CN101899442B - Rice RR17 promoter and application thereof - Google Patents

Rice RR17 promoter and application thereof Download PDF

Info

Publication number
CN101899442B
CN101899442B CN2010102301518A CN201010230151A CN101899442B CN 101899442 B CN101899442 B CN 101899442B CN 2010102301518 A CN2010102301518 A CN 2010102301518A CN 201010230151 A CN201010230151 A CN 201010230151A CN 101899442 B CN101899442 B CN 101899442B
Authority
CN
China
Prior art keywords
sequence
dna
gus
osrr17p
root
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2010102301518A
Other languages
Chinese (zh)
Other versions
CN101899442A (en
Inventor
梁岩
张健
谢庆军
左建儒
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Genetics and Developmental Biology of CAS
Original Assignee
Institute of Genetics and Developmental Biology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Genetics and Developmental Biology of CAS filed Critical Institute of Genetics and Developmental Biology of CAS
Priority to CN2010102301518A priority Critical patent/CN101899442B/en
Publication of CN101899442A publication Critical patent/CN101899442A/en
Application granted granted Critical
Publication of CN101899442B publication Critical patent/CN101899442B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a rice RR17 promoter and an application thereof. The DNA fragment provided by the invention is any one of DNA molecules shown in 1), 2) and 3) as follows: 1) a DNA molecule shown in sequence 1 in a sequence list; 2) the DNA molecule which can hybridize with the DNA sequence in 1) under a severe condition and has a promoter function; and 3) the DNA molecule which has homology as high as over 90% with the DNA sequence in 1) and has the promoter function. The experiments in the invention prove that an OsRR17 gene promoter OsRR17p can specifically express when the rice stem grows to root, and can be used for research and improvement of development of plant root systems and adaptation on different soil environments, thus achieving the aim of improving yield.

