CN101203602A - Thermophilic microorganisms with inactivated lactate dehydrogenase gene(LDH) for ethanol production - Google Patents
Thermophilic microorganisms with inactivated lactate dehydrogenase gene(LDH) for ethanol production Download PDFInfo
- Publication number
- CN101203602A CN101203602A CNA2006800152991A CN200680015299A CN101203602A CN 101203602 A CN101203602 A CN 101203602A CN A2006800152991 A CNA2006800152991 A CN A2006800152991A CN 200680015299 A CN200680015299 A CN 200680015299A CN 101203602 A CN101203602 A CN 101203602A
- Authority
- CN
- China
- Prior art keywords
- microorganism
- aforementioned
- ldh
- gene
- thermophilic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
A mutated thermophilic microorganism is prepared, with a modification to inactivate the lactate dehydrogenase gene of a wild-type microorganism. The mutated microorganism is used in the production of ethanol, utilising C3, C5 or C6 sugars as the substrate.
Description
Technical field
The present invention relates to alcoholic acid production as the fermentation using bacteria product.Particularly, the present invention relates to alcohol production by means of thermophilic bacterium.
Background technology
According to kind and the envrionment conditions of bacterium, the metabolism of bacterium can have various mechanism.Heterotrophic bacterium (comprising all pathogenic bacterias) obtains energy by the oxidation of organic compound, and carbohydrate (especially glucose), lipid and protein are modal compounds that can be oxidized.But these organic compound are by the ATP of the bio-oxidation synthetic chemistry energy form of bacterium.This process also can produce the required simpler organic compound (precursor molecule) of bacterial cell biosynthesizing reaction.Glycolysis-is the general process of bacterial metabolism suitable substrates, and it is to be pyruvic acid and the series reaction that produces ATP with conversion of glucose.The converted product of pyruvic acid in the metabolizable energy production process is different and different because of microorganism and envrionment conditions.For pyruvic acid, there are three kinds of main reactions.
First kind, under aerobic conditions, many microorganisms can be converted into acetyl-CoA with pyruvic acid by the tricarboxylic acid cycle generate energy and under the catalysis of pyruvic oxidase (PDH).
Second kind, under anoxia condition, the catalysis that the ethanol fermentation that the biology of some producing and ethanol carries out can pass through pyruvic carboxylase (PDC) produces acetaldehyde with the pyruvic acid decarboxylation, and is ethanol by NADH with acetaldehyde reduction under the catalysis of ethanol dehydrogenase (ADH) subsequently.
The third process is under the catalysis of serum lactic dehydrogenase (LDH) pyruvic acid to be converted into lactic acid.
Utilize the research of microorganism producing and ethanol in next life to receive many concerns at present, these research and utilizations can carry out the microorganism of natural anaerobically fermenting or utilize the recombinant microorganism that contains pyruvic carboxylase and alcohol dehydrogenase gene.Although obtained some successes aspect these microorganisms producing ethanol utilizing, fermenting process is affected because of the increase of alcohol concn through regular meeting, and is particularly all the more so when the ethanol tolerance level of microorganism is low.
Thermophilic bacterium has been proposed for alcohol production, and to use their advantage be that fermentation is carried out under higher temperature, and ethanol just can be removed with the form of steam in more than 50 ℃; This also allows to ferment and carries out in higher sugared concentration.Yet it also is a difficult problem that searching can effectively produce the suitable thermophilic bacterium of alcoholic acid.
WO 01/49865 discloses a kind of alcoholic acid gram positive bacterium that is used to produce, this bacterium have conversion the coding pyruvic carboxylase heterologous gene and have and itself have the ethanol dehydrogenase function.This bacterium is thermophilic bacillus (Bacillus), and can utilize the insertion of transposon to make the lactate dehydrogenase gene inactivation and it is modified.Among the WO 01/49865 disclosed bacterium all derived from Bacillaceae LLD-R bacterial strain, it is a kind of bacterial strain of spontaneous generation in culture, have the sporulation defective, its ldh gene by spontaneous mutation or chemomorphosis means by inactivation.Bacterial strain LN and TN also are disclosed as the improvement derivative of bacterial strain LLD-R.Yet all bacterial strains all have the restricted system of HaeIII type, stop plasmid to transform and also stop the not interior conversion of methylate DNA thus.
WO 01/85966 discloses the microorganism that makes by the process of methylating in the body, and this method has overcome restricted problem.This need be transformed into the HaeIII methyltransgerase of Haemophilus influenzae (Haemophilus aegyptius) in LLD-R, LN and the TN bacterial strain.But LLD-R, LN and TN bacterial strain are unsettled mutant and can spontaneously be reversed to the wild type strain that produces lactic acid, especially under the condition of low pH and higher sugar concentration.So just caused tunning to change lactic acid into, so these bacterial strains are unsuitable for producing ethanol from ethanol.
Disclosed bacterial strain LLD-R and derivative thereof comprise naturally occurring insertion element (IE) among the WO 02/29030 in the coding region of its ldh gene.Swivel base (and disengaging) and gene inactivation subsequently that this element inserts the ldh gene are unsettled, counter-rotating can occur.The technical scheme that proposes at this phenomenon is that plasmid DNA is integrated in the IE sequence.
Therefore, in the art, generation is used to produce the alcoholic acid microorganism and is based on the chemical mutation bacillus microorganisms that the laboratory is produced and modifies, and it is handled and further plasmid DNA is integrated into the modification that the IE sequence is carried out microorganism with methylation method in the body.This method is complicated, uncertain and to use how and also to have general problem aspect the bacterial strain.
Therefore need to improve to be used to produce the alcoholic acid microorganism.
Summary of the invention
According to a first aspect of the invention, thermophilic microorganism is modified to increase alcoholic acid output, the described lactate dehydrogenase gene inactivation that is modified to the wild-type thermophilic microorganism.
According to a second aspect of the invention, microorganism is carried out preservation, its deposit number is NCIMB41275.
