plants of the ipt gene transformation that is connected to fruit-specific promoter (2AII, Z130 and Z70).Described into coarsely at the mezzanine level fruit, in ripening process, then described to raggle-taggle, have flecky and dark specking is arranged.Also, wherein disclose and used ipt and the preferred promotor converting cotton of seed tissue to change cotton boll setting and fiber quality referring to United States Patent (USP) 6,329,570.

In PCT patent application publication number WO93/07272, the ipt gene is merged into from gold Water shield (Antirrhinum majus)In chalcone synthase (chs) promotor and in potato, express.The phenotypic alternation of transformant comprises the stem tuber output of increase, height and the blade size of plant, the leaf aging that increases thick stem and delay.People such as Wang (Australian J of PlantPhys 24 (5): 661-672 and 673-683,1997) reported that the phytokinin level increases in the stem on the impeller of the tobacco that the ipt with the chs promoters driven transforms and top, and axillalry bud discharges, the growth of root is suppressed, the leaf aging delays, the chlorophyll level improves, the initial phase of blooming postpones, development delay, the leaf branch of flower grow, leaf shape changes, arteries and veins enlarges in the leaf, vein enlarges, stem increases slightly, the tubercle number increases and the respiratory rate increase from main root.The expression of chalcone synthase gene is very complicated and is subjected to the adjusting of many factors, comprises light, fungal induction thing (elicitor), damage and microbial pathogen.In addition, the chs expression can be (the producing in the germination process in early days) of tissue-specific (resulting from the painted flower and root) and developmental characteristic.(people such as Ito, Mol.Gen.Gen.255:28-37 (1997); People such as Shimizu, Plant Molecular Biology 39 (4) 785-95 (1999)).

The existing report of other ipt gene/promoter construct.

People such as Smigocki are in WO 94/24848 and United States Patent (USP) 5,496,732 and 5,792, disclose in 934 and can give the enhanced insect-resistant, comprised the gene construct that merges to the damage inducible promoter of ipt gene.Described research concentrates on insect-resistant and does not report variation on the plant morphology.

People such as Houck are at United States Patent (USP) 4,943, and 674 and 5, several promotors (2AII, Z130 and Z70) are disclosed in 177,307, the gene coupling of the enzyme in described promotor and the Codocyte mitogen pathways metabolism is especially for express this zymoid ipt in the tomato fruit.

People such as Amasino disclose two senescence-specific promotors in the open WO96/29858 of PCT patent application, thereby comprise and be operably connected to the ipt gene suppresses leaf senile in tobacco SAG-12.Transformant is grown normal, has biomass and the flower and the seed production of increase, perhaps owing to the growth cycle of the prolongation that causes by delaying senility.Also referring to United States Patent (USP) 5,689,042 and 6,359,197; Gan, people such as S., (Science 270:1986-1988 (1995)).People such as Jordi exist Plant, Cell and Environment23 (3): studied the physiological effect of SAG12:ipt construct in tobacco among the 279-289 (2000).Although benefiting from, older leaf keeps chlorophyll, rubisco and albumen, but nutritive substance has reduced to flowing again of younger leaf from older leaf, thereby cause upper blade photosynthesis to be restricted and to have limited the increase of these plant potential biomasss, particularly compel under the condition in association.

Roeckel, people such as P. ( Transgenic Res.6 (2): 133-141 (1997)) be used in from the ipt gene transformation of being grown of edaphic bacillus 2S white protein promotor adjusting, seed-specific control low erucic acid mustard seed (canola) and tobacco.Although ipt mRNA only is found in seed, and has only estimated the phytokinin level in seed, the effect of construct is not limited to seed: tobacco has the root of minimizing; Low erucic acid mustard seed plant is made us unusual ground (p.139) and increases and have more branch and Geng Duo has the structure of seed.Yet, in two species, both do not influenced output, do not influence the type of leaf, the number of leaf, bloom for the first time preceding fate or solid preceding fate yet.

Transform the controlled system that (28 examples are arranged) provides the effect that is used to estimate the phytokinin output that increases with being connected to tobacco that the ipt copper inducible type, the root specificity promotor carries out in 31 examples.Dependence inductive morphological change comprises delaying of the release of apical dominance, whole strain plant leaf purpose increase and leaf senile.(people such as McKenzie, Plant Physiol.116:969-977 (1998)).Yet several transgenic lines show the expression of uncontrolled phytokinin and show distinct, undesired phenotype, lack root development and and stem elongation.

People such as Ivic ( Plant Cell Reports20:770-773 (2001)) the report expression of ipt in transgenic beet causes root development to be subjected to severe inhibition, simultaneously on the morphology of leaf and stem with the variation of not thinking.The seedling that transforms takes root and takes root more slowly or not, and surviving rate is extremely low when transplanting to soil.

People such as Sa (Transgenic Research 11 (3): 269-278,2002) report that the ipt transformation of tobacco from edaphic bacillus that is used under TA29 promotor (the expressing specifically) control causes the growth disorder of flower pesticide and pollen in flower pesticide.About 80% T0 transgenic plant show significant pollen germination rate and reduce, and to be up to 20% T0 transgenic plant be male sterile.In addition, unusual style and stamen in described transgenic plant, have been found.

In PCT publication number WO 00/52169, mention the negative effect that these are caused by the expression of the guidance of transgenosis IPT especially: " even under the situation about expressing under the control in tissue-specific promoter; these methods have also produced undesired side effect in plant at ipt or rolC; may because phytokinin between the cell of plant and tissue, easily transported, so in other tissue, can observe these side effects." (add and emphasize)

Therefore, in order there not to be these deleterious effects, for example improve plant vigor and output under root development of Jian Shaoing or the unusual morphologic situation of stem, still exist to be used for plant (comprise plant seed and the parent tissue of seed development takes place therein) control and instruct time of phytokinin metabolic gene and the space in check expression, or be used to regulate plant sensation (sensing) and/or respond the nucleic acid construct of phytokinin and the needs of method.The invention provides several such nucleic acid construct and methods that are used for regulating cytokine activity (level of significance that comprises phytokinin in plant seed, developmental plant seed and the relevant parent's germinal tissue) plant.In addition, exist the construct that described plant vigor and output improves and the needs of method can be provided under favourable or disadvantageous growth conditions.The invention provides and allow the activity level of ability technician by utilizing transgenic method especially to learn so to influence the phytokinin instrument and the reagent of (comprising in the seed metabolic flux) about the phytokinin pathways metabolism.This influence can be anabolic also can be catabolic, its meaning is that described influence can increase the biosynthesizing of phytokinin and/or reduce degraded.The present invention also expects the combination of two kinds of methods.Further combination can comprise that the target that the polynucleotide of separated coding polypeptide are expressed regulates, and described polypeptide participates in the identification of phytokinin and to providing as the active cell response of enhanced cell mitogen of definition herein.

Summary of the invention

Certain embodiments of the present invention provide plant, transgenic corns particularly, its relatively other gene plant such as grade have the cytokine activity of increase and do not have corresponding deleterious effect.Described increase with respect to other gene plant such as grade can occur under the advantageous environment condition, under the hostile environment condition or all can under two kinds of conditions.The cytokine activity that increases can comprise seed, developmental seed and the parent relevant with seed development organize in the level of phytokinin.Selectively or in addition, the cytokine activity of increase may be owing to the sensation of described plant pair cell mitogen and reply to improve and produce.The cytokine activity that increases can play the work of metabolism buffer reagent in order to improve the influence that of short duration association compels, and particularly at the lag phase of seed development, thereby improves corn to assisting urgent tolerance and yielding stability.The cytokine activity that increases also shows as the plant vigor that improved and/or the seed production of increase.This class embodiment has comprised the nucleic acid construct that stably is integrated in its genome, and described construct can be in time or space adjusted phytokinin level.

But certain embodiments of the present invention provide the system of the transgenic plant with genetic phenotype, described phenotype is used to design the procedure of breeding of the commerical prod that is used for producing the performance with improvement, and described performance is included in the vigor of plant under favourable or the hostile environment condition, the seed size of improvement, the top nuclear abortion of reduction and/or the seed-setting of increase.These commerical prods are further embodiments of the present invention.

Embodiments more of the present invention provide and have comprised the educated transgenic plant that stably are integrated into the nucleic acid construct in its genome, and described construct can influence the adjusting of cytokine activity in described plant.

Certain embodiments of the present invention provide isolating recombinant DNA molecules, described recombinant DNA molecules comprises promotor and randomly comprises one or more enhancer elements from the gene of highly expressing, and described promotor instructs the expression of the phytokinin regulatory gene that is operably connected that is subjected to time or space adjusting.

In some embodiments, the invention provides and be used for improving the method that association compels tolerance and yielding stability plant, it comprises stably can influence the nucleic acid construct importing vegetable cell that cytokine activity is regulated, and go out to have the urgent tolerance of association of raising and the described plant of yielding stability from described cell regeneration.Described construct can cause the preferred expression of phytokinin regulatory gene during the lag phase that plant seed is grown.

Embodiment also provides and has been used for producing the method that can regulate the transgenic plant of phytokinin regulatory gene expression at developmental seed that can educate, it comprises and will import in the plant host cell under the condition of nucleic acid construct in being enough to carry out described construct stably is integrated into the genome of described cell, and regeneration and reclaim the described transgenic plant that educate, described nucleic acid construct is at developmental seed and the preferred time and/or the space expression that can carry out the phytokinin regulatory gene during the parent relevant with seed development organizes.

The further embodiment of the present invention provides and has been used to produce the method with the transgenic plant of invigorating that can educate, it comprises and will import in the plant host cell under the condition of nucleic acid construct in being enough to carry out described construct stably is integrated into the genome of described cell, and regeneration and reclaim the described transgenic plant that educate, described nucleic acid construct can influence the adjusting of cytokine activity.

According to these aspects of the present invention, the isolated nucleic acid molecule of Codocyte mitogen metabolic enzyme is provided, it comprises variant, analogue or derivative that mRNAs, cDNAs, genomic dna s and its biology are useful, comprises the fragment of its variant, analogue or derivative.Other embodiment of the present invention provides the naturally occurring allele variant of nucleic acid molecule of the sequence of Codocyte mitogen metabolic enzyme.Comprise in addition the phytokinin metabolic enzyme and its biology or diagnosis that are provided are equally gone up useful fragment and aforesaid variant, derivative and analogue and its segmental polypeptide.For example, provided phytokinin metabolism polypeptide especially, particularly ipt (for example, SEQ ID NOS:1 and 2) and cytokinin oxidase (for example, SEQ ID NOS:26-37), described polypeptide or enzyme can be used for regulating the particularly phytokinin level in the meristematic tissue zone of female reproductive tissue of seed and relevant female reproductive tissue.

Certain embodiments of the present invention provide the method that is used to produce desired polypeptides, be included in and be suitable in seed and the relevant female reproductive tissue phytokinin metabolic enzyme and under the condition of expressing on time and/or the space, cultivate and have the host cell that can be integrated in polynucleotide wherein with expressing, randomly reclaim polypeptide expressed then.

What be provided in certain embodiments also has probe with the polynucleotide sequence hybridization of the phytokinin metabolic enzyme that is used as molecule marker in the procedure of breeding.

Other embodiment of the present invention provides product, composition, process and the method for utilizing aforesaid polypeptide and polynucleotide to carry out biology and agricultural purposes research.

Other embodiment of the present invention provides at this class polypeptide, is used to the inhibitor of regulating the active of described polypeptide and/or expressing.The antibody of anti-this class polypeptide is provided especially.

In the present invention's some embodiment aspect this, provide the antibody of anti-cell mitogen catabolic enzymes.Described antibody can be to whole phytokinin katabolism enzyme (no matter source of species) antibody of antibody and species specificity selectively.

Other embodiment provides the antagonist and the agonist of phytokinin enzyme.Wherein preferred antagonist be those and phytokinin catabolic enzymes (for example, cytokinin oxidase), thereby further stops the antagonist of the biologic activity that produces by the phytokinin catabolic enzymes in conjunction with combination that suppresses binding molecule or the stability of destroying the mixture that forms between phytokinin catabolic enzymes and the binding molecule.Wherein preferred agonist be combine with the phytokinin biosynthetic enzyme or interacts with one or more that stimulate specific cells mitogen biosynthetic enzyme plant the molecule of effects or strengthen described enzyme expression molecule and also preferably cause phytokinin to accumulate the molecule of adjusting.

Effectively construct causes at meristematic tissue, particularly regulates phytokinin in the female reproductive tissue, thereby observable raising on vigor is provided.The present invention comprises specific construct described herein and other can provide the phytokinin regulatory gene to express this class construct of the vegetable active that has improved with generation under the situation of no remarkable deleterious effect.Under any circumstance and not be subject under the situation of any specific theory, cause in described plant female reproductive tissue not having that the active adjusting of plant vigor enhanced cell mitogen is required protection under the situation of remarkable deleterious effect.

The expression of separated DNA sequence depends on the existence of the regulatory element of performance function in described plant host that is operably connected in the plant host.The selection of described adjusting sequence will determine where when the sequence of separated DNA expressed in biology.When wanting in whole growth course in all or nearly all vegetable cell continuous expression, use constitutive promoter.On the contrary, when wanting the genetic expression that stimulation is responsed, inducible promoter is selected regulatory element.When wanting in specific tissue or organ, to express in the specific etap sometimes, preferred promotor of using-system and/or terminator.Be that these regulatory elements can drive expression in the specific stage in specific tissue or organ.The other adjusting sequence that can comprise the upstream that is arranged in core sequence and/or downstream in the expression cassette of conversion carrier is to produce the expression of the isolated nucleic acid sequences of various levels transgenic plant.

Seed development comprises embryo generation and ripe incident and occurs in the physiology adaptive process of surviving to guarantee the offspring in seed inside.Developmental plant seed accumulation and storage are subsequently at the employed carbohydrate of duration of germination, lipid and albumen.Usually, the proteic expression pattern of seed is subjected to altitude mixture control.This adjusting is included in the adjusting on time and space during the seed development.During embryogeny and seed development, various protein accumulation and decomposition and providing is used to the outstanding system that investigates the different aspect of generegulation and be used to be provided for the adjusting sequence of plant genetic operation.

Along with the development in plant biological engineering field with can obtain more gene, exist bigger demand to using polygene to transform.These a plurality of foreign genes need be controlled by the adjusting sequence of separating usually.Some genes should be regulated by composing type, and other gene should be expressed in some etap or the position of genetically modified organism.Therefore, need various adjusting sequences with different-effect.

Another reason that needs various adjusting sequences is that undesired biochemical interaction may be owing to use identical adjusting sequence control to cause above a gene.For example, the conversion with multiple copied regulatory element can cause between two or more expression systems homologous recombination, owing to the reason of two very contiguous identical promoters of arranging in the opposite direction or enhanser copy causes between the formation of hairpin loop, the identical expression system in conjunction with competition on the common promotor specificity regulatory factor and because the incorrect expression level of foreign gene that the trans-effect of second promotor or enhanser causes.

Consider that based on these target of this area has been asserted the new adjusting sequence that detects and characterize the transgenosis control that is used for DNA construct.

For needing to separate and characterize preferred promotor of seed and terminator in the proterties that improves plant seed, described promotor and terminator can be used as the regulatory element of expressing isolating purpose nucleotide sequence in the preferred mode of seed.Especially, early stage caryogenesis is the critical stage of drought-induced fringe point abortion.Proved that the active storehouse that keeps phytocytomine is for keeping nucleus growth under compeling in of short duration arid association and growth is vital.In addition, help usually for example participating in the gene that ABA replys, keep in addition that cell is grown up and the splitted gene compels down reproductive development to be played keying action in association assisting the urgent gene of replying.Because the endosperm of commitment surrounds developmental embryo and for it provides nutrition, change the important target tissue that base table reaches so it has become.EEP1 and EEP2 promotor have satisfied the needs that instruct transgene expression in described early stage endosperm tissue.

By following description, it is more obvious that other target of the present invention, characteristic, advantage and aspect will become for a person skilled in the art.Yet, should be appreciated that following description and certain embodiments (although being expressed as the preferred embodiment of the invention) only provide in the mode of explanation.By reading the other parts of following description and present disclosure, to those skilled in the art, various variations in the spirit and scope of invention disclosed and modification will become apparent.

Description of drawings

Figure 1A-embryo: this figure shows that the preferred ipt overexpression of embryo increases phytokinin level, particularly ZR and the Z9G (scope is a 2-8 times of difference) of embryo.On the contrary, the Z level does not change, and IPAR did not detect in arbitrary etap.Abbreviation: Z=zeatin, ZR (or [9R] Z)=zeatin ribonucleoside, Z9G (or [[9G] Z]=zeatin-9-glucoside, IPA or [9R] iP=isopentenyl adenosine, IPAR (or [9R-5 ' P] iP)=isopentenyl adenosine-5 '-single phosphoric acid and DAP=pollination back fate.

Figure 1B-endosperm: this figure represents that the preferred ipt overexpression of embryo has changed phytokinin level in the endosperm, but is lower than the level (scope only is 10 to 30% differences) in the embryo.Among employed abbreviation such as Figure 1A.

Fig. 2 is illustrated in the fringe growth rate data that non-association compels D2F1 hemizygote plant under the condition.

Fig. 3 is illustrated in grain yield, check figure order, nuclear dry-matter and the spike length degrees of data that non-association compels D3F1 hemizygote plant under the condition.

Fig. 4 is illustrated in the plant height data that non-association compels D4F3 homozygote plant under the condition.

Fig. 5 is illustrated in the yield data that non-association compels D4F3 homozygote plant under the condition.

Fig. 6 provides non-association to compel the output composition data of D4F3 homozygote plant under the condition.

Fig. 7 provides the plant height data of the urgent D4F3 plant of arid association.

Fig. 8 provides the leaf green data of the urgent D4F3 plant of arid association

Fig. 9 provides the yield data of the urgent D4F3 plant of arid association

The phytomass of the increase of Figure 10 presentation of events TC15850.

Embodiment

Sequence table is described

1	Agro ipt(pnt)
		2	Agro ipt(ppt)
3	zag 2.1
		4	The CaMV35s enhanser
5	ZmMADS＝ZAP
		6	Promotor ckx1-2
7	eep1
		8	end2
9	lec1
		10	The F3.7 promotor

11	The GSP1 primer of eep1
		12	The GSP2 primer of eep1
13	The primer of eep1
		14	The primer of eep1
15	Clontech AP1 primer
		16	Clontech AP2 primer
17	The tb1 promotor
		18	The eep2 promotor
19	Trx1 or thxH promotor (Trx H)
		20	The Zm40 promotor
21	The GSP1 primer of eep2
		22	The GSP2 primer of eep2
23	mLIP15
		24	The ESR promotor
25	The PCNA2 promotor
		26	ZmCkx2 pnt
27	ZmCkx2 ppt
		28	ZmCkx3 pnt
29	ZmCkx3 ppt
		30	ZmCkx4 pnt
31	ZmCkx4 ppt
		32	ZmCkx5 pnt
33	ZmCkx5 ppt
		34	The ZmCkx2 promotor
35	The ZmCkx3 promotor
		36	The ZmCkx4 promotor
37	The ZmCkx5 promotor
		38	The primer that is used for the ipt gene isolation
39	The primer that is used for the ipt gene isolation

Nomenclature

Provide following illustrative to explain to help to understand particularly frequent in an embodiment some term that uses herein.Described explanation be for convenience and provide but do not limit the present invention.

Cytokine activity as used herein, comprises level and the sensation of plant pair cell mitogen and the level of replying of active cells mitogen in the plant.Therefore, phytokinin biosynthetic enzyme and phytokinin degrading enzyme are the examples that can regulate the enzyme of cytokine activity.The polynucleotide that " phytokinin regulatory gene " comprises encoding such enzymes and coding participate in the polynucleotide of the albumen (comprise with phytokinin and reply relevant transcription factor) that phytokinin sensation and plant reply.Exactly, " active cells mitogen storehouse " is meant at any time the accumulation of active cells mitogen in the part of cell or plant or whole plants.Downward modulation or the biosynthetic rise of phytokinin that stabilizing active phytokinin storehouse can relate to the phytokinin degraded or put together.

Phytokinin metabolic enzyme binding molecule as used herein, is meant specifically with phytokinin metabolic enzyme polypeptide of the present invention or polynucleotide combine or interactional molecule or ion, comprises, for example the substrate of enzyme, cell membrane component and classic receptor.Polypeptide of the present invention can be ad hoc at polypeptide of the present invention with the combination of this quasi-molecule (comprise and combining or interactional molecule), or but its high special ground is at polypeptide of the present invention, or but its high special ground is at the protein groups that comprises polypeptide of the present invention, but or its high special ground at several histones (wherein have one group at least and comprise polypeptide of the present invention).Binding molecule also comprise antibody and derive from antibody specifically with polypeptide bonded reagent of the present invention.

Phytokinin is replied component, as used herein, typically refer to and combine with phytokinin or interact, thereby cause in the cell or intercellular signal conduction or cause that one or more pair cell mitogens exist or do not exist or the cellular component of replying of level fluctuation.

Developmental plant seed as used herein, typically refers to the mother plant tissue that can produce plant seed after the pollination.This mother plant tissue comprises such tissue, and for example female Xiao Hua, ovary, aleuron, bennet and bennet form the zone.

Deleterious effect as common that understand and as used herein, is meant those significantly infringement or damage effects.Significant deleterious effect in the application's context, is meant the morphological change that productivity or vigor to plant produce clean negative effect.

Gene silencing is meant interferes the back of transcribing of genetic expression.For example, antisense, common inhibition and RNA (RNAi) this class technology of interfering have shown to gene silencing it is effective.(summary, referring to Arndt and Rank, Genome 40 (6): 785-797,1997; Turner and Schuch, Journal of Chemical Technology and Biotechnology 75 (10): 869-882,2000; Klink and Wolniak, Journal of Plant GrowthRegulation 19 (4): 371-384,2000).

Gene, as used herein, typically refer to the zone that comprises coded polypeptide or regulate and duplicate, transcribe or translate or to the polynucleotide of the polynucleotide region of expression considerable other process of polypeptide in host cell or comprise the zone of coded polypeptide and the polynucleotide in the zone that the adjusting that is operably connected with it is expressed.Gene can be contained in the carrier that duplicates as the additive type element; That is, as the molecule that physically is independent of the host cell gene group.It can be contained in the plasmid.Gene also can be contained in the genome of host cell; Except other,, for example separate, clone and import in the host cell with the DNA of purifying or the form that is contained in the carrier not with its native state but through operation.

Germplasm as used herein, is meant that a cover can be used for developing the hereditary entity of the procedure of breeding of new botanical variety.

High phytokinin transgenosis, so employed, be meant result as genetic recombination operation, be created in and have heritable increase on the phytokinin and/or the entity of the seed of heritable minimizing on growth hormone.

Host cell, as used herein, be transformed or transfection or can be transformed or cells transfected by the exogenous polynucleotide sequence." exogenous polynucleotide sequence " is defined as non-natural and is present in described cell or natural be present in the described cell but with different genetic locis, with different copy numbers or the sequence that exists under the different adjustment element instructs.

Identity and similarity as used herein with known in the art, are meant the mutual relationship between two peptide sequences or two polynucleotide sequences, as by as described in sequence determined.In the art, identity is also represented as the sequence degree of correlation between two polypeptide determining by the coupling between two chains of these sequences or two polynucleotide sequences.Identity and similarity can calculate easily all that (A.M. writes for Computational Molecular Biology, Lesk, Oxford University Press, New York, 1988; Biocomputing:Informatics and Genome Projects, Smith, D.W. writes, Academic Press, New York, 1993; Computer Analysis ofSequence Data, Part I, Griffin, A.M. and Griffin, H.G. writes, Humana Press, New Jersey, 1994; Sequence Analysis inMolecular Biology, von Heinje, G., Academic Press, 1987; With Sequence Analysis Primer, Gribskov, M. and Devereux, J. writes, M Stockton Press, New York, 1991).The method that generally is used for determining identity between two sequences or similarity includes, but are not limited at Carillo H. and Lipman, D., SIAM J.Applied Math., disclosed method among the 48:1073 (1988).Be used for preferably determining that the method for identity is designed to be tried to produce between the sequence maximum match at two.The method of determining identity and similarity is compiled to computer program.Determine that the general computer program means of identity and similarity comprises GCG between two sequences ^Routine package (Accelrys, Inc., San Diego, CA.; Devereux, people such as J. Nucleic Acids Research12 (1): 387 (1984)), BLASTP, BLASTN, FASTA and TFASTA (Atschul, people such as S.F., J.Mol.Biol.215:403 (1990)).

Isolating, as used herein, be meant that " by means of staff " changes from its native state; If i.e. its natural existence, it has been changed or has been taken out from its primal environment so, or either way takes place.For example, the naturally occurring polynucleotide or the polypeptide that are present in natively in the living organism with its native state are not " isolating ", but isolating identical polynucleotide or polypeptide are " isolating ", term as used herein from the material of its native state coexistence.For example, for polynucleotide, the isolating meaning of term is that it is separated from its naturally occurring karyomit(e) and cell.After an isolating part or separation, such polynucleotide can be connected to other polynucleotide, for example among the DNAs, for example to be used to carry out mutagenesis, with the formation fusion rotein, and are used in host's breeding or expression.Can with individually or be connected to other polynucleotide for example the isolating polynucleotide in the carrier import in host cell, culture or the whole biology.Such DNAs is after importing host cell, cultured tissue or whole biology, because do not exist with its naturally occurring form or environment, so remain isolating, term as used herein.Similarly, polynucleotide and polypeptide can be present in the composition, the substratum preparation or the solution that for example are used for transfered cell, or be used for the composition or the solution of chemistry or enzymatic reaction, described substratum or solution are not naturally occurring compositions, therefore, this polynucleotide or polypeptide are to keep isolating in the connotation scope of term as used herein.

Connect, as used herein, be meant the process that between two or more polynucleotide (modal is double-stranded DNA s), forms phosphodiester bond.The technology that is used to connect is known in this area, and the experimental technique that is used for connecting is described in the laboratory manual and the document of standard, people such as Sambrook for example, MOLECULAR CLONING, A LABORATORY MANUAL, second edition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, people such as New York (1989) and Maniatis, pg.146 quotes as following.

Low-level constitutive expression be meant gene basically plant in a organized way in and great majority or all etap to be lower than by the horizontal expression of the gene of CaMV35S promoters driven.The low-level constitutive expression of polynucleotide may be that the further contiguous enhancer element of described combination is the CaMV35s enhanser for example owing to may be operably coupled to for example F3.7 (SEQ ID NO:10) or form combination with the promotor that may be operably coupled to gene and cause of this expression promoter of driven.(referring to, Mol.Gen.Gen.261:635-643 (1999) for example) preferably in meristematic tissue, drive expression promoter for example zag2.1 (SEQ ID NO:3) also can provide low-level constitutive expression.

Oligonucleotide as used herein, is meant short polynucleotide.Described term typically refers to the strand deoxyribonucleotide, but in addition, it also can refer to strand or double-stranded ribonucleotide, RNA:DNA heterozygote and double-stranded DNA s.Oligonucleotide, for example the ssDNA probe oligonucleotide is synthetic by chemical process usually, is for example implemented on automatic oligonucleotide synthesizer.Yet oligonucleotide can pass through other prepared in various methods, comprises technology and the cell and the biological interior DNAs expression of extracorporeal recombinant DNA mediation.Originally, the DNAs of chemosynthesis acquisition does not have 5 ' phosphoric acid usually.5 ' end of this oligonucleotide is not the substrate that is used for forming by ligation phosphodiester bond, and the ligase enzyme that is generally used for forming recombinant DNA molecules is used in described ligation.In the place of wanting to connect this oligonucleotide, can for example use the technology of kinases and ATP to add phosphoric acid by standard technique.3 ' end of the oligonucleotide of chemosynthesis has the free hydroxyl usually, and ligase enzyme for example under the T4 dna ligase situation about existing easily with another polynucleotide for example 5 ' phosphoric acid of another oligonucleotide form phosphodiester bond.As everyone knows, when needed, optionally stop this reaction by the 5 ' phosphoric acid of before connection, removing another polynucleotide.

Be operably connected, as used herein, be meant the functional connection between promotor and second sequence, wherein said promoter sequence starts and mediation transcribing corresponding to the DNA of second sequence.Usually, the connected nucleotide sequence of expression that is operably connected is an adjacency, and, when needs connect two encoding histones zones, be adjacency and identical reading frame in.

Plant as used herein, comprises referring to complete plant, part or organ (for example, leaf, stem, root etc.), vegetable cell, seed and its offspring of plant.Vegetable cell, as used herein, further include, but not limited to available from or be found in: the cell of seed, suspension culture, embryo, meristematic tissue zone, callus, leaf, root, stem, gametophyte, sporophyte, pollen and sporule.Also can understand vegetable cell and comprise that adorned cell is for example available from the protoplastis of aforementioned tissue.Can be used for the wide usually higher plant kind that extremely can be suitable for transformation technology of floristics of the inventive method, comprise unifacial leaf and dicotyledons, comprise for example corn, soybean and low erucic acid mustard seed.

Plasmid, as used herein, herein usually according to standard naming rule well known to those skilled in the art with lowercase p beginning and/or then name with capitalization and/or numeral.Initial plasmid disclosed herein be commerce can obtain, obtainable publicly, maybe can be to use to come from obtainable plasmid construction by the routine of the open method known.Many plasmids that can use according to the present invention and other clone and expression vector are well-known and are acquisitions easily to the ability technician.In addition, those skilled in the art can easily make up other plasmid that many present invention of being suitable for use.According to disclosure of the present invention, characteristic, structure and the purposes of these plasmids and other carrier are apparent to those skilled in the art among the present invention.

Polynucleotide as used herein, typically refer to any polyribonucleotide or polydeoxyribonucleotide, and it can be RNA or DNA or the adorned RNA or the DNA of unmodified.Thereby, in addition, for example, polynucleotide as used herein be meant strand and double-stranded DNA, as DNA, strand and the double-stranded RNA of the mixture in strand and double-stranded region or strand, two strands and three chain zones with as the RNA of the mixture of strand and double-stranded region, comprise and can be strand or more generally be double-stranded or three chains or the DNA of strand and double-stranded region mixture and the hybrid molecule of RNA.In addition, polynucleotide used herein are meant the three chain zones that comprise RNA or DNA or RNA and DNA.Chain in this zone can be from same molecular or from differing molecular.Described zone can comprise complete one or more molecules, but the more general zone that includes only some molecules.One of the molecule in triple helical zone is oligonucleotide normally.As used herein, the term polynucleotide comprise above-mentioned DNAs that contains one or more modified bases or RNAs.Therefore, also be that term is wanted " polynucleotide " of expressing herein because stability or other reason have the DNAs of modified main chain or RNAs.In addition, comprise unconventional base for example inosine or modified base for example the DNAs of tritylation base or RNAs (only for two examples) are expressed polynucleotide of term as used herein.Will be appreciated that DNA and the RNA with the known purpose of many those skilled in the art carried out a large amount of various modifications.Term polynucleotide used herein comprise the polynucleotide of this chemistry, enzymatic or metabolism modified forms, and virus and cell particularly comprise simply and the characteristic DNA of complex cell and the chemical species of RNA.

Polypeptide as used herein, comprises all polypeptide that describe below.The basic structure of polypeptide is well-known, and is described in a large amount of textbooks of this area and publication.In the present context, term used herein is meant and anyly comprises two or more by peptide bond interconnective amino acid whose peptide and albumen on linear chain.As used herein, described term is meant the short chain that is also referred to as for example peptide, oligopeptides and oligomer in this area and refers to be known as proteic longer chain in this area usually that described albumen has numerous species.Will be appreciated that polypeptide comprises usually except being generally known as 20 kinds of amino acid naturally occurring amino acid whose 20 seed amino acids, and many amino acid (comprising end amino acid) can be modified in given polypeptide, not only for example process with other posttranslational modification and modified by natural process, also can be by technology well known in the art by chemically modified.To such an extent as to even the natural common modification that is present in the polypeptide all can not be listed too much fully herein, but in basic reader and more detailed monograph and a large amount of research document, it has been carried out good description, and they are known to one skilled in the art.The known modification (for the illustrative example of minority) that wherein can be present in the polypeptide of the present invention is acetylize; acidylate; ADP ribosylation; amidation; the covalent attachment of flavine; the covalent attachment of heme moiety; the covalent attachment of Nucleotide or nucleotide derivative; the covalent attachment of lipid or lipid derivant; the covalent attachment of phosphatidylinositols; crosslinked; cyclisation; form disulfide linkage; demethylation; form covalent cross-linking; form Gelucystine; form Pyrrolidonecarboxylic acid; formylation; gamma-carboxylation; glycosylation; form the GPI grappling; hydroxylation; iodate; methylate; myristoylization; oxidation; proteolysis processing; phosphorylation; isoprenylation; racemization; selenizing; sulfation; the interpolation amino acid in albumen of transfer RNA mediation is arginylization and ubiquitination for example.These modifications are known for a person skilled in the art, and have carried out very detailed description in a large amount of scientific literatures.Several common especially modifications, for example glycosylation, lipid are adhered to, gamma-carboxylation, hydroxylation and the ADP-ribosylation of sulfation, glutaminic acid residue are described in the most basic textbook, PROTEINS-STRUCTUREAND MOLECULAR PROPERTIES for example, second edition, T.E.Creighton, W.H.Freeman and Company, New York (1993).Can obtain the detailed summary of many relevant these themes, for example by Wold, F. POSTTRANSLATIONAL COVALENTMODIFICATIONOFPROTEINS, B.C.Johnson, Ed., Academic Press, the Posttranslational Protein Modifications:Perspectives and Prospects among the New York (1983), 1-12 page or leaf; People's such as people's such as Seifter Meth.Enzymol.182:626-646 (1990) and Rattan Protein Synthesis:Posttranslational Modifications and Aging, the summary that Ann.N.Y.Acad.Sci.663:48-62 (1992) provides.Will be appreciated that, as point out above with well-known, polypeptide is always fully linear.For example, because the result of ubiquitination, polypeptide can be a ramose, and usually owing to translate the result of back incident (incident that manual operation produces of passing through that comprises the existence of natural process incident and non-natural), they can be to have or do not have the ramose annular.Equally, can be by the untranslated natural process with by complete synthetic method synthetic annular, ramose and branch's annular polypeptide.Modification can occur in any position of polypeptide, comprises peptide main chain, amino acid side chain and amino or C-terminal.In fact, amino by covalent modification sealing polypeptide or carboxylic group or both in naturally occurring and synthetic polypeptide be very general just, and this class is modified and equally also can be present in the polypeptide of the present invention.For example, in the proteolysis first being processed, the n terminal residue of the polypeptide that produces in intestinal bacteria (E.coli) or other cell is N-formylmethionine always almost.In the posttranslational modification process of peptide, NH ₂-terminal methionine residues can be removed.Therefore, the present invention expects and of the present inventionly proteicly contains methionine(Met) and lack the purposes of the aminoterminal variant of methionine(Met).Betide and modify normally its function how to produce on the polypeptide.For example, for the polypeptide by the preparation of cloning by expression gene in the host, the nature and extent of modification depends on the modification ability and the modification signal that is present in the polypeptid acid sequence after the host cell translation to a great extent.For example, well-known glycosylation does not betide host bacterium for example in the intestinal bacteria usually.Therefore, when wanting glycosylated the time, polypeptide should be expressed in carrying out glycosylated host (normally eukaryotic cell).Similar consideration may be used on other modification.The modification of recognizing same type can exist with identical or variable degree in several sites of given polypeptide.Equally, given polypeptide can contain the modification of many types.Generally speaking, as used herein, the term polypeptide comprises all these modifications, particularly is present in the modification on the synthetic polypeptide by express polynucleotide in host cell.

Promotor as used herein, comprises from the upstream of transcription initiation site and the DNA zone that participates in identification and transcribe with startup in conjunction with RNA polymerase and other albumen." plant promoter " is meant and can starts the promotor of transcribing in vegetable cell.Exemplary plant promoter includes but not limited to, available from plant, plant virus and the bacterium that is included in the gene of expressing in the vegetable cell promotor of edaphic bacillus and root nodule bacterium (Rhizobium) for example.Comprise preferably at some tissue at the example of growing the promotor under the control, for example leaf, root or seed or spatially be positioned on the zone in for example endosperm, embryo or meristematic tissue zone and start the promotor of transcribing.This class promotor is called as " tissue is preferred ".Only in certain tissue, start the promotor of transcribing and be called " tissue-specific ".The promotor of being regulated in time is on the specific time, and for example the pollination back drove and expresses in 0-25 days." cell type is preferred " promotor is some cell type in one or more organ mainly, for example drives in the dimension tube cell in root or the leaf and expresses." induction type " promotor is under environment control and the promotor that can be induced or derepress.The example of the envrionment conditions that can transcribe by inducible promoter influence comprises the existence of anaerobic condition or illumination.Tissue specificity, tissue are preferred, the promotor of cell type specificity and induction type has constituted " non-composing type " and started subclass." composing type " promotor is under most envrionment conditionss and in all or nearly all tissue, in all or nearly all etap active promotor of tool all.

Recombinant expression cassettes as used herein, is meant the nucleic acid construct with specific genetic elements that a series of permission specific nucleic acids transcribe in host cell, described nucleic acid construct is by reorganization or synthetic the generation.Described recombinant expression cassettes can be integrated in plasmid, karyomit(e), Mitochondrial DNA, plastid DNA, virus or the nucleic acid fragment.Usually, except other sequence, the recombinant expression cassettes of expression vector partly comprises the nucleic acid and the promotor of being transcribed and can randomly comprise extra element, for example enhanser.

Relevant female reproductive tissue as used herein, comprises before the pollination or the mother plant tissue after the pollination, and for example female Xiao Hua, ovary, aleuron, bennet and bennet form the zone.Seed tissue also can be called as " cereal initial body " or " seed initial body " before the pollination.

Transforming, as used herein, is when foreign DNA has been imported in the cytolemma, the method that cell is transformed by described foreign DNA.Foreign DNA can or can not be integrated (covalently bound) and goes into to form in the chromosomal DNA of cellular genome.For example, in prokaryotic organism and yeast, described foreign DNA can remain on the additive type element for example on the plasmid.As for higher eucaryotic cells, thus stable conversion or cells transfected be on the karyomit(e) that foreign DNA has been integrated into wherein so that foreign DNA by chromosome duplication by the cell of daughter cell heredity.Verify this stability by eukaryotic cell foundation by the clone of the daughter cell group one-tenth that contains foreign DNA or clone's ability.

Polynucleotide or variant polypeptides, term is polynucleotide or the polypeptide that is different from respectively with reference to polynucleotide or polypeptide as used herein.In this sense, variant is able to more detailed description with other place of present disclosure below.For polynucleotide, difference is normally limited, thereby the nucleotide sequence of reference and variant is quite similar on the whole, and is identical in many zones.As following pointed, the variation of variant nucleotide sequence may be reticent; That is to say that they can not change the amino acid by described nucleotide coding.When change was restricted to such reticent variation, variant had coding the polypeptide of the aminoacid sequence identical with reference.In other cases, as following pointed, the change of the nucleotide sequence of variant can change the amino acid sequence of polypeptide by the reference polynucleotide encoding.As discussed below, this Nucleotide variation can cause one or more amino acid replacements, interpolation, disappearance, fusion and brachymemma in by the canonical sequence encoded polypeptides.For variant polypeptide, difference is normally limited, thereby the sequence of reference and variant is quite similar generally, and is identical in many zones.Variant with reference to polypeptide on aminoacid sequence can by one or morely substitute, interpolation, disappearance, fusion and brachymemma cause differently, described variation can exist with arbitrary combination.

Plant vigor, as used herein, be meant health, productivity and plant and/or the certain plants speed of growth partly relatively, and can be reflected in the various growth contributions, described contribution includes but not limited to chlorophyll concentration, photosynthetic rate, total biomass, root biomass, grain quality and/or grain yield.Particularly in corn, vigor also can be reflected in the extent of fringe growth velocity, fringe size and/or fringe silk.Can determine the vigor of different genotype under the similar envrionment conditions or under the varying environment condition, determine identical or different genotypic vigor.

Yielding stability, as known in the art with used herein, be meant in all environment (comprise association compel environment) given genotypic consistent output down to show.

Detailed Description Of The Invention

The present invention partly relate to be used for regulating the plant cytokine activity (comprise the cell fission plain gene in seed and relevant female reproductive tissue time and/or the expression on the space) nucleic acid construct and relevant polynucleotide and polypeptide, these polynucleotide and variant polypeptides, be used to prepare the method for these polynucleotide and these polypeptide and its variant and derivative, the agonist of described polypeptide and antagonist, the product that comprises these polynucleotide and polypeptide and its variant and derivative, with these polynucleotide, polypeptide, variant, derivative, the purposes of agonist and antagonist and comprise these polynucleotide, polypeptide, variant, derivative, the purposes of the product of agonist and antagonist.Particularly aspect these and other, the present invention relates to the polynucleotide of phytokinin pathways metabolism and polypeptide (comprising their gene of ipt enzyme and cytokinin oxidase and coding) and its individually or in combination with one another and/or with many other the isolating polynucleotide of cytokine activity and purposes of polypeptides in combination of influencing.Described by the expression of the raising plant vigor of target and seed production and regulated.