Description

Rice RR 17 promoter and application thereof
Technical field
The present invention relates to a kind of rice RR 17 promoter and application thereof, relate in particular to a kind of dna fragmentation and application thereof with specific expression promoter function.
Background technology
The root of plant has two main basic functions: from soil, absorb moisture content, nutrition and fixed action.Through the research to the Arabidopis thaliana model plant, people have had deep understanding to the gene of dicotyledons roots such as regulation and control Arabidopis thaliana.But monocotyledonous root system such as paddy rice and Arabidopis thaliana are essentially different.What play a major role in the life of dicotyledons is the main root that is come by fetal development.And for paddy rice, the main root that fetal development comes only plays important effect in early days, and in the several weeks behind the seed germination, the main root that stem-root will replace fetal development plays a major role.From initial mechanism, stem-root is to grow behind the embryo, therefore can not from Arabidopis thaliana, find the gene of the initial needs of stem-root through the mode of homology comparison.
Phytokinin is one of five big classical hormones of plant, and it has regulated and control all respects of growth and development of plants.Main through the research to the model plant Arabidopis thaliana, pair cell mitogen signal transduction pathway has had partly to be understood.The signal transduction of phytokinin is to be mediated by a kind of double base component system (two-component system) that is similar in bacterium and the yeast; This system comprises histidine kinase (Histidine Kinases; HKs); The phosphoric acid translocator (Histidine-Phosphotransfer proteins, HPs) with the reaction regulatory factor (Response Regulators, RRs).In the model plant Arabidopis thaliana, ARR (Arabidopsis Response Regulators) is the downstream factor of bigram sub-system, also is that its major function is exercised element.Present known Arabidopis thaliana ARR gene has 24.According to the similarity degree of their sequences, the reaction of functional domain and pair cell mitogen can roughly be divided three classes ARR: promptly the A type is (10; Comprise ARR3-ARR9; ARR15-ARR17), Type B (12 comprise ARR1, ARR2; ARR10-ARR14, ARR18-ARR21 and ARR23) and atypical ARR22 and ARR24.
Summary of the invention
The purpose of this invention is to provide a kind of dna fragmentation and application thereof with specific expression promoter function.
Dna fragmentation provided by the invention (OsRR17 gene promoter OsRR17p) derives from paddy rice (Oryza sativaL.japonica.cv Nipponbare), is following 1)-3) in arbitrary described dna molecular:
1) dna molecular shown in the sequence 1 of sequence table;
2) under stringent condition with 1) said dna sequence dna hybridization and have the dna molecular of promoter function;
3) with 1) described in dna sequence dna have 90% above homology, and have the dna molecular of promoter function.Sequence 1 is made up of 2455 Nucleotide.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.
The recombinant vectors, expression cassette, transgenic cell line or the reorganization bacterium that contain above arbitrary said dna fragmentation all belong to protection scope of the present invention.
Said recombinant vectors is specially OSRR17p is inserted in the recombinant vectors that obtains between PstI and the SalI recognition site of pC1300-GUS-NOS, and said pC1300-GUS-NOS is the SmaI of small segment insertion pCAMBIA1300 binary vector that pBI121 is obtained and the carrier that the EcoRI recognition site obtains after SmaI cuts with the EcoRI enzyme.
The primer of arbitrary said dna fragmentation is to also belonging to protection scope of the present invention more than the amplification.
The sequence of a primer of said primer centering is a sequence 2, and the sequence of another primer is a sequence 3.
The application of above-mentioned dna fragmentation in the expression that makes goal gene in axis base portion joint also is the scope that the present invention protects.
In the above-mentioned application, said axis base portion joint is the initial position of stem-root.
