CN101215572A - Barley yellow dwarf virus interference virogene expression vector and its construction method and application - Google Patents

Barley yellow dwarf virus interference virogene expression vector and its construction method and application Download PDF

Info

Publication number
CN101215572A
CN101215572A CNA2008100565092A CN200810056509A CN101215572A CN 101215572 A CN101215572 A CN 101215572A CN A2008100565092 A CNA2008100565092 A CN A2008100565092A CN 200810056509 A CN200810056509 A CN 200810056509A CN 101215572 A CN101215572 A CN 101215572A
Authority
CN
China
Prior art keywords
dwarf virus
yellow dwarf
gene
carrier
interference
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2008100565092A
Other languages
Chinese (zh)
Inventor
王锡锋
吴蓓蕾
刘艳
周广和
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority to CNA2008100565092A priority Critical patent/CN101215572A/en
Publication of CN101215572A publication Critical patent/CN101215572A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to 'an expression vector of interfering viruses of barley yellow dwart viruses, a constructing method, and the application' and belongs to the technical field of biological engineering. The invention provides the expressing vector of interfering viruses of barley yellow dwart viruses which is characterized in that a skeleton carrier which is adopted is pMCG161, a sense strand of a coat protein gene of the barley yellow dwart viruses is inserted between two restriction sites of AscI and AvrII which are on the upstream portion of the pMCG161, and an antisense strand of the coat protein gene of the barley yellow dwart viruses is inserted between two restriction sites of SpeI and SgfI which are on the downstream portion of the pMCG161. The expression vector of interfering viruses of barley yellow dwart viruses GAV which is constructed by the invention is transferred into wheat through particle bombardment to obtain a transgene wheat variety which has resistance to the barley yellow dwart viruses GAV. The invention provides a breeding way with high efficiency and a new strategy.