As mentioned above, the invention provides with enhanced cell mitogen activity is the necessary reagent of growth of the transgenic plant of feature.As used herein, phrase " cytokine activity " is a relative reactivity, and is meant and does not contain the cytokine activity that the genetically modified control plant that influences phytokinin is compared with the genetically modified plant with this performance function.Also can only use transgenic plant to measure level relatively, but will existed by preliminary operation genetic expression and non-existent situation under measure.Therefore, any structure gene can be used in the practice of the present invention, and the expression of the adjusting of described structure gene has the effect of (particularly in seed) increase cytokine activity in plant.Guidance plays the gene (for example, ipt or tzs) of increase phytokinin biosynthesizing effect or the gene (its expression is suppressed) of Codocyte mitogen degrading enzyme can be used in the practice of the present invention.Yet the present invention also expects the purposes of other gene.Except the gene that influences the phytokinin abswolute level, also can use the gene of the ratio that influences phytokinin and growth hormone.The gene that reduces growth hormone for example iaa-1 and gene-5 also can be used in the practice of the present invention.In addition or selectively, being regulated by the expression of the separation polynucleotide of target to provide enhanced as the cytokine activity of definition herein, and described polynucleotide encoding participates in the polypeptide of phytokinin identification and cell response.Also expect the combination (comprising the variation in expressing of one or more phytokinin regulatory gene) of these methods.

As mentioned above,, describe in detail more, the invention still further relates to its construct of polynucleotide of new phytokinin metabolism polypeptide and coding as following except that other.The polypeptide that is used for the present invention's practice especially includes but not limited to ipt and cytokinin oxidase.The nucleic acid and the fragment thereof of above-mentioned enzyme of encoding can be used for producing enzyme productivity transgenosis.For example, individual gene or gene fragment (or combination of several genes) can be integrated into the suitable expression cassette 27kd γ zein promotor of promotor or seed endosperm preferred expression (use the sphaeroprotein-1[glb1 that for example is used for the embryo preferred expression]), and be transformed in the corn with suitable selective marker (for example BAR and pat gene).What some embodiment comprised the polynucleotide that may be operably coupled to Codocyte mitogen biosynthetic enzyme drives expression promoter in the female reproduction meristematic tissue.The example that is used for the promotor of this embodiment comprises zag2.1, Zap (being also referred to as ZmMADS), tb1 and PCNA2, as shown in SEQ ID NOS:3,5,17 and 25.

In some cases, reticent or reduce some gene, for example cytokinin oxidase is preferred.Describing the reticent pertinent literature of using of homology dependent gene comprises: Jorgensen, Trends Biotechnol.8 (12): 340-344 (1990); Flavell, Proc.Nat ' l.Acad.Sci. (USA) 91:3490-3496 (1994); People such as Finnegan, Bio/Technology12:883-888 (1994); People such as Neuhuber, Mol.Gen. Genet.244:230-241 (1994); People such as Flavell, (1994) Proc.Natl.Acad.Sci.USA 91:3490-3496; People such as Jorgensen, (1996) Plant Mol.Biol.31:957-973; Johans en and Carrington (2001) Plant Physiol.126:930-938; People such as Broin, (2002) Plant Cell 14:1417-1432; People such as Stoutjesdijk, (2002) Plant Physiol.129:1723-1731; People such as Yu, (2003) Phytochemistry 63:753-763; With U.S. Patent number 5,034,323,5,283,184 and 5,942,657.Selectively, another method that produces gene silencing be can use antisense technology (people such as Rothstein, Plant Mol.Cell.Biol.Among the 6:221-246 (1989); People such as Liu (2002) Plant Physiol.129:1732-1743 and U.S. Patent number 5,759,829 and 5,942,657).Be used to reduce the method for cytokinin oxidase expression and the common unsettled U.S. Provisional Patent Application that construct is described in submission on April 2nd, 2004: Cytokinin Oxidase-Like Sequences and Methods of Use, 60/_ _ _ _ _ _ _ _ _.

Some embodiment can comprise the cytokine activity of phytokinin degraded to cause improving of the phytokinin biosynthesizing and the minimizing of increase simultaneously.

Polynucleotide

According to an aspect of the present invention, isolating polynucleotide SEQ ID NOS:26,28,30 and 32 is provided, described isolating polynucleotide encoding phytokinin metabolic enzyme maize cell mitogen oxydase, what have derivation is shown as SEQ ID NOS:27,29,31 and 33 aminoacid sequence herein, as the common unsettled provisional application of submitting on April 2nd, 2004: Cytokinin Oxidase-Like Sequences and Methods of Use, 60/_ _ _ _ _ _ _ _ _ in disclosed; With the maize cell mitogen oxydase of SEQ ID NO:38, coding SEQ ID NO:39, as in United States Patent (USP) 6,229,066 and WO99/06571 in disclosed.The present invention also expect the coding ipt (prenyltransferase) isolating polynucleotide (as in Molecular and General Genetics 216:388-394 (1989), provide and provide as SEQ ID NO:1 herein, its derivation aminoacid sequence is SEQ ID NO:2) purposes, and separate from other biology phytokinin biosynthesis gene (for example, purposes ipt) of Arabidopis thaliana or corn for example.

According to an aspect of the present invention, the isolating Agrobacterium tumefaciens polynucleotide SEQ ID NO:1 of sequences encoding isopentenyl transferase and its deduced amino acid SEQ ID NO:2 are provided (people such as Strabala, Mol.Gen.Genet.216,388-394 (1989); GenBankAccession X14410); Corn Zag2.1 promotor, SEQ ID NO:3 (GenBankX80206); CaMV 35s enhanser, SEQ ID NO:4; Corn Zap promotor, SEQ IDNO:5 (is also referred to as ZmMADS; U.S. Patent application 10/387,937; WO 03/078590); Corn ckx1-2 promotor, SEQ ID NO:6 (U.S. Patent Publication 2002-0152500 A1; WO 02/0078438); Corn eep1 promotor, SEQ ID NO:7 (U.S. Provisional Patent Application 60/460,718); Corn end2 promotor, SEQ ID NO:8 (United States Patent (USP) 6,528,704 and U.S. Patent application 10/310,191); Corn lec1 promotor, SEQ IDNO:9 (U.S. Patent application 09/718,754); Corn F3.7 promotor, SEQ ID NO:10 (people such as Baszczynski, Maydica 42:189-201 (1997); Corn tb1 promotor, SEQ ID NO:17 (December 2002 for people such as Hubbarda, Genetics 162:1927-1935); Corn eep2 promotor, SEQ ID NO:18, corn Trx H promotor, SEQ ID NO:19, U.S. Provisional Patent Application 60/514,123); Corn Zm40 promotor, SEQ ID NO:20 (United States Patent (USP) 6,403,862 and WO 01/2178); Corn mLIP15 promotor, SEQ ID NO:23 (United States Patent (USP) 6,479,734); Corn ESR promotor, SEQ ID NO:24 (U. S. application 10/786,679 that on February 25th, 2004 submitted to); Corn PCNA2 promotor, SEQ ID NO:25 (U.S. 10/388,359 that on March 13rd, 2003 submitted to); Maize cell mitogen oxydase and promotor, SEQ ID NOS:26-37 (the common unsettled provisional application that on April 2nd, 2004 submitted to, CytokininOxidase-Like Sequences and Methods of Use, 60/_ _ _ _ _ _).

Based on Arabidopis thaliana in instruct the homology of the AGAMOUS gene of flower development to isolate the ZAG2 gene of corn.(people such as Schmidt, Plant Cell 5 (7): 729-737,1993) ZAG2 mainly expresses in developmental female Xiao Hua usually.5 ' the sequence of ZAG2 encoding sequence and about 2.1kb was preserved among the GenBank with recording mechanism X80206 September nineteen ninety-five.The part in ZAG25 ' zone is SEQ ID No:3 herein and is called as the ZAG2.1 promotor.

Use information provided herein, the polynucleotide sequence that for example provides below is by clone who uses standard and the polynucleotide of the present invention that screening method can obtain Codocyte mitogen metabolic enzyme polypeptide.For by using dna sequence dna given below to obtain the polynucleotide of proteins encoded, can synthesize and known polynucleotide sequence complementary Oligonucleolide primers.These primers can be used for then from the PCR of the described polynucleotide of template amplification, described template derives from mRNA or the genomic dna that separates from the source material of wanting.The extension amplification outcome of gained can be gone into then in the cloning vector that commerce buys, for example from the TA serial carrier of InVitrogen.By using sequencing primer that single clone is checked order, may on both direction, extend described sequence then to determine the full gene sequence according to the original series design.Carry out sort sequencer by using preparation from the denatured double stranded dna of plasmid clone.Suitable technique is described in Maniatis, T., Fritsch, E.F. and Sambrook, J. MOLECULAR CLONING, (second edition, 1989 Cold Spring Harbor Laboratory. see among the SequencingDenatured Double-Stranded DNA Templates 13.70 A LaboratoryManual.

The separation of ipt gene

Prenyltransferase of the present invention (ipt) can obtain from include but not limited to corn, Agrobacterium, Sa Shi pseudomonas (Psuedomonas savsstano), Rhod (Rhodococcus) and erwinia (Erwinia).Strabala, people's such as T.J. Isolation and characterization of an ipt gene from theTi plasmid Bo542, Mol.Gen.Genet.216,388-94 (1989) provides the complete sequence of ipt gene.Can use the DNA synthetic method that the synthetic those of skill in the art of gene are known by the synthetic copy for preparing this gene.Selectively, can directly from the biology that carries the ipt gene, separate described gene copy, for example, quote as a reference herein by the clone of the PCR described in WO 00/63401.

Polynucleotide of the present invention can exist with the form of RNA (for example mRNA) or with the form of DNA (comprising for example cDNA and genomic dna), and described polynucleotide can obtain or obtain by chemical synthesising technology or by its combination by the clone.Described DNA can be two strands or strand.Single stranded DNA can be a coding strand, is also referred to as sense strand, or it can be noncoding strand, is also referred to as antisense strand.

The encoding sequence of coded polypeptide can be identical with the encoding sequence of the polynucleotide that show below.It also can be the polynucleotide with polypeptide that not homotactic coding shows below, and described different sequences are because the redundancy (degeneracy) of genetic code causes.More fully discuss as following, these selectable encoding sequences are to be used for the optimized important sequence of password source.

The polynucleotide of the present invention of listed polypeptide can include, but not limited to the encoding sequence of mature polypeptide self below the coding; The encoding sequence of mature polypeptide and extra encoding sequence, the sequence of for example encode leader sequence or secretion sequence ((pre-) or former (pro-) or preceding former (prepro-) protein sequence for example); The encoding sequence of mature polypeptide (having or do not have aforementioned extra encoding sequence) is together with extra non-coding sequence, described extra non-coding sequence for example comprises, but be not limited to noncoding 5 ' and 3 ' sequence, for example transcribing the non-translated sequence that (for example comprising termination signal), rrna are transcribed in conjunction with the quilt that works in, the mRNA stability element, with the coding additional amino acid, for example provide the amino acid whose extra encoding sequence of additional functionality.

Described DNA also can comprise the promoter region that plays the function that the DNA that instructs coding allos phytokinin regulatory enzyme of the present invention transcribes.Allos is defined as and is not the sequence that exists with described promoter sequence natively.Although described nucleotide sequence is allogenic for promoter sequence, its can with described plant host homology (natural) or allos (external source).

In addition, described polypeptide and flag sequence merge, and described flag sequence is the peptide that for example helps the described fusion polypeptide of purifying.In the present invention's some embodiment aspect this, described flag sequence is six Histidine peptides, and for example (Qiagen, Inc.) and the mark that provides of PET serial carrier (Novagen), wherein, many marks are commercial obtainable to the pQE carrier.For example, as people such as Gentz Proc.Nat ' l.Acad.Sci., (USA)Described in the 86:821-824 (1989), six Histidines provide convenience for purified fusion protein.For example, people such as Wilson described in Cell 37:767 (1984), and the HA mark also can be used for generating fusion rotein and corresponding to the epi-position that derives from influenza hemagglutinin protein.

According to aforementioned, term " polynucleotide of coded polypeptide " comprises and contains code book invention polypeptide as used herein, particularly has the polynucleotide of sequence of the phytokinin regulatory enzyme of following listed aminoacid sequence.Described term comprises the polynucleotide of the single successive zone of containing coded polypeptide or discontinuity zone (phage that for example, is integrated or insertion sequence or editor interrupt) and additional areas (coding and/or non-coding sequence also can be contained in described zone).

The variant of the polynucleotide of the present invention of fragment, analogue and the derivative of the polypeptide that the invention further relates to encodes has following deduced amino acid.The variant that the variant of polynucleotide can exist natively, for example naturally occurring allele variant, or it can be the variant that known non-natural exists.The variant that the non-natural of this polynucleotide exists can comprise the technology preparation that is applied to polynucleotide, cell or organ by the sudden change generation technique.

Wherein, variant is owing to substitute, lack or add the variant that is different from aforementioned polynucleotide of generation in this.Described substituting can comprise one or more polynucleotide.Described variant can all change at coding or non-coding region or two districts.Change on the coding region can produce conservative or non-conserved amino acid substitutes, lacks or adds.

Wherein, embodiment of the present invention is polynucleotide, its variant, analogue, derivative and the fragment that coding has the polypeptide of following listed aminoacid sequence in this.

In this, further be coding have following amino acid sequences (have in the described sequence several, a few, 1 to 10,1 to 5,1 to 3,2,1 or do not have amino-acid residue and stand the substituting of any combination, disappearance or add) variant, analogue, derivative and the fragment of phytokinin biosynthetic enzyme and the polynucleotide of described segmental variant, analogue and derivative.Wherein, these polynucleotide are to comprise the character and the active silence that do not change the phytokinin biosynthetic enzyme to substitute, add and disappearance; Conservative alternate polynucleotide and coding have the polynucleotide of following amino acid sequences, no alternate polypeptide.

Further embodiment of the present invention comprise polynucleotide (described polynucleotide have greater than 79%, 80% or 85% identity with the polynucleotide that the aminoacid sequence that provides below is provided coding at least at least) and with these polynucleotide complementary polynucleotide.In addition, some embodiment is following polynucleotide, and described polynucleotide encoding keeps basic identical or even the polypeptide that increases of performance with being compared by the mature polypeptide of the polynucleotide encoding that provides below on biological function or activity.

The invention further relates to and the polynucleotide of above-mentioned sequence hybridization herein.In this, The present invention be more particularly directed under stringent condition and the polynucleotide of above-mentioned multi-nucleotide hybrid herein.As used herein, term " stringent condition " is meant to have only when having at least 80% identity between the sequence and just can hybridizes.

Term " stringent condition " or " stringent hybridization condition " but be meant probe and the hybridization of its target sequence reaches the detection level that is higher than with other sequence hybridization residing condition when (for example, being higher than 2 times of backgrounds at least).Stringent condition is sequence dependent and different under different environment.By the strict degree of control hybridization and/or wash conditions, can identify and probe 100% complementary target sequence (homology detection).Selectively, stringent condition can tune to and allows some sequence mispairing, so that detect the more similarity of low degree (allos detection).Usually, probe on length less than about 1000 Nucleotide, on length often less than 500 Nucleotide.

Usually, stringent condition is that salt concn is lower than about 1.5M Na ion, usually be about 0.01 to 1.0M in pH 7.0 to 8.3 o'clock Na ionic concn (or other salt), and (for example for short probe, 10 to 50 Nucleotide) temperature is about 30 ℃ and be about 60 ℃ at least for long probe (for example, greater than 50 Nucleotide) temperature at least.Stringency also can realize by adding destabilizing agent such as methane amide.Exemplary low stringency condition comprises that buffered soln with 30 to 35% methane amides, 1M NaCl, 1%SDS (sodium lauryl sulphate) is in hybridizing under 37 ℃ and washing under 50 to 55 ℃ in 1X to 2XSSC (20XSSC=3.0M NaCl/0.3M trisodium citrate).Exemplary medium stringent condition is included among 40 to 45% methane amides, 1M NaCl, the 1%SDS in hybridizing under 37 ℃ and washing under in 55 to 60 ℃ in 0.5X to 1XSSC.Exemplary high stringent condition is included among 50% methane amide, 1MNaCl, the 1%SDS in 37 ℃ of hybridization and in 60 to 65 ℃ of washings down in 0.1XSSC down.

Specificity is the function of post-hybridization washing normally, and key factor is the ionic strength and the temperature of last washing soln.For DNA-DNA hybridization, can be approx from Meinkoth and Wahl, Anal.Biochem., the equation among the 138:267-284 (1984): T _m=81.5 ℃+16.6 (logM)+0.41 (%GC)-0.61 (% methane amide)-500/L calculates and obtains T _mWherein M is the molarity of univalent cation, and %GC is the per-cent of guanosine and cytidylic acid(CMP) among the DNA, and % formyl ammonia is that the per-cent and the L of methane amide in the hybridization solution is the length of heterozygote in the base pair.T _mTemperature (under ionic strength of determining and pH) when being 50% complementary target sequence with abundant paired probe hybridization.The mispairing T of every generation 1% _mJust descend about 1 ℃; Therefore, T _m, hybridization and/or wash conditions can tune to and be fit to and the sequence hybridization with identity of wanting.For example, has 〉=sequence of 90% identity T if seek _mCan descend 10 ℃.Usually under ionic strength of determining and pH, select specific heat melting temperature(Tm) (T _m) low about 5 ℃ stringent condition is used for specific sequence and its complementary sequence.Yet the height stringent condition can be at specific heat melting temperature(Tm) (T _m) hybridize on low 1,2,3 or 4 ℃ the temperature and/or wash; Medium stringent condition can be at specific heat melting temperature(Tm) (T _m) hybridize on low 6,7,8,9 or 10 ℃ the temperature and/or wash; Low stringency condition can be at specific heat melting temperature(Tm) (T _m) hybridize on low 11,12,13,14,15 or 20 ℃ the temperature and/or wash.By the T that uses described equation, hybridization and cleaning composition and want _m, it will be understood by those skilled in the art that the variation on the strict degree that to describe hybridization and/or washing soln inherently.If the mispairing degree of wanting causes T _mBe lower than 45 ℃ (aqueous solution) or 32 ℃ (formamide soln), so preferably increase SSC concentration so that can use higher temperature.Hybridization and/or wash conditions can be used 10,30,60,90,120 or 240 minutes at least.At the Laboratory of Tijssen Techniques in Biochemistry andMolecular Biology-Hybridization with Nucleic Acid Probes, part 1, the 2nd chapter " Overview of principles of hybridization and thestrategy of nucleic acid probe assays ", Elsevier, New York (1993); With Current Protocols in Molecular Biology, the 2nd chapter, people such as Ausubel write, and Greene Publishing and Wiley-Interscience can find the detailed description of nucleic acid hybridization among the New York (1995).

For example, as the other discussion of measuring about polynucleotide of the present invention herein, polynucleotide of the present invention as discussed above can be used as the probe of RNA, cDNA and genomic dna, separating the full-length cDNA s and the genomic clone of Codocyte mitogen biosynthetic enzyme, and separate cDNA and the genomic clone that has with other gene of described gene height sequence similarity.This probe generally includes about 15 to 50 bases.

Polynucleotide of the present invention and polypeptide can be used as research reagent and the material of the transgenic plant that are used to find to have the cytokine activity of being regulated.Be used as the PCR primer in the method that polynucleotide of the present invention (it is the oligonucleotide that derives from following sequence) can be described herein, whether intactly or partly in phytokinin accumulation tissue, transcribe to determine certified genes identified herein herein.

The ripe albumen of described polynucleotide codified adds extra amino or C-terminal amino acid or inserts the amino acid whose polypeptide of mature polypeptide inside (for example, when ripe form has the polypeptide chain of surpassing).Except that other, this sequence can play a role in that albumen is machined to the mature form from precursor, can allow the albumen transportation, can prolong or shorten proteic transformation period or available help operation albumen to measure or to produce.As common in vivo situation, described additional amino acid can be processed from maturation protein by intracellular enzyme and to be removed.

Having the precursor protein that is merged to the mature form of the polypeptide of one or more sequences former (prosequence) can be the inactive form of described polypeptide.When sequence is former be removed after, this inactive precursor is activated usually.Before activation, part or all of precursor sequence can be removed.Usually, this precursor is called as proteinogen (proprotein).

In a word, the ripe albumen of polynucleotide codified of the present invention, maturation protein add leader sequence (it can be described as proteinogen), have the former maturation protein precursor of the sequence of one or more non-proteinogen leader sequences or have leader sequence and the precursor of the proteinogen of one or more sequence former (can be removed in the procedure of processing of the described polypeptide that produces active and mature form usually), i.e. preproprotein.

Polypeptide

The invention further relates to polypeptide with following deduced amino acid.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides or synthetic polypeptide.In certain embodiments, it is a recombinant polypeptide.

The present invention also relates to fragment, analogue and the derivative of these polypeptide.When relating to described polypeptide, term " fragment ", " derivative " and " analogue " are meant at least 90%, at least 95% or essentially identical biological function or the active polypeptide that maintains these polypeptide.Therefore, comprise can be by the former part of scinderin to produce the proteinogen that active mature polypeptide is activated for analogue.Wherein, embodiment of the present invention are polypeptide, its variant, analogue, derivative and fragment and described segmental variant, analogue and the derivative with the phytokinin regulatory enzyme aminoacid sequence that provides below in this.

The fragment of following polypeptide, derivative or analogue can be (i) wherein substitutes one or more amino-acid residues with conservative or nonconservative amino-acid residue (preferably Bao Shou amino-acid residue) polypeptide, and this replaced amino-acid residue can be or can be not by genetic code amino acids coding residue, or (ii) wherein one or more amino-acid residues include substituent polypeptide, or (iii) wherein mature polypeptide and another compound, the compound that for example increases the described polypeptide transformation period (for example, polyoxyethylene glycol) polypeptide of Rong Heing, or (iv) wherein additional amino acid (for example leading or secretion sequence or be used for the sequence or the proteinogen sequence of purifying mature polypeptide) merged polypeptide to mature polypeptide.These fragments, derivative and analogue it is believed that by those skilled in the art and obtain according to instruction herein.

Wherein, preferred variant is to substitute from reference substance by conserved amino acid to change the variant of coming.These substitute is to have amino acid whose substituting given in the amino acid replacement polypeptide of similar features by another.Usually be counted as conservative alternate and be in aliphatic amino acid Ala, Val, Leu and Ile one to substituting between the exchange of substituting between exchange, amide residues Asn and the Gln of exchange, acidic residues Asp and the Glu of another substitute, hydroxyl residue Ser and Thr, alkaline residue Lys and Arg and aromatic moieties Phe, Tyr.

In this, further particularly preferably be variant, analogue, derivative and fragment and described segmental variant, analogue and derivative with following aminoacid sequence, in described aminoacid sequence, have several, a few, 1 to 10,1 to 5,1 to 3,2,1 or do not have amino-acid residue through the substituting of any combination, disappearance or add.Particularly preferably being the characteristic and the active silence that do not change the phytokinin biosynthetic enzyme in the middle of these substitutes, adds and disappearance.Particularly preferably being conservative in this equally substitutes.The polypeptide that does not have the alternate aminoacid sequence below most preferably having.

Polypeptide of the present invention and polynucleotide preferably provide with isolating form, and can be purified to homogeneity.

Carrier, host cell, expression

The present invention also relates to comprise polynucleotide of the present invention carrier, comprise the host cell of carrier of the present invention and produce polypeptide of the present invention by recombinant technology.

Carrier

According to this aspect of the invention, described carrier can be for example plasmid vector, strand or double stranded phage carrier, strand or double-stranded RNA or dna viral vector.By being used for of knowing can be with the technology of DNA and RNA transfered cell with these carriers as in polynucleotide (particularly DNA) transfered cell.Under the situation of phage and virus vector, also can be by the technology of knowing that is used for transfection and transduction with described carrier importing with preferably with viral transfered cell parcel or capsidation.Virus vector can be have a replication or replication defect type.In the latter case, Bing Du breeding can only take place in the complementary host cell usually.

In some aspects, wherein preferred carrier is the carrier that is used to express polynucleotide of the present invention and polypeptide.Usually, these carriers comprise the cis acting control area that is used for expressing effectively, may be operably coupled to the host on the polynucleotide that will express.Suitable trans-acting factor is provided, is provided or provided after importing the host certainly by carrier by complementary carrier by the host.

In this, in certain preferred aspects, carrier provides preferred expression.This preferred expression can be an inducible expression or to be subjected to the restriction of time or to be limited to mainly maybe can be the expression of above-mentioned any combination in the cell of some type.In the carrier of induction type, particularly preferably be by can maneuverable environmental factors the carrier of temperature and nutritional supplements abduction delivering for example.The carrier of this aspect of various suitable the present invention (comprising the composing type and the inducible expression vector that are used for protokaryon and eucaryon host) is well known to those skilled in the art and is used by conventional.Wherein, this class carrier comprises karyomit(e), additive type and the carrier that derives from virus, for example derive from bacterial plasmid, from phage, from transposon, from the yeast additive type, from insertion element, from the yeast chromosomal element, from virus baculovirus for example, papovavirus, SV40 for example, vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus and retroviral carrier and from the carrier of its combination, for example from the carrier of plasmid and phage genetic elements, for example clay and phagemid and be used for the binary vector of agrobacterium-mediated conversion.All carriers all can be used in the expression of this aspect according to the present invention.

Provide the following carrier that can commercial buy by example.PBS carrier, Phagescript carrier, Bluescript vector, pNH8A, pNH16a, pNH18A, the pNH46A that preferably be used for having among the carrier of bacterium pQE70, the QE60 that can obtain from Qiagen and pQE-9, can obtain from Stratagene, and ptrc99a, pKK223-3, pKK233-3, pDR540, the pRIT5 that can obtain from Pharmacia.Have among the preferred eukaryotic vector from pWLNEO, pSV2CAT, pOG44, pXT1 and the pSG of Stratagene acquisition and pSVK3, pBPV, pMSG and the pSVL that obtains from Pharmacia.Useful plant binary vector comprises BIN19 and its derivative that obtains from Clontech.These carriers only are to list in the mode that the carrier that many commerce are obtainable and know is described, described carrier is the obtainable carriers that use according to this aspect of the invention of those skilled in the art.Will be appreciated that take office what it be suitable for for example in the host, import, keep, breed or express the plasmid of polynucleotide of the present invention or polypeptide or carrier and can be used for of the present inventionly aspect this, disclose wherein several below in further detail.

Usually, expression construct contains the ribosome bind site that is useful on transcription initiation and terminated site and is used to translate in the zone of being transcribed.The encoding part of the mature transcript of being expressed by described construct comprises the AUG that is positioned at initial startup translation and is positioned at the terminator codon of being transcribed the polypeptide end rightly.

In addition, described construct can comprise the control area of regulating and producing expression.Usually, according to many common practice in methods, except other, these zones are transcribed by control and are worked, for example transcription factor, repressor binding site and termination signal.For will the translation protein excretion to endoplasmic, secrete to periplasmic space or to extracellular environment, suitable secretion signal can be integrated in the polypeptide expressed.These signals can be endogenous for described polypeptide or it can be the allos signal.

By enhancer sequence being inserted transcribing of the DNA that can increase the code book invention polypeptide that is undertaken by higher eucaryotic cells in the carrier.Enhanser is to play the DNA cis-acting elements that increases the promoter transcription active function in given host cell type, is typically about 10 to 300bp.The example of enhanser comprises the sub-enhanser of SV40 enhanser, cytomegalovirus early promoter of the replication orgin side in late period (latesite) that is positioned at bp100 to 270, the polyoma enhanser that is positioned at replication orgin side in late period and adenovirus enhanser.The enhanser that the present invention transcribes with the dna fragmentation that strengthen to import that is used in addition comprises virus enhancer especially, for example is positioned at the enhanser of 35S promoter, exists as people such as Odell Plant Mol.Biol.Shown and among the 10:263-72 (1988) from the enhanser of opine gene, exist as people such as Fromm Plant CellDescribed in the 1:977 (1989).Enhanser can influence the tissue specificity and/or the temporal that are contained in the sequence in the carrier expresses.For example, construct can comprise the CaMV35s enhanser of arranging with " head to head " direction with the zag2.1 promotor (SEQ ID NO:3) that drives ipt (SEQ IDNO:1) (SEQ ID NO:4).

By stopping transcribing, stop the zone and also help to express effectively in suitable site.Being used to put into practice useful terminator of the present invention comprises, but be not limited to, pinII is (referring to people such as An, 115-122 (1989)), glb1 (referring to Genbank Accession#L22345), gz (referring to the gzw64a terminator, Genbank Accession#S78780) and from the no terminator of edaphic bacillus PlantCell 1 (1):.

It is wherein known that to be suitable for eukaryotic promoter that generalization expresses be CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus LTRs promotor promotor, metallothionein promoter mouse metallothionein(MT)-I promotor and the various plant promoter sphaeroprotein-1 (globulin-1) for example for example of Rous sarcoma virus (" RSV ") for example.In possible, can use the intrinsic promotor of phytokinin regulatory enzyme gene.The representative of prokaryotic promoter comprises phage PL promotor, colibacillary lac, trp and tac promotor, only lifts a few well-known promotor.

For plant, the example of the preferred promotor of seed comprises the promotor of seed storage protein (people such as Thompson; BioEssays; .10:108 (1989)), for example for dicotyledons, (β-conglycinin) promotor and soybean agglutinin promotor, described promotor is expressed these albumen in the mode of highly being regulated in seed for beans p-phaseolin promoter, napin promotor, beta-conglycinin.For monocotyledons, the promotor that is used for the present invention practice includes but not limited to corn 15kD zein promotor, 22kD zein promotor, 27Kd γ-zein promotor (gzw64A promotor for example, referring to Genbank Accession#S78780), Waxy promotor, shrunken-1 promotor, sphaeroprotein-1 promotor (referring to Genbank Accession#L22344), ltp2 promotor (people such as Kalla, Plant Journal 6:849-860 (1994); United States Patent (USP) 5,525,716), the cim1 promotor is (referring to United States Patent (USP) 6,225,529) corn end1 and end2 promotor are (referring to the United States Patent (USP) of submitting on December 4th, 2,002 6,528,704 and the application 10/310,191), nuc1 promotor (United States Patent (USP) 6,407,315), Zm40 promotor (United States Patent (USP) 6,403,862), eep1 (SEQ ID NO:7) and eep 2 (SEQ ID NO:18), lec1 (U.S. Patent application 09/718,754), Trx H promotor (U.S. Provisional Patent Application 60/514,123), mlip 15 promotors (United States Patent (USP) 6,479,734), the PCNA2 promotor, SEQ ID NO:25 and shrunken-2 promotor.(people such as Shaw, Plant Phys98:1214-1216,1992; People such as Zhong Chen, PNAS USA 100:3525-3530,2003).Yet, other promotor that is used for the present invention's practice is known to art technology person, for example the nucellain promotor is (referring to people such as C.Linnestad, Nucellain, A Barley Homolog of the Dicot Vacuolar-Processing Proteasem isLocalized in Nucellar Cell Walls, Plant Physiol.118:1169-80 (1998), the kn1 promotor is (referring to S.Hake and N.Ori, The Role of knottedlin Meristem Functions, B8:INTERACTIONS AND INTERSECTIONS INPLANT PATHWAYS, COEUR D ' ALENE, IDAHO, KEYSTONE SYMPOSIA, February8-14,1999, at 27.) and F3.7 promotor (people such as Baszczynski, Maydica 42:189-201 (1997); SEQ ID NO:10).The promotor that spatially works, glb1 (the preferred promotor of embryo) for example, or γ zein (the preferred promotor of endosperm), or have active promotor in the embryo peripheral region and (ask 10/786 in the United States Patent (USP) of submitting to referring on February 25th, 2004,679), or BETL1 is (referring to people such as G.Hueros, PlantPhysiology 121:1143-1152 (1999) and Plant Cell 7:747-57 (June1995)), be useful especially, comprise preferably in female reproductive tissue promoters active and at meristematic tissue, particularly promoters active in mitogenetic female reproductive tissue.

The present invention also expects the purposes of the promotor that works in time.The promotor that (DAP) worked in 0-25 days after pollination is preferred, and the promotor that works at 4-21,4-12 or 8-12DAP is preferred too.In this, for example cim1 and ltp2 are preferred to promotor.The promotor that also can use the pollination back to work in-14 to 0 day, for example SAG12 (referring to WO96/29858, Richard M.Amasino, published 3 Oct.1996) and ZAG1 or ZAG2 (referring to R.J.Schmidt, wait the people; Identification and MolecularCharacterization of ZAG1, the Maize Homolog of the ArabidopsisFloral Homeotic Gene AGAMOUS, Plant-Cell 5 (7): 729-37 (July1993).Also referring to SEQ ID NO:3).

Useful promotor comprises corn zag2.1 (SEQ ID NO:3), (SEQ ID NO:5 is also referred to as ZmMADS to Zap; U.S. Patent application 10/387,937; WO 03/078590); Corn tb1 promotor (SEQ ID NO:17; Also referring to people such as Hubbarda, Genetics 162:1927-1935,2002).

The example that is used in the general suitable promotor of expressing of plant is a ribulose-1,5-bisphosphate, the promotor of 5-bisphosphate carboxylase small subunit, from the promotor of the tl plasmids of Agrobacterium tumefaciens, for example nopaline synthase and octopine synthase promoter, and viral promotors, for example cauliflower mosaic virus (CaMV) 19S and 35S promoter or radix scrophulariae mosaic virus 35 S promoter.

Be to be understood that the promotor of not mentioning in a large number is applicable to this aspect of the present invention, described promotor is well-known and those skilled in the art can easily use described promotor by the mode that illustrates among discussed herein and the embodiment.For example, the present invention expects the phytokinin biosynthetic enzyme promotor that use (when suitable) is natural, to drive the expression of enzyme in the reorganization environment.

The carrier that is used to breed and expresses generally includes selective marker.These marks also can comprise the other mark that is used for this purpose applicable to amplification or described carrier.In this, described expression vector preferably comprises one or more selectable marker genes, to be provided for selecting the phenotypic characteristic of transformed host cells.Preferred mark comprises Tetrahydrofolate dehydrogenase or the neomycin resistance gene that is used for the eukaryotic cell cultivation and is used to cultivate intestinal bacteria and other procaryotic tsiklomitsin or ampicillin resistance gene.Kantlex and herbicide resistance gene (PAT and BAR) are generally used for families of plant.

Use the dna fragmentation that next-door neighbour physically imports selectable marker gene so that cell transformed can select or screening be reclaimed by positive heredity.Selectable marker gene also makes it possible to transgenic plant colony is kept selecting to press, and keeps dna fragmentation and its control promotor and the enhanser that imports to guarantee transgenic plant.

The positive selection marker gene that is used for Plant Transformation of many general uses is separated from bacterium, and is coded in the toxic enzyme of removing the selection chemical reagent in the metabolism, and described chemical reagent can be microbiotic or weedicide.Other positive selection marker gene coding is to the insensitive altered target of inhibitor.

The example that is used for the selectable marker gene of Plant Transformation is BAR or the pat gene that uses with the selective reagents bilanafos.People such as Spencer, J .Theor.Appl ' d Genetics79:625-631 (1990).Another useful selectable marker gene is to separate from the neomycin phosphotransferase II of Tn5 (nptII) gene, gives the resistance to kantlex when described gene is placed under the control of plant conditioning signal.People such as Fraley, Proc.Nat ' l Acad.Sci. (USA)80:4803 (1983).It is the further example of useful selective marker that hygromycin phosphotransferase gene to the microbiotic hygromycin resistance is provided.People such as Vanden Elzen, Plant Mol.Biol.5:299 (1985).The positive selection marker gene of giving antibiotics resistance that comes from bacterium in addition comprises GAT, streptomycin phosphotransferase, aminoglycoside-3-VITAMIN B4 transferring enzyme and bleomycin RD.People such as Hayford, Plant Physiol.86:1216 (1988); People such as Jones, Mol.Gen.Genet.210:86 (1987); People such as Svab, Plant Mol.Biol.14:197 (1990); People such as Hille, Plant Mol.Biol.7:171 (1986).

Other positive selection marker gene that is used for Plant Transformation is not a bacterial origin.These genes comprise little mouse dihydrofolate reductase, plant 5-enol pyruvic acid shikimic acid-3-phosphate synthase and plant acetyl lactic acid synthetic enzyme.People such as Eichholtz, Somatic Cell Mol.Genet.13:67 (1987); People such as Shah, Science233:478 (1986); People such as Charest, Plant Cell Rep.8:643 (1990).

The another kind of vegetable cell that requires the screening supposition to be transformed with marker gene that dna sequence dna carries out Plant Transformation of being used for, rather than just for example antibiotic resistance of toxicant is directly carried out the heredity selection to cell transformed.Because these genes can be merged to the adjusting sequence of gene or gene to be used to study expression of gene, so it is specially adapted to quantitatively or observes the spatial model that dna sequence dna is expressed in particular organization and be commonly referred to as reporter gene.General being used to of using screens supposition and comprised β-glucuronidase, beta-galactosidase enzymes, luciferase and E.C. 2.3.1.28 by the gene of cell transformed.Jefferson, Plant Mol.Biol. Rep.5:387 (1987); People such as Teeri, EMBO J.8:343 (1989); People such as Koncz, Proc.Nat ' l Acad.Sci. (USA)84:131 (1987); People such as De Block, EMBO J.3:1681 (1984).Another identify the method for rare relatively transformation event used the gene of the dominance composing type conditioning agent of coding corn anthocyanin chromogenesis approach (people such as Ludwig, Science247:449 (1990)).

Can by any various known and routine techniquess will be suitable dna sequence dna insertion carrier in.Usually, by with one or many restriction endonucleases cutting DNA sequence and expression vector, with the T4 dna ligase restricted fragment is coupled together then, thereby the dna sequence dna that will be used for expressing connects into expression vector.Described sequence can be inserted with direction forward or backwards.Spendable in this be used to limit know for a person skilled in the art with the method that is connected and conventional.In this, at people's such as Sambrook MOLECULAR CLONING, ALABORATORYMANUAL, the 2nd edition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor also is to know and the appropriate parties of conventional technique construction expression vector has been carried out very detailed elaboration to using selectable for a person skilled in the art among the N.Y. (1989).

By using standard technique usually the polynucleotide of the present invention of the allos structure sequence of code book invention polypeptide to be inserted in the carrier,, it is used for expression promoter so that may be operably coupled to.Determine the position of described polynucleotide so that transcription initiation site suitably is positioned at 5 ' of ribosome bind site.Described ribosome bind site will be positioned at startup want polypeptide expressed translation AUG 5 '.Usually, do not exist other from initiator codon (normally AUG) beginning and the open reading-frame (ORF) between ribosome bind site and initiator codon.Equally, usually, there is translation stop codon at the end of described polypeptide, and has polyadenylation signal at the construct that is used for eucaryon host.Place 3 ' the terminal transcription termination signal of being transcribed the zone also can be included in described polynucleotide constructs rightly.

Use the various technology of knowing to import and be suitable for expressing therein among the host of the polypeptide of wanting containing carrier as other local described suitable dna sequence dna herein and suitable promotor and other suitable control sequence.The present invention also relates to contain the host cell of above-mentioned construct.Described host cell can be a for example vegetable cell of higher eucaryotic cells, or eukaryotic cell such as low yeast cell for example, and perhaps described host cell can be a for example bacterial cell of prokaryotic cell prokaryocyte.

Transfection, electroporation, transduction, friction-loaded (scrape loading), impact (ballistic) importing, infection or other method of mediating by calcium phosphate transfection, the transfection of DEAE-dextran mediation, microinjection, positively charged ion lipid can realize construct is imported in the host cell.These methods are described in many standard laboratory handbooks, people's such as Davis BASICMETHODS IN MOLECULAR BIOLOGY for example, (1986) and people's such as Sambrook MOLECULARCLONING:A LABORATORY MANUAL, the 2nd edition, Cold Spring HarborLaboratory Press, Cold Spring Harbor is among the N.Y. (1989).