In the above-mentioned application, said plant is a monocotyledons.
In the above-mentioned application, said monocotyledons is a paddy rice.
The application of above-mentioned dna fragmentation in the genetic breeding of plant also is the scope that the present invention protects.
Said plant is a monocotyledons; Said monocotyledons is preferably paddy rice.
The OsRR17 of experiment showed, gene promoter OsRR17p of the present invention can be taken root initial specific expressed in rice stem, can be used for studying and improves the growth of root system of plant and to the adaptation of different soils environment, finally reach the purpose that improves output.For some rice varieties that is prone to lodging, also can regulate and control expression of gene resistant to lodging with the specific expressed promotor of stem-root, increase the lodging tolerance of paddy rice, yet blade and the seed quality of paddy rice do not influenced.Illustrating of the discovery of promotor and its expression pattern and function, all significant in development of plants regulation and control and biotechnology breeding, for from now in the axis base portion saves specific expressed foreign gene novel and effective promotor or cis element are provided.
The result of study of this experiment shows that phytokinin has suppressed the initial of stem-root; Because the function specificity of A type ARR gene family possibly determine the specificity of phytokinin regulating growth of plants signal pathway; Therefore through detecting the spatial and temporal expression pattern of rice cell mitogen reaction regulatory factor OsRR; Find that OsRR17 is the gene of rice stem base portion joint specifically expressing; Therefore from paddy rice, clone the promotor of OsRR17 gene, and detected the spatial and temporal expression pattern of this promotor, find that this promotor is specific expressed at the rice stem initial position (being the basal part of stem joint) of taking root through gus reporter gene; Therefore this promotor will provide strong tool for the finely regulating and the biotechnology of plant metabolism, have important theory and realistic meaning.
Description of drawings
Fig. 1 suppresses the initial of stem-root for phytokinin
Fig. 2 is the RT-PCR result of OsRR17
Fig. 3 is the pC1300-OSRR17p::GUS-NOS plasmid map
Fig. 4 is that the GUS of OsRR17p::GUS transgenic plant is active
Embodiment
Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.
Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.
Used in an embodiment of the present invention material comprises: intestinal bacteria (Escherichia coli) strain is DH5 α; Agrobacterium (Agrobacterium tumefaciens) bacterial strain EAH105; Cloning vector pGEM-T Easy and ligase enzyme (Promega); Restriction enzyme (NEW ENGLAND BioLabs); Plasmid pBI121 (Clontech), binary vector pCAMBIA 1300 (Cambia, have can supply plant to select to use hygromycin gene at T-DNA right sides within battery limit); Rice varieties Japan fine (Oryza sativa L.japonica.cv Nipponbare).
The structure of embodiment 1, commentaries on classics OsRR17p paddy rice
What 1, phytokinin inhibition rice stem was taken root is initial
Fine (the Oryza sativa L.japonica.cv Nipponbare of rice varieties Japan; Fang J., Chai C., Qian Q., Li C., Tang J.; Sun L., Huang Z., Guo X., Sun C.; Liu M., Zhang Y., Lu Q., Wang Y.; Lu, C, Han B., Chen F.; Cheng Z., Chu C. (2008) Mutations of genes in synthesis of the carotenoid precursors of ABA lead to preharvest sprouting and photo-oxidation in rice, Plant Journal, the 54:177-189. public can obtain with developmental biology institute from the heredity of institute of Chinese section.) with after the 20% javelle sterilization 20 minutes, with aseptic water washing 3 times.Then contain the 1/2MS substratum of 1% sucrose (Sigma-Aldrich company Cat#:M5524) go up to germinate, and plant growing condition is: 28 ℃, continuous illumination, intensity of illumination is 80-120 sun olm -2.sec -1Observe the growth (Figure 1A) of stem-root after 4 days.Through dissect finding that joint (Basal node) that stem-root originates in basal part of stem (Figure 1B).When external source applies the 6-BA (a kind of autosynthetic calls's mitogen commonly used) of 1 μ M, the visible stem-root obviously reduces (Fig. 1 C), on the 1/2MS substratum that contains 5 μ M 6-BA, does not observe stem-root (Fig. 1 D) fully.Whether suppressed the initial of stem-root in order to detect phytokinin, basal part of stem has been done semithin section.In the paddy rice that does not have phytokinin to handle, initial (red arrow among Fig. 1 F and the G) that can high-visible stem-root, however after the processing of 5 μ M phytokinin, there be not initial (Fig. 1 H, I and the J) of stem-root fully.Fig. 1 suppresses the initial of stem-root for phytokinin, and the scale of wherein dissecting in the picture is 0.5mm, and the scale in the semithin section is 100 μ m.