According to a third aspect of the invention we, a kind ofly be used to produce the alcoholic acid method, be included under the appropriate condition and at C
3, C
5Or C
6When existing, cultivates sugar according to microorganism defined above.
According to a forth aspect of the invention, a kind of plasmid is defined as pUB190-ldh (deposit number NCIMB 41276) in this article.
According to a fifth aspect of the invention, thermophilic microorganism contains the plasmid (Fig. 4) that is defined as pUB190 herein.
Description of drawings
Present invention is described with reference to accompanying drawing, wherein
Fig. 1 produces the alcoholic acid graphic representation for showing microorganism of the present invention (ldh 35) with different substrates;
Fig. 2 produces the alcoholic acid graphic representation for showing microorganism of the present invention (ldh 58) with different substrates;
Fig. 3 produces the alcoholic acid graphic representation for showing with 11955 knocking out property of LDH mutant;
Figure 4 and 5 are the diagram of the pUB plasmid that uses among the present invention; Fig. 4 is a ldh mutant of the present invention;
Fig. 6 is for showing the beta stability line figure of knocking out property of the LDH mutant under the different culture condition.
Embodiment
The present invention is based on the modification of wild-type thermophilic microorganism to destroy the expression of serum lactic dehydrogenase.
The inactivation of lactate dehydrogenase gene helps to stop pyruvic acid to be decomposed into lactic acid, thereby promotes that by pyruvic carboxylase and ethanol dehydrogenase (under appropriate condition) pyruvic acid is decomposed into ethanol.Preferably, destroy serum lactic dehydrogenase by disappearance in the gene or by genetically deficient.
Wild-type microorganisms can be any thermophilic microorganism, but preferably, this microorganism is a bacillus.Especially, this microorganism is a ground bacillus (Geobacillus), in particular for hot Polyglucosidase ground bacillus (Geobacillus thermoglucosidasius).
The microorganism that is selected for modification is called as " wild-type ", and promptly they are not the mutant that the laboratory produces.This microorganism can contain the thermophilic environmental sample from expectation and separate.Isolating wild-type microorganisms can produce ethanol, but because not through modifying, lactic acid may be main tunning.The selection of this isolating microorganism also depends under higher temperature, and they can be at the energy for growth on hexose and/or pentose and the oligomer thereof.
Preferably, microorganism of the present invention has some desired characteristics and makes and can use this microorganism during the fermentation.Microorganism should preferably not have restriction system, needing to avoid methylated requirement in the body thus.In addition, this microorganism should be stable under at least 3% alcoholic acid condition, and should be able to utilize the C that comprises cellobiose and starch etc.
3, C
5Or C
6Sugar (or their oligomer) is as substrate.Preferably, microorganism can be by high-frequency conversion.In addition, the growth velocity of microorganism in cultured continuously should satisfy 0.3h
-1More than (typical OD
600Be 0.3) dilution rate.
This microorganism should be thermophilic microorganism and can grow in 40 ℃-85 ℃ temperature range.Preferably, this microorganism can grow in 50 ℃-70 ℃ temperature range.In addition, the desirable growth conditions of microorganism is at pH7.2 or following, especially between pH6.9-pH4.5.
This microorganism can have spore, also can not be with spore.The success of fermenting process does not depend on that microorganism necessarily has the ability that forms spore, but when wishing that after fermenting process finishes microorganism is used as animal-feed, preferably can form the microorganism of spore in these cases.This is because when it was used as animal-feed, spore had the ability that can produce good immunostimulation.Can form the also sedimentation during the fermentation of microorganism of spore, therefore not need centrifugal just energy separated.Therefore, this microorganism can be used for animal-feed and need not carry out complicated or expensive sepn process.
Now, the nucleotide sequence of serum lactic dehydrogenase is known.Those skilled in the art can utilize this sequence by various mechanism lactate dehydrogenase gene to be carried out target so that this gene inactivation.The method for deactivating of preferred lactate dehydrogenase gene is by inserting transposon, perhaps preferably, and the disappearance of the part by this gene order or this gene order.Preferred deletion mutantion, this is because this mode has been avoided this gene order activatory difficult problem once more, and often occurs this situation when utilizing transposon inactivation.In preferred embodiments, by integrating temperature sensitivity plasmid (plasmid pUB190-ldh), can realize natural homologous recombination or integration between plasmid and microbial staining body like this with the lactate dehydrogenase gene inactivation.The screening of chromosomal integration body can be by they resistances to antimicrobial drug (for example kantlex).The integration of lactate dehydrogenase gene can be changed reorganization or two (many) exchanges reorganization generation by single cross.
In preferred embodiments, microorganism comprises allos alcohol dehydrogenase gene and allos Pyruvate Decarboxylase Gene.These expression of heterologous genes can produce the enzyme that can be redirected the metabolism direction, and therefore make ethanol become main tunning.These genes can obtain from the microorganism that carries out anaerobically fermenting usually, and described microorganism comprises fermentation single cell bacterium (zymomonas) and belongs to, and this genus comprises zymomonas mobilis (zymomonas mobilis).
It is known preparing these genes and being integrated into method of microorganism, Ingramet al for example, Biotech ﹠amp; BioEng, 1998; 58 (2+3): 204-214 and US 5916787, the content of above-mentioned every piece of document all by reference mode is included this paper in.Those skilled in the art should know, and this gene be directed in the plasmid or is integrated in the karyomit(e).
Microorganism of the present invention can be cultivated under conventional culture condition, and this decides according to selected thermophilic microorganism.Selected substrate, temperature, pH and other growth conditionss can require select based on known cultivation, and for example referring to WO 01/49865 and WO 01/85966, every piece of document all by reference mode is included this paper in.
Now in following examples with reference to accompanying drawing and only present invention is described in the mode of example.