Description

Barley yellow dwarf virus interference virogene expression vector and construction process thereof and application
Technical field
The invention belongs to gene engineering technology field, particularly relate to a kind of barley yellow dwarf virus interference virogene expression vector and construction process thereof and application.Further relate to barly yellow dwarf virus GAV viral gene expression carrier, and transforming gramineous plant wheat and obtain the method for resistant plant.
Background technology
The yellow stunt of wheat (Wheat yellowdwarf disease) that is caused by barly yellow dwarf virus (Barley yellow dwarfvirus, be called for short BYDV) is to take place the most general and one of the destructive cereal crop virus disease of tool.This disease main harm wheat, from nineteen sixty since finding BYDV first on the wheat in China Shaanxi, Gansu, at present should disease annual in the wheat district, Winter-Spring of nearly 20 provinces such as NORTHWEST CHINA, North China, southwest and East China all have causing harm in various degree.It wherein is the main popular district of winter wheat with Yu Xi, Jin Nan, the Central Shanxi Plain, Long Dong and East China and southwest, ground such as Hexi Corridor, Gansu Province, northern Shensi are the popular district of wheat miscegenation, Winter-Spring, and Ningxia, the Inner Mongol, Jin Bei, Ji Bei and the Northeast are the main popular district of spring wheat.BYDV is propagated in the persistence mode by aphid.Symptoms such as blade yellow, reddening, leaf roll and plant dwarfing can appear in the host plant of falling ill, and photosynthesis and metabolism are destroyed, thereby the influence heading is with solid.In the popular time of yellow stunt of wheat, the Mai Qu sick thus production loss that causes in whole world can reach 20%-30%, and the general time is quite a few in 2%-3%.According to the ability difference of wheat aphid propagation barly yellow dwarf virus not of the same race, American scholar Rochow is divided into 5 strains systems, PAV, MAV, SGV, RPV and RMV with barly yellow dwarf virus.Zhou Guang and grade are divided into GAV, GPV, PAGV and RMV with the barly yellow dwarf virus isolate of China at home, and wherein GPV is China distinctive strain system.
For the time of the big generation of yellow stunt of wheat, controlling the worm diseases prevention is first-selected emergency schedule.Can reduce the generation that population density is controlled disease by chemical control.But should use chemical insecticide cautiously, reduce the environmental pollution that chemical control brings.Adjust cultivation steps such as crop allocation and date of seeding and removing weeds in field, also can play the effect that alleviates the yellow stunt of wheat generation to a certain extent.Seed selection and the anti-disease tolerant variety of popularization are still at present prevents and treats yellow stunt of wheat and even the most economical effective means of multiple virus disease.Up to now, still find no resistant material in the common wheat.During wheat sibling specieses such as couchgrass, couchgrass and leymus belonged in the middle of the natural resistance gene of yellow stunt of wheat mainly was present in.Hot will bravely waits the utilization cell engineering, promptly uses the conventional hybridization breeding technique in conjunction with the modern biotechnology method, and the natural resistance gene is imported in the cultivated wheat from above-mentioned external source plant.Obtain anti-yellow stunt of wheat translocation line by the hybridization of middle couchgrass and common wheat, and select disease-resistant variety and " face anti-No. 1 ".But, the method for conventional breeding exist the cycle long, directional property is poor, easily brings the defective of bad proterties into.
Molecular biology and Plant Biotechnology develop rapidly nearly ten surplus year in, genetic engineering technique is that new way has been opened up in the integrated control of virus disease, it is ripe that the technological line of plant virus disease-resistant gene engineering has tended to, and still in continuous development.So far, the main policies of application has: (Pathogen-derived resistance PDR) comprises and 1. imports virus coat protein gene CP the resistance of A, viral autogene mediation; 2. utilize viral nonstructural protein gene, as rdrp gene, movement protein gene, some other functional gene etc.; 3. utilize artificial constructed defective interfering particle (defective interfering particle); 4. utilizing virus attenuated strain is the resistance of full genome mediation.B, plant self disease-resistant gene are as N gene, R gene etc.C, utilize plant source disease-resistant cytotoxic activity material gene, for example dyers' grapes protein gene, Trichosanthin gene etc.D, directly or indirectly act on the strategy of viral nucleic acid, comprise 1. Antisense RNA Technique; 2. ribozyme gene; 3. dsRNA lytic enzyme gene is as PacI gene etc.; 4. 2 '-5 ' oligomerization adp system (2 '-5 ' A).Other antiviral gene engineering strategy of E, comprise 1. utilize satellite RNA (satellite RNA, Sat-RNA); 2. utilize antibody gene mediation virus resistance; 3. utilize interferon gene mediation virus resistance.At present, different both at home and abroad research groups imports wheat or oat respectively with coat protein gene (CP), the rdrp gene of the not homophyletic system of BYDV, and obtains BYDV is had the plant of strong resistance.