The representation example of appropriate host comprises bacterial cell, for example suis, staphylococcus, intestinal bacteria, streptomycete (streptomyces) and Salmonella typhimurium (Salmonellatyphimurium) cell; Fungal cell, for example yeast cell and Aspergillus (Aspergillus) cell; Insect cell, for example fruit bat (Drosophila) S2 and Spodoptera (Spodoptera) Sf9 cell; Zooblast, for example CHO, COS and Bowes melanoma cells; And vegetable cell.Vegetable cell can derive from vegetation type widely, monocotyledons particularly, the species gramineous that for example comprise Chinese sorghum (Sorghum bicolor) and corn, and dicotyledons, for example soybean (Glycine max) and low erucic acid mustard seed (colea (Brassicanapus), overgrown with weeds blue or green (Brassica rapa ssp.)).Preferably, plant comprises corn, soybean, Sunflower Receptacle, safflower, low erucic acid mustard seed, wheat, barley, rye, clover and Chinese sorghum; Yet isolating nucleic acid of the present invention and albumen can be used for the species from following dependent of dead military hero: Ananas (Ananas), antirrhinum (Antirrhinum), Arabidopsis (Arabidopsis), Arachis (Arachis), Asparagus (Asparagus), Atropa (Atropa), Avena (Avena), Btassica (Brassica), Brome (Bromus), Browaalia, Camellia (Camellia), Capsicum (Capsicum), Ciahorium, both citrus (Citrus), cocoanut (Cocos), Coffea (Cofea), Cucumis (Cucumis), Cucurbita (Cucurbita), Datura (Datura), Daucus (Daucus), Digitalis (Digitalis), Ficus (Ficus), Fragaria (Fragaria), Geranium (Geranium), Glycine (Glycine), Gossypium (Gossypium), Helianthus (Helianthus), Heterocallis, Hordeum (Hordeum), poison tobacco (Hyoscyamus), sweet potato belongs to (Ipomoea), white walnut (Juglans), Lactuca (Lactuca), linum (Linum), lolium (Lolium), Lotus (Lotus), tomato belongs to (Lycopersicon), Majorana Mango really belongs to (Mangifera), cassava (Manihot), Medicago (Medicago), Musa (Musa), Nemesis, Nicotiana (Nicotiana), Olea (Olea), donkey food grass belongs to (Onobrychis), Oryza (Oryza), Panieum, Pelargonium (Pelargonium), Pennisetum (Pennisetum), Persea (Persea), green winter Solanum (Petunia), Phaseolus (Phaseolus), Pisum (Pisum), Psidium (Psidium), Ranunculus (Ranunculus), Rhaphanus (Raphanus), rose (Rosa), Salpiglossis, Secale (Secale), Senecio (Senecio), Solanum (Solanum), sinapsis alba belongs to (Sinapis), sorghum (Sorghum), Theobroma (Theobroma), Triticum (Triticum), Clover (Trifolium), Semen Trigonellae belongs to (Trigonella), Vigna (Vigna), Vitis (Vitis) and Zea (Zea).

Promoter region of the present invention is separable from any plant, includes, but are not limited to corn (corn; Zea mays), low erucic acid mustard seed (colea (Brasica napus), overgrown with weeds blue or green (Brassica rapa ssp.)), alfalfa (Medicago sativa), rice (Oryzasativa), rye (Secale cereale), Chinese sorghum (Sorghum bicolor, Sorghumvulgare), Sunflower Receptacle (Helianthus annuus), wheat (common wheat (Triticumaestivum)), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), Semen arachidis hypogaeae (Arachis hypogaea), cotton (upland cotton (Gossypium hirsutum)), sweet potato (Ipomoea batatus), cassava (Manihotesculenta), coffee (Coffea (Cofea spp.)), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (both citrus (Citrus spp.)), cocoa (Theobroma cacao), the bitter edible plant (Camellia sinensis), banana (Musa (Musaspp.)), avocado (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidium guajava) Mango fruit (Mangifera indica), Fructus oleae europaeae (Oleaeuropaea), oat, barley, vegetables, ornamental plant and softwood tree.Preferred plant comprises corn, soybean, Sunflower Receptacle, safflower, low erucic acid mustard seed, wheat, barley, rye, clover and Chinese sorghum.

The host who is used for the expression construct of numerous species is well-known, and can easily select to be used to express the host of the polypeptide of this aspect according to the present invention by present disclosure those skilled in the art.

Can modified as being suitable for (especially) activation promotor, selecting on the conventional nutritional medium of transformant or amplification gene cultivating through engineered host cell.It will be readily apparent to one skilled in the art that the front is used for the culture condition of the host cell through selecting to be used to express, for example temperature, pH etc. are generally suitable for polypeptide expression of the present invention.

Can in mammalian cell, yeast, bacterium or other cell, express maturation protein under the control of suitable promotor.By using the RNA from DNA construct of the present invention, cell free translation system also can be used for producing these albumen.

After transforming appropriate host strain system and making described host's strain system grow to suitable cell density, when the promotor of selecting be induction type the time, it can induce and cell is cultivated for some time again by suitable method (for example, temperature transition or be exposed in the chemical inducer).

Usually by centrifugal collecting cell, destroy cell with physics or chemical process, and the crude extract of gained is preserved for being further purified then.Can destroy the microorganism cells that is used for expressing protein by any method easily, comprise freeze thaw circulation, supersound process, physical disturbance or use the lysis agent; These methods are known the ability technician.

Methods for plant transformation

The isolating nucleic acid of the present invention can be imported in the plant according to technology known in the art.Usually, preparation is aforesaid and be suitable for the recombinant expression cassettes of transformed plant cells.Being used for transforming widely, the technology of higher plant species is well-known and is described in technology, science and patent documentation.Referring to, people such as Weising for example Ann.Rev.Genet.22:421-477 (1988).For example, for example use electroporation, PEG perforation, particle bombardment, silica fibre to send, or the callus that the microinjection of plant protoplast or embryo take place directly import DNA construct in the genomic dna of vegetable cell.Selectively, can and import in the conventional Agrobacterium tumefaciens host carrier DNA construct and the combination of suitable T-DNA flank region.After cell is by infectation of bacteria, Agrobacterium tumefaciens host's invasive function will instruct construct and contiguous mark to insert in the described plant cell dna.Referring to, U.S. Patent number 5,591,616.

People's such as Paszkowski Embo J.Describe the use polyethylene glycol precipitation among the 3:2717-2722 (1984) and imported DNA construct.Electroporation technology is described in people's such as Fromm Proc.Natl.Acad.Sci (USA) 82: 5824 (1985).The bombardment transformation technology is described in people's such as Klein Nature327:70-73 (1987) and Tomes, D. wait people's IN:Plant Cell, Tissue and Organ Culture:Fundamental Methods, Eds, O.L.Gamborg and G.C.Phillips, the 8th chapter, pgs.197-213 (1995). (also referring to people's such as Tomes United States Patent (USP) 5,886,244; 6,258,999; 6,570,067; 5,879,918).

The transformation technology of Agrobacterium tumefaciens mediation is described in the scientific literature well.Referring to, people such as Horsch for example SciencePeople's such as 233:496-498 (1984) and Fraley Proc.Natl.Acad.Sci (USA)80:4803 (1983).Although edaphic bacillus is mainly used in dicotyledons, some monocotyledons also can transform by edaphic bacillus.For example be described in U.S. Patent number 5,550, in 318 with the edaphic bacillus maize transformation.

Other transfection or method for transformation comprise (1) rhizobiaceae (Agrobacteriumrhizogenes) mediation conversion (referring to, for example, Lichtenstein and Fuller In:Genetic Engineering, the 6th volume, PWJ Rigby, Ed., London, AcademicPress, 1987; And Lichtenstein, C.P., and Draper, J, In:DNA Cloning, Vol.II, D.M.Glover, Ed., Oxford, IRI Press, 1985), disclosed application on April 7th, 1988 PCT/US87/02512 (WO 88/02405) described rhizobiaceae A4 strain system and its Ri plasmid together with the liposome-mediated DNA of the purposes (2) of Agrobacterium tumefaciens carrier pARC8 or pARC16 absorb (referring to, for example, people's such as Freeman PlantCell Physiol.25:1353,1984), (3) vortex method (referring to, for example, Kindle Proc.Nat ' l.Acad.Sci. (USA)87:1228, (1990).

As people such as Zhou Methods in Enzymology, 101:433 (1983); D.Hess, Intern.Rev.Cytol., 107:367 (1987); People's such as Luo Plant Mol. Biol.Reporter,6:165 (1988) is described, also DNA can be imported in the plant by instructing DNA to change pollen over to.As people such as Pena NatureDescribed in the 325:274 (1987), by obtaining the peptide coding expression of gene in the reproductive organ that DNA is injected into plant.As people such as Neuhaus Theor.Appl.Genet.,75:30 (1987); Exist with people such as Benbrook Procee dings Bio Expo.1986, described in the Butterworth, Stoneham, Mass., pp.27-54 (1986), also dna direct can be injected in the cell of immature embryo and rehydration exsiccant embryo.Various plant viruses as carrier are known in this area, and comprise cauliflower mosaic virus (CaMV), geminivirus infection group, brome mosaic virus and tobacco mosaic virus (TMV).

The regeneration of plant transformed

Can cultivate the plant transformed cell that produces by any above-mentioned transformation technology and provide the whole plant of the phenotype of described conversion with regeneration.This regeneration techniques depends on usually and carry out the certain plants HORMONE TREATMENT in tissue culture medium (TCM), depends on the biocide and/or the weedicide mark that have been imported into polynucleotide of the present invention usually.About the conversion of corn and regeneration referring to, for example, United States Patent (USP) 5,736,369.

Plant tissue culture technique according to standard can be from for example regenerating with plant expression vector plant transformed cell individual cells, callus or the leaf dish.It is well-known in the art that from almost various cells, tissue and the organ of any plant all can successfully be cultivated to bear complete plant again.Be described in people's such as Evans Protoplasts Isolation and Culture from the regeneration of the plant of the protoplastis of cultivating, Handbook of Plant CellCulture, Macmillilan Publishing Company, New York, pp.124-176 (1983); And Binding, Regeneration of Plants, Plant Protoplasts, CRC Press, Boca Raton is among the pp.21-73 (1985).

As people such as Horsch Science, described in the 227:1229-1231 (1985), can realize from leaf explant, bearing again the plant that contains the foreign gene that imports by edaphic bacillus.In the method, exist as people such as Fraley Proc.Nat ' l.Acad.Sci. (U.S.A)., described in the 80:4803 (1983), make transformant under the situation that selective reagents exists and inducing the plant transformed species to regenerate and growing in the substratum of branch.This method produces branch usually in 2 to 4 weeks, then these transformant branches are transferred in the suitable root induction substratum, and described substratum contains selective reagents and prevents the microbiotic of bacterial growth.Transgenic plant of the present invention can be that can educate or sterile.

Also can obtain regeneration from plant callus, explant, organ or its part.These regeneration techniqueses are described in people's such as Klee usually Ann.Rev.of Plant Phys.Among the 38:467-486 (1987).Plant regeneration from single plant protoplast or various explants is well-known in the art.Referring to, for example, Methods for Plant Molecular Biology, A.Weissbach and H.Weissbach, eds., Academic Press, Inc., San Diego, Calif. (1988).This regeneration and cultural method comprise that the branch of selecting transformant cell and branch, making conversion takes root and make plantlet be grown in step in the soil.Cultivate and regeneration about maize cell, usually referring to, The Maize Handbook, Freeling and Walbot, Eds., Springer, N.Y. (1994); Corn and Corn Improvement, the 3rd edition, Sprague and Dudley Eds., American Society of Agronomy, Madison, Wisconsin (1988).

Those skilled in the art recognize that recombinant expression cassettes be integrated in the transgenic plant with being stabilized and be confirmed as exercisable after, can it be directed in other plant by sexual hybridization.Can use any in many standard hybridization techniques, this decides on the species of being hybridized.

In the crop that nourishes and generates, transplant a cutting or can breed sophisticated transgenic plant to produce a plurality of identical plants by taking by tissue culture technique.Carry out the transgenosis selection that needs and obtain new mutation going forward side by side the foster breeding in field headquarters in order to commercial use.In the numerous crop of planting of seed, sophisticated transgenic plant can produce the selfing plant of isozygotying by selfing.Described selfing plant produces the seed of the heterologous nucleic acids that comprises new importing.Can make these seed growths can produce the plant of selecting phenotype to produce.Ripe transgenic plant also can with other suitable plant hybridization, normally another kind of selfing plant of described suitable plant or hybrid plant comprise, for example, wait the non-conversion selfing of gene plant.

Available from the part of aftergrowth, for example flower, seed, leaf, branch, fruit etc. all are contained among the present invention, and prerequisite is that described part comprises the cell that contains isolating nucleic acid of the present invention.The offspring of aftergrowth and variant and mutant also are contained in the scope of the invention, and prerequisite is the nucleotide sequence that these plants comprise importing.

Immunoblotting and DNA detection technology by for example standard can be screened nucleic acid transmission of the present invention in the transgenic plant of expressing selective marker.Usually also estimate the expression level of the heterologous nucleic acids of transgenic lines.Originally can determine the expression of rna level, to identify and quantitative expression male plant.Can use the RNA analytical technology of standard, and described technology is drawn together pcr amplification that the Oligonucleolide primers that uses design to be used for only increasing allos RNA template carries out and is measured and use the solution hybridization that the heterologous nucleic acids specific probe carries out and measure.The specific reaction antibody of the application of the invention carries out the protein immunoblot analysis and comes the protein expression of described RNA sun plant is analyzed then.In addition, can carry out in situ hybridization and immunocytochemistry by using heterologous nucleic acids specificity polynucleotide probes and antibody respectively, with localization and expression site in genetically modified organism according to standard scheme.Usually, can screen the integration nucleic acid of a large amount of transgenic lines usually to identify and to select to have the plant of optimum expression characteristic.

Some embodiments comprise transgenic plant, and described transgenic plant are the heterologous nucleic acids homozygotes that add; That is, contain the transgenic plant of the nucleotide sequence of two addings, the nucleotide sequence of wherein said adding is a gene that is positioned at homologous genes seat on each right karyomit(e) of karyomit(e).Contain the transgenic plant that heterozygosis (aka hemizygote) transgenic plant of the heterologous nucleic acids of single adding can obtain to isozygoty by sexual mating (selfing), the seed germination of some generations is also analyzed the plant that is produced, to observe (promptly with respect to control plant, natural, not genetically modified) expression of altered polynucleotide of the present invention.Also expected and backcrossed with mother plant and carry out outcross with non-transgenic plant or with genetically modified plant with identical or other one or more proterties.

Expect that also described plant transformed will can be used in traditional procedure of breeding, comprise being disclosed in US 5,706,603 and US 5,704,160 in topcross (TOPCROSS) pollination system, its each disclosure is incorporated herein by reference.

Polynucleotide are measured

Described in the open US89/00709 of for example PCT, the present invention also relates to phytokinin biosynthetic enzyme polynucleotide are used for mark to help the procedure of breeding.Before analyzing described DNA can be directly used in detection maybe can use PCR carry out enzymatic amplification (people such as Saiki, Nature324:163-166 (1986)).Also can use RNA or cDNA in the same manner.As an example, can be used for identifying existence and expression with analysis of cells mitogen biosynthetic enzyme with the nucleic acid complementary PCR primer of Codocyte mitogen biosynthetic enzyme.By using PCR, the gene that is present in particular organization or the botanical variety can characterize by the genotype of analyzing described tissue or mutation.For example, the size variation of comparing with the phenotype of canonical sequence by amplified production can detect disappearance and insert.By DNA and radiolabeled phytokinin biosynthesizing ribozyme or selectively that will amplification, hybridize with radiolabeled phytokinin biosynthetic enzyme antisense dna sequence and to identify point mutation.Paired sequence preferably can be made a distinction from the mispairing duplex by RNA enzyme A digestion or by the difference on the melting temperature(Tm).

Also can disclose reference gene and have sequence difference between the gene of sudden change by direct dna sequencing.In addition, clone's dna fragmentation can be used as probe with the detection specificity dna fragmentation.Can strengthen the sensitivity of these methods greatly by the reasonable use of PCR or another kind of amplification method.For example, sequencing primer is used with double-stranded PCR product or the single-stranded template molecule that produced by the PCR that modifies.Ordinary method by using radiolabeled Nucleotide or determine by being with fluorescently-labeled automatic sequencing method to carry out sequence.

By under denaturing agent existence or non-existent situation, the change of the electrophoretic mobility of detection dna fragmentation can obtain the gene type based on the various botanical varieties of dna sequence dna difference in gel.Can show the insertion of becoming estranged of foreword Lieque by the high resolving power gel electrophoresis.Can distinguish not homotactic dna fragmentation on the methane amide gradient gel of sex change, the mobility of different dna fragmentations is unwind according to its specificity or the part melting temperature(Tm) is arrested in different positions in the gel in described gel.(referring to, for example, people's such as Myers Science, 230:1242 (1985)).

Measure by nuclease protection, for example RNA enzyme and S1 protection or chemistry fracture also can show sequence variation on the specific position (people such as Cotton for example, Proc.Nat ' l.Acad.Sci., (USA), 85:4397-4401 (1985)).

Therefore; by for example hybridization, RNA enzyme protection, chemistry fracture, direct dna sequencing row or use the method for the southern blotting technique of restriction enzyme (for example, restriction fragment length polymorphism (" RLFP ")) and genomic dna can realize detection to specific DNA sequences.

Except more conventional gel-electrophoresis and dna sequencing row, also can detect sudden change by the original position analysis.

For example measure and to determine sudden change by dna sequencing.Handle sample to catch RNA by methods known in the art.By adding article one chain of Oligonucleolide primers synthetic cDNA from described RNA sample, described primer by with described mRNA on the sequence of area hybridization form.Add reversed transcriptive enzyme and deoxynucleotide so that article one chain of synthetic cDNA.Dna sequence dna synthetic primer sequence based on phytokinin regulatory enzyme of the present invention.Described primer sequence is usually by at least 15 continuous based compositions, and can comprise at least 30 or even 50 continuous bases.

Also the cell that carries sudden change or polymorphism in gene of the present invention can detected on the dna level by various technology.Described DNA can be directly used in detect or before analyzing can by use PCR carry out enzymatic amplification (people such as Saiki, Nature, 324:163-166 (1986)).Also can use RT-PCR to detect sudden change.Particularly preferred being to use and the automatic checkout system RT-PCR that combines of GeneScan for example.RNA or cDNA also can be used for identical purpose, PCR or RT-PCR.As an example, can use and identify and analyze sudden change with the nucleic acid complementary PCR primer of Codocyte mitogen biosynthetic enzyme.Below the example of representative primer is shown in.For example, the size variation of comparing with normal phenotype by amplified production can detect disappearance and insert.Can hybridize to determine point mutation with radiolabeled antisense dna sequence by DNA and radiolabeled RNA or selectively that will amplification.Although preferred paired sequence can be distinguished from the duplex of mispairing by RNA enzyme A digestion or by the difference on the melting temperature(Tm), preferably identify point mutation by sequential analysis.Be used for detecting the primer of sudden change or polymorphism at the ipt gene:

Primer sequence

5′GCGTCCAATGCTGTCCTCAACTA 3′

5′GCTCTCCTCGTCTGCTAACTCGT3′

Above-mentioned primer can be used for increasing separation from the phytokinin biosynthetic enzyme cDNA or the genomic clone that derive from the sample of single plant.The present invention also provides the above-mentioned primer that has from 1,2,3 or 4 Nucleotide of 5 ' and/or 3 ' terminal deletion.Described primer can be used for increasing and separates individual certainly gene, thereby makes described gene then carry out various technology for detection to illustrate dna sequence dna.By this method, but the sudden change on the identification of dna sequence.

Polypeptide is measured

The present invention also relates to diagnostic assay, for example be used for detecting the quantitative and diagnostic assay of cell and tissue phytokinin biosynthesizing enzyme level (comprise and determine normal and abnormal level).Therefore, for example, the diagnostic assay that is used to detect the expression that the phytokinin biosynthetic enzyme compares with the normal control tissue sample according to the present invention can be used for detecting the expression of the level of can not accepting.Be used in from the determination techniques of determining polypeptide level of the present invention in the sample of plant origin and know for a person skilled in the art.This class measuring method comprises that radioimmunoassay, competition are in conjunction with mensuration, western blot analysis and ELISA mensuration.Wherein, ELISAs is normally preferred.ELISA measures and comprises the antibody of preparation to described polypeptid specificity, preferably monoclonal antibody at first.In addition, preparation and monoclonal antibody bonded report antibody usually.Described report antibody is attached detectable reagent, and for example radioactivity, fluorescence or enzyme reagent are horseradish peroxidase in the present example.

For carrying out ELISA, from the host, take out sample and for example carry out incubation in the polystyrene ware at solid support, described solid support can with the protein binding in the sample.Then by with nonspecific proteins for example the bovine serum albumin(BSA) incubation any free protein binding site on the ware is covered.Then, in ware, carry out incubation, on described monoclonal antibody between incubation period is attached to attached to any phytokinin biosynthetic enzyme on the polystyrene ware with monoclonal antibody.Remove unconjugated monoclonal antibody with the damping fluid washing.The report antibody that is connected to horseradish peroxidase is put into ware, cause described report antibody to combine with any monoclonal antibody that is bonded on the phytokinin biosynthetic enzyme.The report antibody washing of will not adhere to is then removed.To be used for then showing that the reagent of peroxidase activity comprises that colorimetric substrates adds ware.Produced colored reaction product by anti-and two anti-peroxidase that are fixed that are connected on the phytokinin biosynthetic enzyme.Colour developing amount indication in the preset time section is present in the amount of the phytokinin biosynthetic enzyme in the sample.Quantitative result obtains by the reference standard curve usually.

Can use competition assay, wherein the specific antibody of pair cell mitogen biosynthetic enzyme is attached on the solid support, and the enzyme that derives from the host of mark is flow through on solid support.The amount attached to the mark on the solid support that is detected can be relevant with the amount of cells in sample mitogen biosynthetic enzyme.

Antibody

Polypeptide, its fragment or other derivative or its analogue or the cell of expressing them can be used as immunogen to produce the antibody at it.These antibody can be for example polyclonal antibody or monoclonal antibody.The present invention also comprises chimeric, strand and humanized antibody, and the product of Fab fragment or Fab expression library.Can use various methods known in the art to produce these antibody and fragment.

The anti-antibody corresponding to polypeptide of sequence of the present invention that produces can be by being injected directly into animal with described polypeptide, or by using described polypeptide acquisition for animal (preferably inhuman animal).The antibody that will obtain like this self combines with described polypeptide then.In this way, even only the fragments sequence of coded polypeptide all can be used for producing the antibody in conjunction with described complete natural polypeptides.These antibody can be used to separate polypeptide then from the tissue of expressing this polypeptide.

Be the preparation monoclonal antibody, can use any technology that the antibody that produces by the successive cloned culture is provided.The example that produces human monoclonal antibodies comprise hybridoma technology (Kohler, G. and Milstein, C., Nature256:495-497 (1975)), trisome knurl (trioma) technology, human B cell hybridoma technology (people such as Kozbor, Immunology Today 4:72 (1983)) and EBV-hybridoma technology (people such as Cole, pg.77-96 is in MONOCLONALANTIBODIES AND CANCER THERAPY, Alan R.Liss, Inc. (1985)).

The hybridoma cell line of secrete monoclonal antibody is another aspect of the present invention.

The technology that is used for the manufacture order chain antibody described in (U.S. Patent number 4,946,778) can be suitable for producing the single-chain antibody at immunogenic polypeptide product of the present invention.Equally, transgenic mice or other biology for example other animal can be used for expressing humanized antibody at immunogenic polypeptide product of the present invention.

Above-mentioned antibody can be used for separating or identifies the clone who expresses described polypeptide, or by with described antibody attached to be used for by affinity chromatography separate and/or the solid support of purifying on purifying described polypeptide of the present invention.

Polypeptide derivative comprises on the antigen or the derivative of the formation particular aspects of the present invention that is equal on the immunology.

Term as used herein " antigen equivalent derivatives " comprises peptide or its equivalent of being discerned by some antibodies specific, when the antibody that produces at albumen of the present invention or polypeptide, described antibody interferes with the direct physical interaction between antibody and its pass associated antigen.

Term " immunology equivalent derivatives " comprises peptide or its equivalent as used herein, when described peptide or its equivalent are used for when vertebrates produces antibody with appropriate formulation, produced interference antibody and it closes the interactional antibody of direct physical between the associated antigen.

With described polypeptide for example antigen or immunology equivalent derivatives or its fusion rotein as antigen with immune mouse or other animal, for example rat, cavy, goat, rabbit, sheep, ox or chicken.Fusion rotein can be described polypeptide stability is provided.Described antigen can for example bovine serum albumin(BSA) (BSA) or keyhole limpet hemocyanin (KLH) be connected by puting together with immunogenic carrier albumen.Selectively, comprise the multiple antigenic peptide of multiple copied albumen or polypeptide, or the polypeptide that is equal to of its antigen or immunology can have enough antigenicities improving immunogenicity, thereby remove the use of carrier from.

Selectively, display technique of bacteriophage can be used for selecting to have and combines active antibody gene with polypeptide, described antibody gene have from the screening of hanging oneself of pcr amplification anti-Fbp human lymphocyte v-gene pool spectrum or from original (naive) library (McCafferty, people such as J. (1990) Nature348:552-554; Marks, people such as J., (1992) Biotechnology10:779-783).Reorganize avidity (Clackson, people such as T., (1991) that (chain shuffling) also can improve these antibody by chain Nature352:624-628).

Should screen the antibody that described polypeptide and/or fusion rotein is had high affinity with searching once more to described antibody.

The fragment that can prepare as mentioned above, final antibody.

Described antibody can be M _rBe approximately 150,000 complete antibody or its derivative, for example as be described in Sierra, A and Pluckthun, A., ScienceFab fragment among the 240:1038-1040 (1988) or Fv fragment.If there are two antigen binding domainss, each structural domain can resist different epi-positions-be called " dual specific " antibody so.

As mentioned above, antibody of the present invention can prepare by ordinary method, for example monoclonal antibody technique (Kohler, G. and the Milstein by having set up, C., Nature, 256:495-497 (1975)) or use recombination method, combinatorial library for example, for example as at Huse, people's such as W.D. ScienceDescribe among the 246:1275-1281 (1989).

Preferably by in appropriate expression system, the DNA polymkeric substance that encoding said antibody is expressed by for example above-mentioned system that is used for expressing polypeptide of the present invention prepares antibody.The selection that is used for the carrier of expression system is determined part by the host, described host can be a prokaryotic cell prokaryocyte, for example colibacillus (preferably strain is B) or streptomyces species, or eukaryotic cell for example mouse C127, mouse myeloma, people HeLa, Chinese grey mouse ovary, thread or unicellular fungi or insect cell.Described host also can be transgenic animal or transgenic plant, for example as Hiatt, people's such as A. NatureDescribed in the 340:76-78 (1989).Suitable carriers comprises plasmid, phage, clay and recombinant virus (for example deriving from baculovirus and vaccinia virus).

Also can handle, for example use papoid partly to cut out the Fab part from Fc by enzyme, thereby from parent's Monoclonal Antibody Fab fragment.

Phytokinin biosynthetic enzyme binding molecule and mensuration

The present invention also provides and has been used to identify for example method of binding molecule of molecule, and described binding molecule is in conjunction with the phytokinin biosynthetic enzyme.By a large amount of methods known to those skilled in the art, but for example part elutriator and FACS separating method identification code and for example protein-bonded gene of enzyme bonded albumen.These methods are described in many laboratory manuals, for example people's such as Coligan Current Protocols in Immunology 1 (2): Chapter 5 (1991).

For example, cloning by expression can be used for this purpose.For this reason, the poly-adenylylation RNA of preparation sets up the cDNA library from this RNA from the cell of expressing the mitogen biosynthetic enzyme, described library is divided into aggregate (pool), and individually aggregate is transfected in the cell of not expressing described enzyme.Then with transfected cellular exposure in the enzyme of mark.Can be by the described enzyme of the various technical marks of knowing, described technology comprises that radioiodination or introducing are used for the standard method of the recognition site of locus specificity protein kinase.After the exposure, cell is fixed and the combination of enzyme is determined.These methods can be carried out on glass slide easily.

Aggregate is the generation phytokinin biosynthetic enzyme identified the cDNA in conjunction with cell.From these male aggregates, prepare inferior aggregate, it is transfected in the host cell also screens as mentioned above.By using inferior aggregateization of multiple and screening method again, the single clone of the binding molecule of separable one or more codings supposition.

Selectively, the part of mark can be connected on the cell extract by light is affine, for example from expressing film or the film extract that its bonded molecule for example prepares the cell of binding molecule.By the distinguishable crosslinked material of polyacrylamide gel electrophoresis (" PAGE ") and exposure in X-ray film.The mixture that contains part bonded mark can be scaled off, resolve into peptide fragment and accept the albumen microsequencing.Aminoacid sequence available from microsequencing can be used for designing the oligonucleotide probe of single or degeneracy to screen the gene that the binding molecule of identification code supposition is come in the cDNA library.

Polypeptide of the present invention also can be used for estimating the phytokinin biosynthetic enzyme binding ability of the phytokinin biosynthetic enzyme binding molecule (for example binding molecule) in cell or the cell-free preparation.

Polypeptide of the present invention also can be used for estimating the small molecules substrate in for example cell, cell-free preparation, chemical library and the natural product mixture and the combination of part.These substrates and part can be that natural substrate and part maybe can be structure or functional analogue thing.

Anti-cell mitogen biosynthesizing enzyme antibody is represented the useful binding molecule kind of the present invention's expection.

Antagonist and agonist-assay method and molecule

The present invention also provides SCREENED COMPOUND to strengthen or the effect of blocking-up phytokinin biosynthetic enzyme pair cell to identify, for example with the method for substrate molecule interactional compound.Antagonist is the compound that reduces the natural biological function of described enzyme.Be cytokinin oxidase by the specific enzyme of target in this.

Possible antagonist comprises and combines with cytokinin oxidase and therefore suppress or eliminate its active organic molecule, peptide, polypeptide and antibody.Possible antagonist also can be to be bonded to for example organic molecule, peptide, the polypeptide on the same loci of cytokinin oxidase binding molecule of binding molecule, albumen that for example is closely related or antibody, it is inducing cell mitogen metabolic enzyme inductive activity not, thereby stops the effect of enzyme by the combination of repelling enzyme.

Possible antagonist comprises for example binding molecule bonded small molecules of the binding site that is bonded to and occupies polypeptide thereby prevention and cell binding molecule, has so just stoped normal biologic activity.Micromolecular example includes but not limited to organic molecule, peptide or sample molecule.

Other possible antagonist comprises the molecule (for example trans-activation inhibitor) of the genetic expression that influences Codocyte mitogen biosynthetic enzyme.Other possible antagonist comprises antisense molecule.By antisense DNA or RNA or the formation by duplex or triple helical, antisense technology can be used for controlling gene expresses.For example, at Okano, J.Neurochem.56:560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENEEXPRESSION, CRC Press, Boca Raton, FL discusses antisense technology in (1988).For example people's such as Lee Nucleic Acids Research6:3073 (1979); People's such as Cooney Science241:456 (1988); With people's such as Dervan Science251:1360 discusses the formation of triple helical in (1991).Described method combines based on polynucleotide and complementary DNA or RNA's.For example, 5 ' encoding part of the polynucleotide of code book invention mature polypeptide can be used for the antisense rna oligonucleotide of design length at about 10 to 40 base pairs.The gene region complementation that the design of DNA oligonucleotide is used for and participates in transcribing, thereby stoped transcribing and producing of phytokinin biosynthetic enzyme.Described antisense rna oligonucleotide is hybridized with described mRNA in vivo, and has blocked the mRNA molecule is translated into the phytokinin biosynthetic enzyme.Also above-described oligonucleotide delivery can be gone into cell so that sense-rna or DNA can express in vivo, thereby suppress the generation of phytokinin biosynthetic enzyme.

DNAs of the present invention also can be used for common inhibition or reticent phytokinin metabolic enzyme gene; For example, as describing among the open WO 98/36083 of PCT patent application.

Antagonist can be used for for example increasing the level of phytokinin and/or reduce obtainable growth hormone in vegetable cell.

Selectively, the invention provides the method that is used to screen agonist, described agonist is to play the molecule that the natural biological that strengthens enzyme is learned function.Target comprises enzyme in this, for example ipt, beta-glucosidase enzyme and iaa-1.

Possible agonist comprises and combines with biosynthetic enzyme and therefore stimulate or increase its active organic molecule, peptide, polypeptide and antibody.Possible agonist also can be to be combined in binding molecule for example on the site of ipt binding molecule and improve phytokinin metabolic enzyme inductive activity, therefore and strengthen organic molecule, peptide, the polypeptide of the effect of enzyme, albumen that for example is closely related or antibody.

Possible agonist comprises small molecules, described small molecules in conjunction with and occupy for example combining of substrate of the allosteric site of enzyme thereby promotion and cell binding molecule, this makes that normal biologic activity is strengthened.Micromolecular example includes but not limited to organic molecule, peptide or peptide sample molecule.

Other possible agonist comprises the molecule (for example trans-activator) of the genetic expression that influences Codocyte mitogen synthetic enzyme.

" piling up (stacking) " of construct and proterties

Nucleotide sequence of the present invention in certain embodiments can use to generate the phenotype of wanting to plant with other purpose polyacid nucleotide sequence combination (" accumulation ").Can pile up polynucleotide of the present invention with the combination of any gene or gene, and the combination that produces can comprise a plurality of copies of any one or a plurality of polynucleotide of interest.The described combination of wanting can influence one or more proterties; That is, can generate some combination to be used to regulate the expression of gene that influences cytokine activity.For example, raising synthetic can the expression with the downward modulation cytokinin oxidase of phytokinin makes up.Other combination can design and be used for producing the plant with various proterties of wanting, includes but not limited to be used for the required proterties of animal-feed, and for example high oil base is because of (for example, U.S. Patent number 6,232,529); Equilibrated amino acid (hordothionins (U.S. Patent number 5,990,389,5,885,801,5,885,802 and 5,703,409) for example; Barley high-lysine (people (1987) Eur.J.Biochem.165:99-106 such as Williamson; And WO98/20122); With homomethionine albumen (people (1986) J.Biol.Chem.261:6279 such as Pedersen; People such as Kirihara (1988) Gene 71:359; With people (1989) Plant Mol.Biol.12:123 such as Musumura)); The digestibility that increases (for example, modified storage protein (the U. S. application series number 10/053,410 that submit to November 7 calendar year 2001); And Trx (the U. S. application series number 10/005,429 that submit to December 3 calendar year 2001)), its disclosure is incorporated herein by reference.Also polynucleotide of the present invention and the proterties that needs can be piled up, described proterties comprises the resistance of insect, disease or weedicide (for example bacillus thuringiensis (Baciilus thuringiensis) toxic protein (U.S. Patent number 5,366,892; 5,747,450; 5,737,514; 5723,756; 5,593,881; People such as Geiser (1986) Gene 48:109); Lectin (people (1994) Plant Mol.Biol.24:825 such as Van Damme); Fumonism (fumonisin) detoxification genes (U.S. Patent number 5,792,931); Nontoxicity and disease resistance gene (people (1994) Science 266:789 such as Jones; People such as Martin (1993) Science 262:1432; People such as Mindrinos (1994) Cell 78:1089); Acetolactate synthase (ALS) mutant that causes Herbicid resistant, for example S4 and/or Hra mutant; The inhibitor of glutamine synthase, for example phosphinothricin or careless ammonium phosphine (basta) (for example, bar gene); And glyphosate resistance (EPSPS gene)); Process or proterties that treating product is required for example high oil (for example, U.S. Patent number 6,232,529) with being used to of wanting; Oil (for example, fatty acid desaturase gene (U.S. Patent number 5,952,544 modified; WO 94/11516)); The starch of modifying (for example, ADPG pyrophosphorylase (AGPase), starch synthase (SS), Q-enzyme (SBE) and starch-debranching enzyme (SDBE)); With polymkeric substance or biological plastics (bioplastics) (for example, U.S. Patent number 5,602,321; β-Tong Liuxiemei (β-ketothiolase), polyhydroxybutyrate synthase and Acetoacetyl-CoA reductase (people (1988) J.Bactedol.170:5837-5847 such as Schubert) help poly (hydroxy alkanoate) (polyhydroxyalkanoates) expression (PHAs)), its disclosure is incorporated herein by reference.Also can be with polynucleotide of the present invention and the polynucleotide combination that influences agronomy character, described proterties be for example male sterile (for example, referring to U.S. Patent number 5,583,210), strength of stem, flowering time or transformation technology learn proterties, for example (for example WO 99/61619 for Cycle Regulation or gene target; WO 00/17364; WO99/25821), its disclosure is incorporated herein by reference.

Can generate these by any method and pile up combination, described method includes but not limited to by hybrid plant breeding or gene transformation any routine or that the topcross methodology is carried out.If described proterties is piled up by genetic transformation plant, the polynucleotide of interest sequence can make up at any time and with any order so.For example, comprise and one or morely want the transgenic plant of proterties to can be used as the target of introducing further proterties by conversion afterwards.Use can be introduced described proterties by the polynucleotide of interest that the combination of any conversion box provides simultaneously with co-transformation method of particle.For example, if import two sequences, then two sequences can be contained in the conversion box separately (trans) or be contained in the identical conversion box (cis).The expression of aim sequence can drive by identical promoters or different promoters.In some cases, can to suppress the conversion box that polynucleotide of interest expresses may be needs in importing.It can be accompanied by mutually in plant and to be produced the proterties combination that needs by any other inhibition box or overexpression box.

Purposes in breeding method

Conversion plant of the present invention can be used in the plant breeding program.The purpose of plant breeding is that various required proterties are combined in single mutation or the hybrid.For field crop, these proterties can comprise, for example to the resistance of disease and insect, to heat and arid tolerance, reduce the crop maturation time, increase output and better agronomy quality.Because with the many crops of mechanical harvesting, so unified plant characteristics is for example sprouted and the height of plant associations (stand) foundation, the speed of growth, maturation and plant and fringe needs.The traditional plant breeding exploitation new with the commercial crops of improving in be very important instrument.As described herein, the present invention includes the method that is used for by with the first parental maize plant and second parental maize plant hybridization generation milpa, one of them or two parental maize plant are the conversion plants that represent the enhanced vigor.

Plant breeding technology known in the art and that be used for the maize plant procedure of breeding include but not limited to recurrent selection, group select, mix selects, backcross, pedigree breeding, open pollination breeding, restriction fragment length polypeptide enhanced are selected, the selection of genetic marker enhanced, unit bodies doubles and transform.The use that often is combined of these technology.

The exploitation of corn hybrid need be developed the self-mating system of isozygotying usually in the maize plant procedure of breeding, is hybridization and estimation results of hybridization with these.The analytical procedure that many obtainable estimation results of hybridization are arranged.The earliest and the most traditional analytical procedure be to observe phenotypic character.Selectively, can investigate the genotype of plant.

By using well-known traditional breeding technology in the field of plant breeding will change over to and other be by using transformation technology to import inherited character in the specific maize plant through engineering.For example, the general method of backcrossing of using is transferred to transgenosis the original seed self-mating system from the milpa that transforms, so the offspring of gained will comprise transgenosis.Equally, if self-mating system is used for transforming, so can be with described transgenic plant and different selfing plant hybridization with generation transgenosis hybrid corn plant.As used herein, " hybridization " can refer to that sample X hybridized by Y, or backcross process, and this decides on context.

Exploitation cultivation corn hybrid comprises three steps in the maize plant procedure of breeding: (1) selects plant to be used for initial breeding cross from various germplasms storehouse; (2) the plant self intersection number that will select from breeding cross although described serial self-mating system is different mutually, is purebred and highly consistent for to produce serial self-mating system; (3) with the self-mating system selected and different hybridization between selfed lines to hybridize.In the breeding process of corn, the vigor that is reduces.Vigor is recovered when two different hybridizations between selfed lines hybridize.The homozygosity of self-mating system is always identical by the hybrid of definite paired hybridization between selfed lines generation with homogeneous important results.Identified in case produce the self-mating system of super hybrid, as long as then keeping self-mating system parent's homogeneity just can breed cenospecies continuously.

Transgenic plant of the present invention can be used for producing single-cross hybrid, triple-crossing or double cross hybrid.When producing the F1 offspring, two hybridizations between selfed lines just produced single-cross hybrid.The double cross hybrid is by in pairs (AXB and the CXD) hybridization of four self-mating systems, then two F1 hybrids is hybridized again that (AXB) X (CXD) produces.The triple-crossing hybrid originates from three self-mating systems, wherein earlier with two hybridizations between selfed lines (AXB), then with the F1 hybrid and the 3rd hybridization between selfed lines (AXB) XC of gained.Many hybrid vigor and consistence that represented by the F1 hybrid are lost in the s-generation (F2).Therefore, the seed that produces by hybrid be used to consume rather than be used to plant.

According to the present invention, provide to allow in seed, to start the nucleotide sequence of transcribing.Sequence of the present invention comprises and the seed formation transcription initiation zone relevant with seed tissue.Therefore, composition of the present invention comprises the new nucleotide sequence that is used to regulate sequence.

Provide and be used for by using transcriptional initiation sequence disclosed herein to express the method for isolating nucleotide sequence plant.Maniatis, T., Fritsch, E.F. and Sambrook, J. have described suitable technique at MOLECULAR CLONING among the A Laboratory Manual (the 2nd edition 1989 ColdSpring Harbor Laboratory).Described method comprises with comprising the conversion carrier transformed plant cells of the separating nucleotide sequence that may be operably coupled to promotor of the present invention and the plant that goes out stable conversion from plant transformed cell regeneration.By this method, promotor is used for control endogenous and the expression external source product in the preferred mode of seed.

The aim sequence that the seed phenotypes modification is provided is under the adjusting of the transcription initiation of the preferred promoter region of seed.This modification comprises that the generation of the generation of regulating endogenous product (about amount, relatively distribute etc.) or heterogenous expression product is to provide new function or product in seed.

" seed is preferred " is meant and is partial in seed, comprise the expression in embryo, nuclear, pericarp, endosperm, megarchidium, aleuron, bennet etc. at least.

" regulatory element " is meant that the tissue of being responsible for the correlative coding sequence preferably goes up the preferred sequence of expressing with the time, comprises promotor, terminator, enhanser, intron etc.