The inactivation of LDH gene
Sudden change is changed in embodiment 1-single cross
The formation of LDH knockout carrier
Utilize HindIII and XbaI, the part fragment subclone of about 800bp of ldh gene to temperature sensitivity delivery vectors pUB190 (SEQ ID NO.1), is obtained the plasmid pUB190-ldh (Fig. 4 and SEQ ID NO.2) of 7.7kb.As described below, plasmid pUB190 by preservation to NCIMB.Verified ten colon bacillus of inferring (E.coli) JM109 (pUB190-ldh) transformant by restriction analysis, and the plasmid DNA of using two culture productions to be used to transform.Digest the ldh fragment that pUB190-ldh can obtain expecting with HindIII and XbaI.
With pUB190-ldh transition heat polyglycoside enzyme ground bacillus 11955
Under 54 ℃, obtain the transformant of all three kinds test plasmids through the screening of 24-28 hour kantlex.Obtain the ldh transformant from hot polyglycoside enzyme ground bacillus (Gt) 11955 purifying, and utilize HindIII and XbaI to verify by restriction analysis.
The LDH gene knockout
By the temperature sensitivity plasmid integration is carried out gene knockout to chromosomal ldh gene.
Plasmid pUB190-ldh is replicated in 54 ℃ Gt11955, is not replicated under 65 ℃.(12 μ g/ml) keeps screening with kantlex (kan).Then culture temperature is risen to 65 ℃ (plasmid no longer is replicated).Nature reorganization or integration take place between plasmid and karyomit(e).Based on resistance the chromosomal integration body is screened kantlex.Owing to homologous sequence is arranged on plasmid, integrates just at the ldh gene.Change regrouping process by known single cross and realized targeted integration at the ldh gene.This plasmid is integrated in the ldh gene, causes the ldh gene inactivation.Can produce the series connection repetition if integrated a plurality of plasmid copies.
Method and result
Tested two kinds of different methods that are used to integrate:
Method 1: 4 * 50ml TGP (kan) culture was cultivated 12-18 hour down at 54 ℃.Centrifugally obtain the cell precipitation thing, and be resuspended among the 1ml TGP.Resuspended thing is inoculated in (on 5 * 200ml) TGP (kan) flat board, and 68 ℃ of following incubated overnight.Select intasome, and it is inoculated in 50 * 50 dull and stereotyped lattice of new system TGP (kan), cultivate in 68 ℃ spend the night (o/n).
Method 2: 1 * 50ml TGP (km) culture was cultivated 12-18 hour at 54 ℃.With 1ml culture inoculation 50ml new system TGP (kan) culture, and 68 ℃ of cultivations 12-18 hour.In 50ml new system TGP (kan) culture, went down to posterity, and cultivated again 12-18 hour in second day at 68 ℃.This culture is inoculated on TGP (km) flat board, and in 68 ℃ of incubated overnight.On flat board, obtain the confluent growth thing.With each single colony inoculation in dull and stereotyped 50 * 50 lattice of new system TGP (kan), and in 68 ℃ of incubated overnight.
Screening
At knocking out of ldh gene, the integration thing that adopts following method screening to infer:
1) plate screening
With hundreds of intasome repeated inoculations on 68 ℃ SAM2 flat board (containing kan).Lactic acid negative cells output sour less, thereby can on the fermention medium of no damping fluid, have the growth vigor stronger than wild-type.
2) PCR screening
Adopt bacterium colony PCR to determine whether plasmid has been integrated in the ldh gene.By selecting to be positioned at the primer of integration site flank, can determine whether to have taken place ldh gene integration (inserting the no amplification PCR fragment in back).
3) lactic acid analysis
This analytical method determines whether intasome produces lactic acid during 68 ℃ of incubated overnight in SAM2 (kan).The Sigma lactic acid reagent that use is used to measure lactic acid is measured the lactic acid concn of culture supernatant.The negative intasome of lactic acid is re-used PCR identify, and in fermentor tank, assess its stability.
The electroporation of hot Polyglucosidase ground bacillus NCIMB 11955
The preparation of NCIMB 11955 freezing original seeds: incubated overnight NCIMB11955 in the TGP substratum (at 55 ℃ of 250rpm, 50ml nutrient solution in the Erlenmeyer flask of 250ml, OD
600), add isopyknic 20% glycerine, and be divided into the equal portions of 1ml, be loaded in the freeze pipe and place-80 ℃ of storages down.This original seed of 1ml is seeded among the 50ml TGP in the 250ml Erlenmeyer flask, cultivates down at 55 ℃ with 250rpm, until culture OD
600Arrive 1.4.
Make Erlenmeyer flask cooled on ice 10 minutes, then with culture centrifugal 20 minutes of 4 ℃ of 4000rpm.Throw out is resuspended in the ice-cold electroporation substratum of 50ml, and centrifugal 20 minutes of 4000rpm.(1 * 25ml and 2 * 10ml) washings are resuspended in throw out in the ice-cold electroporation substratum of 1.5ml then and are divided into the equal portions of 60 μ l through three times again.
For carrying out electroporation, add 1-2 μ l DNA at the 60 μ l electroreception attitude cells that place EP pipe on ice, and stir gently.This suspension is transferred in the electroporation cup (1mm spacing) of precooling, and under 2500V, 10 μ F electric capacity, 600 Ω resistance, carries out electroporation.
Add 1ml TGP behind the electricimpulse immediately, mix and suspension is transferred in the screw-cap tubule, in 52 ℃ of jolting water-baths, cultivated 1 hour.After the cultivation, (for example 2 * 0.5ml) in containing on the suitable antibiotic TGP agar, perhaps centrifugal 20 minutes of 4000rpm and throw out is resuspended among the 200 μ l-500 μ l TGP back coating with the suspension direct inoculation.
The electroporation substratum
TGP supports base
0.5M Sorbitol Powder Tryptones 17g/L
0.5M N.F,USP MANNITOL soy peptone 3g/L
10% glycerine K
2HPO
42.5g/L
NaCl 5g/L
PH to 7.3
Add behind the autoclaving:
Sodium.alpha.-ketopropionate 4g/l
Glycerine 4ml/L
The inactivation of LDH gene
The double exchange sudden change
Based on obtainable 11955 LDH sequences Design primers.Knocking out strategy is based on by two kinds of methods produces inner disappearance in the LDH gene.