Semithin section: the basal part of stem of paddy rice is fixed on the PBS that contains 4% LUTARALDEHYDE and spends the night; After Leica historesin embedding; Use Leica RM6625 slicing machine to obtain the semithin section of 4 μ m; Through toluidine blue (0.1%w/v) dyeing, observe down then at opticmicroscope (Olympus BX51).
2, the phytokinin reaction regulatory factor OsRR of screening specifically expressing in the basal part of stem joint
Primer sequence:
Name ID Primer?sequence
OsRR17-F LOC_Os04g28120 ?AGTTCCTCGAAGCTGCAAGAGTGA
OsRR17-R LOC_Os04g28120 AGGCACTACATGACCATCACCACT
RNA extracts
The TRIzol method: the operation instruction with reference to manufacturer (Invitrogen) provides is carried out.At first precooling mortar, pestle, 1.5ml centrifuge tube and TRIzol reagent.The Japanese fine leaf of the rice varieties of fetching water respectively, main root, lateral root and basal part of stem joint are organized each 100mg, pulverize fast with liquid nitrogen, are transferred to the centrifuge tube of precooling.Add 1ml TRIzol reagent, the vibration mixing.Room temperature was placed 5 minutes, centrifugal 10 minutes of 4 ℃ of 12000g.Get supernatant and move into new centrifuge tube, add 200 μ l chloroforms, the jog mixing.Room temperature was placed 3 minutes, centrifugal 10 minutes of 4 ℃ of 12000g.Get upper water and move into new pipe mutually, add 250 μ l Virahols and the high salt precipitation agent of 250 μ l (0.8M Trisodium Citrate, 1.2M sodium-chlor), room temperature was placed 3 minutes, and centrifugal 10 minutes of 4 ℃ of 12000g remove supernatant.Deposition is with 1ml 75% washing with alcohol, centrifugal 5 minutes of 4 ℃ of 7500g, removal supernatant.Be deposited in drying at room temperature 5-10 minute, and added an amount of (about 50 μ l) DEPC water dissolution (, can place 50 ℃ of water-bath 10-30 minutes) and obtain RNA in order to help the RNA dissolving.
The cDNA reverse transcription:
Synthesizing of cDNA first chain:
(1) gets the RNA 1-2 μ g of said extracted, add DEPC water to 10 μ l;
(2) add 1 μ l (0.5g) Oligo (dT) 15With 1 μ l 10mM dNTP, mixing;
(3) 65 ℃, 5 minutes, be placed on then on ice, add fast: 5 * buffer, 4 μ l, RNAse inhibitor1 μ l, 0.1M DTT 2 μ l, 5U/ μ l ThermoScript II H 0.5 μ l;
(4) reverse transcription reaction (cDNA first chain is synthetic) carries out on the PCR appearance, uses following program:
42 ℃ earlier, 50 minutes; 45 ℃ again, 10 minutes; 50 ℃ again, 10 minutes; 70 ℃ again, 15 minutes;
(5) take out fast after reaction finishes, add 10mg/ml 1 μ l RNase on ice, placed 30-60 minute at 37 ℃ then, obtain cDNA.
Pcr amplification:
PCR reaction system (20 μ l): template DNA 1 μ l; 10 * buffer, 2 μ l; 2.5mM dNTP 2 μ l; 10 μ M primers, 2 μ l; Ultrapure water 12.8 μ l; 5U/ μ l Taq archaeal dna polymerase 0.2 μ l.
The pcr amplification program is: 94 ℃ of preparatory sex change 2min of elder generation; 94 ℃ of sex change 30s again, 58 ℃ of annealing 30s, 72 ℃ prolong 1min, and cycle number from 22 to 34 does not wait; And then 72 ℃ of prolongation 10min; 4 ℃ of preservations.
Used PCR appearance model is Whatman Biometra T Gradient 96 and MJ PTC-200.
The result sees Fig. 2, can find out special in the basal part of stem joint, the expressing of OSRR17p.
3, change the acquisition of OSRR17p paddy rice