" promotor " is meant to comprise usually and can the guide RNA polymerase II starts the DNA regulation domain of RNA synthetic TATA frame at the suitable transcription initiation site of specific coding sequence.Promotor can comprise other extraly and be usually located at the upstream of TATA frame or 5 ' recognition sequence, is known as upstream promoter element, and it influences transcription initiation speed.Will be appreciated that behind the nucleotide sequence of having identified promoter region disclosed herein, further separate and the regulatory element of identifying the 5 ' non-translational region that is positioned at herein the specific promoter region upstream of identifying within the state of the art of this area.Thereby promoter region disclosed herein is further defined as usually and comprises the upstream regulation element, the element that the tissue of for example being responsible for encoding sequence is preferably preferably expressed with the time, enhanser etc.By identical mode, make expression can be identified, separate, and use, thereby determine that seed preferably expresses with other core promoter at the promoter element of wanting that carries out in the seed for example of organizing.

Can modify the isolating promoter sequence of the present invention so that the scope of isolating nucleotide sequence expression level to be provided.Can use less than the zone of complete promoter region and the ability that keeps the driving seed preferably to express.Yet, recognize excalation owing to described promoter sequence, the expression level of mRNA may reduce.Therefore, promotor can be modified to weak or strong promoter.Usually " weak promoter " is meant with low-level driving encoding sequence expression promoter." low-level " is meant the level of about 1/10,000 transcript to about 1/100,000 transcript to about 1/500,000 transcript.On the contrary, strong promoter drives the expression of encoding sequence with high level, or with the level of about 1/10 transcript to about 1/100 transcript to about 1/1,000 transcript.Usually, the Nucleotide of about at least 20 isolating promoter sequences can be used for driving the expression of nucleotide sequence.

Recognize in order to increase transcriptional level, enhanser and promoter region of the present invention can be used in combination.Enhanser is to increase the nucleotide sequence that promoter region is expressed.Enhanser is known in this area and comprises SV40 enhanser zone, 35S enhancer element etc.

Promotor of the present invention is separable to be connected with its 5 ' non-translational region of the transcription initiation site of encoding sequence separately from flank.Equally, terminator is separable is connected with its 3 ' non-translational region of the terminator codon of encoding sequence separately from flank.

Term " isolating " is meant material, for example nucleic acid or albumen, described material is: (1) is not contained in following usually of finding in the naturally occurring environment of described material or composition interactional with it or (2) basically or in essence if described material is present in its natural surroundings, and then described material is changed into composition by the artificial interference of having a mind to and/or is placed on the site that is different from the original site of described material in the cell.Being used for the isolating method of promoter region is well known in the art.The sequence of promoter region eep1 is a sequence shown in the SEQ ID NO:7.The sequence of promoter region eep2 is a sequence shown in the SEQ ID NO:18.

Eep1 promotor length shown in the SEQ ID NO:7 is 960 Nucleotide.Find CAAT primitive of inferring and the TATA primitive of inferring in the discovery of 139bp place, the upstream of translation initiation site at 308bp place, the upstream of translation initiation site.Described promotor separate comfortable 4 and 6 DAP blastulars and 5 and the corn tissue library of the complete nuclear of 7DAP in the est sequence found.Provide expression by the commitment in seed development in seed tissue, the eep1 promotor can solve expression problem.

Eep2 promotor length shown in the SEQ ID NO:18 is 1027 Nucleotide.Described promotor is separated the est sequence of finding in the corn tissue library of comfortable 4 DAP (pollination back fate) blastular, and early stage nuclear and endosperm are expressed is high special, as determined by distribution and the Lynx MPSS feature of EST in the library.

Promoter region of the present invention is separable to include but not limited to corn (corn from any plant; Zea mays), low erucic acid mustard seed (colea (Brassica napus), overgrown with weeds blue or green (Brassica rapa ssp.)), alfalfa (Medicago sativa), rice (Oryzasativa), rye (Secale cereale), Chinese sorghum (Sorghum bicolor, Sorghumvulgare), Sunflower Receptacle (Helianthus annuus), wheat (common wheat (Triticumaestivum)), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), Semen arachidis hypogaeae (Arachis hypogaea), cotton (upland cotton (Gossypium hirsutum)), sweet potato (Ipomoea batatus), cassava (Manihotesculenta), coffee (Coffea (Cofea spp.)), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (both citrus (Citrus spp.)), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa (Musaspp.)), avocado (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidium guajava) Mango fruit (Mangifera indica), Fructus oleae europaeae (Oleaeuropaea), oat, barley, vegetables, ornamental plant and softwood tree.Preferred plant comprises corn, soybean, Sunflower Receptacle, safflower, low erucic acid mustard seed, wheat, barley, rye, clover and Chinese sorghum.

From the promoter sequence of other plant can according to know based on its sequence therewith place row promoter sequence homologous technology separate.In these technology, with all or part of probe that is used as of known promoter sequence, described probe can be present in from the hybridization of the sequence selective in the cloned genes group dna fragmentation colony (being genomic library) of the biology of selecting with other.Can use the method that is used for nucleic acid array hybridizing that is easy to obtain in this area to obtain sequence corresponding to promotor of the present invention.

Complete promoter sequence or its part can be used as can be specifically and the probe of corresponding promoter sequence hybridization.For realizing specific hybrid under various conditions, these probes comprise unique and length be preferably about at least 10 Nucleotide and most preferably length be at least the sequence that is approximately 20 Nucleotide.These probes can be used to increase from the corresponding promoter sequence of the biology of selecting by well-known polymerase chain reaction (PCR) method.This technology can be used for separating from the extra promoter sequence of the biology of needs or as determining that described promoter sequence is present in the diagnostic assay in the biology.Example comprises screening by hybridization (plaque or the bacterium colony in the DNA library of paving plate; Referring to (1990) PCR Protocols of people such as for example Innis, AGuide to Methods and Applications, eds., Academic Press).

Usually, have at least 50% homology, 55% homology, 60% homology, 65% homology, 70% homology, 75% homology, 80% homology, 85% homology, 90% homology, 95% homology and even 98% homology or higher corresponding to promoter sequence of the present invention with the sequence of disclosed promoter sequence hybridization herein and disclosed sequence herein.

Following term is used to describe the sequence relation between two or more nucleic acid or the polynucleotide: (a) " canonical sequence ", (b) " comparison window ", (c) " sequence identity per-cent " and (d) " quite big identity ".

(a) as used herein, " canonical sequence " is defined as the sequence as the sequence comparison basis.Canonical sequence can be the subgroup or the integral body of particular sequence; The for example fragment of total length promoter sequence or complete promoter sequence.

(b) as used herein, " comparison window " relates to the adjacency and the specific fragment of polynucleotide sequence, wherein said polynucleotide sequence can compare with canonical sequence, and wherein compare with canonical sequence (do not comprise and add or disappearance), the part of the polynucleotide sequence in comparison window can comprise interpolation or lack (promptly, breach), to be used for the best comparison of two sequences.Usually, comparison window is the Nucleotide of 20 adjacency on length at least, and randomly can be 30,40,50,100 or the Nucleotide of more a plurality of adjacency on length.Those skilled in the art understand for fear of owing in polynucleotide sequence, comprise breach that cause with the similarity canonical sequence height, introduce the breach point penalty usually and from matching number, deduct the breach point penalty.

(c) as used herein, " sequence identity per-cent " is meant the value of determining by the sequence of relatively two best comparisons on comparison window, wherein compare for the best of two sequences, compare with canonical sequence (do not comprise and add or disappearance), the part of polynucleotide sequence can comprise interpolation or disappearance (that is breach) in the comparison window.Described per-cent calculates by following method: the number of determining to exist the position of identical nucleic acid base on two sequences, to produce the number of matched position, number with matched position multiply by 100 divided by the total position number in the comparison window and with the result, thereby produces sequence identity per-cent.

(d) " the quite big identity " of term polynucleotide sequence is meant by using a comparison program and a canonical sequence of describing with canonical parameter to compare, polynucleotide comprise have at least 70% sequence identity, the sequence of at least 80%, more preferably at least 90% and most preferably at least 95% sequence identity preferably.

The method that is used for the aligned sequences of comparison is known in this area.Genetic comparison can by under default parameter to carrying out BLAST (Basic Local Alignment Search Tool with the identity that is contained in the sequence in BLAST " GENEMBL " database; Altschul, S.F. waits the people, (1993) J.Mol.Biol.215:403-410; Also referring to www.ncbi.nlm.nih.gov/BLAST/) search for to determine.The identity that discloses obtainable dna sequence dna of using the BLASTN algorithm sequence and all can be contained in the GENEMBL database under default parameter is analyzed.Represent to have at least 65% sequence identity, more preferably at least 70% sequence identity, more preferably at least 75% sequence identity, more preferably at least 80% sequence identity, more preferably at least 85% sequence identity, the more preferably at least 90% sequence identity and the polynucleotide of at least 95% sequence identity most preferably with the identity of sequence of the present invention, wherein said per-cent sequence identity is based on complete promoter sequence.

In order to define purpose of the present invention, used GAP (Global Alignment Program).GAP has used the comparison of algorithm to find the making matching number maximization and to make minimized two sufficient sequences of breach number of Needleman and Wunsch (J.Mol.Biol.48:443-453,1970).GAP considers all possible comparison and gap position, and has generated the comparison with maximum match base number and minimum breach number.It makes it possible to provide in the base unit of coupling breach to generate point penalty and breach extends point penalty.GAP must use breach to generate point penalty to the matching number of each breach of its insertion.If select the breach greater than zero to extend point penalty, GAP also will use notch length to multiply by breach extension point penalty to the breach of each insertion so.At Wisconsin Package ^(Accelrys, Inc., San Diego, CA) in the 10th edition, the default breach that is used for protein sequence generates point penalty value and breach, and to extend the point penalty value be respectively 8 and 2.Default breach generation point penalty for nucleotide sequence is 50, and default breach extension point penalty is 3.Described breach generation and breach extension point penalty can be expressed as and be selected from 0 to 200 integer.Therefore, for example, breach generates and breach extension point penalty can be 0,1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65 or bigger.

GAP provides a member in the family of best comparison.Have the member of many this families, but do not have other member to have better quality.GAP has showed four merit indexs that are used to compare: quality, ratio, identity and similarity.Quality is maximized index for aligned sequences.Ratio is that quality is divided by the base number on more short-movie section.Per-cent identity is the per-cent of the symbol of actual match.The per-cent similarity is the per-cent of similar sign.Ignore the symbol that strides across breach.When being used for symbol paired rating matrix value, mark to similarity more than or equal to 0.50 (similarity threshold value).Be used for Wisconsin Package ^(Accelrys, Inc., San Diego, CA) rating matrix in the 10th edition is BLOSUM62 (referring to Henikoff and Henikoff (1989) Proc.Natl.Acad.Sci.USA 89:10915).

The sequence fragment that has with the high per-cent identity of sequence of the present invention also refers to specific promoter sequence fragment disclosed herein, and described promoter sequence fragment has improved the seed of the isolating nucleotide sequence that can be operatively connected preferably expresses.These fragments comprise the Nucleotide of about at least 20 adjacency of specific promotor nucleotide sequence disclosed herein, preferably Nucleotide, more preferably Nucleotide, the Nucleotide of about at least 100 adjacency more preferably of about at least 75 adjacency of about at least 50 adjacency.These segmental Nucleotide comprise the TATA recognition sequence of specific promoter sequence usually.By using restriction enzyme cutting naturally occurring promoter sequence disclosed herein, can obtaining these fragments from the nucleotide sequence of naturally occurring dna sequence dna or by the use round pcr by synthetic.Especially referring to, (1987) Methods Enzymol.155:335-350 of people such as Mullis, and Erlich, ed. (1989) PCRTechnology (Stockton Press, New York).Equally, these segmental variants, for example the variant that is caused by site-directed mutagenesis is contained in the composition of the present invention.

In the nucleotide sequence that contains the sequence of about at least 20 adjacency of sequence shown in the SEQ ID NO:10 is comprised in.Can pass through hybridization, PCR etc. and separate these sequences.These sequences comprise the fragment that can drive the seed preferred expression, fragment and responsible time or the tissue-specific element that is used as the probe of identifying similar sequences.

Composition of the present invention also comprises the biologic activity variant of described promoter sequence.Regulating " variant " is modified promotor form, and wherein one or more bases are modified, removed or add.For example, the ordinary method of removing partial dna sequence is to use and DNA cloning bonded exonuclease, to produce double-stranded DNA clone's unidirectional nested deletion.The commercial reagents box that is used for this purpose is with commodity Exo-Size by name ^TMSell (New England Biolabs, Beverly, Mass.).In brief, this method need one by one be excised Nucleotide with 5 ' overhang, flush end or incision on dna profiling by 3 ' to 5 ' direction with the DNA incubation with exonuclease I II.But exonuclease I II can not excise 3 ', the Nucleotide of 4 base overhangs.Use the clone's of this enzyme the digestion of time control to produce unidirectional nested deletion.

An example regulating sequence variants is by produce the promotor that one or more disappearances form on bigger promotor., can lack and do not lose promoter activity in the promotor described in the The Plant Cell 7:1681-89 (1995) as people such as Zhu as far as 5 ' part near the TATA frame of transcription initiation site.These variants should keep promoter activity, particularly drive the ability of expressing in seed or seed tissue.The biologic activity variant comprises for example, having the of the present invention natural adjusting sequence of one or more nucleotide substitutions, disappearance or insertion.By rna blot analysis, use the reporter gene activity measurement transcribe when merging etc. can measure activity.Referring to, for example, and (1989) Molecular Cloning:ALaboratory Manual of people such as Sambrook (the 2nd edition, Cold Spring Harbor Laboratory, ColdSpring Harbor N.Y.), quotes as a reference herein.

When operationally being connected with isolating nucleotide sequence, the nucleotide sequence of the preferred promotor of seed disclosed by the invention with and variant and fragment can be used for the genetic manipulation of any plant, described isolating nucleotide sequence is expressed in control with the phenotype that obtains to want and is replied." be operably connected " and be meant the transcribing or translate under the influence of described adjusting system sequence of isolating nucleotide sequence.In this way, the nucleotide sequence that is used for promotor of the present invention can be provided in the expression cassette with the isolating nucleotide sequence that is used in that purpose plant (more particularly described plant seed) is expressed.This expression cassette has a plurality of restriction sites that are used to be inserted in the nucleotide sequence under the promoter transcription control.

The goal gene of expressing under promotor of the present invention instructs can be used for changing the phenotype of seed.Expression endogenous or the external source product can realize this change in the seed by increasing.Selectively, by providing the enzyme that reduces in the one or more endogenous products, particularly seed or the expression of cofactor can reach the result.These modifications cause the phenotypic alternation of transformed the seed.Recognize that promotor can use increasing or to reduce and express with its natural encoding sequence, thereby cause the change of phenotype in the transformed the seed.

The general category that is used for the goal gene of the object of the invention comprises and for example relates to for example gene classification that refers to of zinc of information; Relate to for example kinase whose gene classification of communication; With relate to for example gene classification of heat shock protein of house keeper.More specific transgenosis classification comprises the gene of the important character of coding agronomy, insect-resistant, disease resistance, Herbicid resistant and cereal feature.Other transgenosis classification comprises and is used to induce the external source product, for example the gene of expressing from plant and other eucaryon and procaryotic enzyme, cofactor and hormone.Recognize any goal gene, comprise that natural encoding sequence can may be operably coupled to regulatory element of the present invention and expresses in seed.

The modification that influences the cereal proterties comprises to be increased oleic content or changes saturated and level unsaturated fatty acids.Equally, the type and the content of starch can need in the level of increase Methionin and sulfur-containing amino acid and the change seed.The WO9416078 that submits on April 10th, 1997; The WO 9638562 that on March 26th, 1997 submitted to; It is protein modified to have described Hordothionin in the U.S. Patent number 5,703,409 that the WO 9638563 that on March 26th, 1997 submitted to and on December 30th, 1997 authorize; Its disclosure is incorporated herein by reference.Another example is by the seed albumen that is rich in Methionin and/or sulphur that is described in the soybean 2S white protein coding among the WO 9735023 that submitted on March 20th, 1996, and from the chymotrypsin inhibitor of barley, people such as Williamson (1987) Eur.J.Biochem.165:99-106, each disclosure all is incorporated herein by reference.

The derivative that can prepare following gene by site-directed mutagenesis is with the be encoded amino acid levels of preliminary election in the polypeptide of increase.For example, the gene source of coding barley high-lysine polypeptide (BHL) is in the barley chymotrypsin inhibitor, the WO 9820133 that submitted on November 1st, 1996, and its disclosure is incorporated herein by reference.Other albumen comprises the vegetable-protein that is rich in methionine(Met), for example from sunflower seeds (people (1989) Proceedings of the WorldCongress on Vegetable Protein Utilization in Human Foods andAnimal Feedstuffs such as Lilley; Applewhite, H. (ed.); American Oil ChemistsSoc., Champaign, IL:497-502 is incorporated herein by reference), corn (people such as Pedersen, (1986) J.Biol.Chem.261:6279; People such as Kirihara, (1988) Gene71:359, the two all is incorporated herein by reference) and the albumen of paddy rice (people such as Musumura, (1989) Plant Mol.Biol.12:123 quotes as a reference herein).Other important function of gene coding dextran, Floury 2, somatomedin, the storage of seeds factor and transcription factor.

Can improve agronomy character in the seed by changing expression of gene, described gene is to influence seed growth and grow the gene of replying during environment association is urgent, people such as Cheikh-N (1994) Plant Physiol.106 (1): 45-51) with the gene of control sugar metabolism with the abortion of minimizing corn center, people such as Zinselmeier (1995) Plant Physiol.107 (2): 385-391.These genes comprise, for example, and the gene of Codocyte mitogen biosynthetic enzyme, for example prenyltransferase; Codocyte mitogen catabolic enzymes is the gene of cytokinin oxidase for example; The polypeptide that coding participate in to be regulated the cell cycle is the gene of cyclin D or cdc25 for example; Codocyte mitogen acceptor or sensor for example CRE1, CKI1 and CKI2, Histidine phosphoric acid mediator (phospho-transmitter) or phytokinin are replied the gene of instrumentality.

Insect-resistant gene codified is to the insect of causing output and reducing the greatly resistance of rootworm, cutworm, European corn borer etc. for example.These genes comprise, for example: bacillus thuringiensis endotoxin genes, (U.S. Patent number 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; People such as Geiser (1986) Gene 48:109); Lectin (people (1994) Plant Mol.Biol.24:825 such as Van Damme) etc.

The gene of coding disease resistance proterties comprises: detoxification genes, for example gene of anti-fumonosin (WO 9606175 that submit to June 7 nineteen ninety-five); Nontoxicity (avr) and disease resistance (R) gene, people such as Jones (1994) Science 266:789; People such as Martin (1993) Science 262:1432; People such as Mindrinos (1994) Cell 78:1089; Deng.

Commercial proterties may also be encoded within on the gene, and described gene can change or increase the starch that for example is used for paper, textiles and alcohol production or the protein expression with other commercial use is provided.The other important commercial use that transforms plant is to produce polymkeric substance and biological plastics, for example in the U.S. Patent number 5,602 of mandate on February 11st, 1997, described in 321.Gene for example B-ketothiolase, PHBase (polyhydroxybutyrate synthase) and Acetoacetyl-CoA reductase (referring to (1988) J.Bacteriol 170 (12) of people such as Schubert: 5837-5847) help the expression of poly (hydroxy alkanoate) (PHAs).

The external source product comprises the enzyme of plant and product and comprises the product in prokaryotic organism and other Eukaryotic source from other.These products comprise enzyme, cofactor, hormone etc.Can increase the level of seed albumen (the particularly modified amino acid branch with improvement is equipped with the seed albumen that improves the seed nutritive value).Realize this purpose by expressing the albumen that this class has an aminoacids content of increase.

The nucleotide sequence that may be operably coupled to regulatory element disclosed herein can be by the antisense sequences of the gene of target." antisense DNA nucleotide sequence " is meant the sequence of arranging with the direction opposite with 5 ' to 3 ' normal direction of described nucleotide sequence.After antisense dna sequence was sent vegetable cell, it was expressed and can stop by the normal expression of the dna nucleotide sequence of the gene of target.Described antisense base sequences coding with endogenous messenger RNA(mRNA) (mRNA) complementary and can with the rna transcription thing of its hybridization, described messenger RNA(mRNA) is by by the generation of transcribing of the dna nucleotide sequence of the gene of target.In this case, thus be restricted by described production and reached the phenotype that needs and reply by the native protein of the genes encoding of target.Therefore adjusting sequence disclosed herein can may be operably coupled to antisense dna sequence to reduce or to suppress the expression of native protein in the plant seed.

Described expression cassette is also included within isolating purpose nucleotide sequence 3 ' terminal the transcribing and the translation termination zone of being positioned at of performance function in the plant.Described termination zone can be natural for promotor nucleotide sequence of the present invention, can be natural for the target DNA sequence, maybe can derive from other source.

Other stops the zone easily and can obtain from the Ti-plasmid of Agrobacterium tumefaciens, and for example octopine synthase and nopaline synthase stop the zone.Also referring to (1991) Mol.Gen.Genet.262:141-144 of people such as Guerineau; Proudfoot (1991) Cell 64:671-674; (1991) Genes Dev.5:141-149 of people such as Sanfacon; (1990) Plant Cell 2:1261-1272 of people such as Mogen; (1990) Gene 91:151-158 of people such as Munroe; People such as Ballas 1989) Nucleic Acids Res.17:7891-7903; (1987) Nucleic Acid Res.15:9627-9639 of people such as Joshi.

Described expression cassette can contain 5 ' leader sequence in addition.This leader sequence can strengthen translation.The translation leader sequence is known in this area, and comprise: the picornavirus leader sequence, for example: EMCV leader sequence (encephalomyocarditis 5 ' non-coding region), people such as Elroy-Stein (1989) Proc.Nat Acad.Sci.USA 86:6126-6130; Marmor upsilon group leader sequence, for example, TEV leader sequence (marmor erodens), people such as Allison (1986); MDMV leader sequence (corn stunt mosaic virus), Virology 154:9-20; Human immunoglobulin heavy chain conjugated protein (BiP), people such as Macejak (1991) Nature 353:90-94; From the untranslated leader (AMVRNA 4) of the coat protein mRNA of alfalfa mosaic virus, people such as Jobling (1987) Nature 325:622-625); Tobacco mosaic virus (TMV) leader sequence (TMV), people such as Gallie (1989) Molecular Biology of RNA, pages 237-256; With people (1991) Virology 81:382-385 such as corn chlorotic mottle poison leader sequence (MCMV) Lommel.Also referring to (1987) Plant Physiology 84:965-968 of people such as Della-Cioppa.Described box also can comprise the sequence that strengthens translation and/or mRNA stability, for example intron.

At the specific organoid of expression product guiding of wanting to make isolating nucleotide sequence, particularly plastid, amyloplast, or guiding endoplasmic reticulum or secrete to cell surface or extracellular situation, described expression cassette can further comprise the encoding sequence that is used for transit peptides.This transit peptides is well known in the art, and includes, but are not limited to: be used for small subunit, plant EPSP synthase of transit peptides, the rubisco of acyl carrier protein etc.

In preparation expression cassette process, can operate various dna fragmentations, so that with correct direction with suitably provide dna sequence dna with correct reading frame.For this reason, can use connector or joint to connect dna fragmentation and maybe can remove unnecessary DNA, remove restriction site etc. by the restriction site of other operation to provide convenience.For this reason, can relate to vitro mutagenesis, primer reparation, restriction digest, annealing and again alternative as conversion and transversion.

So point out in the place, the invention provides the carrier that can express goal gene under regulatory element control.Usually, described carrier should be brought into play function in vegetable cell.Sometimes, it can be preferred having the carrier of bringing into play function (for example, being used to produce the segmental structure of proteic production, dna sequence analysis, insertion of antibody, the amount of acquisition nucleic acid) in intestinal bacteria.In (the same) of people such as Sambrook, discussed and be used for carrier and the method cloning and express intestinal bacteria.

The conversion carrier that comprises the promotor of the present invention on the isolating nucleic acid that may be operably coupled in the expression cassette also can comprise at least one extra nucleotide sequence that will corotation dissolves biological gene.Selectively, can on another conversion carrier, provide described additional sequences.

The carrier of performance function can be the binary plasmid that derives from edaphic bacillus in plant.This carrier can transformed plant cells.These carrier bags are integrated into necessary left margin and right border sequence in host (plant) karyomit(e).At least, between these border sequences be the gene of under regulatory element control of the present invention, expressing.In one embodiment, selective marker and reporter gene have also been comprised.Be the bacterium replication orgin that easily obtains the carrier of q.s, can use in intestinal bacteria, to duplicate.

Reporter gene can be contained in the conversion carrier.The example of suitable reporter gene known in the art can be for example: (1991) Plant Molecular BiologyManual of people such as Jefferson, people such as ed.Gelvin (Kluwer Academic Publishers), pp.1-33; (1987) Mol.Cell.Biol.7:725-737 of people such as DeWet; (1990) EMBO of people such as Goff J.9:2517-2522; (1995) BioTechniques19:650-655 of people such as Kain; With find among (1996) Current Biology 6:325-330 of people such as Chiu.

Be used for selecting the selectable marker gene of transformant or tissue can be contained in conversion carrier.These genes can comprise the gene of giving antibiotics resistance or antiweed resistance.The example of suitable selectable marker gene includes but not limited to: coding chloramphenicol resistance people (1983) EMBO such as (J.2:987-992) Herrera Estrella, methotrexate (people (1983) Nature 303:209-213 such as Herrera Estrella; People such as Meijer (1991) Plant Mol.Biol.16:807-820), Totomycin (people (1985) Plant Mol.Biol.5:103-108 such as Waldron; People such as Zhijian (1995) Plant Science 108:219-227), Streptomycin sulphate (people (1987) Mol.Gen.Genet.210:86-91 such as Jones), spectinomycin (people (1996) Transgenic Res.5:131-137 such as Bretagne-Sagnard), bleomycin (people (1990) Plant Mol.Biol.7:171-176 such as Hille), sulfanilamide (SN) (people (1990) Plant Mol.Biol.15:127-136 such as Guerineau; Bromoxynil (people (1988) Science 242:419-423 such as Stalker), glyphosate (people such as Shaw. (1986) Science 233:478-481), the gene of phosphinothricin (people (1987) EMBO such as DeBlock J.6:2513-2518) resistance.

That other works in the recovery of transgenic event but may unwanted gene in final product can include but not limited to: GUS (β-glucuronidase) (Jefferson (1987) Plant Mol.Biol.Rep.5:387), GFP (green fluorescent protein) (people (1994) Science 263:802 such as Chalfie), the corn gene that luciferase people (1989) EMBO such as (J.8:343) Teeri and coding anthocyanin are produced people (1990) Science247:449 such as () Ludwig.

Comprise conversion carrier particular adjustments sequence of the present invention, that may be operably coupled to the isolating nucleotide sequence of purpose in the expression cassette and can be used for transforming any plant.In this way, can obtain the plant, vegetable cell, plant tissue, seed etc. of genetic modification.The conversion scheme can be according to the kind that is used to carry out plant transformed or vegetable cell by target, i.e. monocotyledons or dicotyledons and change.The appropriate method of transformed plant cells comprises, microinjection, people such as Crossway (1986) Biotechniques 4:320-334; Electroporation, people such as Riggs (1986) Proc.Natl.Acad.Sci.USA 83:5602-5606; Agrobacterium-mediated conversion, referring to for example, people's U.S. Patent numbers such as Townsend 5,563,055; Direct gene shifts, and people such as Paszkowski (1984) EMBO J.3:2717-2722; Quicken with the bombardment particulate, referring to for example, people such as Sanford, U.S. Patent number 4,945,050; People such as Tomes (1995) in Plant Cell, Tissue, and Organ Culture:Fundamental Methods, ed.Gamborg and Phillips (Springer-Verlag, Berlin); With people (1988) Biotechnology6:923-926 such as McCabe.Also referring to people such as Weissinger (1988) Annual Rev.Genet.22:421-477; People such as Sanford (1987) ParticulateScience and Technology 5:27-37 (onion); People such as Christou (1988) PlantPhysiol.87:671-674 (soybean); People such as McCabe (1988) Bio/Technology6:923-926 (soybean); People such as Datta (1990) Biotechnology 8:736-740 (rice); People such as Klein (1988) Proc.Natl.Acad.Sci.USA 85:4305-4309 (corn); People such as K1ein (1988) Biotechnology6:559-563 (corn); People such as Klein (1988) Plant Physiol.91:440-444 (corn); People such as Fromm (1990) Biotechnology 8:833-839; People (1984) Nature (London) 311:763-764 such as Hooydaas-Van Slogteren; People such as Bytebier (1987) Proc.Natl.Acad.Sci.USA 84:5345-5349 (Liliaceae (Liliaceae)); People (1985) in The Experimental Manipulation of Ovule Tissues such as De Wet, people such as ed.G.P.Chapman (Longman, New York), pp.197-209 (pollen); People such as Kaeppler (1990) Plant Cell Reports 9:415-418; With people (1992) Theor.Appl.Genet.84:560-566 (conversion of whisker (whisker)-mediation) such as Kaeppler; People such as D.Halluin (1992) Plant Cell 4:1495-1505 (electroporation); People (1995) Annals of Botany 75:407-413 (rice) such as people such as Li (1993) Plant Cell Reports 12:250-255 and Christou; People such as Osjoda (1996) Nature Biotechnology 14:745-750 (by the corn of Agrobacterium tumefaciens conversion), all documents are all quoted as a reference herein.

Can make according to the method for routine and to be grown into plant by cell transformed.Referring to, (1986) Plant Cell Reports 5:81-84 of people such as McCormick for example.Can make these plant-growths also with identical transformation plant or not homophyletic system pollination, the plant that can identify the seed preferred expression with the phenotypic characteristic that needs of gained then then.Can grow two generations or more generations to guarantee stably to keep and the seed preferred expression of the phenotypic characteristic of heredity needs.

Embodiment

By the following example the present invention is further described.By the specific embodiment of reference, described embodiment only is used to the present invention that furnishes an explanation.These examples although some particular aspects of the present invention is described, are not described the restriction or the constraint of the disclosed scope of the invention.Clearly can in the scope of appended claim, put into practice some change and modification.

In aforesaid nomenclature, some term used herein is explained.

Unless detailed description is arranged in addition, use those skilled in the art know and conventional standard technique is implemented all embodiment.Conventional Protocols in Molecular Biology in the following example can be by the standard laboratory handbook, people's such as Sambrook MOLECULAR CLONING:A LABORATORYMANUAL for example, the 2nd edition; Carrying out described in the Cold Spring Harbor Laboratory Press, Cold SpringHarbor, N.Y. (1989).

Unless otherwise indicated, part shown in all the following example or amount are all calculated by weight.

Unless stipulate people's such as use Sambrook MOLECULAR CLONING:ALABORATORYMANUAL, the 2nd edition in addition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and other lot of documents, for example the agarose of standard separates with the clip size that polyacrylamide gel electrophoresis (" PAGE ") technology is carried out in the following example among people's such as Goeddel the Nucleic Acids Res.8:4057 (1980).

Unless description is arranged in addition, damping fluid, heated culture temperature and the time of use standard, the dna fragmentation to be connected of about equimolar amount are finished with the T4 dna ligase of about 10 units of per 0.5 micrograms of DNA and are connected.

Embodiment 1: the time and the space seed preferred expression that are used for the phytokinin biosynthetic enzyme The structure of carrier system

PHP 11466 and PHP 11467 and cointegrates (cointegrate) thereof (are respectively PHP11551 and PHP11552) structurePHP 11466 and PHP 11467 are used for gene gun conversion method, even it has right margin and the left margin of tDNA.The form that will be called PHP11551 and PHP11552 is used for agrobacterium-mediated method for transformation.

Obtain as the segmental ipt encoding sequence of 732bp BamHI/HpaI and be inserted into the GLB1 expression cassette (BamHI/HpaI, 4.9kb) in to produce PHP11310.Corn GLB1 promotor among the PHP 3303 (Genbank Accession#L22344 L22295) and terminator (GenbankAccession#L22345 L22295) comprise the GLB1 expression cassette.PGLB1:ipt:GLB13 ' box is imported in the T-DNA carrier that digests with EcoRI+HindIII (6.33kb) with two fragments (HindIII/BamHI 1401bp and BamHI/EcoRI 1618bp), thereby produce PHP11363.At last, with selectable marker gene (pUBI:UBIINTRON1: the optimized PAT:35S 3 ' of corn) insert among the PHP11363 (9.35kb) of HindIII digestion with 2.84kb HindIII fragment.In PHP11466, described two genes are arranged with relative mutually direction.In PHP11467, described two genes are arranged with identical direction.Behind the triparental cross, the cointegrates of PHP11466/PHP10523 is known as PHP11551.Equally, the cointegrates of PHP11467/PHP10523 is known as PHP11552.

The structure of PHP11404 and PHP11550

Use biology to launch the method for transformation of striking (biolistics) mediation to PHP11404.Described plasmid has the feature of whole edaphic bacillus forms.In fact the plasmid that agrobacterium-mediated method for transformation uses is PHP11550.

Use plasmid PHP9063 (pUBI:UBIINTRON1:ipt:pinII 3 '), use site-directed mutagenesis (5 Prime → 3 Prime, the MORPH of Inc. especially, ^TMTest kit) initiator codon at ipt generates the NcoI restriction site.The plasmid of gained is called PHP11362.(the BamHI-cutting fills into flush end with Ke Lienuo (Klenow) processing with overhang, then with the NcoI cutting, 4.9kb) to produce PHP11401 to change the ipt encoding sequence over to PHP8001 with 724bp NcoI/Hpa I fragment then.PHP8001 comprises from the GZ-W64A promotor of the 27KD zein spirit-soluble gene of corn and terminator (Genbank Accession # S78780).(PacI/KpnI digestion 10.87kb) to produce PHP11404 with PacI+KpnI digestion PHP11401 and with 1.35kb fragment insertion PHP11287.PHP11287 has carried above-mentioned pUBI:UBIINTRON1: the T-DNA carrier of corn optimization PAT:35S3 ' selective marker.Behind triparental cross, the cointegrates of PHP11404/PHP10523 is known as PHP11550.

The structure of PHP12975

In the U.S. Patent application of submitting on August 19th, 1,999 09/377,648, the CIM1 promotor has been described.Use site-directed mutagenesis to generate NcoI site (PHP12699) at CIM1 translation initiation place.Promotor is cut into 1.69kb SacI/NcoI fragment and is connected to the ipt encoding sequence and from the pinII terminator of PHP11362, thereby forms PHP12800.Then CIM1:ipt:pinII transcription unit is inserted among the PHP12515 (9.5kb) of Bst EII digestion as 2.8kb Bst EII fragment, described PHP12515 is the binary vector that has carried the UBI:UBIINTRON1:MO-PAT:35S selective marker between border sequence.The gained plasmid is called PHP12866.Import among the Agrobacterium tumefaciens LBA4404 (PHP10523) to produce cointegrates plasmid PHP12975 by triparental cross.

The structure of PHP12425

Plasmid PHP11404 (above-mentioned) is used as initial plasmid, to be used for substituting the GZ-W64A promotor from the LTP2 promotor of barley (H.vulgare).With NotI and KpnI (9.46kb fragment) and use NcoI respectively and KpnI (1.24kb fragment) digestion PHP11404DNA.These two fragments are mixed and are connected with the 1.52kb NotI/NcoI fragment that contains the LTP2 promotor from PHP8219.The plasmid product of gained is called PHP12333. this plasmid triparental cross is imported Agrobacterium tumefaciens LBA4404 (PHP10523) to produce cointegrates plasmid PHP12425..

Triparental cross and selective marker 35s:bar:pinII:

The Protocols in Molecular Biology of use standard makes up all carriers.The T-DNA zone that is used to transform is made up of the T-DNA border sequence that flank is connected with reporter gene and selective marker.Described reporter gene inserts near the right margin of T-DNA and is made up of the 2.0kb PstI fragment that flank is connected with corn ubiquitin promotor Ubi-1 people such as (, 1992) Christensen of 5 ' HindIII and 3 ' BamHI restriction site.The ubiquitin promotor is connected to 5 ' BamHI site of β-glucuronidase (GUS) reporter gene (people such as Jefferson, 1986), and described reporter gene comprises the 2nd intron (people such as Vancanneyt, 1990) from potato ST-LS1.(base 2 to 310 is from people's such as An Plant Cell 1 (1): 115-122 (1989)) be connected to the downstream of GUS encoding sequence with flush end with potato proteinase II (pinII) terminator.3 ' end at terminator is the NotI restriction site.

Described selective marker is connected with the enhanced cauliflower mosaic virus 35S promoter in 5 ' NotI site and 3 ' PstI site by flank, and (base-421 is to-90 and-421 to+2, from Gardner, R.C., wait people's Nucl.Acids Res.9:2871-88 (1981) .)) form.PstI/SalI fragment (the Gallie that will contain 79bp tobacco mosaic virus (TMV) leader sequence, D.R., Deng the people, Nucl.Acids Res.15:3257-73 (1987) .)) downstream of inserting promotor, and then insert SalI/BamHI fragment people such as (, 1984) Dennis of first intron contain maize alcohol dehydrogenase ADH1-S.With BAR encoding sequence (Thompson, C.J. wait the people, and Embo is (1987) J.6:2519-23 .)) be cloned into the BamHI site, and the pinII terminator is connected the downstream.PinII signal flank is connected to 3 ' SacI site.

By the reorganization between two plasmids the T-DNA of PHP8904 is integrated into (people 1996 such as Ishida) among the super binary plasmid pSB1.With the edaphic bacillus strain of carrying pSB1 is that LBA4404 is that HB101 hybridization is to produce the cointegrates (by Ditta G., the method that waits the people to describe) that is called LBA4404 (PHP10525) in edaphic bacillus in Proc.Natl.Acad.Sci.USA 77:7347-51 (1980) with the e. coli strains that contains PHP8904.By edaphic bacillus the resistance of spectinomycin is selected LBA4404 (PHP10525), and be confirmed that it is recombinant chou by SalI restriction digest plasmid.

Embodiment 2: the conversion of corn

Biology launches striking:

The polynucleotide of the present invention that will be contained in the carrier by particle bombardment are transformed in the maize calli of embryo generation, usually as Tomes, D. wait the people at IN:Plant Cell, Tissue and Organ Culture:Fundamental Methods, Eds.O.L.Gamborg and G.C.Phillips, described in the 8th chapter, pgs.197-213 (1995) and as simplified summary below.Be combined with immature embryo that the tungsten microparticle bombardment embryo of DNA plasmid replys to produce rotaring gene corn plant by use.Described plasmid is by selectable and non-choice structure genomic constitution.

The preparation of particulate

In the 2ml concentrated nitric acid, add 15mg 0.5 to 1.8 μ, preferably 1 to 1.8 μ and the tungsten particulate of 1 μ (General Electric) most preferably.Under 0 ℃ to this suspension supersound process 20 minutes (Branson Sonifier Model 450,40% work outpuies, constant duty cycle).By centrifugal 1 minute precipitation tungsten particulate under 10000rpm (Biofuge), and remove supernatant liquor.Add 2 milliliters of sterile distilled waters to precipitation, and carry out of short duration supersound process with suspended particulates again.With described suspension precipitation, add 1 milliliter of dehydrated alcohol to precipitation, of short duration supersound process is suspended particulates again.Again particulate is carried out 2 rinsings, precipitation and suspension again with sterile distilled water, the most described particulate is suspended in 2 milliliters of sterile distilled waters again.Particulate is divided into 250-ml aliquots containig and freezing storage.

The preparation of particulate-plasmid DNA association body

In water-bath ultrasonoscope (Branson Sonifier Model 450,20% work outpuies, constant duty cycle), tungsten particulate stock is carried out of short duration supersound process, and 50ml is transferred in the Eppendorf tube.All carriers all are cis: promptly selective marker and goal gene are on identical plasmid.Then these carriers are transformed individually or in combination.

In described particulate, add plasmid DNA and carry out of short duration supersound process with the amount that contains the final DNA of 0.1 to 10 μ g in the final 10 μ l cumulative volumes.Preferably, use the total DNA of 10 μ g (1 μ g/ μ L is in the TE damping fluid) with hybrid dna and the particulate that is used to bombard.Especially, wherein each bombardment can be used the PHP11404,11466 and/or 11467 (1 μ g/ μ L) of 1.0 μ g, all alternative ipt of any phytokinin biosynthetic enzyme polynucleotide wherein.Add the aseptic 2.5M CaCl of 50 microlitres (50 μ L) ₂The aqueous solution, and with of short duration supersound process of mixture and vortex.Add the aseptic 0.1M spermidine aqueous solution of 20 microlitres (20 μ L) and with of short duration supersound process of mixture and vortex.Under the situation of the of short duration supersound process of intermittence with described mixture incubation 20 minutes at room temperature.Centrifugal and remove supernatant liquor to microparticle suspending liquid.Add 250 microlitres (250 μ L) dehydrated alcohol to precipitation, carry out of short duration supersound process then.With the suspension precipitation, remove supernatant liquor, and add the 60ml dehydrated alcohol.Before particulate-DNA aggregate (agglomeration) is added huge carrier, suspension is carried out of short duration supersound process.

The preparation of tissue

The immature embryo of corn mutation High Type II is the target of the conversion of particle bombardment mediation.This genotype is the F of two purebred hereditary systems (parent A and B) ₁, described parent A and B derive from the hybridization of two known corn inbred line A188 and B73.According to people's such as Armstrong Maize Genetics Coop.News 65: 92 (1991), two parents select with regard to high somatic embryo generating ability.