It is the hereditary interference phenomenon that specific interaction comes inhibition of gene expression of passing through by the RNA mediation that RNA disturbs, its mRNA that can degrade special, effectively, thus cause the gene silencing of post-transcriptional level.When the RNA silence takes place in the transgenic plant of expressing source and viral a certain gene or nucleotide sequence, the RNA of close virus degrades in or belonging to together the same virus of invasion, the virus of invasion can not be accumulated in plant, thereby give the transgenic plant virus resistance.In recent years, the RNA perturbation technique has had widespread use in research plant virus gene function and mechanism of causing a disease and plant disease-resistant mechanism, but at home and abroad the BYDV-GAV resistance led of mediated rnai yet there are no report.
Summary of the invention
Based on the blank in the above-mentioned field, the invention provides a kind of barley yellow dwarf virus interference virogene expression vector, this carrier comprises a kind of coat protein gene of Causative virus.With this carrier plant is carried out genetic transformation, the RNA silent reaction takes place between the Causative virus of resulting transfer-gen plant and invasion, the irreproducible or accumulation of intrusive viruses, thus have disease resistance.The present invention also provides the construction process and the application of this interference virogene expression vector, for Resistant breeding provides a kind of new countermeasure and thinking.
A kind of barley yellow dwarf virus interference virogene expression vector, it is characterized in that the skeleton carrier that adopts is pMCG161, insert the positive-sense strand of barly yellow dwarf virus coat protein gene between at its upstream two restriction enzyme site AscI, AvrII, between two restriction enzyme site SpeI, the SgfI in downstream, insert the antisense strand of its barly yellow dwarf virus coat protein gene.
Described barly yellow dwarf virus is barly yellow dwarf virus GAV.
The construction process of above-mentioned interference virogene expression vector comprises the steps:
(1) primer of design barly yellow dwarf virus GAV coat protein CP gene:
SEQ?NO?1：5′ATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?2：5′CTATTTGGGAGTCATGTTGGC?3′
Total RNA with BYDV-GAV is a template, through RT-PCR amplification total length CP gene fragment, reclaims the positive colony that purpose fragment rear clone obtains the CP gene,
(2) design has the RNA interference primer of the total length CP gene of four restriction enzyme site AscI, AvrII, SpeI and SgfI:
SEQ?NO?3：5′CTACTAGTGGCGCGCCATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?4：5′CGGCGATCGCCTAGGCTATTTGGGAGTCATGTTGGC?3′
Positive colony with the CP gene is a template, and through the precursor double-stranded DNA of RT-PCR amplification mediate rna interferential BYDV-GAV coat protein, the purpose fragment obtains containing purpose fragment positive plasmid after reclaiming,
(3) contain the segmental positive plasmid of purpose and cut through AscI, AvrII enzyme and obtain positive-sense strand, obtain antisense strand through SpeI, AsiSI,
(4) pMCG161 at first is cut into linear segment through AscI, AvrII enzyme, and positive-sense strand is connected to the AscI and the AvrII site of pMCG161 carrier, and antisense strand is connected to the SpeI and the SgfI site of pMCG161 carrier, finally is built into interference carrier.
Described clone obtains the used carrier pGEM T-easy carrier of positive plasmid, and transforming bacterial strain is intestinal bacteria JM110.
The application of above-mentioned barley yellow dwarf virus interference virogene expression vector.
Described application is above-mentioned barley yellow dwarf virus interference virogene expression vector to be transformed relevant recipient plant make it barly yellow dwarf virus is produced resistance.
Described method for transformation is particle bombardment, agrobacterium-mediated transformation or cotransformation method.
Described method for transformation is a particle bombardment.
Described recipient plant is a grass.
Described grass is a wheat.
The present invention is in genome (the GenBank accession number: AY220739 of BYDV-GAV; Jin Zhibo etc., 2003) designed RNA interferential dsRNA (600bp) precursor of BYDV-GAV coat protein (CP) mediation on, the CP gene of BYDV-GAV is connected to the AscI and the AvrII site of two-way interference carrier pMCG161 carrier, then on SpeI that on the basis of positive-sense strand carrier the CP gene of BYDV-GAV is connected to two-way interference carrier pMCG161 carrier and SgfI site, make up the antisense strand segment, finally made up the BYDV-GAV interference carrier that suitable grass transforms.Utilize the method for particle gun to carry out the genetic transformation of wheat, Transcription by RdRp in the wheat tissue, the form of the dsRNA of the CP gene of generation BYDV-GAV, effect by DicerIII produces SiRNA again, when wheat is infected by BYDV-GAV, just can produce SiRNA, utilize mediated rnai to lead purpose the resistance of BYDV-GAV thereby reach.Finishing screen is selected the transgenic wheat plant of immunity or high anti-BYDV-GAV.