In method 1, utilize near two special restriction sites that exist the LDH encoding sequence middle part to be changed to produce disappearance.The single big pcr product that produces from genomic dna comprises most LDH sequence, is cloned in the SmaI site of multiple clone site of pUC19.This pUC19 clone is digested in succession by BstEII and BsrGI then, and is reconnected in Klenow digestion back, thereby produces inner disappearance between the BstEII of LDH gene and BsrGI.
In method 2 (referring to embodiment 2), this LDH gene is cloned as 2 PCR products, introduces the NotI site in the oligomerization primer 2 PCR products are joined together in pUC19, and produce disappearance at LDH sequence middle part.These two LDH genes with inner disappearance are sent in the delivery system by subclone three kinds to genus bacillus.
| Plasmid | Describe |
| pCU1 | 4.94kb,, carry cat and bla based on the shuttle vectors of pC194 |
| pBT2 | 6.97kb the shuttle vectors derived from the responsive to temperature type mutant of pE194 carries cat and bla |
| pTV0mcs | 4.392kb,, carry cat (non-Gram-negative replicon) derived from pE194ts |
By electroporation delivery vectors is converted in 11955.
Genetic method information: exploitation is used for the delivery system that send of homologous recombination.
For generation knocks out body, need an efficient system with the gene delivery of sudden change to target organ, and filter out the integration of carrying out with genome by with the homologous recombination of target " wild-type " gene.In theory, this can realize by DNA being introduced the colon bacillus carrier carry the Gram-positive selected marker but not contain the Gram-positive replicon.This needs a high transformation efficiency.μ is that the electroporation method of genus bacillus 11955 exploitations is applied on the pNW33N, and the DNA of per 1 μ g can produce 3 * 10
4Individual transformant.The Gram-positive replicon derives from pBC1 in the BGSC catalogue and the pTHT15 in the sequence library.
Cat gene on the pNW33N is used to the screening in colon bacillus and the bacillus.The responsive to temperature type mutant of pNW33N produces by plasmid is gone down to posterity in Statagene XL1r ed mutant strain.
Produce the LDH mutant by gene substitution
Another kind method is designed to produce in hot Polyglucosidase ground bacillus NCIMB11955 by gene substitution the stable sudden change of LDH gene.This method forms the disappearance of 42bp near being included in the encoding sequence middle part, and in this site insertion 7bp base, introduces a new NotI restriction site.The purpose of the sequence of this insertion is the phase shift mutation that causes the downstream.
This method comprises utilizes 2 PCR fragments of the oligomerization primer of introducing new NotI site to produce disappearance.Design of primers is based on the partial sequence of 11955 LDH coding region.Used primer sequence is shown below.
Fragment 1:
Primer 1 (forward):
TCCCTTATGAACCAAGGAATAGCA (SEQ ID NO.3; The dash area sequence table is shown the base that produces new EcoRI site and introduce)
Primer 2 (oppositely):
ACCCGCTCTTTCGGTAACCCGCT (SEQ ID NO.4; The dash area sequence table is shown the base that produces new NotI site and introduce)
Primer 3 (forward):
GCTTGCTAAGTGAATATTTTCAAGT (SEQ ID NO.5; The dash area sequence table is shown the base that produces new NotI site and introduce)
Primer 4 (oppositely):
AGCGTCAATTCCATCACTTCACGA (SEQ ID NO.6; The dash area sequence table is shown the base that produces new PstI site and introduce) preparation of genomic dna.
Genomic dna prepares from 11955, as the template of PCR.20ml 11955 cultures of TGP substratum, 52 ℃ of incubated overnight are centrifugal 20 minutes collecting cells under 4000rpm.Cell precipitation is resuspended in 5ml contains 0.3M sucrose, 25mM Tris HCl and 25mM EDTA, pH is 8.0, and contains in the STE damping fluid of 1mg/ml ribonuclease A of 2.5mg N,O-Diacetylmuramidase and 50 μ l.Cultivated 1 hour at 30 ℃, add 5mg Proteinase K and 50 μ l 10%SDS then, cultivated 1 hour at 37 ℃ then.This culture lysate extracts successively with isopyknic phenol/chloroform and chloroform subsequently, uses isopropanol precipitating then.After twice of 70% ice-cold washing with alcohol, the DNA throw out is dissolved in the 0.5ml TE damping fluid again.
The formation of LDH disappearance construct
Use Robercycler Gradient 96 (Stratagene) to carry out PCR, reaction conditions is as follows: circulation 1; 95 ℃ of sex change 5 minutes,, extended 2-30 circulation 2 minutes at 72 ℃ 47 ℃ of annealing 1 minute; 95 ℃ of sex change 1 minute,,, hatched 5 minutes at 72 ℃ again extending 2 minutes 47 ℃ of annealing 1 minute.Used enzyme is Pfu polysaccharase (Promega) and Taq polysaccharase (New England Biolabs, geometric ratio mixture NEB).The composition of buffer reagent and dNTP and concentration are the recommendation of Pfu according to supplier.With the genomic dna of NCIMB 11955 is that the PCR product that template obtains carries out purifying by agarose gel electrophoresis, and with QIA PhastGel extraction test kit (Qiagen) wash-out from the sepharose.The PCR product of purifying is connected with the pUC19 (New England Biolabs) that digests with SmaI in advance, and the mixture that connects is used to the conversion of colon bacillus (Escherichia coli) DH10B (Invitrogen).Select the penicillin resistance clone, its plasmid that comprises is separated and evaluation by restriction analysis, and determines the direction of insertion.