Will be from F ₁The fringe of plant carries out selfing or compatriot's hybridization, embryo is dissected under aseptic condition when scultellum becomes opaque for the first time from the caryopsis of growing.This stage approximately took place after pollination in 9-13 days, and the most general is after pollination about 10 days, and this decides on growth conditions.Described embryo is about 0.75 to 1.5 millimeters long.To fringe surface sterilization 30 minutes, use the sterile distilled water rinsing then 3 times with 20-50%Clorox.

Immature embryo is cultivated on embryo generation inducing culture with scultellum direction up, described substratum is by the basic salt of N6, Eriksson VITAMIN, 0.5mg/l vitamin, 30gm/l sucrose, 2.88gm/l L-proline(Pro), 1mg/ l 2,4 dichloro benzene ethoxyacetic acid, 2gm/lGelrite and 8.5mg/l AgNO ₃Form.People such as Chu, Sci.Sin.18:659 (1975); Eriksson, Physiol.Plant18:976 (1965).With substratum 121 ℃ of autoclavings 15 minutes and be dispensed in 100 * 25mm culture dish.With AgNO ₃Filtration sterilization also adds in the substratum behind autoclaving.To be organized in 28 ℃ of complete dark culturing down.After about 3 to 7 days, after the most general just about 4 days, the scultellum of embryo is expanded to 2 times that are approximately its original size, and the protuberance on the coleorhiza surface of scultellum represents that beginning to form embryo organizes.Be up to 100% embryo and show this replying, but the most general just, embryo generation answer frequency is about 80%.

After observing embryo and replying, embryo is transferred in the substratum of being made up of the inducing culture of the modified 120gm/l of containing sucrose.With coleorhiza bar (embryo is replied tissue) from substratum towards direction embryo is carried out orientation.With 10 embryos of each culture dish embryo is placed in the zone of the about 2cm of culture dish mid-diameter.Just be combined with contain select and the particle bombardment of the plasmid DNA of non selected marker gene before, with embryo under 28 ℃ in this substratum complete dark kept preferably 4 hours 3-16 hour.

For realizing particle bombardment, use DuPont PDS-1000 particulate acceleration equipment that particulate-DNA aggregate is quickened to embryo.Particulate-DNA aggregate is carried out of short duration supersound process and 10ml is deposited on the huge carrier, and allow ethanol evaporation.By breaking of membrane for polymer (blowout disk) huge carrier being accelerated to stainless steel stops on the screen (stopping screen).Realize breaking by the helium of pressurization.The speed that particulate-DNA quickens is according to the parting pressure decision of blowout disk.Use 200 to 1800 pounds/inch ²(psi) blowout disk pressure, preferably 650 to 1100 pounds/inch ²And about 900 pounds/inch ²Be most preferred.Use a plurality of dishes to produce the parting pressure of certain limit.

The shelf that will contain the flat board that is mounted with embryo is held in place following 5.1cm place (shelf #3), huge carrier platform bottom.For carrying out particle bombardment, blowout disk and the huge carrier that is loaded with dry particles-DNA aggregate are installed in the equipment the immature embryo of cultivating.The He that is delivered to equipment pressed to be adjusted to be higher than 200 pounds/inch of rupture disk ruptures pressure ²The culture dish that is loaded with the target embryo is put into vacuum chamber and place the transmission path that quickens particulate.In the chamber, produce vacuum, preferably about 28 inches Hg.After finishing operation of equipment, discharge vacuum and take out culture dish.

In the bombardment process, remained in the substratum that osmotic pressure regulated by the embryo that bombarded, and continue 1-4 days subsequently.Embryo is transferred to by the basic salt of N6, Eriksson VITAMIN, 0.5mg/l vitamin, 30gm/l sucrose, 1mg/ l 2,4 dichloro benzene ethoxyacetic acid, 2gm/lGelrite and 0.85mg/l AgNO ₃(Herbiace is Meiji) in the selection substratum of Zu Chenging with the 3mg/l bilanafos.The bilanafos that adds filtration sterilization.With 10 to 14 days intervals embryo subculture is cultured on the selection substratum of newly joining.After about 7 weeks, organize from about 7% the embryo that supposition transformed selection and non selected marker gene that through the embryo of bombardment, breeds.The genetically modified organism of rescue supposition is used as the tissue that derives from single embryo as an incident and breeds on the substratum selecting independently.Select minimum organized embryo generation continuous tissue fragment to finish two by range estimation and take turns clonal propagation.

Processing from the tissue sample of each incident to reclaim DNA.With the described DNA of the restricted cutting of restriction endonuclease, and survey with design be used for the increasing primer sequence of the dna sequence dna that acellular mitogen biosynthetic enzyme with phytokinin biosynthetic enzyme and plasmid partly overlaps.But tissue takes place the embryo that will have extension increasing sequence is further used for plant regeneration.

For the regeneration of transgenic plant, organize succeeding transfer culture in 100 * 25mm culture dish, to comprise MS salt and VITAMIN (Murashige ﹠amp embryo; Skoog, Physiol.Plant15:473 (1962)), 100mg/l inositol, 60gm/l sucrose, 3gm/l Gelrite, 0.5mg/l zeatin, 1mg/l indole-3-acetic acid, 26.4ng/l be suitable-substratum of anti--dormin and 3mg/l bilanafos in, and till, the sophisticated somatic embryo that good growth forms until seeing 28 ℃ of following dark culturing.This needs about 14 days.The good somatic embryo that forms is opaque and is creamy, and is made up of confirmable scultellum and coleoptile.With embryo individually succeeding transfer culture in 100 * 25mm culture dish, contain in the substratum of MS salt and VITAMIN, 100mg/l inositol, 40gm/l sucrose and 1.5gm/l Gelrite, and illumination in 16 hours: 8 hours dark photoperiod and 40 meinsteinsm ^-2Second ^-1Carry out incubation under (coming self cooling white fluorescent tube).After about 7 days, somatic embryo has been sprouted and has been produced very clear and definite stem and root.With in the germination medium of single plant succeeding transfer culture in 125 * 25mm Glass tubing so that plant further grow.Plant is remained on illumination in 16 hours: 8 hours dark photoperiod and 40 meinsteinsm ^-2Second ^-1(under (coming self cooling white fluorescent tube).After about 7 days, plant grows up to well and is transplanted in the horticultural soil, and soil pressure is real, and potted plant in the commercial greenhouse soil mixture, and grows into sexual maturity in the greenhouse.The original seed self-mating system is pollinated to the regenerated transgenic plant as male.

Agrobacterium-mediated:

When using agrobacterium-mediated conversion, with the same method of using Zhao in PCT patent public affairs WO98/32326, its content is incorporated herein by reference.In brief, from corn, separate immature embryo and embryo contacted (step 1: the infection step) with edaphic bacillus suspension.In this step, preferably immature embryo is immersed and begin to carry out incubation in the edaphic bacillus suspension.Embryo and edaphic bacillus are cultivated for some time altogether (step 2: be total to culturing step).Preferably after infecting step, immature embryo is cultivated on solid medium." static " step that expection is chosen wantonly after this cultivates the period altogether.In this static step, under the situation that does not add the selective reagents that is used for vegetable transformant, embryo is carried out incubation (step 3: static step) under the situation of the microbiotic existence of at least a known inhibition edaphic bacillus growth.Preferably immature embryo is cultivated and contained microbiotic but do not contain on the solid medium of selective reagents, to remove edaphic bacillus and to carry out the static phases of described infected cells.Then, the embryo culture of inoculation in containing the substratum of selective reagents, and is reclaimed the callus (step 4: select step) of the conversion in the growth.Preferably, immature embryo is cultivated on the solid medium that contains the selective reagents that causes the transformant selective growth.Then callus regeneration is become plant (step 5: regeneration step) and preferably will be grown in the callus culture selected on the substratum on solid medium with aftergrowth.

Embodiment 3: the evaluation that high phytokinin transgenic corns is

Use directly measure and body in the phytokinin level that just improved of the related combination transformant of screening gained.

Vivipary experiment (glb1:ipt construct)

Because recognizing seed dormancy is to be subjected to ABA: the control of the ratio of phytokinin, so the phytokinin level that has improved in the seed can be induced the vivipary phenotype.

The conversion of using GS3 embryo and edaphic bacillus (polynucleotide 11551 of the present invention and 11552) or biology to launch striking (polynucleotide 11466 of the present invention and 11467) mediation has started the Glb1::ipt transformant.Regenerate after 2-3 month plantlet and after 2-3 month, these plantlets (T0 ' s) being transferred in the greenhouse.In flowering period, with HG11 and T0 ' s hybridization and in developmental T1 seed, detecting vivipary after about 30 days.Save the developmental T1 seed of performance vivipary phenotype by under the situation of not carrying out seed drying, planting (replant) again.Whether analyze the plant that can survive by PCR and blade painted (paint) exists with definite ipt gene and selective marker (pat gene).The T1 flowering of plant and with the fringe selfing to produce the T2 seed.Those plants of carrying ipt gene (PCR and blade are painted to be positive) have produced 3: 1 isolating seeds to described gene, but PCR does not produce with the painted plant of being negative of blade and separates.

Phytokinin is determined

Pollination back (DAP) 19 and 23 days is from four multiple of each incident (11551 and 11552), 10 seeds of results each.Then seed is separated into embryo and endosperm and is chilled in the liquid nitrogen.In each Date of Sampling, will lump together and definite phytokinin level from 4 multiple embryo tissues.Handle endosperm tissue with similar methods.The results are shown among Fig. 1.

Glb1::ipt seminal propagation:

In order to breed the vivipary seed, half in 25DAP gathers in the crops each incident in the remaining plant.Fringe is placed in the moisture eliminator box and blows 3 days with dry seed slowly with ambient air (22 to 25 ℃).The moisture eliminator box that the transgenosis fringe will be housed then is transferred in the grown cultures chamber and with 35 ℃ of blows air over seeds 3 to 5 days, is dried to about 12% humidity.Then with the shelling of single fringe and with the seed storage under 10 ℃ and 50%RH.

Phenotype is determined

Be to determine the ratio of the seed of performance vivipary, at about 45DAP results fringe and mark to seed from half remaining plant with regard to the vivipary degree.Four ranks of vivipary are defined as:

Rank 1: do not have obvious coleoptile protuberance.

Rank 2: visible coleoptile protuberance, but do not prolong.

Rank 3: visible coleoptile protuberance and prolongation surpass scultellum, but do not break through pericarp.

Rank 4: visible coleoptile protuberance and prolongation surpass scultellum and break through pericarp.

The results are shown in down in the tabulation 1

Table 1

Incident	SID#	PCR result	The painted result of blade	T2 characterizes the vivipary result	The vivipary of 45 DAP characterizes				Total seed #
										Rank 1	Rank 2	Rank 3	Rank 4
					11551	751412 751415 751416 751417 751420 751422	++++++	++++++						+ + + + + +	4 0 99 167 2 0	4 169 28 55 193 141	7 34 18 39 47 93	4 2 59 18 0 11	19 205 204 279 242 245
	Amount to								272	590	238	94	4194
					11551	751425 751426 751429 751432	++++	++++						+ + + +	50 0 56 41	57 75 40 16	85 64 19 14	4 12 4 4	196 151 129 75
	Amount to								157	100	102	24	551
					11551	751433 761434 751435 751436	----	----						- - - -	438 405 375	0 0 0	0 0 0	0 0 0	438 405 375
	Amount to								406	0	0	0	406
					11551	751437 751438 751439 751443	++++	++++						+ + + +	14 52 128 70	50 37 92 84	78 128 101 89	19 10 9 4	161 227 330 247
	Amount to								264	263	398	42	963
					11551	751441 751442 751444	-+-	---						- -	375 343	0 0	0 0	0 0	375 343
	Amount to								359	0	0	0	359
					11551	751445 751448 751450 751451	++++	++++						+ + + +	168 4 101 101	76 126 83 33	38 79 44 48	9 3 14 1	281 212 242 183
	Amount to								364	318	209	27	918
					11552	752902 752908 752910 752911 752912 752913 752914 752919	++++++++	++++++++						+ + + + + + + +	16 35 9 2 0 49 75 25	53 74 132 148 40 36 47 72	62 24 14 39 27 36 12 80	4 4 0 3 2 8 21 16	135 137 155 192 69 129 155 193
	Amount to								211	602	294	58	1165
					11551	752924 752930 752936 752937 752939 752940	++++++	++++++						+ + + + +	109 6 53 53 58 0	57 27 60 36 48 1	98 22 47 70 68 0	16 10 3 10 6 0	260 55 163 169 160
Amount to									279	229	305	45	857

The phenotype estimated result shows that with respect to the plant of no gene, the existence of ipt gene causes bigger vivipary that (2 grades to 4 grades) take place.

The seed that increases is done unit mass (gz:ipt construct):

Because nuclear mass is the function of the number of albuminous cell and amyloplast, and phytokinin relates to be increased the albuminous cell number and relates to from protoplast differentiation amyloplast, and generation is corresponding on the unit mass increases so the seed of the phytokinin level that performance increases should be done at seed.

Start the Gz::ipt transformant with GS3 embryo and agrobacterium-mediated conversion (polynucleotide 11550 of the present invention).In 1997, the plantlet of regenerating 2-3 the middle of the month was transferred to these plantlets (T0 ' s) in the greenhouse after 2-3 month.In flowering period,, and seed is used for once again seminal propagation (backcrossing and self-pollination with HG11) with HG11 and T0 ' s hybridization and in ripening stage results fringe, shelling.Plant T2 seed (BC2 generation and selfing) then.Chromatographic analysis T2 plant to determine respectively whether ipt gene and selective marker (pat gene) exist by using PCR and blade.The subgroup of these plants is carried out self-pollination in order to definite phytokinin, or carry out open pollination and determine (output and output constitute) to be used for phenotype.

Phytokinin is determined

But collected specimens also analysis is carried out as follows.At 10,16 and 22 DAP, from 2 repetitions (each repetition is made up of 2 subsamples) of each incident, gather 50 to 100 seeds and remove bennet.For 10 DAP samples, remaining seed tissue directly can be put into liquid nitrogen (tissue that is defined as " seed " mainly is made up of pericarp, aleurone layer, endosperm and megarchidium).On the contrary,, at first embryo can be dissected from remaining seed tissue (be defined as the tissue of " seed deducts embryo ", and mainly be made of pericarp, aleurone layer and endosperm), then two kinds of tissues directly be put into liquid nitrogen 16 and 22DAP.

Phenotype is determined

Be to determine of the influence of gz::ipt construct to seed quality, at the manual results individual plants of physiological maturity (layer of visible black color), with the seed shelling and with oven drying to constant-quality (104 ℃, minimum 3 days).Determine output (g plant) and output constitute (fringe of every strain plant, the seed on each fringe and the weight of every seed) on nascent fringe and secondary fringe.

The seed-setting frequency that increases and the number seeds of increase

(ltp2:ipt construct):

Because output is the seed-setting frequency of each fringe and the combination of number seeds, so should have the fringe that on seed-setting and number, has corresponding increase at seed-setting and the early stage seed that shows the phytokinin level that increases of formation.

Start the ltp2:ipt transformant with GS3 embryo and agrobacterium-mediated conversion (12425).In 1998, the plantlet of after 2-3 month, regenerating, and after 2-3 month, these plantlets (T0 ' s) are transferred to the greenhouse.In flowering period, be used for seminal propagation once again (backcrossing and self-pollination) with HG11 with HG11 and T0 ' s hybridization and at ripening stage results fringe, shelling with seed.The number seeds of each T0 incident and seed-setting event number and other are had promotor: the number of the transgenic event of the assortment of genes but not ltp2:ipt compares.The results are shown in the table 2.

Table 2.1998 is year at Johnston, IA, the seed-setting mean number of ltp2:ipt gene T0 incident and the contrast of the gene of other T0 plant that grows under identical greenhouse experiment.

The polypeptide of invention	Gene is described	The T0 number	The %T0w/ seed	Seed mean number #
					12425	ltp2：ipt	35	82.9	198
12384	Xylogen	92	22.8	145
					12417	Sugar	40	55.0	156
12427	Ripe	35	45.7	69
					12428	Xylogen	29	75.9	174
12723	Xylogen	35	62.9	184
					12724	Xylogen	35	45.7	161

By comparing seed-setting per-cent and the seed mean number # of each T0 plant, compare with 6 other transgenosiss combination T0 plants that grow under identical time and identical greenhouse experiment, ltp2:ipt has the highest seed bearing T0 plant per-cent and the highest seed numerical value mean number #.These results show that the per-cent that the expression of phytokinin in the early stage aleurone layer of seed development can be by increasing seed bearing plant and the seed-setting number of each fringe increase output.

In generation subsequently, be grown in position, different field to determine comparing its seed-setting and number seeds feature and seed production with the non-transgenic contrast with identical genetic background.Also can examine measurement phytokinin level at the transgenosis and the non-transgenic of similar genetic background.

Phytokinin is determined:

Can following collection and analytic sample.Can from two repetitions (each repeats to comprise 2 subsamples) of each incident, gather 50 to 100 seeds and remove bennet at 2,6 and 22 DAP.For 2,6 and the 22DAP sample, remaining seed tissue directly can be put into liquid nitrogen (tissue that is defined as " seed " mainly is made up of pericarp, aleuron, endosperm and megarchidium).

The separation of embodiment 4-ipt and ckx1-2 separate

In brief, made up and preferably comprised the PCR primer in restriction endonuclease site easily.Two useful primers show below:

SEQ ID NO:38 (upstream primer (Upper primer)) with Bam HI site

5′caucaucaucauggatccaccaatggatctacgtctaattttcggtccaac 3′

SEQ ID NO:39 (downstream primer (Lower primer)) with Hpa1 site

5′cuacuacuacuagttaactcacattcgaaatggtggtccttc 3′

The restriction site of primer indicates with runic.Extend to 3 ' end from Nucleotide 22 and 19 respectively with template bonded primer part.Introducing BamHI site " ggatcc " (runic sign) and Kozak consensus sequence before the initiator codon and after terminator codon, introducing Hpa I site " gttaac " (also indicating) with runic.Following is to show primer is how to connect the synoptic diagram that is attached on the described disclosed sequence.

BamHI

5′caucaucaucauggatccaccaatggatctacgtctaattttcggtccaac

aatggatctacgtctaattttcggtccaacttgcacaggaaaga

catcgactgcgatagctcttgcccagcagactggcctcccagtcctctcgctcgatcgcgtccaatg

ctgtcctcaactatcaaccggaagcgggcgaccaacagtggaagaactgaaaggaacgactcgtctg

taccttgatgatcgccctttggtaaagggtatcattacagccaagcaagctcatgaacggctcattg

cggaggtgcacaatcacgaggccaaaggcgggcttattcttgagggaggatctatctcgttgctcag

gtgcatggcgcaaagtcgttattggaacgcggattttcgttggcatattattcgcaacgagttagca

gacgaggagagcttcatgagcgtggccaagaccagagttaagcagatgttacgcccctctgcaggtc

tttctattatccaagagttggttcaactttggagggagcctcggctgaggcccatactggaagggat

cgatggatatcgatatgccctgctatttgctacccagaaccagatcacgcccgatatgctattgcag

ctcgacgcagatatggagaataaattgattcacggtatcgctcaggagtttctaatccatgcgcgtc

gacaggaacagaaattccctttggtgggcgcgacagctgtcgaagcgtttgaaggaccaccatttcg

aatgtga

3′cctggtggtaaagcttacact

cattgaucaucaucauc

HpaI

The Agrobacterium tumefaciens of tl plasmid pTi Bo542 have been obtained to carry (referring to Guyon, P., Deng the people, Agropine in null-type crown gall tumors:Evidencefor generality of the opine concept, Proceedings of the NationalAcademy of Sciences (U.S.) 77 (5): 2693-97 (1980); Chilton, W.S. waits people Absolute stereochemistry of leucinopine, a crowngall opine, Phytochemistry (Oxford) 24 (2): 221-24 (1985); Strabala, T.J. waits the people, Isolation and characterization of anipt gene from the Ti plasmid Bo542, Molecular ﹠amp; General Genetics216:388-94 (1989)), and the bacterium that will live as pcr template.The PCR condition of use standard.The example of this condition is as follows: the reaction volume of per 100 μ l in thin-walled tube, and with 0.5 μ L10ng/ μ L target plasmid, 0.05 unit/μ L Taq polysaccharase, each 0.5 μ M primer, 0.8mM dNTP ' s1X damping fluid.Mix reagent places on ice.Xiang Guanzhong adds the target plasmid, adds 100 μ L reaction mixtures to each pipe then.In thermal cycler 95 ℃ of following preincubation 3 minutes.Then carrying out 35 seconds at 95 ℃, 55 ℃ are carried out carrying out in 1 minute and 72 ℃ circulation in 1 minute 5 times.Then carrying out 35 seconds at 95 ℃, 65 ℃ are carried out carrying out in 1 minute and 72 ℃ circulation in 1 minute 30 times.Finished in 10 minutes to react and allow to be immersed under 6 ℃ by staying at 72 ℃.Use by the test kit of Life Technologies preparation according to manufacturer's explanation then the PCR product cloning is gone into DH5 α cell.From the transformant of inferring, extract DNA,, and run glue to confirm conversion with BamHI and HpaI cutting.Should insert fragment then and carry out gel-purified and be transformed into easily in the expression vector, for example contain in 7921 carrier DNAs of Ubi promotor and pinII terminator.

In Molecular and General Genetics 216:388-394 (1989), provide preferred dna sequence dna.The proteic open reading-frame (ORF) that it comprises 239 amino acid of coding, have the deduced molecular weight of about 26.3kDa (press amino-acid residue number X110 calculate).

Maize cell mitogen oxidase gene, the separation of cytox1-2

Another preferred dna sequence dna is provided by following SEQ.I.D.NO:1.It comprises coding about 535 amino-acid residues (SEQ ID NO.:2), has the proteic open reading-frame (ORF) of the deduced molecular weight (press amino-acid residue number X110 calculate) of about 58.9kDa.The known DNA synthetic method of technician in the synthetic field of applying gene can be synthesized the copy for preparing cytokinin oxidase.Selectively, can from the biology that carries cytokinin oxidase, copy by direct isolated genes by the PCR clone.The Roy Morris of University of Missouri has cloned maize cell mitogen oxidase gene (ckx1), and sequence is deposited among the Genbank.(people such as Morris, 1999.Isolation of a gene encoding aglycosylated cytokinin oxidase from maize.Biochem.Biophys.Res.Commun.255 (2): 328-333.Also referring to people such as Houba-Herin, 1999.Cytokinin oxidase from Zea mays:purification, cDNA cloningand expression in moss protoplasts.Plant J. (6): 615-626.).Made up and preferably contained the PCR primer in restriction endonuclease site easily: the primer of two uses shows below:

5 ' CATGCCATGGCGGTGGTTTATTACCTGCT 3 ' (having the NcoI site) at 5 ' end

5 ' CGGGATCCTCATCATCAGTTGAAGATGTCCT 3 ' (having the BamHI site) at 3 ' end

These primers are at the sequences Design of ckx1, and use reverse transcriptase PCR (RT-PCR) with isolated cell mitogen oxidase gene from several different tissues of developmental corn nuclear.Amplification of DNA fragments from following tissue: the endosperm of 10 DAP, 13 DAP, 18 DAP and 20 DAP; With the embryo of 10 DAP, 18 DAP and 20 DAP, wherein DAP is a pollination back fate.From fragment in a organized way in gel, migrate to 1.6kb, this length with disclosed sequence is identical.We select one of them fragment (from 18 DAP embryos) and to described dna sequencing.This fragment is called Cytox1-2 herein, and its full length sequence is provided by following SEQ ID NO.:1.On amino acid levels, have 98% homology between ckx1 gene and the cytox1-2, therefore, one skilled in the art will recognize that cytox1-2 is the cytokinin oxidase gene from corn.

The expression of embodiment 5. transgenosiss in monocotyledons

Structure comprises the Zag2.1 promotor (SEQ ID NO:3) of the isolating Nucleotide (SEQ ID NO:1) that may be operably coupled to coding ipt or the plasmid vector of Zap promotor (SEQ ID NO:5 is also referred to as ZmMADS) or tb1 promotor (SEQ ID NO:17).By following method this construct is imported maize cell then.

From the developmental caryopsis that derives from the hybridization of corn plants system, separate and cut immature maize.10 to 11 days separation embryos after pollination, its about 1.0 to 1.5mm length at this moment.Then embryo is placed down by the axle side and contacted with agarose solidified N6 substratum (people (1975) Sci.Sin.Peking 18:659-668 such as Chu).Embryo is kept in the dark down at 27 ℃.Breed from the scultellum of these immature embryos and frangible embryo generation callus, described embryo generation callus is had the somatocyte proembryoid and the embryoid that are positioned at the structural production of suspensor and is formed by undifferentiated.To separate embryo generation callus culture from nascent explant on the N6 substratum, and per 2 to 3 all succeeding transfer culture are on these substratum.

For selective marker is provided, plasmid p35S/Ac (Hoechst Ag, Frankfurt, Germany) or coordinator can be used for transformation experiment.This plasmid contains the Pat gene (disclosing 0 242 236 referring to European patent) of coding phosphinothricin acetyl transferase (PTA).The PAT enzyme is given the weedicide glutamine synthase inhibitor resistance of phosphinothricin for example.Pat gene among the p35S/Ac (people (1985) Nature 313:810-812 such as Odell) under from the control of the 35S promoter of cauliflower mosaic virus, and comprise 3 ' zone from the nopaline synthase gene of the Ti-plasmids T-DNA of Agrobacterium tumefaciens.

Alpha bombardment method (people (1987) Nature 327:70-73 such as Klein) is changed over to gene in the callus culture cell.According to this method, use following technology to give golden particulate (diameter 1 μ m) bag by DNA.10 μ g plasmid DNA s are added in the 50 μ L gold microparticle suspending liquids (every mL 60mg).The base (solution of 20 μ L 1.0M) that in particulate, adds calcium chloride (solution of 50 μ L 2.5M) and no spermidine.Vortex suspension during adding these solution.After 10 minutes, pipe is carried out of short duration centrifugal (15,000rpm 5 seconds) and removes supernatant liquor.With particulate be resuspended in the 200 μ L dehydrated alcohols, centrifugal and remove supernatant liquor again.Carry out the ethanol rinsing once more and particulate is resuspended in the ethanol that final volume is 30 μ L.The golden particulate aliquots containig (5 μ L) that DNA can be wrapped quilt is positioned over the central authorities of Kapton flying disc (Bio-Rad Labs).Then at 1000 pounds/inch ²The clearance distance of helium pressure, 0.5cm and the flying distance of 1.0cm under (Bio-Rad Instruments HerculesCA) accelerates to particulate in the corn tissue with Biolistic PDS-1000/He.

For bombarding, tissue is taken place in embryo be placed on the filter paper that overlays on the agarose solidified N6 substratum.Tissue is discharged the also border circular areas of the about 5cm of covering diameter like that by thin lawn.The culture dish that tissue is housed can be placed on distance stops to shield in the PDS-1000/He cell of about 8cm.Then the cell air is evacuated to the vacuum of 28 inches Hg.Quicken huge carrier by barrier film safe in utilization with the helium shockwave, the He of described blowout disk in impact tube presses and reaches 1000 pounds/inch ²The Shi Fasheng explosion.

After bombardment, tissue can be transferred in the 7th day and contain careless ammonium phosphine (gluphosinate) (every liter of 2mg) and lack in the N6 substratum of casein and proline(Pro).Described tissue continues slow growth in this substratum.Contain newly the joining in the N6 substratum of careless ammonium phosphine after tissue being transferred in 2 weeks.After 6 weeks, on being equipped with the plate of the substratum that careless ammonium phosphine replenishes, some can identify the callus of the active growth of the about 1cm area of diameter.These callus can continued growth when on selecting substratum, carrying out succeeding transfer culture.

Replenished 2 of every liter of 0.2mg by at first organizing bunch to be transferred to, can be from described transgenic calli in the N6 substratum of 4-D aftergrowth.Described tissue can be transferred to after 2 weeks (people such as Fromm, (1990) Bio/Technology 8:833-839) in the regeneration culture medium.

The expression of embodiment 6. transgenosiss in dicotyledons

As described below, with the embryo of the plasmid bombardment soybean that comprises the Zag2.1 promotor on the heterologous nucleotide sequence that may be operably coupled to coding ipt.Be the inductor somatic embryo, separation length is the cotyledon of 3-5mm from the immature seed of the surface sterilization of soybean culture kind A2872, is cultivating 6 to 10 weeks on suitable nutrient agar under illumination or the dark under 26 ℃ then.Cutting produces the somatic embryo of secondary embryo and puts into suitable liquid nutrient medium then.Behind the somatic embryo that repeats to select as early stage spherical stage embryo, to breed bunch, as described belowly keep described suspension.

Can be on gyrate shaker, under 150rpm and 26 ℃, 16:8 hour day/night (use luminescent lamp) arrangement of time under soybean embryo generation suspension culture is remained in the 35ml liquid nutrient medium.Per 2 weeks are carried out succeeding transfer culture by about 35mg tissue is inoculated in the 35ml liquid nutrient medium to culture.

Can bombard the method soybean transformation embryo generation suspension culture of (people (1987) Nature (London) 327:70-73 such as Klein, U.S. Patent number 4,945,050) then by particle gun.Can use DuPont Biolistic PDS1000/HE instrument (helium modified version) to carry out these conversions.

The selectable marker gene that can be used for promoting soybean to transform is by from the 35S promoter of cauliflower mosaic virus people such as (, (1985) Nature 313:810-812) Odell, from the hygromycin phosphotransferase gene of plasmid pJR225 (from intestinal bacteria; People such as Gritz (1983) Gene 25:179-188) and from 3 ' zone of the nopaline synthase gene of the T-DNA of the Ti-plasmids of Agrobacterium tumefaciens form.It is separated that the purpose expression cassette of heterologous polynucleotide that comprises Zag2.1 promotor and coding ipt can be used as restricted fragment.Then this fragment is inserted the single restriction site of the carrier that carries marker gene.

In the golden microparticle suspending liquid of the 1 μ m of 50 μ L 60mg/ml, add (in order): 5 μ L DNA (1 μ g/ μ L), 20 μ L spermidines (0.1M) and 50 μ L CaCl ₂(2.5M).Stirred described microparticle formulation then 3 minutes, rotation is 10 seconds and remove supernatant liquor on Eppendorf centrifuge.The particulate that then DNA is wrapped quilt washs in 400 μ L, 70% ethanol and once and again is suspended in the 40 μ L dehydrated alcohols.Can be with DNA/ microparticle suspending liquid supersound process three times, each 1 second.Golden particulate with 5 microlitre DNA bag quilt is loaded on each huge carrier plate then.

The suspension culture in 2 ages in week of about 300-400mg is placed in empty 60 * 15mm culture dish and with pipettor from tissue, removes residual liquid.For each transformation experiment, bombard the tissue of about 5-10 plate usually.Film rupture pressure is arranged on 1100 pounds/inch ²And cell is evacuated to the vacuum of 28 inches mercury.Be placed on tissue apart from the local of 3.5 inches of retaining screens (retainingscreen) and bombard 3 times.After the bombardment, can organize in two and be returned in the liquid described, and cultivate as mentioned above.

Bombardment back 5 to 7 days, the available substratum of newly joining is changed liquid nutrient medium, and substratum is changed with the substratum that contains the 50mg/ml Totomycin of newly joining in bombardment back 11 to 12 days.Can change this selection substratum weekly.In 7 to 8 weeks after bombardment, can be observed the green tissue that transforms and from the embryo of unconverted necrosis takes place bunch, grow.Take out isolating chlorenchyma and be inoculated in the one flask to produce conversion embryo generation suspension culture new, clonal propagation.Can with each new be to handle as transformation event independently.These suspension can be carried out succeeding transfer culture then, and be used as that immature embryo family keeps or the maturation by single somatic embryo and sprout the complete plant of regeneration.

Embodiment 7. compels the fringe growth velocity of T1 (D2F1 hemizygote) plant under the condition in non-association Analysis.

As corn is transformed described in the embodiment 5 with the zag2.1::ipt construct.(D2 is meant parent's 2 multiple doses to produce the D2F1 seed to the aftergrowth pollination with one of them parent genotype; Be also referred to as the T1 seed).In 17 primary transformant, select 9 to be used for based on favourable hereditary complexity (that is, the list of determining by the southern blotting technique analysis-to the low copy number order), the integrity (as analyzing determined) of plant transcription unit and the further analysis of sufficient seed quantity by southern blotting technique.

With D2F1 seed kind at Johnston, the repetition of Iowa, the good experimental plot of irrigating.Measure the dry biomass of the fringe of not pollinating when initial fringe silk occurs and after 7 days.Difference with amount of dry matter is calculated fringe growth velocity (EGR) divided by fate.As shown in Figure 2, with respect to the negative sisters' strain of the transgenosis of plantation in contrast, 9 are subjected to have in the examination incident 4 to show that the fringe growth velocity increases.Confirmed that by RT-PCR the ipt transcript is present in the developmental fringe of representing all 9 incidents.

Yet the space constraint in field makes can not directly carry out the transgenic positive of similar events as and homologous genes type and the comparison of transgenosis heliophobous plant.As an alternative, the T1 seed gross sample of the long self-separation of the control plant in the present embodiment.It is thinning to standard density to contrast patch; Equally, remove the plant (by leaf being carried out painted evaluation) of transgenic positive with weedicide.As the result that the field condition of bulk crossing incident and genotype and transgenic plant relative comparison plant changes, the difference between transgenosis and the control plant on EGR is ambiguous and the result is non-decision.Therefore, next year all carries out volume analysis to all 9 incidents.

There is the difference of fringe growth velocity in expection for transgenic event, and can keep under the constant situation by directly estimating relatively rightly in genetic background and field growing condition.

Embodiment 8. compels the analysis of T2 (D3F1 hemizygote) plant biomass under the condition in non-association

To represent 9 to select the T2 seed (deriving from recurrent parent) of incident to be planted in Johnston, in the non-repetition of Iowa, the good experimental plot of irrigating to the T1 plant pollination.Determine that by rna blot analysis the ipt transcript is present in the developmental fringe.The negative sisters' strain of the transgenosis of each incident is planted in contrast, and each incident is carried out to mode is analyzed (variance analysis) and incident mean number is analyzed.All are tried plant emasculation flower fringe and pollinated by blended non-transgenic male parent.

By collecting nascent fringe determine output.With cereal by incident with by genetically modified existence or there is not mixing; Then with cereal with oven drying and measure total dry biomass.The results are shown among Fig. 3.The grain yield that has 7 in 9 incidents is greater than the output of contrast.Also check figure order, spike length degree and nuclear mass are measured; On the spike length degree, there is 5 genetically modified result to surpass non-transgenic sisters strain in 9 incidents; For the dry-matter of check figure order and each nuclear, there is 5 genetically modified result to surpass non-transgenic sisters strain in 9 incidents.

The embodiment 9.D4F3 analysis of plant on output and plant height of isozygotying

In 2002, at Johnston, the good experiment Tanaka who irrigates of the multiple of Iowa selected the offspring of future generation of incident to estimate to 9.The negative sisters' strain of transgenosis is planted in contrast.All are tried plant emasculation flower fringe; The mixture of non-transgenic plant is used as pollen source.

Measure plant height at V10 and V12.(about growth phase, referring to How a Corn Plant Develops, Iowa State University of Science and TechnologyCooperative Extension Service Special Report No.48, ReprintedJune 1993.).As shown in Figure 4, there are 5 showing increase significantly on the statistics on the plant height in 9 incidents.

Come determine output by collecting all fringes that produce cereal.Suitably grain is mixed, dry and measure total dry biomass.As shown in Figure 5, on output, there are 3 to show increase significantly on the statistics in 9 incidents, comprise two incidents that wherein also show the plant height that increases.As shown in Figure 6, spike number order, check figure order and nuclear mass are also measured.

Embodiment 10. compels output, plant height, the blade edge of D4F3 plant down in arid association The analysis of look, biomass and transgene expression.

The revision test Tanaka of California estimated the offspring of isozygotying of 9 incidents at Woodland in 2002.Stop supplement irrigation during flowering period, the association that is enough to the underproduction 40% to 50% with target compels.For reaching this purpose, after plantation, begin to stop to irrigate and irrigate again at 1860GDUs from 920GDUs (extent of growth unit).All are tried plant emasculation flower fringe also pollinates with blended non-transgenic plant male parent.Determine the existence of ipt transcript by the rna blot analysis of developmental stem, leaf and male flower fringe.

An about week is measured the green of blade with Minolta SPAD chlorophyll measuring apparatus before blooming.Measure plant height simultaneously.As shown in Figure 7, there are 5 showing to have increase significantly on the statistics on the plant height in 9 incidents.As shown in Figure 8,4 and an other leaf green that the incident demonstration increases are arranged in these 5 incidents.

By collecting the fringe determine output that all have cereal.Suitably mix the total dry biomass of grain, oven dry and measurement.Also check figure order, spike number order and nuclear mass are measured.As shown in Figure 9, there are 3 to produce the yield result that improves in 9 incidents; All these three incidents also show the plant height and the leaf green of increase.An increase on phytomass in these incidents is shown in Figure 10.In addition, be subjected in the examination incident at all, with respect to the transgenosis heliophobous plant, the transgenic positive plant shows all that in various nutrition and germinal tissue the steady state level of ipt transcript increases.

Embodiment 11. compels under the condition transgenosis to the analysis of output effect in non-association

In the ground of supplement irrigation several constructs are tested in preliminary screening with regard to its influence to output on request at one.All constructs are used as a plurality of incidents, original seed parent's 2 multiple doses and are estimated, and repeat to check self output by two of each incidents.Only gather in the crops the transgenic positive plant, all incidents are carried out each other comparison with regard to the favourable aspect of its output then.The described table 2 that the results are shown in wherein carries out classification by output to different constructs, output the highest at the top and output minimum be positioned at the bottom.Second hurdle writes down thick output, and third column writes down different between the mean value of described clauses and subclauses and all constructs.

Table 2

PHP	Bu/acr	Construct subtracts other constructs	S.E.	The P value
					PHP19698PHP19020PHP19874PHP15418PHP16036	138.0 137.4 135.8 132.0 131.2	Mean value bu/acr 13.05 12.54 10.87 9.00 6.23	5.81 5.54 5.06 1.85 4.86	0.0248 0.0236 0.0318 ＜.0001 0.2006
PHP19304	129.4	4.42	4.17	0.2895
					PHP19369	128.6	3.57	4.17	0.3925
PHP19512	126.4	1.30	4.17	0.7543
					PHP19513	126.0	0.85	4.22	0.8399
PHP19815	124.3	-0.89	4.35	0.8375
					PHP19380	124.1	-1.07	4.17	0.7977
PHP16889	124.0	-1.18	7.79	0.8794
					PHP17897	123.3	-1.87	5.67	0.7416
PHP16037	122.9	-2.34	4.97	0.6378
					PHP19699	122.7	-2.58	4.32	0.5497
PHP18070	122.1	-3.11	4.97	0.5315
					PHP16176	121.7	-3.52	5.22	0.5011
PHP16178	121.5	-3.74	6.08	0.5385
					PHP16172	120.8	-4.45	5.58	0.4258
PHP19523	120.5	-4.82	4.20	0.2478
					PHP19814	120.3	-5.04	4.37	0.2504
PHP19368	118.4	-6.92	4.17	0.0968
					PHP19514	118.1	-7.31	4.20	0.0812
PHP19822	117.4	-8.23	4.91	0.0936
					PHP18015	114.5	-10.92	4.99	0.0288
PHP19370	114.0	-11.56	4.20	0.0058
					PHP19303	108.9	-16.90	4.17	＜0.001

Have than other any one at vertical 4 constructs of table as can be seen and tried significantly higher output of construct.Similarly, three constructs show the output that significantly is lower than any one other construct in this check.Remaining is not having significant difference each other thereby can suppose that it only is the influence of background genotype that its transgenosis does not have generation obviously to be different from.In this check, have 4 to be driven the IPT construct of expressing by Zag 2.1 or Zap and this group is represented four production peaks in this check construct: PHP19698Zap::IPT, have Ubi:BAR PHP19020 Zag:IPT, have the PHP19874 Zag::IPT of 35s BAR (head to head) and have the original Zag::IPT construct of PHP15418 of 35s BAR (head to head).Although remaining these constructs are tested with 10 incidents of each construct, in fact the recasting of PHP15418 (remake) comprises and surpasses 90 incidents.These results clearly illustrate that the IPT gene and concentrate on the expression promoter/adjusting sequence link coupled influence on every side of female meristematic tissue.

The analysis that embodiment 12.zag2:ipt expresses in soybean

By using methods known in the art with the method soybean transformation embryo generation suspension culture of particle gun bombardment (people (1987) Nature (London) 327:70-73 such as Klein; U.S. Patent number 4,945,050; Hazel waits people (1998) Plant Cell.Rep.17:765-772; Samoylov waits people (1998) In Vitro Cell Dev.Biol.-Plant 34:8-13).

In particle gun bombardment method, may use purifying 1) complete plasmid DNA or, 2) only contain the dna fragmentation of purpose recombinant dna expression box.In the present embodiment, described recombinant dna fragment is isolating from complete plasmid before being used for bombardment.For per 8 bombardments to soyabean tissue, the dna fragmentation that is up to 100 piks (pg) with the base pair of 3mg 0.6 μ m gold particulate and every dna fragmentation prepares 30 μ l solution.