The present invention provides a kind of interference virogene expression vector and construction process and application for genetic engineering of plant for disease resistance, and the application in the biotic resistance breeding provides new thinking for transgenic technology and RNA interference.This carrier is changed in the wheat, successfully obtained antiviral plant, realized utilizing the RNA interference principle to obtain the re-set target of anti-BYDV-GAV new variety of wheat, plant resistance to environment stress breeding and the genetically engineered led for mediated rnai provide successful examples, have remedied the vacancy of BYDV-GAV resistance in the research of this area that mediated rnai is led.
Interference carrier of the present invention combination has more than to be limited to BYDV is transformed and is used to cultivate the transfer-gen plant that BYDV is had resistance.The resistance organism that utilizes interference carrier of the present invention to transform gained can be any microorganism, plant or its tissue, cell, and the microorganism, the plant that obtain to have any anti-disease activity thus, and such plant offspring's seed, hybridization and transformation offspring.
Description of drawings
Fig. 1 .RT-PCR amplification obtains the electrophoresis picture of coat protein (CP) gene of BYDV-GAV;
Fig. 2 .RT-PCR amplification obtains the electrophoresis picture of the precursor double-stranded DNA of mediate rna interferential BYDV-GAV coat protein (CP);
Fig. 3 A. barly yellow dwarf virus GAV strain is in the building process of coat protein interference carrier, and the segmental PCR of positive-sense strand identifies in the positive-sense strand carrier;
Fig. 3 B. barly yellow dwarf virus GAV strain is in the building process of coat protein interference carrier, and the segmental enzyme of positive-sense strand is cut evaluation (AscI andAvrII) in the positive-sense strand carrier;
Fig. 3 C. barly yellow dwarf virus GAV strain is that the segmental enzyme of antisense strand is cut evaluation (SpeI andAsiSI) in the coat protein antisense strand carrier;
Fig. 3 D. barly yellow dwarf virus GAV strain is in the building process of coat protein interference carrier, and the segmental enzyme of antisense strand is cut evaluation (SpeI andAsiSI); M:DNAMarker DL2000; CK: negative control
Fig. 4. the structural representation of carrier pMCG161;
Fig. 5. plasmid vector pMCG161 external source segment makes up linear graph;
Fig. 6. wheat transgenic rataria callus is at the differentiation culture that contains PPT (5mg/L) division culture medium;
Fig. 7. strong sprout on the substratum of no hormone;
Fig. 8. selecting to press is the vigorous transgenosis regeneration wheat of PPT 6mg/L growing way;
Fig. 9. be transplanted to the transgenic wheat in the flowerpot
Embodiment
(this carrier is kept in the Plant Protection institute, Chinese Academy of Agricultral Sciences virus group laboratory carrier pMCG161 that uses in the experiment; can provide to the public) be to be specially adapted for the interference carrier (Fig. 4) that grass transforms; it contains the Rice waxy-a intron 1 that derives from paddy rice; be positioned at 5442bp-6576bp; contain two restriction enzyme sites of AscI and AvrII in its upstream; be used for making up the positive-sense strand of CP gene; contain AsiSI and SgfI site in its downstream, be used for making up the antisense strand (Fig. 5) of CP gene.
Used pGEM T-easy in the experiment is available from Promega biotech company.
The BYDV-GAV genome is AY220739 in the GenBank accession number.
Embodiment 1, the structure of barly yellow dwarf virus GAV interference virogene expression vector
Step 1, according to the genome sequence of BYDV-GAV, the present invention at first designs the primer of total length CP gene, and is as follows:
SEQ?NO?1：5′ATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?2：5′CTATTTGGGAGTCATGTTGGC?3′
Total RNA with BYDV-GAV is a template, (Fig. 1) is connected on the pGEM T-easy carrier after the recovery of purpose fragment through RT-PCR amplification total length CP gene fragment (600bp), and transformed into escherichia coli JM110 carries out cloning and sequencing and identifies, obtains the positive colony of CP gene.
Step 2, contain the acquisition of the double-stranded CP gene masculine of RNA interferential precursor plasmid
According to RNA interferential mechanism, the RNA that the present invention's design has four restriction enzyme sites (AscI, AvrII, SpeI, SgfI) total length CP gene disturbs primer:
SEQ?NO?3：5′CTACTAGTGGCGCGCCATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?4：5′CGGCGATCGCCTAGGCTATTTGGGAGTCATGTTGGC?3′
Positive colony with the CP gene is a template, through the precursor double-stranded DNA (Fig. 2) of RT-PCR amplification mediate rna interferential BYDV-GAV coat protein (CP).The purpose fragment is connected on the pGEM T-easy carrier after reclaiming, and transformed into escherichia coli JM110 carries out cloning and sequencing and identifies, obtains positive plasmid.