The plasmid (pTM002) that inserts fragment 2 among the pUC19 (being introduced into new PstI site on the nearest primer 4 in the PstI site of the multiple clone site (mcs) of distance pUC19) is by NotI and PstI digestion.The fragment of gained (about 0.4kb) is connected on the pUC19 plasmid (pTM001) that contains fragment 1 (having introduced new EcoRI site on the nearest primer 1 in the EcoRI site of the mcs of distance pUC19), makes plasmid linearization with NotI and PstI digestion.The mixture that connects is used to transform colon bacillus DH10B.Select and have the penicillin resistance bacterium colony, the separated and evaluation of restriction analysis of its plasmid that comprises.By utilizing the plasmid (pTM003) that M13mp18 order-checking reverse and forward primer is identified and checking has the restricted pattern of expectation of the structure (this LDH coding region contains disappearance and is introduced into the NotI site) that needs.
The digestion of the LDH gene of sudden change by HindIII and EcoRI goes up cutly to come from pTM0003, and is purified by agarose gel electrophoresis, then with the QIA PhastGel extract test kit (as the fragment of about 0.8kb) from the gel by wash-out.This fragment is handled (NEB is according to manufacturer's specification sheets) by the Klenow polysaccharase and is produced flush end, and is introduced in the pUB190 carrier.This introducing can be connected realization by carrying out flush end with pUB190, and this pUB190 passes through the digestion linearizing of Xbal, and according to the above-mentioned gel-purified of carrying out the Klenow processing and following.This connection mixture is used to transform colon bacillus SCS110 (Stratagene).Select the penicillin resistance bacterium colony, its plasmid that comprises is separated and evaluation by restriction analysis.Plasmid (pTM014) with the restricted pattern of expectation that needs structure is identified, and is applied in the NCIMB 11955 electroporations conversion that utilizes qualification electroporation method among the embodiment 1.
Produce and identify the gene substitution mutant of LDH by double exchange
(strain TM15) former generation intasome of obtaining the pTM014 infer is applied to obtaining two recombinant chous (gene substitution) in this way.This is to realize by in not containing the TGP substratum of kantlex TM15 being carried out a series of cultivations of going down to posterity.Adopt 5 continuous joltings to cultivate, condition changes between 8 hours to 52 ℃ 16 hours at 54 ℃, in the pipe of every 50ml (Falcon) 5ml TGP is arranged, and rotating speed is 250rpm, goes down to posterity to shift 1% at every turn.After above-mentioned go down to posterity for 5 times, the TGP serial dilution of gained culture, and 100 μ l samples are seeded on the TGP agar plate, cultivate down for 54 ℃.With gained bacterium colony repeated inoculation to the TGP agar that contains 12 μ g/ml kantlex, to identify kantlex susceptibility bacterium colony.Obtain the single bacterium colony of purifying in streak inoculation on the agar after, detect these kantlex susceptibility derivatives and whether produce lactic acid, as expected, be confirmed that it is LDH
+And LDH
-Mixture.A kind of LDH-derivative TM89 is further identified with PCR and Southern trace.
With TM15 (former generation intasome) and TM89 (the two recombinant chou LDH-that infer) preparation genomic dna, and as the template among the PCR of primer 1 and 4, working conditions as mentioned above.11955 genomic dna is used as contrast.This PCR product (all obtaining about 0.8kb band from all 3 templates) is used the gel electrophoresis purifying, and extracts test kit wash-out from the sepharose with the QIA PhastGel.Sample digests with NotI, and carries out electrophoresis to show product on 0.7% sepharose.11955 PCR product does not have NotI digestion as demonstrating with estimating, and the PCR product of TM89 has 2 bands in the position of about 0.4kb, shows that displacement has taken place the allelotrope of wild type gene and sudden change.The NotI digestion of the PCR product of former generation intasome TM15 has 2 main bands identical with TM89, and the not cutting band (0.8kb) of trace is arranged.This point can be explained by the result who obtains from the Southern trace of TM15 genomic dna.
Use NotI, PstI and NotI, and the genomic dna of HindIII and NotI digestion 11955, TM15 and TM89, the row agarose gel electrophoresis of going forward side by side.Specification sheets (Luo Shi (Roche) molecular biochemistry DIG application manual) according to the manufacturer, this DNA is transferred on the positively charged nylon membrane (Roche), and with the probe hybridization of DIG mark, this probe be utilize primer 1 and 4 and the dNTP of DIG mark 11955 LDH gene carried out PCR produce.Show the hybridization band with the detection kit that provides (Roche).The Southern trace shows a large amount of amplified bands that have about 7.5kb in the NotI digest of TM15, the similar amplified band that has about 7kb and 0.4kb in the digest of the HindIII/NotI of TM15 and PstI/NotI, this shows that the pTM014 that integrates is integrated by the form with many tandem copies in former generation on the LDH locus of this intasome.Carry out all three kinds of restrictive diges-tion, TM89 demonstrates has different restricted chart-patterns, has more a hybrid belt than 11955, and this conforms to gene substitution.As mentioned below, TM89 has been preserved in NCIMB, is numbered 41275.
Embodiment 3
Produce ethanol with the wild-type thermophile
Thermophilic fed batch cultivation of wild-type and cultured continuously have realized that multiplicative growth and product generate.Table 1,2 and 3 shows the condition of using in the fermenting process.