The genomic dna that extracts the fine seedling of paddy rice Japan is as template, and (ctgcagGTGAATCTCCATCCGTAGTTG, lowercase are the PstI restriction enzyme site with primer OsRR17p-F; Sequence 2) and OsRR17p-R (gtcgacGTGTCCTACCCTTTGAGCCA, lowercase are the SalI restriction enzyme site, sequence 3) pcr amplification; The PCR product that obtains is connected on the intermediate carrier pGEM-T Easy; Obtain pT-OsRR17p, through order-checking, the Nucleotide that the result has sequence 1 in the sequence table for this PCR product; Size is 2455bp, and the unnamed gene of this PCR product is OsRR17p.Simultaneously, the small segment that with SmaI and EcoRI pBI121 (Clontech) double digestion is obtained inserts between SmaI and the EcoRI recognition site of pCAMBIA1300 (Cambia) binary vector and obtains pC1300-GUS-NOS.The small segment that obtains with the pT-OSRR17p of PstI and the above-mentioned acquisition of SalI double digestion then inserts between the PstI and SalI recognition site of pC1300-GUS-NOS; Obtain pC1300-OSRR17p::GUS-NOS; Its plasmid structural pattern is as shown in Figure 3, and wherein 35S-pro refers to 35S CaMV promotor; Nos-ter is the NOS terminator; Hygromycin is the hygromycin selection resistant gene; GUS is an E.coli GUSB reporter gene.
Plasmid pC1300-OSRR17p::GUS-NOS is imported among Agrobacterium (Agrobacterium tumefaciens) the bacterial strain EAH105 (ancient cooking vessel state in Shanghai is biological); Carrying out PCR again identifies; Primer OsRR17p-F and OsRR17p-R; Obtaining size is the Agrobacterium that contains plasmid pC1300-OSRR17p::GUS-NOS for the fragment of 2455bp, called after EAH105/pC1300-OSRR17p::GUS-NOS; Again that EAH105/pC1300-OSRR17p::GUS-NOS and wild-type Japan is fine callus on culture medium altogether 28 ℃ cultivate 2 days altogether after; Callus is transferred in the hygromycin resistance screening culture medium that contains 50mg/l; 28 ℃ of dark cultivations after 14 days forward to and continue screening 14 days on the freshly prepared screening culture medium.The resistant calli that after the two-wheeled screening, grows goes on the division culture medium that contains the 50mg/l Totomycin, and dark earlier the cultivation 3 days goes to then under the 15h illumination condition and cultivate, and differentiates seedling after 30-40 days.Seedling moved on on the root media to cultivate about two weeks move native continued growth, this transforms and obtains 5 strain T0 altogether for changeing the OSRR17p::GUS paddy rice.
The culture medium prescription that more than relates to is following:
(1) NB minimum medium
Title Content
KNO 3 2830mg/L
(NH 4) 2SO 4 463mg/L
KH 2PO 4 400mg/L
MgSO 4.7H 2O 185mg/L
CaCl 2.2H 2O 166mg/L
FeSO 4.7H 2O 27.8mg/L
Na 2EDTA 37.5mg/L
MnSO 4.4H 2O 10mg/L
H 3BO 3 3mg/L
ZnSO 4.7H 2O 2mg/L
Na 2MoO 4.2H 2O 0.25mg/L
CuSO 4.5H 2O 0.025mg/L
CoCl 2.6H 2O 0.025mg/L
KI 0.75mg/L
Vitamin 10mg/L
Pyridoxine hydrochloride 1mg/L
Nicotinic acid 1mg/L
Inositol 100mg/L
Caseinhydrolysate 300mg/L
Stimulina 500mg/L
Proline(Pro) 500mg/L
Sucrose 30,000mg/L
Plant gel 2.6mg/L
pH 5.8
(2) rice callus is induced and subculture medium
NB
2，4-D 0.002g/L
Stimulina 0.5g/L
Proline(Pro) 0.5g/L
Casein 0.3g/L
Sucrose 30g/L
Plant gel 2.6g/L
pH 5.8
(3) be total to culture medium
NB (not comprising Stimulina and proline(Pro))
2，4-D 2mg/L
Inositol 2mg/L
Syringylethanone 15mg/L
pH 5.5-5.2
(4) resistance screening substratum
NB
2，4-D 2mg/L
Cefotaxine (cephamycin) 500mg/L
Hygromycin B (Totomycin) 50mg/L
pH 5.8
(5) paddy rice division culture medium
NB
BA 0.002g/L
NAA 0.0005g/L
Sucrose 30g/L
Plant gel 3g/L
pH 5.8
(6) paddy rice root media
The 1/2NB inorganic salt
1/2B5 is organic
Sucrose 12g/L
Plant gel 2.6g/L
pH 5.8
5, identify
Through resistance screening, identified that the positive T0 of 5 strains is for changeing the OSRR17p::GUS paddy rice.Then the positive T0 of 5 strains of above-mentioned acquisition is carried out the PCR evaluation for changeing the OSRR17p::GUS paddy rice; Primer is p1300F (5 ' ATCGGTGCGGGCCTCTTC) and OsRR17p-R (5 ' gtcgacGTGTCCTACCCTTTGAGCCA); Template is the genomic dna of the positive T0 of 5 strains for the leaf that changes the OSRR17p::GUS paddy rice; Obtain PCR product size and be the positive plant of 2575bp; With PCR product sequencing analysis, therefore the Nucleotide with sequence 1 in the sequence table further confirm to obtain the positive T0 of 5 strains for changeing the OSRR17p::GUS paddy rice again.