Step 3, contain the segmental positive plasmid of purpose and cut through AscI, AvrII enzyme and obtain positive-sense strand, obtain antisense strand through SpeI, AsiSI (AsiSI and SgfI are the coordination enzymes).With carrier pMCG161 at first carry out AscI, the AvrII enzyme is cut into linear segment, to cut through AscI, AvrII enzyme and obtain the positive-sense strand segment, be connected to the AscI and the AvrII site of pMCG161 carrier with the T4 ligase enzyme, then on the basis of positive-sense strand carrier, make up the antisense strand segment, be about to the antisense strand segment that obtains through SpeI, AsiSI (AsiSI and SgfI are the coordination enzymes), be connected to the SpeI and the SgfI site of pMCG161 carrier with the T4 ligase enzyme, finally be built into interference carrier pMCG161+CP (SA) (writing a Chinese character in simplified form pSA) (Fig. 3).
In like manner can obtain two control vector: positive-sense strand carrier pMCG161+CP (S) (writing a Chinese character in simplified form pS), antisense strand carrier pMCG161+CP (A) (writing a Chinese character in simplified form pA).
Acquisition and the detection of embodiment 2 transgenic plant
Step 1, get the interference carrier and the control vector thereof that build, transform JM1 10 competent cells respectively, coated plate, 37 ℃ of overnight incubation.Picking list bacterium colony, concussion is cultivated through gobbet LB (3-5ml); After middle amount is cultivated (20-30ml); With 1: 50 ratio inoculation 200ml liquid LB substratum, 37 ℃ of concussions were cultivated 2-3 hour; Adding final concentration is the paraxin of 170 μ g/ml, continues to cultivate 16-18 hour; 5000rpm10 minute centrifugal collection thalline; Adopt a large amount of plasmid extraction kits (Marligen) plasmid purification.Method is referring to shop instruction.Obtain plasmid concentration and reach 2-3mg/ml, contain the super coiled DNA more than 90%, can be used for particle gun and transform.
Step 2, the wheat children tassel (kind: raise wheat 158) that will pollinate about 14 days are adopted from the field, manually shell grain, then in Bechtop after 70% ethanol and 10% (V/V) hypochlorous acid is received solution disinfection, use dissecting needle, the picking wheat immature embryo, the about 1-1.5mm of rataria diameter is advisable, be put on the SD2 substratum, scultellum makes progress, and plumule is downward, about two plumule mutual spacing 0.5cm.Rataria is peeled off, and puts on SD 2 substratum and cultivate.Evoked callus under 26 ℃ of dark conditions, take out the plumule of elongation behind the 3d, behind the 7-10d callus concentrated on culture dish central authorities, about the about 2cm of diameter, handle the usefulness of 4～6h through 0.4mol/L osmotic pressure substratum (SD2 adds 0.2mol/L N.F,USP MANNITOL, 0.2mol/L sorbyl alcohol) in order to the particle gun bombardment.
The plasmid that extracts in step 3, the WHEAT CALLUS that step 2 is got ready and the step 1 is applied to the conversion of particle gun.Callus after the bombardment continues to handle 16～18h on former osmotic pressure substratum, changes (26 ℃) recovery 2 weeks of cultivation under the SD 2 substratum dark conditions then over to.
Step 4, callus after recover cultivating moves on on the substratum of MS+NAA (1mg/L)+KT 1mg/L+Bialaphos (PPT) 3mg/L and induces differentiation 3 weeks (10h illumination every day, 24 ℃) (Fig. 6), after green bud differentiation occurring, forward no hormone culture-medium (MS+Bialaphos 5mg/L) to and go up 1 week of cultivation, change no hormone culture-medium (MS+Bialaphos 5mg/L) again over to and go up continuation cultivation (10h illumination every day, 24 ℃) (Fig. 7), when seedling grows into 1～2cm, strong sprout (Fig. 8) on the substratum of immigration MS+IAA (0.5mg/L)+Bialaphos (6mg/L), regeneration plant grows into suitable size (height of seedling 6～8cm, root system is better) time put into 4 ℃ of refrigerator vernalization treatment 20～30 days, move in the paper nutrition pot that sterilization soil is housed then, the outer cover preservative film is preserved moisture.Move into flowerpot at last, place the greenhouse.By the genetic transformation of particle gun, the T0 that has obtained four carriers is for plant.(Fig. 9)
Step 5, the present invention have obtained the transgenic wheat of four carriers, and the positive T0 of pSA, pS, pA, pMCG161 is respectively 14 strains, 4 strains, 3 strains, 3 strains for transgenic wheat strain number.T0, the T1 of transgenic wheat, T2 generation has been carried out the PCR evaluation respectively, and the positive transformation efficiency in T0 generation is to be respectively 0.46%, 0.15%, 0.12%, 0.11%.The T3 of interference carrier shows four disease resistance strain systems that obtained interference carrier for the inoculation test of transgenic wheat, and they are pSA-6,9,11,12, morbidity severity average out to (promptly disease-resistant) below 3 grades.
Appendix
SEQ?NO?1：5′ATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?2：5′CTATTTGGGAGTCATGTTGGC?3′
SEQ?NO?3：5′CTACTAGTGGCGCGCCATGAATTCAGTAGGCCGTAGA?3′
SEQ?NO?4：5′CGGCGATCGCCTAGGCTATTTGGGAGTCATGTTGGC?3′