Table 1
| Chemical substance | Volume/L | Final concentration | |
| NaH 2PO 4·2H 2O | 25mM | ||
| K 2SO 4 | 10mM | ||
| Citric acid H 2O | 2mM | ||
| MgSO 4·7H 2O | 1.25mM | ||
| CaCl 2·2H 2O | 0.02mM | ||
| The TE sulfate liquor | 5ml | See below | |
| Na 2MoO 4·2H 2O | 1.65μM | ||
| Yeast extract | 10g | ||
| Defoamer | 0.5ml | ||
| Add behind the autoclaving: | |||
| 4M urea | 25ml | |
|
| 1% vitamin | 300μl | 12μM | |
| 20% glucose 2 | 50ml | 1％ |
Table 2
Trace element vitriol liquid storage
| Chemical substance | gl -1(ml) | Substratum concentration |
| Conc.H 2SO 4 | 5ml | |
| Zn SO 4.7H 2O | 1.44 | 25μM |
| Fe SO 4.7H 2O | 5.56 | 100μM |
| Mn SO 4.H 2O | 1.69 | 50μM |
| Cu SO 4.5H 2O | 0.25 | 5μM |
| Co SO 4.7H 2O | 0.562 | 10μM |
| Ni SO 4.6H 2O | 0.886 | 16.85μM |
| H 3BO 3 | 0.08 | |
| Deionized water (final volume) | 1000ml |
Table 3
The fermentor tank condition
| Inoculum | 10％V/V |
| | 1000ml |
| Temperature | |
| 60℃ | |
| PH | Transfer to 7.0 with NaOH |
| Ventilation | 0.4vvm |
| N 2Air-flow | 0.05lpm |
| Stir | 400rpm |
| Substratum | The urea sulfate that is used for fermentor tank |
| Sugar is supplied with | 100ml 50% glucose |
Table 4
Embodiment 4
Increase ethanol production by thermophile
In order to obtain target output and productivity from thermophilic ethanol, the inactivation by the ldh gene knocks out L-serum lactic dehydrogenase (LDH) activity so that the generation of lactic acid minimizes.Make the method for ldh gene inactivation have two kinds: thus marker DNA and chromosomal ldh zone carry out single cross and change reorganization and stop and to transcribe, perhaps the homology of DNA zone and ldh gene carry out dual group forming sudden change in gene region, thereby make it lose function.
Compare with wild type strain (NCIMB 11955), the single cross method of changing produces the increase that the negative mutant of LDH demonstrates ethanol production fast.
Improve ethanol production by the LDH mutant
The negative mutant of LDH is cultivated in fed batch cultivation, uses conventional minimum medium to measure the active increase of removing the ethanol production that is caused of LDH.The metabolite changed condition of LDH mutant is shown in table 5, and compares with the optimum ethanol production of wild type strain.The metabolite yield curve of two kinds of LDH mutant is shown in Fig. 1 and 2.Table 6 has shown the increase by the ethanol production due to the active removal of LDH.
Table 5
Table 6
The ethanol production of LDH mutant output shows that apparently higher than the wild-type thermophile these thermophilic metabolic pathway are successfully changed.Culture condition and the medium component of further optimizing the LDH mutant strain carry out and will ethanol production be increased.
In continuous culture, produce ethanol with the LDH mutant
The lactic acid mutant is changed in the most stable single cross grows in continuous culture to assess its stability as the long-range of alcohol production bacterial strain.This bacterial strain is cultivated in minimum medium, is carbon source with glucose.The culture of steady state was observed in about 290 hours, occurred the counter-rotating of lactic acid production afterwards.
According to as the design among the embodiment 4, assess the ethanol production of double exchange mutant TM89 (embodiment 2).This result is displayed in Table 8, and shows that the ethanol production of this mutant has reached remarkable high level (greater than 200mM).This mutant is that carbon source is assessed its ethanol production with glucose or wood sugar also.It the results are shown in table 7.
Table 7
It is best carbon source that glucose is shown, but this result clearly illustrates that these biologies are without also can xylose-fermenting under the situation of further modifying.
The stability of the negative mutant of serum lactic dehydrogenase is also detected by 1500 hours continuous culture under the various conditions.The result is displayed in Table 6, though and show that culture has stood very big pressure, the negative phenotype of serum lactic dehydrogenase keeps stable, and this stability and do not rely on antibiotic screening.In this successive processes, dilution rate is 0.1hr
-1To 0.5hr
-1, and culture changes anaerobic (logical N into from aerobic (blowing air) condition
2) condition do not influence concentration of lactic acid.Be more significantly, the pH of culture changes and reduces to pH4.4, and this value is outside the normal pH scope of this wild-type microorganisms growth.Yet culture recovers rapidly, and no phenotype changes, i.e. the lactic acid concn no change.
Be defined as microorganism and the submitted NCIMB preservation of plasmid pUB190-ldh of TM89 herein, the numbering of NCIMB is respectively 41275 and 41276.Depositary institution is NCIMB Ltd, Ferguson Bulding, Craibstone Estate, Bucksburn, Aberdeen, AB219YA, United Kingdom.