Use 2 recombinant dna fragments to carry out the soybean transformation experiment.The recombinant dna fragment that is used to express the IPT gene is present in and the recombinant dna fragment that separates from the selectable marker gene that provides the sulfonylurea herbicide resistance.Two kinds of recombinant dna fragments all by co-precipitation on golden particulate.

By begin to obtain to be used for the original seed tissue of these transformation experiments from the soybean immature seed.From explant, secondary embryo is cut out after on initial substratum, cultivating for 6 to 8 weeks.Described initial substratum be agar solidify to modify replenished VITAMIN, 2, the MS of 4-D and glucose (Murashige and Skoog (1962) Physiol.Plant 15:473-497) substratum.Secondary embryo is placed on that liquid culture in the flask is kept in the substratum and in 26+/-2 ℃ ,～on the revolution vibrator, kept 7 to 9 days under the 80 μ Em-2s-1 optical density(OD).It is to have replenished VITAMIN, 2, the modified MS substratum of 4-D, sucrose and l-asparagine that substratum is kept in described cultivation.Before bombardment, from flask, take out tissue block and be transferred to 60 * 15mm culture dish of the sky that is used for bombarding.By trace dry tissue on Whatman#2 filter paper.Use about 100-200mg to organize to each plate that is bombarded tissue corresponding to 10-20 piece (each piece size 1-5mm).After the bombardment, will from each tissue in the plate of bombardment separately every plate be put into the liquid-retentive substratum of two flasks through the tissue of bombardment.In bombardment back 7 days, keep substratum (selection substratum) with the cultivation that has replenished the 100ng/ml selective reagents of newly joining and change the liquid nutrient medium in each flask.Be the soya cells of selecting to transform, employed selective reagents is that chemical name is 2-chloro-N-((4-methoxyl group-6 methyl isophthalic acid, 3,5-triazine-2-yl) sulfonylurea (SU) of benzsulfamide (popular name: DPX-W4189 and chlorsulfuron (chlorsulfuron)) aminocarboxyl).Chlorsulfuron is the activeconstituents of DuPont sulfonylurea herbicide (GLEAN ).During 6-8 week, change the selection substratum that contains SU weekly.After the selection period in 6-8 week, can be observed the transforming tissue that from the embryo of unconverted necrosis takes place bunch, grows green island.Separate these transgenic events of inferring and on the substratum that contains 100ng/ml SU, keep 2-6 week (every 1-2 week is changed substratum) again to produce conversion embryo generation suspension culture new, clonal propagation.Embryo is spent about 8-12 week altogether in SU.With the suspension culture succeeding transfer culture and maintain immature embryo bunch state, and maturation that also can be by single somatic embryo and sprout and bear complete plant again.

In the greenhouse, the T1 plant that 1400 strains is derived from 42 zag2:ipt::ALS transgenic events is with high-density (holding 1400 strain plants on the space kind of 480 strains in design) plantation.Mutation ' Jack ' plant of using 18 strains to be grown under the equivalent environment compares.With plant culturing to ripe and load (pod load) with regard to unusual pod bunch or the pod that increases and estimate selection.Measure 83 strain zag2:ipt::ALS plants and every strain pod number of 18 strain Jack plants, every strain seed number and seed weight (converting 100 seed weights to).Use the PROC GLM program among the SAS that data are carried out ANOVA, finish mean number with the PROC MEANS function of using SAS and separate (means separation).

Carry out null hypothesis check to determine the range estimation that the zag2:ipt::ALS plant is loaded with regard to unusual pod bunch or the pod that obviously increases selects whether there were significant differences with unconverted contrast (Jack).To selecting from the plant of 34 incidents, and in the incident of all selections pod number data there were significant differences between ipt plant and Jack (p=0.05).In whole all incidents, the zag2:ipt::ALS plant of described selection on average has 32.1 pods, is significantly higher than average 25.4 pods of (LSD=5.2 pod) Jack by contrast.

On 0.05 level, identified 5 incidents that significantly are different from Jack, and at least 2 strains have been measured from the plant of each incident.When the pod data of these incidents were carried out ANOVA, there were significant difference in zag2:ipt::ALS plant and Jack plant.Plant from the incident of 5 selections has average 42.3 pods, is significantly higher than (LSD=5.9 pod) contrast on the statistics.

The number seeds counting is from two all threshing plants with incident of the highest average pod number (AFS 3579.7.1 and AFS3586.1.2).The Zag2:ipt::ALS plant has 73.6 seeds of average every strain plant, and it is significantly higher than the average seed number (44.7 seeds) (table 5) of (LSD=11.7 seed) every strain Jack plant.Incident does not have difference on the statistics each other.

The pod loading the influence whether seed of each individual plant zag2:ipt::ALS plant of weighing and individual plant Jack plant is increased to determine seed size.100 seed weights from the individual plants of AFS 3579.7.1 and AFS3586.1.2 are 16.6 grams, its with from difference (LSD=1.1 gram) on the no statistics of weight (16.2 gram) of 100 seeds of contrast Jack plant.

The data of investigating show that the zag2:ipt::ALS construct can influence pod number and the seed of every strain plant significantly.In addition, the difference on the no statistics of the Jack of seed size of measured zag2:ipt::ALS plant and non-conversion contrast.High-caliber mutability is present in the greenhouse; Yet, these preliminary data suggest zag2:ipt::ALS constructs can increase every strain plant hold pod number (pod retention) and seed and on seed size no difference of science of statistics.

The separation of embodiment 13-eep1 promoter sequence

Be used for the isolating method of promotor and be described in Clontech Laboratories, Inc., Palo Alto is in the user manuals of the Universal Genome Walker test kit that California sells.Corn seedling blade by 10 ages in days of milling in liquid nitrogen prepares genomic dna, and uses DNeasy Plant test kit (Qiagen, Valencia, Califnia) preparation DNA.Then in strict accordance with the described DNA of use described in the Genome Walker user manuals (ClontechPT3042-1 version PR68687).In brief, use restriction enzyme DraI, EcoRV, PvuII, ScaI and StuI (all are the flush end nickases) dna digestion respectively.Except the flush end enzyme of Clontech suggestion, other three kinds of flush end enzyme EcoICRI, XmnI and SspI also are used for other digestion of branch.Use phenol, use chloroform then, extract DNA with ethanol sedimentation afterwards.The end that Genome Walker connector is connected to restricted DNA is to generate " Genome Walker library ".

About separating the specificity promoter zone, design two non-overlapping gene-specific primers of 5 ' terminal complementary (length 26-30bp) with the corn gene of from sequence library, identifying.Described design of primers be used for the increasing zone of described encoding sequence upstream, i.e. 5 ' of selected gene non-translational region and promotor.Provide the sequence of primer below.First round PCR is carried out in 1 pair of each Genome Walker library of gene-specific primer (gsp) of using Clontech primer APl (SEQID NO:15) and having a sequence shown in the SEQ ID NO:11.

Use reagent that Genome Walker test kit provides in that (Hercules carries out PCR in iCycler type thermal cycler Califonia) available from Bio-Rad.Use following loop parameter: carry out 7 circulations: 94 ℃ were carried out 2 seconds, and 68 ℃ were carried out 3 minutes then, then carried out 32 circulations: 94 ℃ are carried out carrying out 3 minutes in 2 seconds and 67 ℃.Then, sample is remained on 67 ℃ carried out 4 minutes, place 4 ℃ afterwards until further analysis.

Described in user manuals, then will be from the DNA of first round PCR dilution and as second template of taking turns PCR of using Clontech primer AP2 (SEQ ID NO:16) and having that the gene-specific primer (gsp) 2 of sequence shown in the SEQ ID NO:12 carries out.

Second loop parameter of taking turns is: 5 circulations: 94 ℃ were carried out 4 seconds, and 70 ℃ were carried out 3 minutes then, then carried out 20 circulations: 94 ℃ were carried out 4 seconds, and 68 ℃ were carried out 3 minutes then.At last, described sample remains on 67 ℃ to carry out 4 minutes, remained on 4 ℃ then.Each reactant of about 10ml is run glue on 0.8% sepharose, and will be with (500bp or bigger usually) to downcut, with Qiaquick Gel Extraction test kit (Qiagen, Valencia, Califonia) purifying and be cloned into TA carrier pGEMTeasy (Promega, Madison, Wisconsin).The clone is checked order to confirm.

The band that originates from XmnI Genome Walker library contains the sequence of gene-specific primer upstream shown in the SEQ ID NO:12 of 1.5kb.Use primer SEQ ID NOS:13 and 14 to obtain the eep1 promoter region, it is the 1kb genomic dna of A63 from corn plants that described primer generates with amplification according to this sequence.These primers have added the HindIII site at 5 ' end, have added the NcoI site and have added the EcoRV site in the upstream in NcoI site just at the initiation site of translating.Add these sites to help further vector construction.Use PCR supermix Highfidelity (Cat# 10790020, Invitrogen, and Carlsbad, Califonia) (Hercules CA) carries out the PCR reaction in the thermal cycler at Bio-Rad iCycler.Use following loop parameter: 94 ℃ were carried out 2 seconds, then carried out 30 circulations: 94 ℃ were carried out 20 seconds, and 55 ℃ are carried out carrying out 1 minute in 30 seconds and 68 ℃.At last, sample remains on 67 ℃ to carry out 4 minutes, remained on 4 ℃ then until further analysis.Then the PCR product cloning is gone into the pGEM-TEasy carrier (Promega Corp.Madison, WI).The clone is checked order to confirm.

The separation of embodiment 14-eep2 promoter sequence

Be used for the isolating method of promotor and be described in Clontech Laboratories, Inc., Palo Alto is in the user manuals of the Universal Genome Walker test kit that California sells.Prepare genomic dna and use PureGene DNA separating kit (Gentra Systems, Minneapolis, Minnesota) preparation DNA by the leaf of in liquid nitrogen, milling from the corn B73 plant in V6 stage.Then in strict accordance with the described DNA of use described in the Genome Walker user manuals (Clontech PT3042-1 version PR68687).In brief, respectively with the enzyme DraI dna digestion that produces flush end.Use phenol, use chloroform then, extract DNA with ethanol sedimentation afterwards.The end that Genome Walker connector is connected to restricted DNA is to generate " Genome Walker library ".

About separating the specificity promoter zone, design two with the non-overlapping gene-specific primer of from sequence library, identifying of corn EST 5 ' terminal complementary (length respectively do for oneself 27bp).Described design of primers be used for the increasing zone of described encoding sequence upstream, i.e. 5 ' of selected gene non-translational region and promotor.Provide the sequence of primer below.The gene-specific primer 1 (GSP1) that uses Clontech primer AP1 (SEQ ID NO:15) and have AAACACCTTCGGATATTGCTCCCTTTT (SEQ ID NO:21) sequence carries out first round PCR to Genome Walker library.

Use reagent that Genome Walker test kit provides in that (Waltham carries out PCR in PTC-200 DNA Engine thermal cycler Massachusetts) available from MJ Research Inc..Use following loop parameter: carry out 7 circulations: 94 ℃ were carried out 10 seconds, and 72 ℃ were carried out 3 minutes then, then carried out 32 circulations: 94 ℃ are carried out carrying out 3 minutes in 10 seconds and 67 ℃.At last, sample is remained on 67 ℃ carried out 7 minutes, place 8 ℃ afterwards until further analysis.

Described in user manuals, then will be from the DNA of first round PCR dilution and as second template of taking turns PCR of using Clontech primer AP2 (SEQ ID NO:16) and having that the gene-specific primer 2 (GSP2) of TCTCGCATTTGCAGAAACGAACAACGT (SEQ ID NO:22) sequence carries out.

Being used for second loop parameter of taking turns is: 5 circulations: 94 ℃ were carried out 10 seconds, and 72 ℃ were carried out 3 minutes then, then carried out 20 circulations: 94 ℃ were carried out 10 seconds, and 67 ℃ were carried out 3 minutes then.At last, described sample remains on 67 ℃ to carry out 7 minutes, remained on 8 ℃ then.Each reactant of about 10 μ l is run glue on 1.0% sepharose, and 500bp or bigger PCR product are downcut, with Qiaquick Gel Extraction test kit (Qiagen, Valencia, Califonia) purifying.The band that originates from Dra I Genome Walker library contains the sequence of the GSP2 primer upstream of 1.0kb, and with its be cloned into TA carrier pCR2.1 (Invitrogen, Carlsbad, Califonia) in.The clone is checked order to confirm.By using described plasmid is carried out PCR, to obtain the eep2 promoter region corresponding to primer from the upstream of the 1027bp zone in the downstream of AP2 primer and ATG initiator codon.The clone is checked order to confirm.

EST about eep2 distributes as follows:

Ο p0083.cldeu53r B73 " nuclear " " " " 7 DAP examine completely "

Ο p0124.cdbmq47r B73 " nuclear, embryo " " " " blastular on the 6th, screening 1 "

Ο p0062.cymab46r B73 " nuclear, endosperm " " " " coenocytic (4 DAP) blastular, "

Ο p0106.cjlps68r B73 " nuclear " " " " 5 DAP examine completely, screening 1 "

Ο p0124.cdbmq21r B73 " nuclear, embryo " " " " blastular on the 6th, screening 1 "

Ο p0100.cbaab57r B73 " nuclear, embryo, endosperm " " " " coenocytic (4

DAP) blastular, screening 1 (primary 1ib

p0062)″

Ο p0100.cbaac19r B73 " nuclear, embryo, endosperm " " " " coenocytic (4

DAP) blastular, screening 1 (primary lib

P0062)″

Ο p0062.cymal89r B73 " nuclear, endosperm " " " " coenocytic (4 DAP)

Blastular, "

Ο p0062.cymai74f B73 " nuclear, endosperm " " " " coenocytic (4 DAP)

Blastular, "

Be below among the PPM about the Lynx data of this gene:

Title	PPM Adj	Title
			Cen61m	10261	The B73 endosperm, 6 DAP blastulars
Cdk81m	457	Corn is nuclear, embryo and endosperm completely, 8 DAP
			Cpd1-ctr	395	The contrast of corn bennet
Cpd1-drg	375	Corn bennet-drought stress
			Cen81m	312	Corn embryosperm 8DAP
Cper51m
		8	B73,5 DAP pericarps
Cebho41m
		5	Maize Askc0,15 DAP
Cen121m
		2	Corn embryosperm 12 DAP

These data meet with this expression of gene is limited in the developmental seed very much.

The level of the technician in the association area of the present invention is represented in all documents mentioned in specification sheets and patent application.All publications and patent application are all quoted as a reference herein, and its degree just is cited as a reference with illustrating individually by clear and definite as each single publication or patent application

Although to the aforementioned invention detailed description of having made comparisons, clearly in the scope of appended claim, can put into practice some variation and modification by the explanation that is used to promote understanding and embodiment.

Sequence table

<110>Pioneer Hi-Bred International，Inc.

＜120〉adjusting of cytokine activity in the plant

<130>0803R-PCT

<150>US 60/460,718

<151>2003-04-04

<150>US 09/545,334

<151>2000-04-07

<150>US 60/129,844

<151>1999-04-16

<160>39

<170>FastSEQ for Windows Version 4.0

<210>1

<211>1919

<212>DNA

＜213〉Agrobacterium tumefaciens (Agrobacterium tumefaciens)

<220>

<221>CDS

<222>(690)...(1411)

<223>ipt

<400>1

ggatcccgtt acaagtattg cacgttttgt aaattgcata ttaatgcaat ctggatgttt 60

aataacgaat gtaatggcgt agaaatatgt attttattgt atttatcttt cactatgttg 120

aagtttgcaa taatatgcta atgtaaaatt aaaaaattat gtactgccgc atttgttcaa 180

atggcgccgt tatttcaaaa atatctttga ttttgttacg aggacaacga ctgcaggaag 240

taaataaaag acgctgttgt taagaaattg ctatcatatg tgcccagcta tagggccatt 300

taagttcaat tgtgaaatag ccgcccttat tttgacgtct catcaaatca aatattaaaa 360

aatatctcac tctgtcgcca gcaatgatgt aataaccgca gaaaagtgag agtaaatcgc 420

ggaaaaacgt cgccgagtgg catgaatagc ggcctccgta ttgctgattt agtcagcttt 480

atttgactta agggtgccct cgttagtgac aaattgcttt caaggagaca gccatgcccc 540

acactttgtt gaaaaacaag ttgccttttg ggaagaacct aaagccactt gctcttcaag 600

gaggaatatc gaggaagaga atataacagc ctctggtaca gacttctctt gtgcaaaaat 660

caatttgtat tcaacatatc gcaagaccg atg gat cta cgt cta att ttc ggt 713

Met Asp Leu Arg Leu Ile Phe Gly

1 5

cca act tgc aca gga aag aca tcg act gcg ata gct ctt gcc cag cag 761

Pro Thr Cys Thr Gly Lys Thr Ser Thr Ala Ile Ala Leu Ala Gln Gln

10 15 20

act ggc ctc cca gtc ctc tcg ctc gat cgc gtc caa tgc tgt cct caa 809

Thr Gly Leu Pro Val Leu Ser Leu Asp Arg Val Gln Cys Cys Pro Gln

25 30 35 40

cta tca acc gga agc ggg cga cca aca gtg gaa gaa ctg aaa gga acg 857

Leu Ser Thr Gly Ser Gly Arg Pro Thr Val Glu Glu Leu Lys Gly Thr

45 50 55

act cgt ctg tac ctt gat gat cgc cct ttg gta aag ggt atc att aca 905

Thr Arg Leu Tyr Leu Asp Asp Arg Pro Leu Val Lys Gly Ile Ile Thr

60 65 70

gcc aag caa gct cat gaa cgg ctc att gcg gag gtg cac aat cac gag 953

Ala Lys Gln Ala His Glu Arg Leu Ile Ala Glu Val His Asn His Glu

75 80 85

gcc aaa ggc ggg ctt att ctt gag gga gga tct atc tcg ttg ctc agg 1001

Ala Lys Gly Gly Leu Ile Leu Glu Gly Gly Ser Ile Ser Leu Leu Arg

90 95 100

tgc atg gcg caa agt cgt tat tgg aac gcg gat ttt cgt tgg cat att 1049

Cys Met Ala Gln Ser Arg Tyr Trp Asn Ala Asp Phe Arg Trp His Ile

105 110 115 120

att cgc aac gag tta gca gac gag gag agc ttc atg agc gtg gcc aag 1097

Ile Arg Asn Glu Leu Ala Asp Glu Glu Ser Phe Met Ser Val Ala Lys

125 130 135

acc aga gtt aag cag atg tta cgc ccc tct gca ggt ctt tct att atc 1145

Thr Arg Val Lys Gln Met Leu Arg Pro Ser Ala Gly Leu Ser Ile Ile

140 145 150

caa gag ttg gtt caa ctt tgg agg gag cct cgg ctg agg ccc ata ctg 1193

Gln Glu Leu Val Gln Leu Trp Arg Glu Pro Arg Leu Arg Pro Ile Leu

155 160 165

gaa ggg atc gat gga tat cga tat gcc ctg cta ttt gct acc cag aac 1241

Glu Gly Ile Asp Gly Tyr Arg Tyr Ala Leu Leu Phe Ala Thr Gln Asn

170 175 180

cag atc acg ccc gat atg cta ttg cag ctc gac gca gat atg gag aat 1289

Gln Ile Thr Pro Asp Met Leu Leu Gln Leu Asp Ala Asp Met Glu Asn

185 190 195 200

aaa ttg att cac ggt atc gct cag gag ttt cta atc cat gcg cgt cga 1337

Lys Leu Ile His Gly Ile Ala Gln Glu Phe Leu Ile His Ala Arg Arg

205 210 215

cag gaa cag aaa ttc cct ttg gtg ggc gcg aca gct gtc gaa gcg ttt 1385

Gln Glu Gln Lys Phe Pro Leu Val Gly Ala Thr Ala Val Glu Ala Phe

220 225 230

gaa gga cca cca ttt cga atg tga ta gattgcacca gttttgtttc 1431

Glu Gly Pro Pro Phe Arg Met *

235

agacttgtcg ctatttgaat aagatgttcg ttctttgttg tgttggtgtg ttgtgataga 1491

ggcaagtggt ttgaaacttg tttttactgg tttattttca gtctcttgga cgatgtttta 1551

caaatataat attgtgaaaa ttgtggtttt atattcgtag aacgaaataa atggtaagta 1611

tagccgttat caaaatttag caaaaattgt taaaggttct tttatgcggt gaggttgtcg 1671

acttttcatc attgtcgcgt aaggagttac ggatatccat aactgtaaaa acgccgcaga 1731

atttacgggt ggtgcattta gtttgccgtt caacatgatt ttggcaatag ttggtaacca 1791

agcactagcc aaccgttcga taatcactta atcgatggaa ccgttcagct ttccttcgtg 1851

aggctgctct tgatgatgag ctgccgtcta gtttttataa cgccgggtta cgcattatag 1911

acaagctt 1919

<210>2

<211>239

<212>PRT

＜213〉Agrobacterium tumefaciens (Agrobacterium tumefaciens)

<400>2

Met Asp Leu Arg Leu Ile Phe Gly Pro Thr Cys Thr Gly Lys Thr Ser

1 5 10 15

Thr Ala Ile Ala Leu Ala Gln Gln Thr Gly Leu Pro Val Leu Ser Leu

20 25 30

Asp Arg Val Gln Cys Cys Pro Gln Leu Ser Thr Gly Ser Gly Arg Pro

35 40 45

Thr Val Glu Glu Leu Lys Gly Thr Thr Arg Leu Tyr Leu Asp Asp Arg

50 55 60

Pro Leu Val Lys Gly Ile Ile Thr Ala Lys Gln Ala His Glu Arg Leu

65 70 75 80

Ile Ala Glu Val His Asn His Glu Ala Lys Gly Gly Leu Ile Leu Glu

85 90 95

Gly Gly Ser Ile Ser Leu Leu Arg Cys Met Ala Gln Ser Arg Tyr Trp

100 105 110

Asn Ala Asp Phe Arg Trp His Ile Ile Arg Asn Glu Leu Ala Asp Glu

115 120 125

Glu Ser Phe Met Ser Val Ala Lys Thr Arg Val Lys Gln Met Leu Arg

130 135 140

Pro Ser Ala Gly Leu Ser Ile Ile Gln Glu Leu Val Gln Leu Trp Arg

145 150 155 160

Glu Pro Arg Leu Arg Pro Ile Leu Glu Gly Ile Asp Gly Tyr Arg Tyr

165 170 175

Ala Leu Leu Phe Ala Thr Gln Asn Gln Ile Thr Pro Asp Met Leu Leu

180 185 190

Gln Leu Asp Ala Asp Met Glu Asn Lys Leu Ile His Gly Ile Ala Gln

195 200 205

Glu Phe Leu Ile His Ala Arg Arg Gln Glu Gln Lys Phe Pro Leu Val

210 215 220

Gly Ala Thr Ala Val Glu Ala Phe Glu Gly Pro Pro Phe Arg Met

225 230 235

<210>3

<211>2085

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(2085)

<223>zag2.1

<400>3

agcttcgtgt gttccttcga tcggtcacag tttgattcct gctcaccaca tatttttgcc 60

gcgtgggagg gaggccacga ctggtggcag aacagcgaga ggcagactac ccttacagcc 120

ttaataactc ttatatcttc tactataaca tcaaaataag acgtagtgtg gtggatatgt 180

tgtctctaat ttagcagcag gtcttgagtt tgattcacaa ttcttgcaga tttatttttt 240

gagccataac agggatgagg gcaaaatagg aaatgaacga catgttaccc ttaccgcctt 300

aataagtagt agagatatcc agtttatacg taattattat tatataaaat gcactgcaca 360

tatattacta ttaccagttt tcttggacat gcacagcaga aaacacgcac acgcagagag 420

gaaaaggaga ggccataaac caaaaggctt taagaatata tgtaaagata tgtctaaatg 480

gctatatctg gttaagcaag ataacagggc tctggtcatc agtagtagtg gccttttgcc 540

cttgcccctc atctctctca cacctctctt ttctcagcct tgcttccgat cgatggatcc 600

catcccactg ccatagtgcc atcctttctt tcccttgcgc gcattgccta gccggccggc 660

cggcctgcta ttaaaccact ttacccccct tctcgttcac gctcgacgca gctccctttt 720

ccttgcttgc ttattgcaag tctctgcaag aacctgctag agaggaacaa ggtagaatag 780

tatcgctttt tccatctaga ggttatctct ttttacatga aaaatttcag ccgtattttc 840

gttctccata tatcagtcct gcgataatat aaatacgcgc gtcttgtgtg atccggcata 900

tgtatagttc ctactaactg atcgagatcg ctctcgtttg tactttctcc ctttgaggaa 960

agagttcccc tttttctgtg cttcaaattc ttgtaaggaa aaccatgcct gcctgccagc 1020

ttcttctgct acttggatga tgattcttat ttgcttactt gatttccgtt tttttttctt 1080

gctttctata tgtatgtatc tgggctgtct tcccctgcgt ctcgttacta cgtactaagc 1140

tttggaaggt ttcaactctt tgtatacgat gaggtttctg cccctagtag cagatccgcg 1200

cacgactaga tgtttgagga aaagaaaagg gcaagacgct atatatatat gcagcacgca 1260

gtcgcacata tatccagttt tccaatctgc ctcttgcttt atgataattc aacttgcgct 1320

gattatattc ttggctacct agctagaaat gtctaattaa actttgtttg ctagctagat 1380

tttgttgctt cttttcgcat ctgatctttt tatctcttct gagtgctccg caaagccttc 1440

cagtgttgaa gaagctgctg gaagaagaga tgagctttct cttgaaggaa aaagagatga 1500

tcattgccgg tttgttgttg tttcgtgttt ttttagcttc ttgtccccca tttatattcg 1560

cgcctaatga acgagcccgt agatcttgtg ttcttgtggc tggttttgtt ggatctcgat 1620

ctcggttacg tttacatgag tcttgctgcc taacatacat ctgtgttctt tttctaggct 1680

gcgagaaact taactgatcg agtctgtctg gcaggcatcg atctatccag tcgtcagttc 1740

gtcacatccg ctttttcgta tatatcatct tcagattttg tccatctgtc aaatcatgga 1800

aaatctgtcg tctttgcttg tattctcttc tgttattcct gctgcctccg gcggaccaat 1860

tcttgaatcg acccgtgttc ctattccctt ttgttagaca gcccaaatcg cttgctcgat 1920

cgtagtgtac tgtactactg cggctagcta gatcttccaa gctagctata gttcgccggt 1980

ccctttgatc tgcttcacag aacatatata acacttgaac tcttttacgc ttatgagaaa 2040

acttgctgct tgctgctttc agctggtatc gtcgccagcg gatcc 2085

<210>4

<211>344

<212>DNA

＜213〉cauliflower mosaic virus (Cauliflower mosaic virus)

<220>

＜221〉enhanser

<222>(1)...(344)

<223>CaMV35s

<400>4

tctagaaatc cgtcaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag 60

atacagtctc agaagaccaa agggctattg agacttttca acaaagggta atatcgggaa 120

acctcctcgg attccattgc ccagctatct gtcacttcat caaaaggaca gtagaaaagg 180

aaggtggcac ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct 240

ctgccgacag tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag 300

acgttccaac cacgtcttca aagcaagtgg attgatgtga tgct 344

<210>5

<211>2198

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(2198)

<223>ZmMADS

<400>5

cctttttctt tttctccaca acatgaacct tactagaaca ctgccccact taaaagaatg 60

agggtagaac tcttgaatct tagggatttg aactccttgc agtacctcat aacaagggtg 120

ttacatgtcc ttcttctgct gttgctgctt gagcaggata tagagagatg accgacaccg 180

ggttgatctt gggacaacct tcttctcatc ttttcttcgt tgttttcttt tctattctca 240

ctaccttttt ctttctcttt gttcttccca ctggaggatt ctatcaaaaa gtattaccat 300

catacagagg aggaacccga agactatgaa ccatgtacaa cagtcttcaa cccaagaatc 360

accaagcatt gtgatcttag gggcgaggga gtggaaaatg gagttgcttg tgatttggca 420

gagggaattt tatcaggagt gttttgcttt gagtggaatg ggaactgagg gagttgttgg 480

gggggggggg tttataggcg agtgggagtg ctcgggtgcg gagtgtggtg atggaacagg 540

tgacatgagg tagcaggtcg atggaggggg gctgttgccg gcgatgatgg cggcggtggg 600

tgcgctgcaa aggagggcgt ggggcggtgg tagtgcgcat ggaggcgggc acgcgtgcgg 660

ggggcacaag tgagtggtgg ggtcgatgac cctgatgttt gtggtctctg gttccaagaa 720

tctttgtctc tctttatgat aataacttct tttgtcgtcc ttttctgttt actttgactc 780

aggggcagtg ctttgattct cacggtcggt ccttttgact gagtgactgg acatgtttct 840

tctgtagcat tgtacaacat gtactttgtg caagctacaa ggccacattt tttgaagcat 900

agattctttc ccccaaacaa tttatacaaa tatgcaaggc tacacttctt gtatttctat 960

aacattgtac attcatgaca gaggctcaaa agcttgtaaa ttttgtgcag gtttaattca 1020

tgtaaagttc ccttgtagag tcatgacaac atcgtactat aaaattattc tacaaaaacc 1080

acacatgacc cccatgttat ttggtgacaa tacagaaacc acacatctag tgatgatata 1140

acactgtaca gaagccacaa attataatat ataaaacact atacaaagta tccaaataaa 1200

gcctaatagg tatggagggt aacctgaatc tttcctaata ataatgaata atctacaata 1260

atgatttgtt tggacaaaga gaattaaacg gtattgagtg ggctaaaatt ccttgttatt 1320

caaaaccctc aatcacagtt tctccgaggg aaaaagaaac aggggaggac actcaggctg 1380

ttcacaatag ggatttcata tcgctctttc caacaatgcc acatcatcaa aagtgttatg 1440

aaactaaaaa tgaaataata cttctcaatg caaactttca ttttcataga ttaatatact 1500

aattaaatga tgcaactaaa taaccaatag atgttagtaa aatatggtaa gattaaacaa 1560

accactatca atggacattt cacatagttt ccaagacttt gaaaacgggt tgacatgatt 1620

tcatccacat caaactaatt ttatctctga aacccattca ttttaaatga tatggcataa 1680

cgtccaaaat gctgacgtga cataccatta aatgtgcatg aaactcccat aaaactttta 1740

ttgataatag cctcacagac atccggtcct acacccgtgt ggacccatca gccagacgcc 1800

ctgcagcaaa cgcgacgttt gacttgccat ctcgctccct tgtgcccgac cgaccctgga 1860

aggctggact ggaactggaa caagcaaaat ggaaaaaacc atatctcacc actgaaccgc 1920

acccttccgg cccacgccag gctcgaccaa tccctgcccc gcgcgccctg acgagcgcat 1980

cactcgaacg ccggcctcgc taggcccatc cttctggccc gcaataacga tccccgtcat 2040

gatccgacgg tctagctgcc tccacgccgc tccaaaaccc ccgcgtccaa tcaaaacacg 2100

acagcgggac gagcgaaacc accgtggttt cgccaaaccg ctttccttcc catctaaaac 2160

cgccccctcc cttcctcttc tcctagctct cttgcctg 2198

<210>6

<211>1470

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1470)

<223>ckx1-2

<400>6

gagctcgccc ttgcatgctt gagtcatatc ttggaaaaaa aaactgtaac ttaaagtatg 60

atctatatat ggattatttg gatgggatgt cattttcgta tcaccaacca aaattacagt 120

ttggtcgtgc gtagaaattc tacctactag ctgaaacaac ggctgctatg tataactact 180

ggtactggaa agaatattag tcattgactc aaaattagaa tgcatgtgta agtcatgcgt 240

gctaatttgt tctatcagca ttcggcgaat tccgaagtcc gtacgtgttg ttcgtggagg 300

agaggaaaac atcagaaatg acaaaactag acggcgtgtg cttctacact gaattcatca 360

acatttgttt tacttttact agagaatggc atcagatgga aaaccgctga aaaaacaaga 420

aaacaattgg accccaaata tgtacagacg ctagctatag ccagccacac tgaagttgac 480

atgcggcaac tagctaacca ccttctctga aacactaaca tttgtacctt ggtcgtgtaa 540

gtgtagttag taacgtatgt tgacgcgact taccgaacaa aaatataatt gtcccaatca 600

agctagggac gattgtttgt ttccaaaatg ttgccatttg cttaatcaat cctatattga 660

ttcatggctg ttaaggtgag ataaagcgac aagaaatctc tctctatata tatatataag 720

atcccgaagg ctagcgacat ttttgatagc aaaatatgag aagttggcag gttctggtag 780

caaatcaaat aatatggcca gaataatcgt ggctagcttg attaaacctt cagcttggtg 840

tattttggaa gtcgaccaac cagctgggcc ggggctcgtc gtagtaccaa aattacagcc 900

tgcttccttc gtcgtcctgt acgtaatgca gtacagctgt ctgtctagta gagacgattt 960

tgagcaggca cacacattaa gtgataacat aaaagacggc ttcattttat ttcataacca 1020

aacgatatgg tcaacacaca cctatagcta ccaaatttgt acaactattt agtgcgaaaa 1080

ctatttcatt ctcaagaatt gatcgcttat atttattatt acaggttttt aaatgtataa 1140

atacgctata ttgcatggca aaagggggta ataattaggc aggactatat atataatagt 1200

tttttttcct ttaaattctt gggaggatgg taaagttggt aactaggcac cttgtgcgca 1260

tatttttctg tggtcaaaca gaataaaact agacgggatg cagaattttt ttttccttgg 1320

aaagcagctc atctctgtgt tcgagtacgt aattgaagaa gtatgtgatc gcactacacc 1380

tacacgtatg tgccgccgta tccgtcctat atatatacgg ggtgcaatca cctagttacc 1440

aaacactcac acataagggc ggatccatgg 1470

<210>7

<211>960

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(960)

<223>eep1

<400>7

tcaaaccggt catcgtttgt atcatccact gcttgacttg ggaagaagtt aagaacttgg 60

taagacagct gtgagggtgt gacccaacta acccataaat acattttctc caattagtaa 120

attagttttt ttttcttggc ttgattgatg aatcattcaa gttggcatga taagattttg 180

ttcagttatt cgtgtgtctt atgtatgaaa agtgattgaa aaaaattatg gatagttttg 240

acttgctatg gatttaatta cacctaatcg cctccaatcc atatggattg gagggaacca 300

aacaagctct aaggttgata tccgcttcta tatatgctgc atgagcagtt tactgcttta 360

tttttctaca gatgggtcag tgatgaggat tggtgaatgc atcaggtcat tcaaataaat 420

ttttttaacg acagggttat gtaggtgatg acacaccata tattccctaa ctgcctgtct 480

agtgtctact aattactaac gggaaaattg cgtatgctca ttgacgtctc agctgtgcag 540

aagaatctcg gaacatttaa ttcacatata ttgatactac gtgctagctg gtgccatctt 600

cctagctgga tactacttat tgcatcaatt aatttctttt tttgttttct ttcaattgct 660

tccaaggtca aactgaatgc aaaccattac ttgttacaac ggtcctctcc atcctacgct 720

acgcctgatg tgatgtaatg taatcgaagc aagagcctta ttattgtata tttctgttcc 780

taccagggct tgcatggaaa actgccagcc tctcattata ttataaatat acgtatactg 840

atacacatac atgcacacca aaagtactca ggactgtcat ctctcagttg caattgcaaa 900

aaaaatacag agagagagag agagagagag agagatccct accctgcaaa gatatcgacc 960

<210>8

<211>1224

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1224)

<223>end2

<400>8

tactataggg cacgcgtggt cgacggcccg ggctggtaaa aagtaattga acccaaaata 60

tcatggtatg tttggtgaag acagtgatca gtgatttttt tatatctata tatatatcaa 120

agatacttga ttttctagaa ggttcttttt gttgttttcc cttatgtttt tacgcatgat 180

gcaattcttt ttgagaggtt tccgatgcat tgatgttatt gtattatctc ctatatatag 240

gtcgacgtac attatgtatt gcaataacca gttaactgga tccagcttcg cttagttttt 300

agtttttggc agaaaaaatg atcaatgttt cacaaaccaa atatttttat aacttttgat 360

gaaagaagat caccacggtc atatctaggg gtggtaacaa attgcgatct aaatgtttct 420

tcataaaaaa taaggcttct taataaattt tagttcaaaa taaatacgaa taaagtctga 480

ttctaatctg attcgatcct taaattttat aatgcaaaat ttagagctca ttaccacctc 540

tagtcatatg tctagtctga ggtatatcca aaaagccctt tctctaaatt ccacacccaa 600

ctcagatgtt tgcaaataaa tactccgact ccaaaatgta ggtgaagtgc aactttctcc 660

attttatatc aacatttgtt attttttgtt taacatttca cactcaaaac taattaataa 720

aatacgtggt tgttgaacgt gcgcacatgt ctcccttaca ttatgttttt ttatttatgt 780

attattgttg ttttcctccg aacaacttgt caacatatca tcattggtct ttaatattta 840

tgaatatgga agcctagtta tttacacttg gctacacact agttgtagtt ttgccacttg 900

tctaacatgc aactctagta gttttgccac ttgcctggca cgcgactcta gtattgacac 960

ttgtatagca aataatgcca atacgacacc tggccttaca tgaaacatta tttttgacac 1020

ttgtatacca tgcaacatta ccattgacat ttgtccatac acattatatc aaatatattg 1080

agcgcatgtc acaaactcga tacaaagctg gatgaccctc cctcaccaca tctataaaaa 1140

cccgagcgct actgtaaatc actcacaaca caacacatat cttttagtaa cctttcaata 1200

ggcgtccccc aagaactagt aaac 1224

<210>9

<211>1433

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1433)

<223>lec1

<400>9

tcctaatctt caaataacca tctcaaaagt tttttaaaac atcttttgag gatatgtatc 60

ccatagccct agagcgctaa attgactact tttagtcgat taaaaggtat tagacatcct 120

tacaagtcct aagtatcaaa tcaccttcta tcggctatac acaactaacg gaagttatct 180

ctagtcacac taacttatgt cggtttccgc atggcagatc aaaattagct aacttttgtt 240

ggctaataag agcaattcca aaagaacgtg taaactaatc tcaaaacaga tattagttaa 300

gaatagtaat ttttcttact ccaacagttc cctcagtctt ccccaaaaaa ttaagcgttc 360

cgcatccaca gcctcctctc ggtcgtattt tggtgtgttt catccctccc caatccattt 420

ctcaacgtat cagatcatcc accgcctacg acgactgtac agtttgcgtc acatatcaca 480

tttaaaggaa ctgttggagt acccatcata attcactctt aaaaaatttt agcctgctct 540

caataatcaa ttgggggggt aaaattttta acatcctttc ggatctaatc caacttatgg 600

aagttagcta gctctggtcg cgctaacttc tgtcgatcgc ctattagcta atactccatc 660

tgtcccatta tataaggtat aaccaactct gattcaaaga ccaaaaatat acttaattgt 720

gtctatacca cttcatcgat gtacgtatgc atagaaagag cacatcttat attgtggaac 780

aagaacaaaa atatggttac gccttatatt ataagacgta gaaatcaatg gtttacaata 840

gccaagaata gatgttttta tttatttcct atatagatgt ttttatttat ttcctatatg 900

tttcacaata gccttatatt gtgccgaaaa tttaggcaca cgtgccacga acgtctgaaa 960

tgtactccgc gcgtattacc atgcactacg acgtacgtag gagtatgtac gttgaaccaa 1020

gcacacatat atctctgaca cagtacaatg atatactaca acaacaacag tactgcccaa 1080

ttcatccatt ttcacgttcc atcttccgcg tgtgacaact cgatcggcca cgcacgcaga 1140

cgacgacgga gcagtacttc acagaatcct ccgccactcg tcacaccaac aggcgcgcgc 1200

tggtgcgcat gcatcatgtg catgccatcg tccgtccctt ggcgtgcctc ggtagacggt 1260

agctagagta gtagcctgtg cttgctaccc ctggtcaaca catcgtagcc tcctatattt 1320

aacgtatcct cacacatcac aagaacgaca cacagaaacc agtagccact actccatcca 1380

ccacgagcga gcgagcgata accctagcta gcttcaggat ccagcgagag ccc 1433

<210>10

<211>820

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(820)

＜223〉F3.7 promotor

<400>10

gagctcaagc cgcaacaaca aatttcggtg ctcccaagct tcataaaggc tatcttcggc 60

gtcgttggga tccatggtgg cacagaatcg agttgatgtt gtagctggcg gctagggttt 120

gaagtggaga agaggtccgg ctggtggcat cctatcgtct attgagggtt gggtccggtg 180

gcatcatact tgatgacaat tgaaagtaat tttaatcaac ttgtcatgag tagtgagtct 240

tttataaaaa ataagctgaa ataagcaccc tttgatgagc ttataggatt atcataatct 300

caaatgctaa attatataat tttattagat aagttgcttg tttgtttccc cactagctta 360

tttacattgg attatataat ctacataaat tataatctca aacaaaaagt ccttaatcag 420

agatcagcga ggtctcacga gtgagaaggc gagagcttgt ccaaacgagc attttcgggc 480

gtgtgaacac ccatttcagc aaagccgtcg ttgtccagtt cagcgaagcg cattctgcgg 540

ctttggcgtg acccattctg ctagctcagc actgagaata cgcgtccgct gcagcgttgg 600

cgtacaggcc ggactacatt agccaacgcg tatcggcagt ggcaaacctc ttcgcttcta 660

actccgctgg gccaccagct ttgaccgccg cctcccttcc cctccgctac tgctcctccc 720

caccccactc ccccgcagga gcggcggcgg cggcggcgag gtcgtacccc acatcggcga 780

gcggcggcgg caccgccgga ggcaaaggca agtctagaac 820

<210>11

<211>26

<212>DNA

＜213〉corn (Zea mays)