From positive T0 for changeing OSRR17p::GUS rice harves seed; After planting obtain T1 for changeing the OSRR17p::GUS paddy rice; Gather in the crops seed from T1 for changeing the OSRR17p::GUS paddy rice; After planting obtain T2 and isozygoty and be, gather in the crops seed for changeing the OSRR17p::GUS paddy rice, after planting obtain T3 and isozygoty and be for changeing the OSRR17p::GUS paddy rice from T2 for changeing the OSRR17p::GUS paddy rice.
Adopt use the same method with empty carrier pC1300-GUS-NOS import wild-type Japan fine in, obtain T0 for changeing the empty carrier paddy rice, obtain T3 for commentaries on classics pC1300-GUS-NOS paddy rice with above-mentioned same method.
Embodiment 2, commentaries on classics OSRR17p::GUS paddy rice GUS staining analysis
GUS dyeing: be numbered 10 days sizes Japanese warm and fine 5 T3 and be immersed in the GUS staining fluid 37 ℃ of placements 6-12 hour, take pictures with stereoscope (Olympus SZX12) behind 70% ethanol decolorization for the whole seedling of commentaries on classics OSRR17p::GUS paddy rice homozygous lines.Is contrast with T3 for changeing pC1300-GUS-NOS paddy rice paddy rice and wild-type Japan fine.
GUS staining fluid: 100mM phosphoric acid buffer (pH 7.0), 10mM EDTA, 1mM K 4Fe 6, 1mM K 3(FeCN) 6, 0.1% (v/v) Triton X-100,1mM X-gluc.
The result is as shown in Figure 4, finds to have only basal part of stem energy-conservation by GUS dyeing (Fig. 4 A and B) for the GUS dyeing of changeing the OSRR17p::GUS paddy rice through the T3 to 10 days sizes; Further free-hand dissection finds that GUS dyeing is mainly at the bottom of joint, the i.e. initial position (Fig. 4 C) of stem-root; When being can painted by GUS (Fig. 4 D) from saving when separating a stem-root, separating the initial position of stem-root.Fig. 4 is active for the GUS that changes the OsRR17p::GUS plant, and wherein arrow representes to have the active position of GUS.White scale is 1mm among the figure.
The fine GUS dyeing of wild-type Japan is found that each histoorgan of plant all can not be dyeed by GUS.
Comprehensive above result explains special in the initial position of stem-root, the expressing of promotor ability of OsRR17, and has regulated and control the growth of root.
The analysis of embodiment 3, OsRR17 promotor cis-acting elements
In order better to understand the promoter function of OsRR17, the promotor OsRR17p of OsRR17 has been done the analysis of cis-acting elements on PLACE (aDatabase of Plant Cis-acting Regulatory DNA Elements).
Table 2:OsRR17 promotor cis-acting elements.
Factor Location Strand Signalsequence
Cytokinin?targeting?sequence 132 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 144 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 217 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1690 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1719 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1781 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 507 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 545 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 574 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1170 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 732 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1941 (+) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 4 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 338 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 368 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 386 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 672 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1038 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1152 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1313 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1459 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 1935 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 2024 (-) (G/A)GAT(T/C)
Cytokinin?targeting?sequence 2413 (-) (G/A)GAT(T/C)
TATABOX2 1106 (+) TATAAAT
TATABOX2 2215 (+) TATAAAT
TATABOX2 2352 (+) TATAAAT
TATABOX2 2150 (-) TATAAAT
TATABOX2 2222 (-) TATAAAT
TATABOX4 353 (+) TATATAA
TATABOX4 1071 (+) TATATAA
TATABOX4 1070 (-) TATATAA
TATABOX4 2047 (-) TATATAA
TATABOX4 2152 (-) TATATAA
TATABOX5 136 (+) TTATTT
TATABOX5 1184 (+) TTATTT
TATABOX5 1920 (+) TTATTT
TATABOX5 301 (-) TTATTT
TATABOX5 1275 (-) TTATTT
Figure ISA00000196229600011
Figure ISA00000196229600021
Figure ISA00000196229600031
Figure ISA00000196229600041