Sequence table
＜110〉TMO Bioisystech Co., Ltd
＜120〉be used to the thermophilic microorganism of the lactate dehydrogenase gene (LDH) producing alcoholic acid, have inactivation
<130>JWJ01150WO
<150>GB0511603.3
<151>2005-06-07
<150>GB0509068.3
<151>2005-05-04
<160>6
<170>PatentIn version 3.3
<210>1
<211>6744
<212>DNA
＜213〉hot Polyglucosidase ground bacillus (Geobacillus thermoglucosidasius)
<400>1
gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 60
acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 120
actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 180
gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 240
cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 300
tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 360
gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 420
ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 480
aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 540
tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 600
ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 660
gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 720
tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 780
caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 840
ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt 900
cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt 960
ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 1020
cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 1080
gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc 1140
aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc 1200
acctatctca gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta 1260
gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga 1320
cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg 1380
cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc 1440
tagagtaagt agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat 1500
cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag 1560
gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 1620
gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 1620
cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa 1680
ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa 1740
gtcattctga gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga 1800
taataccgcg ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg 1860
gcgaaaactc tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc 1920
acccaactga tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg 1980
aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact 2040
cttccttttt caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat 2100
atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt 2160
gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 2220
cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca 2280
gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca 2340
gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg catcagagca 2400
gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa 2460
ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt 2520
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa ggcgattaag 2580
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgccaagct 2640
tgcatgcctg caggtcgact ctagaaaatc aatctctttt tccaaagttt gttttttaaa 2700
tttagctgtc tcaatatgtt tacggtcaga gccacgttca ccacgcttca actcaaaacc 2760
ctgttttttc atatgctcgg ggaatttatc ttgtagccat aacagttctt gacgattaaa 2820
cacatttttt ccttgcagtt ttccatcacg cataggcaca acacctaaat gcatgtgagg 2880
ggtttgctca tcattatgaa ctgttgcata agcaatattt tgcttgccat atcgttcgga 2940
aaataattta taactttcct caaaaaatcg tttttgttct cctggatcca gttgctcaaa 3000
aaaatctcgg tcagatgtta ctagcaactc atttacaaga acagcatctt tcctcgtttt 3060
tcttgtacct gttttttgtg attcaataat ttctttgaca cgttcgttgt aatcaatatt 3120
tttatcattt ttcaaatcat aattttcacg tgttcgctca tggtcaatat catcattcgt 3180
tctacttttt cgctctcttt gattatgaaa ttgcatgcct tttagtccag ctgatttcac 3240
tttttgcatt ctacaaactg cataactcat atgtaaatcg ctccttttta ggtggcacaa 3300
atgtgaggca ttttcgctct ttccggcaac cacttccaag taaagtataa cacactatac 3360
tttatattca taaagtgtgt gctctgcgag gctgtcggca gtgccgacca aaaccataaa 3420
acctttaaga cctttctttt ttttacgaga aaaaagaaac aaaaaaacct gccctctgcc 3480
acctcagcaa aggggggttt tgctctcgtg ctcgtttaaa aatcagcaag ggacaggtag 3540
tattttttga gaagatcact caaaaaatct ccacctttaa acccttgcca atttttattt 3600
tgtccgtttt gtctagctta ccgaaagcca gactcagcaa gaataaaatt tttattgtct 3660
ttcggttttc tagtgtaacg gacaaaacca ctcaaaataa aaaagataca agagaggtct 3720
ctcgtatctt ttattcagca atcgcgcccg attgctgaac agattaataa tagattttag 3780
ctttttattt gttgaaaaaa gctaatcaaa ttgttgtcgg gatcaattac tgcaaagtct 3840
cgttcatccc accactgatc ttttaatgat gtattggggt gcaaaatgcc caaaggctta 3900
atatgttgat ataattcatc aattccctct acttcaatgc ggcaactagc agtaccagca 3960
ataaacgact ccgcacctgt acaaaccggt gaatcattac tacgagagcg ccagccttca 4020
tcacttgcct cccatagatg aatccgaacc tcattacaca ttagaactgc gaatccatct 4080
tcatggtgaa ccaaagtgaa acctagttta tcgcaataaa aacctatact ctttttaata 4140
tccccgactg gcaatgccgg gatagactgt aacattctca cgcataaaat cccctttcat 4200
tttctaatgt aaatctatta ccttattatt aattcaattc gctcataatt aatccttttt 4260
cttattacgc aaaatggccc gatttaagca caccctttat tccgttaatg cgccatgaca 4320
gccatgataa ttactaatac taggagaagt taataaatac gtaaccaaca tgattaacaa 4380
ttattagagg tcatcgttca aaatggtatg cgttttgaca catccactat atatccgtgt 4440
cgttctgtcc actcctgaat cccattccag aaattctcta gcgattccag aagtttctca 4500
gagtcggaaa gttgaccaga cattacgaac tggcacagat ggtcataacc tgaaggaaga 4560
tctgattgct taactgcttc agttaagacc gaagcgctcg tcgtataaca gatgcgatga 4620
tgcagaccaa tcaacatggc acctgccatt gctacctgta cagtcaagga tggtagaaat 4680
gttgtcggtc cttgcacacg aatattacgc catttgcctg catattcaaa cagctcttct 4740
acgataaggg cacaaatcgc atcgtggaac gtttgggctt ctaccgattt agcagtttga 4800
tacactttct ctaagtatcc acctgaatca taaatcggca aaatagagaa aaattgacca 4860
tgtgtaagcg gccaatctga ttccacctga gatgcataat ctagtagaat ctcttcgcta 4920
tcaaaattca cttccacctt ccactcaccg gttgtccatt catggctgaa ctctgcttcc 4980
tctgttgaca tgacacacat catctcaata tccgaatagg gcccatcagt ctgacgacca 5040
agagagccat aaacaccaat agccttaaca tcatccccat atttatccaa tattcgttcc 5100
ttaatttcat gaacaatctt cattctttct tctctagtca ttattattgg tccattcact 5160
attctcattc ccttttcaga taattttaga tttgcttttc taaataagaa tatttggaga 5220
gcaccgttct tattcagcta ttaataactc gtcttcctaa gcatccttca atccttttaa 5280
taacaattat agcatctaat cttcaacaaa ctggcccgtt tgttgaacta ctctttaata 5340
aaataatttt tccgttccca attccacatt gcaataatag aaaatccatc ttcatcggct 5400
ttttcgtcat catctgtatg aatcaaatcg ccttcttctg tgtcatcaag gtttaatttt 5460
ttatgtattt cttttaacaa accaccatag gagattaacc ttttacggtg taaaccttcc 5520