Claims (10)

1. barley yellow dwarf virus interference virogene expression vector, it is characterized in that the skeleton carrier that adopts is pMCG161, insert the positive-sense strand of barly yellow dwarf virus coat protein gene between at its upstream two restriction enzyme site AscI, AvrII, between two restriction enzyme site SpeI, the SgfI in downstream, insert the antisense strand of its barly yellow dwarf virus coat protein gene.
2. barley yellow dwarf virus interference virogene expression vector according to claim 1, described barly yellow dwarf virus are barly yellow dwarf virus GAV.
3. the construction process of the described barley yellow dwarf virus interference virogene expression vector of claim 2 comprises the steps:
(1) primer of design barly yellow dwarf virus GAV coat protein CP gene:
SEQ?NO?1：5′ATGAATTCAGTAGGCCGTAGA?3′，
SEQ?NO?2：5′CTATTTGGGAGTCATGTTGGC?3′，
Total RNA with BYDV-GAV is a template, through RT-PCR amplification total length CP gene fragment, reclaims purpose fragment rear clone and obtains CP gene masculine clone,
(2) design has the RNA interference primer of the total length CP gene of four restriction enzyme site AscI, AvrII, SpeI and SgfI:
SEQ?NO?3：5′CTACTAGTGGCGCGCCATGAATTCAGTAGGCCGTAGA?3′，
SEQ?NO?4：5′CGGCGATCGCCTAGGCTATTTGGGAGTCATGTTGGC?3′，
The clone is a template with the CP gene masculine, and through the precursor double-stranded DNA of RT-PCR amplification mediate rna interferential BYDV-GAV coat protein, the purpose fragment obtains containing the segmental positive plasmid of purpose after reclaiming,
(3) contain the segmental positive plasmid of purpose and cut through AscI, AvrII enzyme and obtain positive-sense strand, obtain antisense strand through SpeI, AsiSI,
(4) pMCG161 at first is cut into linear segment through AscI, AvrII enzyme, and positive-sense strand is connected to the AscI and the AvrII site of pMCG161 carrier, and antisense strand is connected to the SpeI and the SgfI site of pMCG161 carrier, finally is built into interference carrier.
4. according to the described structure of right right 3 army method, described clone obtains and contains the used carrier pGEM T-easy carrier of the segmental positive plasmid of purpose, and transforming bacterial strain is intestinal bacteria JM110.
5. the application of claim 1 or 2 described barley yellow dwarf virus interference virogene expression vectors.
6. application according to claim 5 is barley yellow dwarf virus interference virogene expression vector to be transformed relevant recipient plant make it barly yellow dwarf virus is produced resistance.
7. application according to claim 6, described method for transformation are particle bombardment, agrobacterium-mediated transformation or cotransformation method.
8. application according to claim 7, described method for transformation are particle bombardment.
9. application according to claim 6, described recipient plant are grass.
10. application according to claim 9, described grass are wheat.
CNA2008100565092A 2008-01-21 2008-01-21 Barley yellow dwarf virus interference virogene expression vector and its construction method and application Pending CN101215572A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNA2008100565092A CN101215572A (en) 2008-01-21 2008-01-21 Barley yellow dwarf virus interference virogene expression vector and its construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNA2008100565092A CN101215572A (en) 2008-01-21 2008-01-21 Barley yellow dwarf virus interference virogene expression vector and its construction method and application