Claims (4)

1.DNA fragment is the dna molecular shown in the sequence 1 of sequence table.
2. the recombinant vectors, expression cassette, transgenic cell line or the reorganization bacterium that contain dna fragmentation described in the claim 1.
3. the primer of dna fragmentation is right described in the amplification claim 1, and the sequence of a primer of said primer centering is a sequence 2, and the sequence of another primer is a sequence 3.
4. the said dna fragmentation of claim 1 makes goal gene in the rice stem application of initial part bit table in reaching of taking root.
CN2010102301518A 2010-07-13 2010-07-13 Rice RR17 promoter and application thereof Expired - Fee Related CN101899442B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010102301518A CN101899442B (en) 2010-07-13 2010-07-13 Rice RR17 promoter and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010102301518A CN101899442B (en) 2010-07-13 2010-07-13 Rice RR17 promoter and application thereof

Publications (2)

Publication Number Publication Date
CN101899442A CN101899442A (en) 2010-12-01
CN101899442B true CN101899442B (en) 2012-02-01

Family

ID=43225362

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010102301518A Expired - Fee Related CN101899442B (en) 2010-07-13 2010-07-13 Rice RR17 promoter and application thereof

Country Status (1)

Country Link
CN (1) CN101899442B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102242119B (en) * 2011-03-25 2013-02-27 浙江大学 Rice root-specific promoter Os03g01700 and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ543070A (en) * 2003-04-04 2008-10-31 Pioneer Hi Bred Int Modulation of cytokinin activity in plants

Also Published As

Publication number Publication date
CN101899442A (en) 2010-12-01

Similar Documents

Publication Publication Date Title
Wang et al. Ectopic expression of miR156 represses nodulation and causes morphological and developmental changes in Lotus japonicus
CN102027111B (en) Gene increasing plant biomass amount and/or seed amount and method of using the same
CN103667314B (en) Derive from protein OsMKK4 and the application of relevant biological material in regulating plant seed size thereof of paddy rice
CN108164590B (en) Application of OsGBP3 gene in regulation of plant height, grain type and thousand seed weight of rice
Boycheva et al. Cyclin-like F-box protein plays a role in growth and development of the three model species Medicago truncatula, Lotus japonicus, and Arabidopsis thaliana
CN102766618A (en) Rice OsICL protein and coding gene thereof, and application of the two
Sharma et al. Allelic variants of OsSUB1A cause differential expression of transcription factor genes in response to submergence in rice
WO2022247591A1 (en) Heat shock-related gene zmhsf11 and application thereof in regulating plant heat tolerance
CN103194451B (en) Specific expression promoter of rice seed aleurone layer and application thereof
Kuluev et al. Constitutive expression of the ARGOS gene driven by dahlia mosaic virus promoter in tobacco plants
AU780310B2 (en) Gene regulating plant branching, vector containing the gene, microorganism transformed by the vector, and method for regulating plant branching by using the microorganism
Chen et al. Overexpression of Doritaenopsis hybrid EARLY FLOWERING 4-like4 gene, DhEFL4, postpones flowering in transgenic Arabidopsis
CN105695461A (en) Wheat flag leaf specific expression promoter and application thereof
CN101899442B (en) Rice RR17 promoter and application thereof
CN113024645B (en) Application of wheat transcription factor WRKY70 gene in regulation and control of plant growth and development
CN104450749A (en) Flower-specific expression vector of cucumber CsLOX1 gene and application of flower-specific expression vector
CN106834339A (en) Specificity suppresses KRP RNAi expression cassettes and the application that corn KRP genes are expressed in corn embryosperm
CN102206262A (en) Soybean activating protein-1(AP1) transcription factor and coding gene and use thereof
CN104293808A (en) Liriodendron hybrids LhMKK2 gene and expression protein and application thereof
CN104450736A (en) Cucumber AG-like gene CsMADS24 overexpression carrier and application thereof
CN103819547A (en) Late blight resistance related protein, and related biomaterial and application thereof
CN104560906B (en) Specifically expressed protein C YP734A1 like 1 and its application in fibrocyte
CN103923917A (en) Application of microRNA444a or coding gene thereof in adjustment of rice salt tolerance
CN116769797B (en) Application of methyl jasmonate and PpyMYC2 gene in germination
KR101494191B1 (en) Promoter for directing the guard-cell specific expression

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20120201

Termination date: 20180713

CF01 Termination of patent right due to non-payment of annual fee