<400>11

gtcagtggtg taaaagcact tctggt 26

<210>12

<211>26

<212>DNA

＜213〉corn (Zea mays)

<400>12

tgcgccagaa gaagcagcag gaagat 26

<210>13

<211>26

<212>DNA

＜213〉corn (Zea mays)

<400>13

aagcttaggg tacctcaaac cggtca 26

<210>14

<211>34

<212>DNA

＜213〉corn (Zea mays)

<400>14

ccatggtcga tatctttgca gggtagggat ctct 34

<210>15

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉Clontech AP1 primer

<400>15

gtaatacgac tcactatagg gc 22

<210>16

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉Clontech AP2 primer

<400>16

actatagggc acgcgtggt 19

<210>17

<211>1679

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1679)

＜223〉tb1 promotor

<400>17

gcggccgcct acctaataga tatgtatcac tctctcctca cttcggctat aaaagagagg 60

gatagagaaa catagaatgg gtttcgaaaa aaactctttg actctctaaa tagaaacaag 120

aggaaaggga agttagttgg tcattatctt tgttgatgcc tcaacatgta attttcttcg 180

ccattgtatt tctcaatcca ctatatacaa agaggttata gggtatatat tacacatctt 240

acggtccgaa cctatattta aattacccat gtattgatgc ctaggcggta tccagcaaca 300

gagtgtctct agcacgcatc tcttactcta tttatcaact ctcccccgaa tacatgtggt 360

tccttattgt cactggcgga tctacagggt gtcaccctgt agtccggtac cggcataaca 420

tattagcttt gtctatttca tgacttcaaa catgttgcaa caacctacag atgcgttcag 480

tctatctata tacaagagga agaatacaag tgacaaatct aatttgtgaa tataagaatt 540

attatgctgg tttacataga ataccaaatt atagcacaca tttatcattc cttattgaat 600

ttctaaatgt atttcactga attattcatg catttttaat ttggcatacc ttatagtaaa 660

attctataac cgctactgct tattgtcatt atgcgacttg gaagacattt tctacctact 720

gaaagcggtc tgttttttgt gttgtcgaga gtgtgatggg taaccatagt taataatgca 780

ctggatctat cactactcat acaggtccca tatgcctaat aatgttgtga agaccaactc 840

atctgaccac atctgtccct accatgcttg tacaccacac tacatacatc actcatcact 900

ggtccttcgt ttcggtaccc tcctcccaca atgttcaatg tatatactaa tagttctcaa 960

ataaattcct gtggatgtta caaaaaccca cggtctttgg tttcctgaag aagtatttca 1020

tggaggcgcg cacgtccatc gtactgcgtc ctgcagctat ggccgccccc atctggccaa 1080

taaatgtact aggtcacttg tagccaatag cgtttcaaca tgcacacagc ttttccccca 1140

atagtgcagg tccttgtatt ctcctccctc tccctcacct caaatctcat ccacacgaac 1200

aggcggcacg gcagtattcc tccacagccc tcctctctat aagatggcac agccctctca 1260

ggtaggggcg agtgtctcac tctcacatag taaaaaaaaa aaaaacgccc ccaaggttct 1320

taagcacaat tctctagcta tcttggtctc ctacacagcc tatgcacatg agcccatgcc 1380

tctcctctcc ttgcgcctgc atagagaggt ggtatgatca cctggaaagt ttttaactct 1440

ctctctctct ctctctctct ctctctctta caagcctaga ccttatgcat ggtcggacgg 1500

acacatctga tcataggaca tatgagtagg ccacactcct cctgcccctc tctcgtagag 1560

atcaacacac actgctctta gtgccaggac ctagagaggg gagcgtggag agggcatcag 1620

ggggccttgg agtcccatca gtaaagcaca tgtttccttt ctgtgattcc tcaagcccc 1679

<210>18

<211>1027

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1027)

＜223〉eep2 promotor

<400>18

gtaaagttac aattatatat caaatgctag ctactagtcg ggagaaaacc aactaagggg 60

atgtttgttt gggattgtaa tctgtccaga atatataatc caacaaattt tgaactaaca 120

ctcggttcaa aatttattag attatataat ccatacatat tacaatccca aacaaacacc 180

cctaattcta aatggtgaga gtaaaaagcg ctgtctaata acttttatca gctaatttgt 240

ttatcttgag ctgttaatta aaccattagt gaagtttttt tggggggtgg tcgaatagag 300

ctaatctaac tattagctca taggatcaag gccattggtt taatttcacc ccactatgac 360

tatgtcccag taactaaata ctatatttgt caccataaac tttggaagaa attagttgct 420

actagaaaga agatccaaac ctggaaaaaa ttagtttcta ctagaaagca gatcatgtct 480

gctacccaga cattgattta tactccagca tcaaccaacc ccgtacttgt tactacaaaa 540

ttggaagaaa ttagttgcta ctagaaagta gataatttct gccaccagat attgatttat 600

aacctagtat caatctctac tagccttgct tccgtcattt gttgctagat ataaatggtt 660

ttctttcaca tatgtgagtg tatatatatg aaccttgcag caaccattat attcggtagt 720

caaacaaagc cctacagaca tcgatctctg atctgagaaa aaaaatcctt atatggcgag 780

aattacaatg gaagcaagca aggctgtcct gctcttgatg gtgatcctag gaagtttgat 840

gattcccgca tactgtaagt gcacatcggg caaccatgcg catttgaatc aagttacata 900

ttatacagtt tcttactagt agtaaatata aattgttcgc ataatgtcaa caaccttaac 960

ttactgtaaa aacagtaact gaatgccctt attgcatgca gctcggaacc ttgttcgttt 1020

tctgccc 1027

<210>19

<211>723

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(723)

＜223〉trx1 or thxH promotor (Trx H)

<400>19

gcccttacta tagggcacgc gtggtcgacg gcccgggctg gtactctctg gtactgagtt 60

agatttggtg aatgttaata catatatact tttaataaaa ttacttttta agacaaaatt 120

gatgcactgg cgttcattgg cggctgtgtt aacaaaaccg aagtggaagt agcccgttcc 180

actggaggtt ggcttaagtg cacatgcagt gaaaataacg ttccacttgc gattcattta 240

acacaactgt cagtataaat agtttttttt attggcggtt gatttaggtg aaccccaagc 300

gaaaatatat ttacacatgc ggttttttaa gccgtgctca cctatttatt ttcagtgtgc 360

ttaactgaaa ctgtcggtat aaatttttgc gtgccatcag tttagagcac ttatctactg 420

actttttttt tcaagtatcg tacggatttt gcaccacgtc gacgaccgtc gataacgagg 480

cacgccgatc tagagagctc gaagacctgg gaatggcaca ggggaccggc cggagcccgc 540

cggcgccatg caagctgcct cgatcgcggg cctcgaccta agtagcccgt ccctgtcgcg 600

cgccagtcgc tcgctgcgcc tataaaagcc gcccgcggct cgcgtaggct accagcgcaa 660

aactctgcca agggcttcgg atcccacacc gaggaaagga gaagagaggg tcggaatacc 720

atg 723

<210>20

<211>1626

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(1626)

＜223〉Zm40 or Mze40-2 promotor

<400>20

aagcttagct agatcatttg taagaatgca acttgttcat atagcatggc tacagcctac 60

atcatctgaa atagacctgt ttataggata cctaagctca attcacccta tatctaaaac 120

ctacgaggcc taaacacacc cgtcctcaag aaaacgacca aaccaaacca aaccatgcgt 180

ccgtgtcatg gttttgtaga cacgtttacg tatcaattat agtgttctga ttttttatat 240

tctcctaatt atttagagct aaatttattt ttatgatagc agagatctaa atatttttgt 300

tttgattttt tatatactaa aatcatctct acaatattag agattttaaa tgctcagaag 360

aattttactt gaattaaaac ctttactgat ttttaactaa aacggagacc aaaagaaatc 420

tatccaaggc tgcctctaag agccttcgtg tctcgttttc ttatttcaga cttcactcat 480

cttcttattt caggctccac tatataaggt ggtctctagt atctttccta tcacatatcc 540

tatttaaaac tttagtatat aaaacattat aattcataat ataaatcgat tattttacac 600

gatctcagcc taaaagcggt aatatgcacg ctctgagcat ggcccaagct ccacgttaac 660

cgttctgtca aaaaaaaaaa catctagtct agaatggaaa acacacgatt ttagaagtta 720

ggactagttt ggcaactcaa ttttccaaat gattctcatt cttttaagag gatttaattt 780

attttttggt aaaataggaa tcactagaaa ctctattttt tcaagagaaa gtaagctatt 840

tttttagaaa aataaaaaat cccttaaaaa atattgttcg taaattagcc ctaagatgga 900

ctaaaaatct ggttttatag aatagggagg gatcgagcaa ccgccaaatc tacgcgccaa 960

aaaggtacct tttccgtgaa taaacacgac tgcggcgatc acgatctgat cgaactcgta 1020

gaataaaatg gagcagcgga atagtgtggg aggcacaagc acaggaggag ctgaaaccga 1080

accgaagtgg cgaacacgat ccccactccg gccggcaccc gagtgtgcga gacgtgtggg 1140

gctgatctga cgagcctgga agaagaagaa gaaaaaaaag tcctcacgct cctgcttggc 1200

tccatcgaca gctcactagc tgctaccgga tgctcgcgtc tctgatgcct ctcgattcat 1260

catccatcgt tggtggcggc ggcggggcgg caaaggttct gattccgcag cagccaagtg 1320

ctcctcctgc agacgaaaat gacggcagag gttggcgttg atccaggaga ctcatcagtt 1380

tagtttaata atgaatctgt agcaggcgct tcagtctctc atcggatgag cgagcagctt 1440

agcagagcag gtggtggtcc ctggctcgcc cccgtccatt ctttcccgcc cgtcctgccg 1500

tccactccgc cgcctattta tacccctcct cgcccaccct gccatcctca ccatcgcaat 1560

tcacaagcaa agcaatcaga gccaagcacc caccgtcctc ctttctttcc ttcgactcat 1620

caaagc 1626

<210>21

<211>27

<212>DNA

＜213〉corn (Zea mays)

<400>21

aaacaccttc ggatattgct ccctttt 27

<210>22

<211>27

<212>DNA

＜213〉corn (Zea mays)

<400>22

tctcgcattt gcagaaacga acaacgt 27

<210>23

<211>525

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(525)

<223>mLIP15

<400>23

ctttcagcta agtccctgct ccctctcttt ttcttacatt caggtcctcg cagctcctct 60

cttttttctt gtttctttct ttcgatctgc gagccgtcca ggtccagtac tctcctttcc 120

gtgaaggaac tcttgcagcc ggcccctctg gtttcctcga attcttgttc cccggtccct 180

cctcctgtcc ccgcgtagat ccgtccgtcc gaggagcaca ccgtccccac ccccatgttt 240

acccaccagt tcctctgacg gccgccgtgc tccgatgaag ctgagcgtgc tccgtatccg 300

ccgctcccac tccttctccg tcgccttcct ctactggttc tacgtcttct catgaacgca 360

tcgcccctct ccacctgctg atccttcgcc atctctccat ctctctttct ctctgagata 420

gtctttcgaa tccatctcta gggctcttgt ttctccccat cctcccccca ccccaccccc 480

caccaaacac aagtcccctt gttcaatccg acaagacaag catcc 525

<210>24

<211>587

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(587)

＜223〉ESR promotor

<400>24

gaattcgccc ttggtagatg tctagatgac ctattctact tttcctaaga ttttctctgt 60

atgagtaacc tgtcataatt taacttgtga gatcttgccg atataaaaaa aaaacgccag 120

tcatttatgg tacgggatta ataggttcca agaaccagcc acaatccatt tattagtttc 180

atataaatgt cataaatttt tactaaaatt ttctctgtat agtaacatgt cataactgaa 240

cttgtgagaa aaacgccagt tatttatggt acgggattaa taggttccaa aaaccagccg 300

taacctattt atattagggt actttaagct ggtgccctca gttttgttgg tgtcttcgtt 360

tttaaactta gttgtatttt ttttcttagt tctgtccttc tagtgttata gagcataagg 420

acaaaattga gcaaaaaatg actaaggata aaaatgagga tatcagaaag ggcagcagct 480

taaaaaacct tttatattag ttcaaaagga caccagtcta taaaaagtat actccaagca 540

catttgaatt tggatttgca ttgtcagtca ggccagtcaa ggggacc 587

<210>25

<211>900

<212>DNA

＜213〉corn (Zea mays)

<220>

＜221〉promotor

<222>(1)...(900)

＜223〉PCNA2 promotor

<400>25

atcgtaatcg gttttcaccg tataccgaac cgaaaaaacc gaataccaaa ctttatcaat 60

tcccaaattt gactattcga ttatgtgaac taattgtgtg atacaattaa attgttattc 120

acttatttgt atgtgatgta tgatgtatat ctaaatattt gtacctatat aatttttact 180

ttttaaaatt atatgtaatc tatcatgtaa acttgttgta tgtattgtct tgattataag 240

tttggtattc ggtttttacc gaaaaatcga agtaaaaaac cgaaaccgaa cttctcggtt 300

tttcattttc tagaaaaccg aacggtttct aatgtttgaa aaaccgaagt tttttaaaac 360

cgaaaaaccg aaccgaagtt tagaaaaaaa ccgaatgccc agccctaaaa attagtaccc 420

cataagaact aaaaaaagat aaaatgacta aaaattaatc agttgaaacc aaacctattt 480

tcccccacac ctcacggtat tgtttcgcat tccaagtttg aaacacgact ggaaacaaaa 540

cccaaaacga ctggagggac cgagcttgtg ctgagcagca gagatggcgg gaaatgctgc 600

gtctcccgcc tcagtttcgg atgccccgcc ctttcccaaa ccggccaccg ccgccgcccg 660

tgtctcccca ccgacaggtg ggtccaatcc ttaaccacgg accagggccc ccacctgtca 720

ggtggacctt ccgaagcaag gatcggccag gcgggaaaac atttcgcggc aggtggcggt 780

tgcgccaaat ttctccctcc cttttccgtt cggcgtcccc aaacgcctcc ctattaatct 840

ccccgcgttc cccttccctc gcgccgccgc tctcccctcc caaagctcgc cccgctccca 900

<210>26

<211>1560

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>CDS

<222>(1)...(1560)

<400>26

atg aag ccg cca tca ctg gtg cac tgc ttc aag ctg ctg gtc ctg ctg 48

Met Lys Pro Pro Ser Leu Val His Cys Phe Lys Leu Leu Val Leu Leu

1 5 10 15

gcg ctc gcc agg ctg acc atg cac gtc ccc gac gag gac atg cta tcg 96

Ala Leu Ala Arg Leu Thr Met His Val Pro Asp Glu Asp Met Leu Ser

20 25 30

ccc ctc ggc gcg ctg cgc ctc gac ggt cat ttc agc ttc cat gac gtc 144

Pro Leu Gly Ala Leu Arg Leu Asp Gly His Phe Ser Phe His Asp Val

35 40 45

tcc gcc atg gcg cgg gac ttc ggc aac cag tgc agc ttc ctg ccg gcc 192

Ser Ala Met Ala Arg Asp Phe Gly Asn Gln Cys Ser Phe Leu Pro Ala

50 55 60

gcc gtg ctc cac cca ggc tcg gtc tcc gat atc gcc gcc acc gtg agg 240

Ala Val Leu His Pro Gly Ser Val Ser Asp Ile Ala Ala Thr Val Arg

65 70 75 80

cac gtc ttc tcc ctg ggc gag ggc tcg ccg ctc acc gtc gcg gcg cgc 288

His Val Phe Ser Leu Gly Glu Gly Ser Pro Leu Thr Val Ala Ala Arg

85 90 95

ggg cat gga cac tcc ctc atg ggt cag tcc cag gcc gcc cag ggg atc 336

Gly His Gly His Ser Leu Met Gly Gln Ser Gln Ala Ala Gln Gly Ile

100 105 110

gtg gtc agg atg gag tcg ctc cgg ggc gct agg ctc cag gtc cac gac 384

Val Val Arg Met Glu Ser Leu Arg Gly Ala Arg Leu Gln Val His Asp

115 120 125

ggc ttt gtc gat gcc ccc gga gga gag ctc tgg atc aat gtc ctg cgt 432

Gly Phe Val Asp Ala Pro Gly Gly Glu Leu Trp Ile Asn Val Leu Arg

130 135 140

gag acg ctg aag cac ggc ctg gca ccc aag tcg tgg acg gac tat ctc 480

Glu Thr Leu Lys His Gly Leu Ala Pro Lys Ser Trp Thr Asp Tyr Leu

145 150 155 160

cat ctc acg gtc ggt ggc acc ttg tct aat gcg ggg gtc agc ggc cag 528

His Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly Val Ser Gly Gln

165 170 175

gcg ttc cgc cac gga ccg cag gtc agc aat gtc aat caa ctg gag att 576

Ala Phe Arg His Gly Pro Gln Val Ser Asn Val Asn Gln Leu Glu Ile

180 185 190

gtg aca gga agg gga gac gtc gtt acc tgc tca ccc gag gat aac tct 624

Val Thr Gly Arg Gly Asp Val Val Thr Cys Ser Pro Glu Asp Asn Ser

195 200 205

gat ctc ttc tat gct gct ctc ggc ggt ctt ggt cag ttc ggg atc ata 672

Asp Leu Phe Tyr Ala Ala Leu Gly Gly Leu Gly Gln Phe Gly Ile Ile

210 215 220

acc aga gca agg att gca ctt gag cct gct cca gag atg gtg agg tgg 720

Thr Arg Ala Arg Ile Ala Leu Glu Pro Ala Pro Glu Met Val Arg Trp

225 230 235 240

ata aga gtt ctt tac tcg gat ttt gaa agc ttc acc gaa gac cag gag 768

Ile Arg Val Leu Tyr Ser Asp Phe Glu Ser Phe Thr Glu Asp Gln Glu

245 250 255

atg ttg atc atg gca gag aac tcc ttt gac tac att gaa ggt ttt gtc 816

Met Leu Ile Met Ala Glu Asn Ser Phe Asp Tyr Ile Glu Gly Phe Val

260 265 270

atc ata aac agg aca ggc atc ctc aac aac tgg agg gcg tcc ttc aag 864

Ile Ile Asn Arg Thr Gly Ile Leu Asn Asn Trp Arg Ala Ser Phe Lys

275 280 285

cca cag gac cca gtc caa gca agc cat ttc cag tca gat gga aga gtg 912

Pro Gln Asp Pro Val Gln Ala Ser His Phe Gln Ser Asp Gly Arg Val

290 295 300

cta tac tgc ctc gaa cta acc aag aac ttc aat agt ggc gac act gat 960

Leu Tyr Cys Leu Glu Leu Thr Lys Asn Phe Asn Ser Gly Asp Thr Asp

305 310 315 320

acc atg gaa cag gaa gtt gct gta ctg cta tct cgg ctt aga ttc ata 1008

Thr Met Glu Gln Glu Val Ala Val Leu Leu Ser Arg Leu Arg Phe Ile

325 330 335

cag tct act cta ttc cac acc gat gtc acg tac ctg gag ttt ttg gac 1056

Gln Ser Thr Leu Phe His Thr Asp Val Thr Tyr Leu Glu Phe Leu Asp

340 345 350

agg gtg cac acc tct gag ctg aag ctg agg gca caa agc ctc tgg gaa 1104

Arg Val His Thr Ser Glu Leu Lys Leu Arg Ala Gln Ser Leu Trp Glu

355 360 365

gtt cca cac cct tgg ttg aat ctt ctg ata ccg agg agc tca atc cgc 1152

Val Pro His Pro Trp Leu Asn Leu Leu Ile Pro Arg Ser Ser Ile Arg

370 375 380

aga ttt gct acg gaa gtc ttt ggc agg atc ctg aaa gat agc aac aat 1200

Arg Phe Ala Thr Glu Val Phe Gly Arg Ile Leu Lys Asp Ser Asn Asn

385 390 395 400

ggt cct ata ttg ctt tat cca gtg aac aaa tca aag tgg gac aac aaa 1248

Gly Pro Ile Leu Leu Tyr Pro Val Asn Lys Ser Lys Trp Asp Asn Lys

405 410 415

acg tca gtg gtc ata cca gat gag gaa att ttc tac cta gtg gga ttc 1296

Thr Ser Val Val Ile Pro Asp Glu Glu Ile Phe Tyr Leu Val Gly Phe

420 425 430

ctt tct tca gca ccg tct ctc tca ggt cac ggc agc att gca cat gcg 1344

Leu Ser Ser Ala Pro Ser Leu Ser Gly His Gly Ser Ile Ala His Ala

435 440 445

atg agc ctg aac agc caa ata gta gag ttc tgt gaa gag gct gat att 1392

Met Ser Leu Asn Ser Gln Ile Val Glu Phe Cys Glu Glu Ala Asp Ile

450 455 460

ggg atg aaa cag tat cta gca cac tac acc aca cag gag cag tgg aaa 1440

Gly Met Lys Gln Tyr Leu Ala His Tyr Thr Thr Gln Glu Gln Trp Lys

465 470 475 480

acc cac ttt gga gca agg tgg gag aca ttt gaa cgg agg aaa cac aga 1488

Thr His Phe Gly Ala Arg Trp Glu Thr Phe Glu Arg Arg Lys His Arg

485 490 495

tat gat ccc cta gcc atc cta gca cca gga cag aga ata ttc cca aag 1536

Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Arg Ile Phe Pro Lys

500 505 510

gcg tca ctc cca ttg tct ttg tga 1560

Ala Ser Leu Pro Leu Ser Leu *

515

<210>27

<211>519

<212>PRT

＜213〉corn (Zea mays)

<400>27

Met Lys Pro Pro Ser Leu Val His Cys Phe Lys Leu Leu Val Leu Leu

1 5 10 15

Ala Leu Ala Arg Leu Thr Met His Val Pro Asp Glu Asp Met Leu Ser

20 25 30

Pro Leu Gly Ala Leu Arg Leu Asp Gly His Phe Ser Phe His Asp Val

35 40 45

Ser Ala Met Ala Arg Asp Phe Gly Asn Gln Cys Ser Phe Leu Pro Ala

50 55 60

Ala Val Leu His Pro Gly Ser Val Ser Asp Ile Ala Ala Thr Val Arg

65 70 75 80

His Val Phe Ser Leu Gly Glu Gly Ser Pro Leu Thr Val Ala Ala Arg

85 90 95

Gly His Gly His Ser Leu Met Gly Gln Ser Gln Ala Ala Gln Gly Ile

100 105 110

Val Val Arg Met Glu Ser Leu Arg Gly Ala Arg Leu Gln Val His Asp

115 120 125

Gly Phe Val Asp Ala Pro Gly Gly Glu Leu Trp Ile Asn Val Leu Arg

130 135 140

Glu Thr Leu Lys His Gly Leu Ala Pro Lys Ser Trp Thr Asp Tyr Leu

145 150 155 160

His Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly Val Ser Gly Gln

165 170 175

Ala Phe Arg His Gly Pro Gln Val Ser Asn Val Asn Gln Leu Glu Ile

180 185 190

Val Thr Gly Arg Gly Asp Val Val Thr Cys Ser Pro Glu Asp Asn Ser

195 200 205

Asp Leu Phe Tyr Ala Ala Leu Gly Gly Leu Gly Gln Phe Gly Ile Ile

210 215 220

Thr Arg Ala Arg Ile Ala Leu Glu Pro Ala Pro Glu Met Val Arg Trp

225 230 235 240

Ile Arg Val Leu Tyr Ser Asp Phe Glu Ser Phe Thr Glu Asp Gln Glu

245 250 255

Met Leu Ile Met Ala Glu Asn Ser Phe Asp Tyr Ile Glu Gly Phe Val

260 265 270

Ile Ile Asn Arg Thr Gly Ile Leu Asn Asn Trp Arg Ala Ser Phe Lys

275 280 285

Pro Gln Asp Pro Val Gln Ala Ser His Phe Gln Ser Asp Gly Arg Val

290 295 300

Leu Tyr Cys Leu Glu Leu Thr Lys Asn Phe Asn Ser Gly Asp Thr Asp

305 310 315 320

Thr Met Glu Gln Glu Val Ala Val Leu Leu Ser Arg Leu Arg Phe Ile

325 330 335

Gln Ser Thr Leu Phe His Thr Asp Val Thr Tyr Leu Glu Phe Leu Asp

340 345 350

Arg Val His Thr Ser Glu Leu Lys Leu Arg Ala Gln Ser Leu Trp Glu

355 360 365

Val Pro His Pro Trp Leu Asn Leu Leu Ile Pro Arg Ser Ser Ile Arg

370 375 380

Arg Phe Ala Thr Glu Val Phe Gly Arg Ile Leu Lys Asp Ser Asn Asn

385 390 395 400

Gly Pro Ile Leu Leu Tyr Pro Val Asn Lys Ser Lys Trp Asp Asn Lys

405 410 415

Thr Ser Val Val Ile Pro Asp Glu Glu Ile Phe Tyr Leu Val Gly Phe

420 425 430

Leu Ser Ser Ala Pro Ser Leu Ser Gly His Gly Ser Ile Ala His Ala

435 440 445

Met Ser Leu Asn Ser Gln Ile Val Glu Phe Cys Glu Glu Ala Asp Ile

450 455 460

Gly Met Lys Gln Tyr Leu Ala His Tyr Thr Thr Gln Glu Gln Trp Lys

465 470 475 480

Thr His Phe Gly Ala Arg Trp Glu Thr Phe Glu Arg Arg Lys His Arg

485 490 495

Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Arg Ile Phe Pro Lys

500 505 510

Ala Ser Leu Pro Leu Ser Leu

515

<210>28

<211>1617

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>CDS

<222>(1)...(1617)

<400>28

atg gca aga agg act cgt ttc gtg gcc atc gcc gcc ctc ctc aca agc 48

Met Ala Arg Arg Thr Arg Phe Val Ala Ile Ala Ala Leu Leu Thr Ser

1 5 10 15

ttc ctc aac gtc gca gcc ggg cat tcc cgg cca ctg tcc ggt gcc ggc 96

Phe Leu Asn Val Ala Ala Gly His Ser Arg Pro Leu Ser Gly Ala Gly

20 25 30

ctc ccg ggc gat ctt ttc ggg ctg ggc atc gcg tcg agg atc cgc acg 144

Leu Pro Gly Asp Leu Phe Gly Leu Gly Ile Ala Ser Arg Ile Arg Thr

35 40 45

gac agc aac tcg acg gcg aag gcg gcg acg gac ttc ggc cag atg gtg 192

Asp Ser Asn Ser Thr Ala Lys Ala Ala Thr Asp Phe Gly Gln Met Val

50 55 60

agg gcc gcg ccg gag gcc gtg ttc cac ccc gcc acg ccg gcc gac atc 240

Arg Ala Ala Pro Glu Ala Val Phe His Pro Ala Thr Pro Ala Asp Ile

65 70 75 80

gcc gcg ctc gtc cgg ttc tcc gcc acg tcg gcg gcg ccg ttc ccc gtt 288

Ala Ala Leu Val Arg Phe Ser Ala Thr Ser Ala Ala Pro Phe Pro Val

85 90 95

gcg ccg cgc ggg cag ggc cac tcc tgg cgc ggc cag gcg ctc gcc ccg 336

Ala Pro Arg Gly Gln Gly His Ser Trp Arg Gly Gln Ala Leu Ala Pro

100 105 110

ggc ggc gtc gtc gtg gac atg ggc tcg ctg ggg cgc ggc ccc cgc atc 384

Gly Gly Val Val Val Asp Met Gly Ser Leu Gly Arg Gly Pro Arg Ile

115 120 125

aac gtg tcc gcc gtg gcc ggc gcg gag ccg ttc gtc gac gcc ggc ggg 432

Asn Val Ser Ala Val Ala Gly Ala Glu Pro Phe Val Asp Ala Gly Gly

130 135 140

gag cag ctg tgg gtc gac gtc ctc cgc gcc acg ctg cga cac ggc ctg 480

Glu Gln Leu Trp Val Asp Val Leu Arg Ala Thr Leu Arg His Gly Leu

145 150 155 160

gcg ccc cgc gtg tgg acc gac tac ctc cgg ctc acc gtc ggc ggc acg 528

Ala Pro Arg Val Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr

165 170 175

ctc tcc aac gcg gga atc ggc ggg cag gcg ttc cga cac ggt ccg cag 576

Leu Ser Asn Ala Gly Ile Gly Gly Gln Ala Phe Arg His Gly Pro Gln

180 185 190

atc gcc aac gtg cat gaa ctc gac gtc gtc aca ggc aca ggt gag atg 624

Ile Ala Asn Val His Glu Leu Asp Val Val Thr Gly Thr Gly Glu Met

195 200 205

gtg aca tgc tcc atg gac gtg aac tcg gac ctg ttc atg gcg gct cta 672

Val Thr Cys Ser Met Asp Val Asn Ser Asp Leu Phe Met Ala Ala Leu

210 215 220

ggc ggg tta ggc cag ttc ggg gtc ata acc aga gca cgg atc cgg ctt 720

Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Arg Leu

225 230 235 240

gag ccg gcg ccc aag agg gtg cgc tgg gtt cga ctt gcc tac acc gac 768

Glu Pro Ala Pro Lys Arg Val Arg Trp Val Arg Leu Ala Tyr Thr Asp

245 250 255

gtc gct act ttc acc aag gat cag gag ttt ctc ata tca aac cgg gct 816

Val Ala Thr Phe Thr Lys Asp Gln Glu Phe Leu Ile Ser Asn Arg Ala

260 265 270

agc caa gtc ggg ttc gac tac gtc gaa ggc cag gtc cag ctc agc cgg 864

Ser Gln Val Gly Phe Asp Tyr Val Glu Gly Gln Val Gln Leu Ser Arg

275 280 285

tcc ttg gtc gaa ggc ccc aaa tca aca ccc ttc ttc tcc ggc gcc gat 912

Ser Leu Val Glu Gly Pro Lys Ser Thr Pro Phe Phe Ser Gly Ala Asp

290 295 300

gtt gct agg ctt gct gga ctc gcg tcc agg acc gga cct gct gca atc 960

Val Ala Arg Leu Ala Gly Leu Ala Ser Arg Thr Gly Pro Ala Ala Ile

305 310 315 320

tac tac atc gaa ggc gcc atg tac tac acc aag gac acc gcc ata tct 1008

Tyr Tyr Ile Glu Gly Ala Met Tyr Tyr Thr Lys Asp Thr Ala Ile Ser

325 330 335

gtg gac aag aaa atg aag gca ctc ctg gat cag ctg agc ttc gag cca 1056

Val Asp Lys Lys Met Lys Ala Leu Leu Asp Gln Leu Ser Phe Glu Pro

340 345 350

ggg ttt gcg ttc acc aag gac gtg acg ttc gtg cag ttc ctc gat cgg 1104

Gly Phe Ala Phe Thr Lys Asp Val Thr Phe Val Gln Phe Leu Asp Arg

355 360 365

gtg cgc gag gag gag agg gtg ctc cgg tca gcc ggc gcg tgg gag gtg 1152

Val Arg Glu Glu Glu Arg Val Leu Arg Ser Ala Gly Ala Trp Glu Val

370 375 380

ccg cac cca tgg ctg aac ctc ttc gtc cca cgg tcg cgc atc ctc gac 1200

Pro His Pro Trp Leu Asn Leu Phe Val Pro Arg Ser Arg Ile Leu Asp

385 390 395 400

ttc gac gac gga gtg ttc aag gct ctg ctc aag gac tcc aac cca gct 1248

Phe Asp Asp Gly Val Phe Lys Ala Leu Leu Lys Asp Ser Asn Pro Ala

405 410 415

ggg atc atc ctc atg tac ccc atg aac aag gat agg tgg gac gac cgg 1296

Gly Ile Ile Leu Met Tyr Pro Met Asn Lys Asp Arg Trp Asp Asp Arg

420 425 430

atg aca gcg atg acc cca gcc acg gac gac gac gac atg ttc tat gcc 1344

Met Thr Ala Met Thr Pro Ala Thr Asp Asp Asp Asp Met Phe Tyr Ala

435 440 445

gtt agt ttc ctt tgg tca gca ctg tcc gca gac gac gtg ccc cag ctc 1392

Val Ser Phe Leu Trp Ser Ala Leu Ser Ala Asp Asp Val Pro Gln Leu

450 455 460

gag aga tgg aac aag gca gtg ctg gac ttc tgt gat cgg tca gga ata 1440

Glu Arg Trp Asn Lys Ala Val Leu Asp Phe Cys Asp Arg Ser Gly Ile

465 470 475 480

gaa tgc aag cag tac ctg cca cac tac aca tct caa gac ggg tgg cga 1488

Glu Cys Lys Gln Tyr Leu Pro His Tyr Thr Ser Gln Asp Gly Trp Arg

485 490 495

cgg cat ttc ggg gcg aaa tgg agc agg atc gct gag ctg aag gcc aga 1536

Arg His Phe Gly Ala Lys Trp Ser Arg Ile Ala Glu Leu Lys Ala Arg

500 505 510

tat gac cct cgg gca ttg ttg tcg ccg ggc cag agg att ttt ccg gtg 1584

Tyr Asp Pro Arg Ala Leu Leu Ser Pro Gly Gln Arg Ile Phe Pro Val

515 520 525

cca gta gag gca tct ggc att gct tct gcc tga 1617

Pro Val Glu Ala Ser Gly Ile Ala Ser Ala *

530 535

<210>29

<211>538

<212>PRT

＜213〉corn (Zea mays)

<400>29

Met Ala Arg Arg Thr Arg Phe Val Ala Ile Ala Ala Leu Leu Thr Ser

1 5 10 15

Phe Leu Asn Val Ala Ala Gly His Ser Arg Pro Leu Ser Gly Ala Gly

20 25 30

Leu Pro Gly Asp Leu Phe Gly Leu Gly Ile Ala Ser Arg Ile Arg Thr

35 40 45

Asp Ser Asn Ser Thr Ala Lys Ala Ala Thr Asp Phe Gly Gln Met Val

50 55 60

Arg Ala Ala Pro Glu Ala Val Phe His Pro Ala Thr Pro Ala Asp Ile

65 70 75 80

Ala Ala Leu Val Arg Phe Ser Ala Thr Ser Ala Ala Pro Phe Pro Val

85 90 95

Ala Pro Arg Gly Gln Gly His Ser Trp Arg Gly Gln Ala Leu Ala Pro

100 105 110

Gly Gly Val Val Val Asp Met Gly Ser Leu Gly Arg Gly Pro Arg Ile

115 120 125

Asn Val Ser Ala Val Ala Gly Ala Glu Pro Phe Val Asp Ala Gly Gly

130 135 140

Glu Gln Leu Trp Val Asp Val Leu Arg Ala Thr Leu Arg His Gly Leu

145 150 155 160

Ala Pro Arg Val Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr

165 170 175

Leu Ser Asn Ala Gly Ile Gly Gly Gln Ala Phe Arg His Gly Pro Gln

180 185 190

Ile Ala Asn Val His Glu Leu Asp Val Val Thr Gly Thr Gly Glu Met

195 200 205

Val Thr Cys Ser Met Asp Val Asn Ser Asp Leu Phe Met Ala Ala Leu

210 215 220

Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Arg Leu

225 230 235 240

Glu Pro Ala Pro Lys Arg Val Arg Trp Val Arg Leu Ala Tyr Thr Asp

245 250 255

Val Ala Thr Phe Thr Lys Asp Gln Glu Phe Leu Ile Ser Asn Arg Ala

260 265 270

Ser Gln Val Gly Phe Asp Tyr Val Glu Gly Gln Val Gln Leu Ser Arg

275 280 285

Ser Leu Val Glu Gly Pro Lys Ser Thr Pro Phe Phe Ser Gly Ala Asp

290 295 300

Val Ala Arg Leu Ala Gly Leu Ala Ser Arg Thr Gly Pro Ala Ala Ile

305 310 315 320

Tyr Tyr Ile Glu Gly Ala Met Tyr Tyr Thr Lys Asp Thr Ala Ile Ser

325 330 335

Val Asp Lys Lys Met Lys Ala Leu Leu Asp Gln Leu Ser Phe Glu Pro

340 345 350

Gly Phe Ala Phe Thr Lys Asp Val Thr Phe Val Gln Phe Leu Asp Arg

355 360 365

Val Arg Glu Glu Glu Arg Val Leu Arg Ser Ala Gly Ala Trp Glu Val

370 375 380

Pro His Pro Trp Leu Asn Leu Phe Val Pro Arg Ser Arg Ile Leu Asp

385 390 395 400

Phe Asp Asp Gly Val Phe Lys Ala Leu Leu Lys Asp Ser Asn Pro Ala

405 410 415

Gly Ile Ile Leu Met Tyr Pro Met Asn Lys Asp Arg Trp Asp Asp Arg

420 425 430

Met Thr Ala Met Thr Pro Ala Thr Asp Asp Asp Asp Met Phe Tyr Ala

435 440 445

Val Ser Phe Leu Trp Ser Ala Leu Ser Ala Asp Asp Val Pro Gln Leu

450 455 460

Glu Arg Trp Asn Lys Ala Val Leu Asp Phe Cys Asp Arg Ser Gly Ile

465 470 475 480

Glu Cys Lys Gln Tyr Leu Pro His Tyr Thr Ser Gln Asp Gly Trp Arg

485 490 495

Arg His Phe Gly Ala Lys Trp Ser Arg Ile Ala Glu Leu Lys Ala Arg

500 505 510

Tyr Asp Pro Arg Ala Leu Leu Ser Pro Gly Gln Arg Ile Phe Pro Val

515 520 525

Pro Val Glu Ala Ser Gly Ile Ala Ser Ala

530 535

<210>30

<211>1566

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>CDS

<222>(1)...(1566)