Publications (1)

Publication Number Publication Date
CN101215572A true CN101215572A (en) 2008-07-09

Family

ID=39622081

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA2008100565092A Pending CN101215572A (en) 2008-01-21 2008-01-21 Barley yellow dwarf virus interference virogene expression vector and its construction method and application

Country Status (1)

Country Link
CN (1) CN101215572A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102154354A (en) * 2010-12-31 2011-08-17 中国农业科学院植物保护研究所 RNAi (RNA interference) plasmid against barley yellow dwarf virus and wheat dwarf virus as well as construction method and application thereof in wheat genetic transformation
CN102154353A (en) * 2010-12-31 2011-08-17 中国农业科学院植物保护研究所 Anti-wheat dwarf virus (WDV) RNA interfering vector, construction method thereof and use thereof in genetic transformation of wheat
CN103060365A (en) * 2012-11-06 2013-04-24 河南科技大学 Method for constructing eukaryotic expression vector by virtue of designing multiple cloning sites (MCS)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102154354A (en) * 2010-12-31 2011-08-17 中国农业科学院植物保护研究所 RNAi (RNA interference) plasmid against barley yellow dwarf virus and wheat dwarf virus as well as construction method and application thereof in wheat genetic transformation
CN102154353A (en) * 2010-12-31 2011-08-17 中国农业科学院植物保护研究所 Anti-wheat dwarf virus (WDV) RNA interfering vector, construction method thereof and use thereof in genetic transformation of wheat
CN102154354B (en) * 2010-12-31 2012-12-26 中国农业科学院植物保护研究所 RNAi (RNA interference) vector against barley yellow dwarf virus and wheat dwarf virus as well as construction method and application thereof in wheat genetic transformation
CN103060365A (en) * 2012-11-06 2013-04-24 河南科技大学 Method for constructing eukaryotic expression vector by virtue of designing multiple cloning sites (MCS)

Similar Documents

Publication Publication Date Title
CN101548017B (en) Method for modifying insect resistance of plants by utilizing rnai technique
CN102985545A (en) Novel microrna precursor and use thereof in regulation of target gene expression
CN105087640B (en) Adjust gene and its application of vegetable seeds development
CN110331145A (en) The application of miR156 and its relevant biological material in regulation disease resistance of plant
CN107338230B (en) The application of OsMPK11 albumen and its encoding gene in regulation plant drought resistance
CN102943091B (en) Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique
CN101974550B (en) RNA (Ribonucleic Acid) interference carriers of RSV (Rice Stripe Virus) and RBSDV (Rice Black-Streaked Dwarf Virus) as well as construction method and application thereof
CN101768602A (en) Scheme and application for increasing amylose content of corn seeds through overexpression of Sh2 and Bt2 genes and RNAi suppression expression of SBEIIa and SBEIIb genes
CN103525828B (en) Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof
CN101215572A (en) Barley yellow dwarf virus interference virogene expression vector and its construction method and application
Liu et al. Genetic transformation and expression of Cry1Ac–Cry3A–NTHK1 genes in Populus× euramericana “Neva”
CN101519659A (en) Antivirus plant expression vector constructed by utilizing pre-miR159a and application thereof
CN102102108B (en) Method for cultivating efficient selected-marker-free transgenic crop by using double T-DNA+1 vectors
CN110982817A (en) amiRNA for resisting wheat yellow mosaic virus and application thereof
CN102911965A (en) Method for transferring anti-borer (BT) and anti-herbicide (Bar) covalent exogenous genes into saccharum officinarum
CN105296492A (en) Meloidogyne javanica effect gene Mj-1-1, related protein and application of effect gene Mj-1-1
CN105779492A (en) Application of rice miR396c
CN105463014A (en) RNAi anti-ASPV (Apple Stem Pitting Virus) expression vector and application thereof in apple breeding for disease resistance
CN102154337A (en) Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof
CN105039345A (en) Clone of miRNA for improving salt resistance capacity of mulberries and application thereof
CN101967491B (en) Rice black-streaked dwarf virus (RBSDV) RNA interference vectors, construction method and application
CN105112423B (en) It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application
CN100372935C (en) Cloning of gene against meloidogyne of capsicum and application thereof
CN103451229A (en) Construction and application of RNAi carrier capable of resisting maze dwarf mosaic viruses
CN102154354B (en) RNAi (RNA interference) vector against barley yellow dwarf virus and wheat dwarf virus as well as construction method and application thereof in wheat genetic transformation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20080709