<400>30

atg atg ctc gcg tac atg gac cgc gcg acg gcg gcc gcc gag cca gag 48

Met Met Leu Ala Tyr Met Asp Arg Ala Thr Ala Ala Ala Glu Pro Glu

1 5 10 15

gac gcc ggc cgc gag ccc gcc acc atg gcg ggc ggg tgc gcg gcg gcg 96

Asp Ala Gly Arg Glu Pro Ala Thr Met Ala Gly Gly Cys Ala Ala Ala

20 25 30

gcg acg gat ttc ggc ggg ctg ggg agc gcc atg ccc gcg gcc gtg gtc 144

Ala Thr Asp Phe Gly Gly Leu Gly Ser Ala Met Pro Ala Ala Val Val

35 40 45

cgc ccg gcg agc gcg gac gac gtg gcc agc gcc atc cgc gcg gcg gcg 192

Arg Pro Ala Ser Ala Asp Asp Val Ala Ser Ala Ile Arg Ala Ala Ala

50 55 60

ctg acg ccg cac ctc acc gtg gcc gcc cgc ggg aac ggg cac tcg gtg 240

Leu Thr Pro His Leu Thr Val Ala Ala Arg Gly Asn Gly His Ser Val

65 70 75 80

gcc ggc cag gcc atg gcc gag ggc ggg ctg gtc ctc gac atg cgc tcg 288

Ala Gly Gln Ala Met Ala Glu Gly Gly Leu Val Leu Asp Met Arg Ser

85 90 95

ctc gcg gcg ccg tcc cgg cgc gcg cag atg cag ctc gtc gtg cag tgc 336

Leu Ala Ala Pro Ser Arg Arg Ala Gln Met Gln Leu Val Val Gln Cys

100 105 110

ccc gac ggc ggc ggc ggc cgc cgc tgc ttc gcc gac gtc ccc ggc ggc 384

Pro Asp Gly Gly Gly Gly Arg Arg Cys Phe Ala Asp Val Pro Gly Gly

115 120 125

gcg ctc tgg gag gag gtg ctc cac tgg gcc gtc gac aac cac ggg ctc 432

Ala Leu Trp Glu Glu Val Leu His Trp Ala Val Asp Asn His Gly Leu

130 135 140

gcc ccg gcg tcc tgg acg gac tac ctc cgc ctc acc gtg ggc ggc acg 480

Ala Pro Ala Ser Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr

145 150 155 160

ctc tcc aat ggc ggc gtc agc ggc cag tcc ttc cgc tac ggg ccc cag 528

Leu Ser Asn Gly Gly Val Ser Gly Gln Ser Phe Arg Tyr Gly Pro Gln

165 170 175

gtg tcc aac gtg gcc gag ctc gag gtg gtc acc ggc gac ggc gag cgc 576

Val Ser Asn Val Ala Glu Leu Glu Val Val Thr Gly Asp Gly Glu Arg

180 185 190

cgc gtc tgc tcg ccc tcc tcc cac ccg gac ctc ttc ttc gcc gtg ctc 624

Arg Val Cys Ser Pro Ser Ser His Pro Asp Leu Phe Phe Ala Val Leu

195 200 205

ggc ggg ctc ggc cag ttt ggc gtc atc acg cgc gcc cgc atc ccg ctc 672

Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Pro Leu

210 215 220

cac agg gcg ccc aag gcg gtg cgg tgg acg cgc gtg gtg tac gcg agc 720

His Arg Ala Pro Lys Ala Val Arg Trp Thr Arg Val Val Tyr Ala Ser

225 230 235 240

atc gcg gac tac acg gcg gac gcg gag tgg ctg gtg acg cgg ccc ccc 768

Ile Ala Asp Tyr Thr Ala Asp Ala Glu Trp Leu Val Thr Arg Pro Pro

245 250 255

gac gcg gcg ttc gac tac gtg gag ggc ttc gcg ttc gtg aac agc gac 816

Asp Ala Ala Phe Asp Tyr Val Glu Gly Phe Ala Phe Val Asn Ser Asp

260 265 270

gac ccc gtg aac ggc tgg ccg tcc gtg ccc atc ccc ggc ggc gcc cgc 864

Asp Pro Val Asn Gly Trp Pro Ser Val Pro Ile Pro Gly Gly Ala Arg

275 280 285

ttc gac ccg tcc ctc ctc ccc gcc ggc gcc ggc ccc gtc ctc tac tgc 912

Phe Asp Pro Ser Leu Leu Pro Ala Gly Ala Gly Pro Val Leu Tyr Cys

290 295 300

ctg gag gtg gcc ctg tac cag tac gcg cac cgg ccc gac gac gac gac 960

Leu Glu Val Ala Leu Tyr Gln Tyr Ala His Arg Pro Asp Asp Asp Asp

305 310 315 320

gag gag gac cag gcg gcg gtg acc gtg agc cgg atg atg gcg ccg ctc 1008

Glu Glu Asp Gln Ala Ala Val Thr Val Ser Arg Met Met Ala Pro Leu

325 330 335

aag cac gtg cgg ggc ctg gag ttc gcg gcg gac gtc ggg tac gtg gac 1056

Lys His Val Arg Gly Leu Glu Phe Ala Ala Asp Val Gly Tyr Val Asp

340 345 350

ttc ctg tcc cgc gtg aac cgg gtg gag gag gag gcc cgg cgc aac ggc 1104

Phe Leu Ser Arg Val Asn Arg Val Glu Glu Glu Ala Arg Arg Asn Gly

355 360 365

agc tgg gac gcg ccg cac ccg tgg ctc aac ctc ttc gtc tcc gcg cgc 1152

Ser Trp Asp Ala Pro His Pro Trp Leu Asn Leu Phe Val Ser Ala Arg

370 375 380

gac atc gcc gac ttc gac cgc gcc gtc atc aag ggc atg ctc gcc gac 1200

Asp Ile Ala Asp Phe Asp Arg Ala Val Ile Lys Gly Met Leu Ala Asp

385 390 395 400

ggc atc gac ggg ccc atg ctc gtc tac cct atg ctc aag agc aag tgg 1248

Gly Ile Asp Gly Pro Met Leu Val Tyr Pro Met Leu Lys Ser Lys Trp

405 410 415

gac ccc aac acg tcg gtg gcg ctg ccg gag ggc gag gtc ttc tac ctg 1296

Asp Pro Asn Thr Ser Val Ala Leu Pro Glu Gly Glu Val Phe Tyr Leu

420 425 430

gtg gcg ctg ctg cgg ttc tgc cgg agc ggc ggg ccg gcg gtg gac gag 1344

Val Ala Leu Leu Arg Phe Cys Arg Ser Gly Gly Pro Ala Val Asp Glu

435 440 445

ctg gtg gcg cag aac ggc gcc atc ctc cgc gcc tgc cgc gcc aac ggc 1392

Leu Val Ala Gln Asn Gly Ala Ile Leu Arg Ala Cys Arg Ala Asn Gly

450 455 460

tac gac tac aag gcc tac ttc ccg agc tac cgc ggc gag gcc gac tgg 1440

Tyr Asp Tyr Lys Ala Tyr Phe Pro Ser Tyr Arg Gly Glu Ala Asp Trp

465 470 475 480

gcg cgc cac ttc ggc gcc gcc agg tgg agg cgc ttc gtg gac cgc aag 1488

Ala Arg His Phe Gly Ala Ala Arg Trp Arg Arg Phe Val Asp Arg Lys

485 490 495

gcc cgg tac gac ccg ctg gcg atc ctc gcg ccg ggc cag aag atc ttc 1536

Ala Arg Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Lys Ile Phe

500 505 510

cct cgg gtc ccg gcg tcc gtc gcc gtg tag 1566

Pro Arg Val Pro Ala Ser Val Ala Val *

515 520

<210>31

<211>521

<212>PRT

＜213〉corn (Zea mays)

<400>31

Met Met Leu Ala Tyr Met Asp Arg Ala Thr Ala Ala Ala Glu Pro Glu

1 5 10 15

Asp Ala Gly Arg Glu Pro Ala Thr Met Ala Gly Gly Cys Ala Ala Ala

20 25 30

Ala Thr Asp Phe Gly Gly Leu Gly Ser Ala Met Pro Ala Ala Val Val

35 40 45

Arg Pro Ala Ser Ala Asp Asp Val Ala Ser Ala Ile Arg Ala Ala Ala

50 55 60

Leu Thr Pro His Leu Thr Val Ala Ala Arg Gly Asn Gly His Ser Val

65 70 75 80

Ala Gly Gln Ala Met Ala Glu Gly Gly Leu Val Leu Asp Met Arg Ser

85 90 95

Leu Ala Ala Pro Ser Arg Arg Ala Gln Met Gln Leu Val Val Gln Cys

100 105 110

Pro Asp Gly Gly Gly Gly Arg Arg Cys Phe Ala Asp Val Pro Gly Gly

115 120 125

Ala Leu Trp Glu Glu Val Leu His Trp Ala Val Asp Asn His Gly Leu

130 135 140

Ala Pro Ala Ser Trp Thr Asp Tyr Leu Arg Leu Thr Val Gly Gly Thr

145 150 155 160

Leu Ser Asn Gly Gly Val Ser Gly Gln Ser Phe Arg Tyr Gly Pro Gln

165 170 175

Val Ser Asn Val Ala Glu Leu Glu Val Val Thr Gly Asp Gly Glu Arg

180 185 190

Arg Val Cys Ser Pro Ser Ser His Pro Asp Leu Phe Phe Ala Val Leu

195 200 205

Gly Gly Leu Gly Gln Phe Gly Val Ile Thr Arg Ala Arg Ile Pro Leu

210 215 220

His Arg Ala Pro Lys Ala Val Arg Trp Thr Arg Val Val Tyr Ala Ser

225 230 235 240

Ile Ala Asp Tyr Thr Ala Asp Ala Glu Trp Leu Val Thr Arg Pro Pro

245 250 255

Asp Ala Ala Phe Asp Tyr Val Glu Gly Phe Ala Phe Val Asn Ser Asp

260 265 270

Asp Pro Val Asn Gly Trp Pro Ser Val Pro Ile Pro Gly Gly Ala Arg

275 280 285

Phe Asp Pro Ser Leu Leu Pro Ala Gly Ala Gly Pro Val Leu Tyr Cys

290 295 300

Leu Glu Val Ala Leu Tyr Gln Tyr Ala His Arg Pro Asp Asp Asp Asp

305 310 315 320

Glu Glu Asp Gln Ala Ala Val Thr Val Ser Arg Met Met Ala Pro Leu

325 330 335

Lys His Val Arg Gly Leu Glu Phe Ala Ala Asp Val Gly Tyr Val Asp

340 345 350

Phe Leu Ser Arg Val Asn Arg Val Glu Glu Glu Ala Arg Arg Asn Gly

355 360 365

Ser Trp Asp Ala Pro His Pro Trp Leu Asn Leu Phe Val Ser Ala Arg

370 375 380

Asp Ile Ala Asp Phe Asp Arg Ala Val Ile Lys Gly Met Leu Ala Asp

385 390 395 400

Gly Ile Asp Gly Pro Met Leu Val Tyr Pro Met Leu Lys Ser Lys Trp

405 410 415

Asp Pro Asn Thr Ser Val Ala Leu Pro Glu Gly Glu Val Phe Tyr Leu

420 425 430

Val Ala Leu Leu Arg Phe Cys Arg Ser Gly Gly Pro Ala Val Asp Glu

435 440 445

Leu Val Ala Gln Asn Gly Ala Ile Leu Arg Ala Cys Arg Ala Asn Gly

450 455 460

Tyr Asp Tyr Lys Ala Tyr Phe Pro Ser Tyr Arg Gly Glu Ala Asp Trp

465 470 475 480

Ala Arg His Phe Gly Ala Ala Arg Trp Arg Arg Phe Val Asp Arg Lys

485 490 495

Ala Arg Tyr Asp Pro Leu Ala Ile Leu Ala Pro Gly Gln Lys Ile Phe

500 505 510

Pro Arg Val Pro Ala Ser Val Ala Val

515 520

<210>32

<211>1629

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>CDS

<222>(1)...(1629)

<400>32

atg gag gtt gcc atg gtc gtg agc gca aga gcc agc ctg ctg atc ctc 48

Met Glu Val Ala Met Val Val Ser Ala Arg Ala Ser Leu Leu Ile Leu

1 5 10 15

gtc ctc tcc ctc tgc tct ccg tac aaa ttc ata cag agc ccc atg gac 96

Val Leu Ser Leu Cys Ser Pro Tyr Lys Phe Ile Gln Ser Pro Met Asp

20 25 30

ctg ggc ccc ctg aac ctg ctc ccc acc acc agc acc gcg gcc gcg tcc 144

Leu Gly Pro Leu Asn Leu Leu Pro Thr Thr Ser Thr Ala Ala Ala Ser

35 40 45

agc gac ttc ggc agg ata ctc ttc cgc gcc ccg gcc gcg gtg ctg agg 192

Ser Asp Phe Gly Arg Ile Leu Phe Arg Ala Pro Ala Ala Val Leu Arg

50 55 60

ccc cag tcg ccg agg gac atc tcc atg ctg ctc agc ttc ctc tcc ggc 240

Pro Gln Ser Pro Arg Asp Ile Ser Met Leu Leu Ser Phe Leu Ser Gly

65 70 75 80

tcg ccc tcg ctg agc agg gtc acg gtg gcg gcc agg ggg gca ggc cac 288

Ser Pro Ser Leu Ser Arg Val Thr Val Ala Ala Arg Gly Ala Gly His

85 90 95

tcc atc cac ggg cag gcg cag gcc ccg ga cggc att gtg gtg gag acg 336

Ser Ile His Gly Gln Ala Gln Ala Pro Asp Gly Ile Val Val Glu Thr

100 105 110

cgc tcc ttg ccc ggc gag atg gag ttc cac cac gtc cgc ggg gga ggc 384

Arg Ser Leu Pro Gly Glu Met Glu Phe His His Val Arg Gly Gly Gly

115 120 125

gaa ggg cgt gcc tcc tac gcc gac gtg ggc ggc ggg gtt ctg tgg atc 432

Glu Gly Arg Ala Ser Tyr Ala Asp Val Gly Gly Gly Val Leu Trp Ile

130 135 140

gag ctc ctg gag cgg agc ctg aag ctt ggg ctg gct ccc agg tcc tgg 480

Glu Leu Leu Glu Arg Ser Leu Lys Leu Gly Leu Ala Pro Arg Ser Trp

145 150 155 160

acc gac tac ctc tac ctc act gtc ggc ggg acg ctg tcc aat gcc ggc 528

Thr Asp Tyr Leu Tyr Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly

165 170 175

atc agc ggg cag acg ttc aag cac ggg cca cag atc agc aac gtc ctc 576

Ile Ser Gly Gln Thr Phe Lys His Gly Pro Gln Ile Ser Asn Val Leu

180 185 190

cag ctg gag gta gtc aca gga cga ggg gag att gtg gaa tgc tca ccc 624

Gln Leu Glu Val Val Thr Gly Arg Gly Glu Ile Val Glu Cys Ser Pro

195 200 205

agc aag gag gcc gac ctg ttc aat gcc gtc ctg gga ggc cta ggc cag 672

Ser Lys Glu Ala Asp Leu Phe Asn Ala Val Leu Gly Gly Leu Gly Gln

210 215 220

ttc ggc atc ata acc agg gcc agg atc ctg ctg cag gag gct ccg gag 720

Phe Gly Ile Ile Thr Arg Ala Arg Ile Leu Leu Gln Glu Ala Pro Glu

225 230 235 240

aag gtg acg tgg gtg agg gcc ttc tac gac gac ttg ggc gcc ttc acc 768

Lys Val Thr Trp Val Arg Ala Phe Tyr Asp Asp Leu Gly Ala Phe Thr

245 250 255

agg gac cag gag ctg ctg gtg tcg att ccg gat tcg gtg gac tac gtg 816

Arg Asp Gln Glu Leu Leu Val Ser Ile Pro Asp Ser Val Asp Tyr Val

260 265 270

gaa ggg ttc atg gtc ctg aac gag cgg tcc ctc cac agc tcc tcc atc 864

Glu Gly Phe Met Val Leu Asn Glu Arg Ser Leu His Ser Ser Ser Ile

275 280 285

gcc ttc ccc gcg agc gtg gac ttc agc ccg gat ttc ggc acc agg agc 912

Ala Phe Pro Ala Ser Val Asp Phe Ser Pro Asp Phe Gly Thr Arg Ser

290 295 300

agc cct agg atc tac tac tgc gtc gag ttc gcg gtc cac cac cac cac 960

Ser Pro Arg Ile Tyr Tyr Cys Val Glu Phe Ala Val His His His His

305 310 315 320

ggt tac cag cag cag tct cag gcg gcc gtg gag gcc atc tcg agg cgg 1008

Gly Tyr Gln Gln Gln Ser Gln Ala Ala Val Glu Ala Ile Ser Arg Arg

325 330 335

atg agc cac atg gcg tcc cag ctg tac agc gtg gag gtg tcc tac ttg 1056

Met Ser His Met Ala Ser Gln Leu Tyr Ser Val Glu Val Ser Tyr Leu

340 345 350

gac ttc ctg aac cgg gtc agg atg gag gag gtg agc ctg cgg agc gcc 1104

Asp Phe Leu Asn Arg Val Arg Met Glu Glu Val Ser Leu Arg Ser Ala

355 360 365

ggg atg tgg gag gag gtg cac cac ccg tgg ctc aac atg ttc gtg ccc 1152

Gly Met Trp Glu Glu Val His His Pro Trp Leu Asn Met Phe Val Pro

370 375 380

aag gcc ggg gtc gct ggc ttc agg gat ctg ctc atg gac aac gtc tcg 1200

Lys Ala Gly Val Ala Gly Phe Arg Asp Leu Leu Met Asp Asn Val Ser

385 390 395 400

ccg gat agc ttc cag ggc ctc atc ctc atc tac cca ctc ctc aga gac 1248

Pro Asp Ser Phe Gln Gly Leu Ile Leu Ile Tyr Pro Leu Leu Arg Asp

405 410 415

aag tgg gac acc aac acg tcg gtc gtg atc ccg gac tcc ggg ccc acc 1296

Lys Trp Asp Thr Asn Thr Ser Val Val Ile Pro Asp Ser Gly Pro Thr

420 425 430

gcg gac gac ccg gtg atg tac gtg gtc ggc atc ctc agg tcc gcg aac 1344

Ala Asp Asp Pro Val Met Tyr Val Val Gly Ile Leu Arg Ser Ala Asn

435 440 445

cct ggt cca gaa gaa gac ggt gac ggc tgc tcc cac cgc tgc ctg cac 1392

Pro Gly Pro Glu Glu Asp Gly Asp Gly Cys Ser His Arg Cys Leu His

450 455 460

gag ctc ctc cgc agc cac cgc cgg atc gcc gac gcc gcg gag gcg cgc 1440

Glu Leu Leu Arg Ser His Arg Arg Ile Ala Asp Ala Ala Glu Ala Arg

465 470 475 480

ctc ggc gcc aag cag tac ctg cct cac cac ccg acc ccg gcc cgc tgg 1488

Leu Gly Ala Lys Gln Tyr Leu Pro His His Pro Thr Pro Ala Arg Trp

485 490 495

cag cag cac ctg ggc cgg cgc tgg gag cgc ttc gcg gac cgc aag gcc 1536

Gln Gln His Leu Gly Arg Arg Trp Glu Arg Phe Ala Asp Arg Lys Ala

500 505 510

cgg ttc gac ccg ctg cgc atc ctg ggg ccc ggc cag ggc ata ttc cct 1584

Arg Phe Asp Pro Leu Arg Ile Leu Gly Pro Gly Gln Gly Ile Phe Pro

515 520 525

cgg acg gcc cag gat gct gcc gcc gct gct gcg tac ggg agc tag 1629

Arg Thr Ala Gln Asp Ala Ala Ala Ala Ala Ala Tyr Gly Ser *

530 535 540

<210>33

<211>542

<212>PRT

＜213〉corn (Zea mays)

<400>33

Met Glu Val Ala Met Val Val Ser Ala Arg Ala Ser Leu Leu Ile Leu

1 5 10 15

Val Leu Ser Leu Cys Ser Pro Tyr Lys Phe Ile Gln Ser Pro Met Asp

20 25 30

Leu Gly Pro Leu Asn Leu Leu Pro Thr Thr Ser Thr Ala Ala Ala Ser

35 40 45

Ser Asp Phe Gly Arg Ile Leu Phe Arg Ala Pro Ala Ala Val Leu Arg

50 55 60

Pro Gln Ser Pro Arg Asp Ile Ser Met Leu Leu Ser Phe Leu Ser Gly

65 70 75 80

Ser Pro Ser Leu Ser Arg Val Thr Val Ala Ala Arg Gly Ala Gly His

85 90 95

Ser Ile His Gly Gln Ala Gln Ala Pro Asp Gly Ile Val Val Glu Thr

100 105 110

Arg Ser Leu Pro Gly Glu Met Glu Phe His His Val Arg Gly Gly Gly

115 120 125

Glu Gly Arg Ala Ser Tyr Ala Asp Val Gly Gly Gly Val Leu Trp Ile

130 135 140

Glu Leu Leu Glu Arg Ser Leu Lys Leu Gly Leu Ala Pro Arg Ser Trp

145 150 155 160

Thr Asp Tyr Leu Tyr Leu Thr Val Gly Gly Thr Leu Ser Asn Ala Gly

165 170 175

Ile Ser Gly Gln Thr Phe Lys His Gly Pro Gln Ile Ser Asn Val Leu

180 185 190

Gln Leu Glu Val Val Thr Gly Arg Gly Glu Ile Val Glu Cys Ser Pro

195 200 205

Ser Lys Glu Ala Asp Leu Phe Asn Ala Val Leu Gly Gly Leu Gly Gln

210 215 220

Phe Gly Ile Ile Thr Arg Ala Arg Ile Leu Leu Gln Glu Ala Pro Glu

225 230 235 240

Lys Val Thr Trp Val Arg Ala Phe Tyr Asp Asp Leu Gly Ala Phe Thr

245 250 255

Arg Asp Gln Glu Leu Leu Val Ser Ile Pro Asp Ser Val Asp Tyr Val

260 265 270

Glu Gly Phe Met Val Leu Asn Glu Arg Ser Leu His Ser Ser Ser Ile

275 280 285

Ala Phe Pro Ala Ser Val Asp Phe Ser Pro Asp Phe Gly Thr Arg Ser

290 295 300

Ser Pro Arg Ile Tyr Tyr Cys Val Glu Phe Ala Val His His His His

305 310 315 320

Gly Tyr Gln Gln Gln Ser Gln Ala Ala Val Glu Ala Ile Ser Arg Arg

325 330 335

Met Ser His Met Ala Ser Gln Leu Tyr Ser Val Glu Val Ser Tyr Leu

340 345 350

Asp Phe Leu Asn Arg Val Arg Met Glu Glu Val Ser Leu Arg Ser Ala

355 360 365

Gly Met Trp Glu Glu Val His His Pro Trp Leu Asn Met Phe Val Pro

370 375 380

Lys Ala Gly Val Ala Gly Phe Arg Asp Leu Leu Met Asp Asn Val Ser

385 390 395 400

Pro Asp Ser Phe Gln Gly Leu Ile Leu Ile Tyr Pro Leu Leu Arg Asp

405 410 415

Lys Trp Asp Thr Asn Thr Ser Val Val Ile Pro Asp Ser Gly Pro Thr

420 425 430

Ala Asp Asp Pro Val Met Tyr Val Val Gly Ile Leu Arg Ser Ala Asn

435 440 445

Pro Gly Pro Glu Glu Asp Gly Asp Gly Cys Ser His Arg Cys Leu His

450 455 460

Glu Leu Leu Arg Ser His Arg Arg Ile Ala Asp Ala Ala Glu Ala Arg

465 470 475 480

Leu Gly Ala Lys Gln Tyr Leu Pro His His Pro Thr Pro Ala Arg Trp

485 490 495

Gln Gln His Leu Gly Arg Arg Trp Glu Arg Phe Ala Asp Arg Lys Ala

500 505 510

Arg Phe Asp Pro Leu Arg Ile Leu Gly Pro Gly Gln Gly Ile Phe Pro

515 520 525

Arg Thr Ala Gln Asp Ala Ala Ala Ala Ala Ala Tyr Gly Ser

530 535 540

<210>34

<211>3003

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉ZmCkx2 promotor

<400>34

ctgccatcct catgcagatg agacggagag aagatgagaa aagtacaaga tcccagaagc 60

aagcagcagg atggggccat cccccccccc ccccactggg ccccacgggc cgaaagccac 120

cggcgaaaat gtccagaagg ccacgtgggg catgggtccc cggagtccac ttccgcgcga 180

tctcgaggcc gggccgcacc ggcaatcgct ctccggccac ctccctgctt cctcaggtcc 240

ggtctcccat agtccaatgc atgcatgcac gagcatcccc tcagaacgct ggcagtgagt 300

gtcttgctcg cacatcagct tggccagtca gtgcgagaac acagcagcaa caacaacaac 360

aacacctgtg cacaatggcg tctatcattg gtaccatctc aatcggctga cttgtctata 420

actactgtta acggaggtcc cttgtgcatc atgcagtttt agaagagcac ctcgatcgca 480

agcgcctcat tattatcatc attctcttaa actggtcaga aaactgacca tcagctaaag 540

tgatactgac atactgtatc tttgtagata attaaatgga gaaaaatctc cttctgttcc 600

gtctggccgt taaatgccga atccatgcat atataaatct gtacgtaggc tcaaagcaca 660

gtgtgcattt tggctttcca gctagcatac atacatgtga ctgctgacga tgaattgtgt 720

ggaccacatt ggcacaacgg tgcattgcaa cggacgggcg ccgtcaaggt caaacgcata 780

aaaggctgtc atttggcaac acaatgaatc agtggcgcca cgccatccgt ccacgatcca 840

ccgttcttgg tgtagtggtt ggtcccagcg cttgaaggcc aggccgaggc cgtgttctgg 900

aaggtggcct gtggtgagca ctaaacatgt gtgtgctttt gcctttccaa gccagagggc 960

cggtctctta atatacataa catacacacc actttttcat tttgttcatt attacggtct 1020

aatgcaaaca aagccatttg cagaatgtgc tacatagcag gtatgtttct ctttttttcc 1080

ctgtaaaatt tgtagactta tcacaagaat aagtttaacc attactagaa tagttcctca 1140

catgtttgtt taccatcggg gcgggaacag cttgcattgc aaaagctgcg caagtattag 1200

ggccctctag atttttttaa tagtagtagt atatataata tataggtgtt actatttgag 1260

ttgttaggcc atctgcggca gattttctat gacatccctt atttcaaact ttattttgca 1320

aacagttgtc atatacccta ttttaggcga atcactgaag acaggtaagt tttggcacgg 1380

atgaggtgga gagtggacaa gaatctccgt tgtggagtct gcctaccagt accaggcaaa 1440

gtaatgcatg cgcgcggaca ggatggacgg tcgaagtggc ctccctgcct ccaccccgac 1500

gacgacgcat gggctccgtc cccttcgctt gcttcctgct ccagctagct ccatcgccta 1560

gtgctccgct ccgccgcaca ggaacggaac ggaacggacc gaaccacttg gtcgcatccc 1620

gatgcgttgc cgtctgccgg tgtccatcgt gtcggtttca cctctgcact agcataaatt 1680

ccttgacacc aacagcgagc gacatcatcg gctcagccct acaagtcacg agtgttctga 1740

ctgaccagct agcaatagca atctgctgct ctgcttgact tgctcggacg atccgccgct 1800

gcttgcgttc ggctccagta ggctatcctc cgcgacgtcg tcgatctgga ctccatggcg 1860

tccacacaga atcgacacga gcttggtgtg ccgcgtacgc atgtgtgcgt atgtatgcct 1920

cgtcttccac atgcaaacat acgcagagga aggggaaagg cggcagcaaa cgcgacggtc 1980

caagtcgtac cacagaagtg gtcgcgcatg tgtgcccaag ttgccatcac ccggatgcta 2040

ttagatttcc agaaactaac ttgtgaggac ccctggtgtc tgctagctgc tctccaactc 2100

caacctgtca atcaattccc agacggacaa gctgagctca cagctcaagc tcaacaacga 2160

tggccggccg ggtcaccatg gaactgatcc tctacagtac aggcatggga aaatggagga 2220

ggagagcagg gcagtgaggc cacagaatca gaggctgatt agtgttggtg agctccaatc 2280

caacagcata tgaccagcga gcagaacata gggatgtcct gtgggcttgc ccagggacag 2340

acgcatgcaa gccatgtgac tgtccggaga gagagccggt gatactggaa cagaggatcc 2400

gatcctgccc cccttctttt gcctctccct ctctcacaca cacagtctca cctatatgtg 2460

gctatgtcgt ctccattagg ctgttaacta gccaacacat gttcccccgt tgcttaagac 2520

agcagctaca aagcgagaac atcatgctct aaaaagaaac ttccgcaatg caccactagc 2580

acatgtctgc gcctcaattc gcaaccggca agcaagcaag ccggcaagca gacagtcgcc 2640

atacggtttt taccaaacag ctagcgccca cagctgacta gctgaccacc gcaccaccca 2700

cactcctcct cgcgagtcgc gaggcaagcc gcaagctcct atatagagag gccccctccc 2760

tccccctgca tggacagcca ccgccttctt caaccctcct tccgtcttcc tcctctagtc 2820

ttacctcgtt gcacctcaag aaacttggcg cgcaaccagg aaaccccctc ttctctctct 2880

ctctctctct ctctctctgc cttctgattc caagctcccc aactgcccag caccaacctg 2940

ccgaactccc ctcctttttg ttggtttgtc gaattataaa ttgagcccgg ccggctgact 3000

acc 3003

<210>35

<211>2001

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉promotor of ZmCkx3

<221>misc_feature

<222>(0)...(0)

＜223〉n=A, T, C, or G

<400>35

ccggggtgtg acaggagcat tgaagcatgc atgctctgct cagcatataa ttaaagaaag 60

aagcatcaaa atgcactgga gcagttgacc aaaacttgca gctacgtcaa aatatatacg 120

agggctggca tcaaggtgtg ctcagcccga gccccgtcag gtaacttggt cttttgtttt 180

ctggccttgc ggcttcatta aaggccgccg gccgcgagcg aggcaaaaca gtgaagggga 240

ggggaggtgc ccgccactaa cctctcggtc ggatatatta gtattcaagc agttgacaaa 300

tctgtgcgga tttgatttgg tctgaggaaa atatatatat atatatatat agcccctcgt 360

cgttcatgca ccctctcgca gcctgcaacc ttacaatatt gttcttgcat ccggttttat 420

ttatattttt attttttaaa aaaaaaatcc atagtcctgc cgtcttgaag gatatgtttt 480

tctttaccca tgcacggcgg agtttaaatt tgcgctgacc cgactgctcg tgaacagaga 540

caagtatgac agatatcgtt gagttccaaa ttttaaaaaa aaaatcaata aaaaatttaa 600

aacagaatgt tgacgaggaa aaaaaatatg aaggtgcttg cacacctgtc actccatgcc 660

ggacatcaac aaattaattg ttcaagtggt gggagtcagc tgcttccagt ttaccttcct 720

gcgccagcgg ttggtagaca ggattgttgc cacgtggacg aaatctcctg ccgccagctg 780

gttgatcacg gcaggcagtc acatgcttct tgccaagatt accgcgggtt gtaatcatct 840

gaaatatatt aacctgagca cgtgatagag taaaaaaatt ggtcgactaa gggggtgttt 900

ggtttctagg gactaatgtt tagtccctac attttattcc attttagttc taaaattacc 960

aaatatagaa actaaaactt tattttagtt tctatattag caatttatag actaaaaaag 1020

aataaaatga agggactaaa tattaatccc tagaaaccaa acacccccta actttaggta 1080

agttgtggca tgcattctct ggaacggcag ttctagagag cacttgagat gtcaacaggt 1140

gaagaattga agattggcca acacaggcgt tcaaggagat tcaaccaccc atccacatac 1200

cgcgcaaaca cttggggggc attcttgctg ctgccacatt tggaagaagc gcagcaatgt 1260

ggtgttcaga agaagcacag ctattttagc tcttgataac tatctttttt tttgcataga 1320

ttaatttatt tcttcgatata tactagctt gtaaaaaaat gttttncaga tatatgtata 1380

aaaatgtgta cctagtacct acgcatgtct tagttcaaca tacttgatag ctgtagtttt 1440

ctgaaaacct gttcaaatta acctttttcc taccctgatg gtgaatagag agaaaagctt 1500

tacctttgtc tgaataagaa aactaacaga aagcttacat tttggccact ctacctgccc 1560

gagtattttc taagcaagca aaggcgcatg aaaattttct cggaatccat gaccttttac 1620

gcgcantgnw aaayawwgwm mattgmtcmg accaatgatc attttgatac tctccacaag 1680

tcaacatctc aaaaaaacca caagatgggg cccatcaaca taagttcacg agtgtgcctt 1740

caggtacatt gttctttttt tttgttttgc taaagtcaat cagctgcaaa atattcagaa 1800

caatttcaat aacccgaaag gctgttgtgc ctccatttgt caacgtttgc gaggccaaat 1860

ggtacccccg ctataaatac catggaagtt cttggcctct aggacacaca agcgatctct 1920

cctcctatag tttctataac cccacaaagc gtccaggtcc cgtagtcacc tccgattgca 1980

ttgcgttgcc gcaagacaag c 2001

<210>36

<211>2448

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉promotor of ZmCkx4

<400>36

ctttatgttg tagccaagga aagtatactg ttaagatcag aatgaacctt ataggagttg 60

tatgggcata aagccagcaa gtatagccaa aggtacacaa ggctaatata gtcaagttgt 120

tgatgtgtga gacgttcaag gaagtgaact attggaggag tcgactaaaa gtacgattaa 180

taaggtagac atgatggtaa aatctttgat ctagaattta agtggtatgg atgcgagggt 240

gagaatggca agcacaactt caaatatagg gtgatgctta tgcttggctg agccatttca 300

ttcatgagca taggaacatg agacatggtg ggatatggat acttgcacaa aaaaaggaat 360

taagtttatg atattcacct cccagtcagt ttgcatggta aaaaaattcc tatcaatttg 420

gttctcaact agggcctaaa attctcaaaa tatctgttgg ggaccattat cgtcgacgat 480

cctcagaatc tgttattacc aaattaaaag gtgtgtttca ggtactgtgc aaagcagcag 540

cgaagctatc cttcgtcaaa agtggctcaa tgaaccaggt ggagaagcta tggagcttcg 600

tctgcgtaga gcgtgccgga ggaggaagct ttggctctga atgcatcgac ttacgaagca 660

tgggagaaga agactcagaa ggcttgtcca gcgtgggaat aaaaaggaga aaatacaatt 720

ttgcccttgt gggatttgta aatcatgtgc aaggctcatg gatatgtttg taattttata 780

tgatatgttt gtaaatcatg gatatgtttt gtaaatcagg tggactagag gagagggagg 840

gtggacatag tgacttgcat cttgatcatg gtagagtggt catggtagag ggaaaggggt 900

aggtcaattc tggagtgcgg ccacggtggc ttgagtgtcg gccacggtag gggaaagggg 960

tagcccaatt ctagggccgg catcggagaa ggccgacatg tgcacgtcag gaggtagtgt 1020

tagaggtttg aacggaaaaa attgaacatg ttagtatga tgagttgtgta attgctggga 1080

attgtggata atttccactt aactacggcc ctgtttattt acccctagat tataaaatcc 1140

aacttaaaaa agttgagatg taaacaaaca acacatatta ttaggtggat tatgttatct 1200

agaaatctgg atgataataa tttataagtc ggttaatagg tgtttacata atcgataagc 1260

tggattatat aatcctggaa cacggctttc gcgagagcgt attaaaacag gattccgtga 1320

agcacactat ctgaggagct ccaccaaaag ctgaatctag cccgcactct tttttggagg 1380

attcaaattt ggtgtcactg gagcattcgg cattttgttt catggcgtga agctattttt 1440

actaattaca gaagctgttt caaatagacc tttaaatgat ggctgagtat aaaaggaggc 1500

aattttttta tctcgccgat ggagccaggt cgcgtcgcgc cgcggccgtg ctgcgctctc 1560

gacgcgatct agcggcgatg tgcacagtac agttttgcca tgccattggt taagcctgca 1620

tacaacacac cagcgtactg ccctgcacaa gatctcctcg gctcggcctc tcctgatgga 1680

acgttcagct tgaacagcgg agcgtggggg catcccgggg atgggcgccg cggccgagaa 1740

attttgcaac ctggcaaatc tgccctgtcg catactacca tccacctcca ggcgccaaga 1800

acgcctccga gtttcaggct tgcagctcag ctctgtgttg aattggaacg ggcggagttt 1860

ctgggttcca gacttccagt acaaggcgat caattggtag ggcgaattac ttgcaggccc 1920

agatgcatgg cccatctatc tggttctcta tcggttgctt ttacttgcac aatagtggca 1980

gacaaactac aagtcagatc cgatcctatc catccatcca tctcgcagcg cgatgcaaat 2040

atgcaatcgt ctgtggaact cgaaaaaaaa cagaggtccg gcctcgcacg aggttaaggg 2100

aaaaaaaacg aagcgtttgg aactttggtt ggcattcgca gcatgctgtg ctgccaccgt 2160

atgtttttat ttttgctttg tttgtcttct ttgagaaacg tgagggagcc gcgtgtccgc 2220

tcgttataaa acccccccgg cgacccaaac taccacgagc tcaagcctca agcctcaagc 2280

ctcaagcaag cagagcgccg tgacatcacg aaacaaacat atagagctag ctgctctgcc 2340

tctgcttcac caatcacctg cttggccgcg cggaggggag ggtttccccc tttgacacag 2400

ctgagctccc ctccatcagc agccagctcc tcgtcgcaaa gcaagaag 2448

<210>37

<211>2346

<212>DNA

＜213〉corn (Zea mays)

<220>

<221>misc_feature

<222>(0)...(0)

＜223〉promotor of ZmCkx5

<400>37

tacagatttg cgttcatcaa tggcagcgcg ggatctcatg aggtcactgg gttcttgcaa 60

gtggggagag aaagggagat ctacgaaaga cttgttagtg ggccaccttt tccctctttc 120

cccacaagga cgagatcgtg gattagagta ggaaagtgat tccgcattgg tctcaaatct 180

tggcgaaaga ttgcattgtg tactctccac cactcgaccg gcaacgaggc attttgttat 240

tgcacgatgc atcctttgca catgagctag gcttgtgcct ttgagtattc agttagcatt 300

gcaaccccat ttcaattcac atgcttgtct ttccaaggaa ctttctaagc cacctaacag 360

acattagggt ttatatcaga atcgagctca tggcgtactt tatgctgcac gaacaatggg 420

ttgggggcgt cgtttcttgc atgagagcat gcgcatcctg gtaaggattt cgccaaaaga 480

actttagtcc tctaccgact ttgtgtttgc gtgatctcgt gatttgaagc ctgtggtggt 540

gtgctgaggc agcatattgg aaggtatctc tgtgttgata tggcatccgt ccgtggacaa 600

atcgatacca catactgttc ttggattcta ttcttgggat tgctaaatga tctagataga 660

ttatattctc ttgttgcagc ccctattgct tcaatacgaa gaaaacccaa cgtttagaac 720

ttaataaaac catttgtgag cttagctgct taggcaattc atttttatgc atgacaaata 780

tataataata ttagctatac tattattgat gcaacctgtg ggagcgtata aaatggtact 840

tccccaattc taaattataa gacgttttga ctatatattc tacatacata tgtttaattt 900

tatatttaga taatcgctat gccttaatat atagtaaaaa gtagtatatc tagaaaagat 960

aaaacatctt ataatttaaa aatgggtaga gtattatatt agatatgaac agtgcttaga 1020

tgccaccaaa attttgccat gccatcctaa ggccagcaaa agtttgtgtc ttcttttgtt 1080

ttccaaacca ctagatgcca atatactatt tatcatcgat cgagatgtag gtcttagtta 1140

attgtgtcgg gtgcccttga gaaagaaaag aaaaaggtgg gattttgttt tcgcttagac 1200

gatgattgga tctcttggtc tctgaattcc atcccgaata aacaaatgaa gtaggtcctc 1260

agtcaccctt gccctgttag ctgcaagaga gctcatggtt tccagccaca caatcagtcc 1320

atggctcctt cttcttggcc taagtggtgg ccaatcattg tgggtgatcg agtcttgggc 1380

cctctgaaca gtattacaca acagtaatcc tgcaaaagat ttggtatatc tagattctag 1440

agtgagcgcc gtgttgtgcc cagctaggaa tgggttgtca agtgcaacag gaggaggacc 1500

caggatggtc aggtgtaata ggctctcatt aaaagactgt tcagatggat tagagcaacg 1560

acggggaagc cgggaaaaaa tggttggttc tgctttcctc tcgctccccg gccgggttca 1620

tatatgaatc tgagaacgat attttttgct tcatttttca tttgctatat atttaaactg 1680

tttttttgtg tgtgtgtgtg tgttcattga gctcaatact tgaggcttga tagggagagg 1740

agtgaggcag ctgatcacat ggacctccat ctgaggacag ttcctcttcc gaaacagaaa 1800

ggagagtgca gggaccagcg tggcctgtac agtattgtgt ttgccctttt cctttggcag 1860

ggacagagag cttcaggctt gtcctcttta tgtatgctgc tcgcctgctt cagagtcaga 1920

gcttcccctt ctcacttctc agagagagag agagagaaga gagagagagg agagccctcc 1980

acagctcccc tgtcctgccc tcaggcattc tttgtcacag ggggcgaggg ctgaagatca 2040

tcacatggtg gccttttttg ggtctgtggc ctttggtctt ttagtgcttc ttccttttac 2100

ctcctcatga catgaacccc ctttttaaac ctccctcaaa atcaaatcac cctccttctc 2160

ctttaagagc cctcaacccc ttcccctcat tttccttcat ccctcagcct ttgcacaaag 2220

ggcaagaata acgcagtatg atcatctgat catactcccg ccgccatcac aatcccacac 2280

gaacgtgaga caaaggtaac agacgcaaga agctagcagc tgcaggagat tgctcagccc 2340

atctcc 2346

<210>38

<211>51

<212>DNA

＜213〉corn (Zea mays)

<400>38

caucaucauc auggatccac caatggatct acgtctaatt ttcggtccaa c 51

<210>39

<211>42

<212>DNA

＜213〉corn (Zea mays)

<400>39

cuacuacuac uagttaactc acattcgaaa tggtggtcct tc 42

Claims (5)

1. can drive the isolating promotor of transcribing in the preferred mode of seed, wherein said promotor comprises and is selected from following nucleotide sequence:

The fragments sequence that comprises the listed nucleotide sequence of SEQ ID NO:7;

The listed nucleotide sequence of SEQ ID NO:7; With

The nucleotide sequence of under stringent condition, hybridizing with the complement of SEQ ID NO:7.

Claim 1 can drive the isolating promotor of transcribing in the preferred mode of seed, wherein said promotor comprises the fragment of the listed nucleotide sequence of SEQ ID NO:7.

Claim 1 can drive the isolating promotor of transcribing in the preferred mode of seed, wherein said promotor comprises the listed nucleotide sequence of SEQ ID NO:7.

Claim 1 can drive the isolating promotor of transcribing in the preferred mode of seed, wherein said promotor is included under the stringent condition nucleotide sequence with the complement hybridization of SEQ ID NO:7.

5. recombinant expression cassettes, described recombinant expression cassettes comprise promotor and may be operably coupled to the nucleotide sequence of described promotor, and wherein said promotor comprises and is selected from following nucleotide sequence:

The fragments sequence that comprises the listed nucleotide sequence of SEQ ID NO:7;

The listed nucleotide sequence of SEQ ID NO:7; With

The nucleotide sequence of under stringent condition, hybridizing with the complement of SEQ ID NO:7.

Images