tccaaatcag acaaacgttt caaattcttt tcttcatcat cggtcataaa atccgtatcc 5580
tttacaggat attttgcagt ttcgtcaatt gccgattgta tatccgattt atatttattt 5640
ttcggtcgaa tcatttgaac ttttacattt ggatcatagt ctaatttcat tgcctttttc 5700
caaaattgaa tccattgttt ttgattcacg tagttttctg tattcttaaa ataagttggt 5760
tccacacata ccaatacatg catgtgctga ttataagaat tatctttatt atttattgtc 5820
acttccgttg cacgcataaa accaacaaga tttttattaa tttttttata ttgcatcatt 5880
cggcgaaatc cttgagccat atctgacaaa ctcttattta attcttcgcc atcataaaca 5940
tttttaactg ttaatgtgag aaacaaccaa cgaactgttg gcttttgttt aataacttca 6000
gcaacaacct tttgtgactg aatgccatgt ttcattgctc tcctccagtt gcacattgga 6060
caaagcctgg atttacaaaa ccacactcga tacaactttc tttcgcctgt ttcacgattt 6120
tgtttatact ctaatatttc agcacaatct tttactcttt cagccttttt aaattcaaga 6180
atatgcagaa gttcaaagta atcaacatta gcgattttct tttctctcca tggtctcact 6240
tttccacttt ttgtcttgtc cactaaaacc cttgattttt catctgaata aatgctacta 6300
ttaggacaca taatattaaa agaaaccccc atctatttag ttatttgttt agtcacttat 6360
aactttaaca gatggggttt ttctgtgcaa ccaattttaa gggttttcaa tactttaaaa 6420
cacatacata ccaacacttc aacgcacctt tcagcaacta aaataaaaat gacgttattt 6480
ctatatgtat caagataaga aagaacaagt tcaaaaccat caaaaaaaga caccttttca 6540
ggtgcttttt ttattttata aactcattcc ctgatctcga cttcgttctt tttttacctc 6600
tcggttatga gttagttcaa attcgttctt tttaggttct aaatcgtgtt tttcttggaa 6660
ttgtgctgtt ttatccttta ccttgtctac aaacccctta aaaacgtttt taaaggcttt 6720
taagccgtct gtacgttcct taag 6744
<210>2
<211>7673
<212>DNA
＜213〉hot Polyglucosidase ground bacillus
<400>2
gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc 60
acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta 120
actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca 180
gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 240
cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 300
tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 360
gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 420
ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 480
aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 540
tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 600
ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 660
gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 720
tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 780
caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 840
ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt 900
cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt 960
ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 1020
cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 1080
gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc 1140
aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc 1200
acctatctca gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta 1260
gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga 1320
cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg 1380
cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc 1440
tagagtaagt agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat 1500
cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag 1560
gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 1620
cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa 1680
ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa 1740
gtcattctga gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga 1800
taataccgcg ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg 1860
gcgaaaactc tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc 1920
acccaactga tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg 1980
aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact 2040
cttccttttt caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat 2100
atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt 2160
gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 2220
cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca 2280
gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca 2340
gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg catcagagca 2400
gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa 2460
ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt 2520
gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa ggcgattaag 2580
ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgccaagct 2640
tggtaccgag ctcactagtc acggccgcca gtgtgctgga attcgccctt ggatcctttg 2700
cccttatgaa ccaaggaata gcagatgagt tagtattgat tgatgtaaat aagaataagg 2760
cagagggcga tgtgatggat ttaaatcacg gaaaagtatt cgcgccgaag ccgatgaata 2820
tttggtttgg agattatcaa gattgccaag acgccgattt ggtggtgatt tgtgcagggg 2880
ctaaccaaaa gccgggagaa acaagactgg atcttgttga caaaaatatt aatatcttca 2940
aaacgattgt cgattctgtg atgaaatccg gatttgatgg cgtttttctt gtggcaacga 3000
acccagtgga tattttaacg tatgctactt ggaaatttag cgggttaccg aaagagcggg 3060
taatcggctc aggaacgatt cttgatacag caagattccg cttcttgcta agtgaatatt 3120
ttcaagtggc tccgaccaat gtacatgcgt atattattgg cgagcatggg gatacagagc 3180
tgcctgtttg gagccatgcg gaaattggaa gcattccagt tgagcaaata ttgatgcaaa 3240
acgataacta tagaaaagag gatttagaca atatctttgt taatgttcgt gatgcggcat 3300
atcaaatcat tgagaaaaaa ggggcaacgt attacggcat tgcaatggga ttagtccgta 3360
tcactcgtgc tattttgcac aatgaaaatg ccatcttaac cgtttctgct catttggacg 3420
gccaatatgg cgaacgaaat gtttatattg gcgtgcctgc cattatcaac cgaaacggta 3480
ttcgtgaagt gatggaattg acgctaaatg aaacagaaca agggcgaatt ctgcagatat 3540
ccatcacact ggcggccgct cgagcatgca gcatgcctgc aggtcgactc tagaaaatca 3600
atctcttttt ccaaagtttg ttttttaaat ttagctgtct caatatgttt acggtcagag 3660
ccacgttcac cacgcttcaa ctcaaaaccc tgttttttca tatgctcggg gaatttatct 3720
tgtagccata acagttcttg acgattaaac acattttttc cttgcagttt tccatcacgc 3780
ataggcacaa cacctaaatg catgtgaggg gtttgctcat cattatgaac tgttgcataa 3840
gcaatatttt gcttgccata tcgttcggaa aataatttat aactttcctc aaaaaatcgt 3900
ttttgttctc ctggatccag ttgctcaaaa aaatctcggt cagatgttac tagcaactca 3960
tttacaagaa cagcatcttt cctcgttttt cttgtacctg ttttttgtga ttcaataatt 4020
tctttgacac gttcgttgta atcaatattt ttatcatttt tcaaatcata attttcacgt 4080
gttcgctcat ggtcaatatc atcattcgtt ctactttttc gctctctttg attatgaaat 4140
tgcatgcctt ttagtccagc tgatttcact ttttgcattc tacaaactgc ataactcata 4200
tgtaaatcgc tcctttttag gtggcacaaa tgtgaggcat tttcgctctt tccggcaacc 4260
acttccaagt aaagtataac acactatact ttatattcat aaagtgtgtg ctctgcgagg 4320
ctgtcggcag tgccgaccaa aaccataaaa cctttaagac ctttcttttt tttacgagaa 4380
aaaagaaaca aaaaaacctg ccctctgcca cctcagcaaa ggggggtttt gctctcgtgc 4440
tcgtttaaaa atcagcaagg gacaggtagt attttttgag aagatcactc aaaaaatctc 4500
cacctttaaa cccttgccaa tttttatttt gtccgttttg tctagcttac cgaaagccag 4560
actcagcaag aataaaattt ttattgtctt tcggttttct agtgtaacgg acaaaaccac 4620
tcaaaataaa aaagatacaa gagaggtctc tcgtatcttt tattcagcaa tcgcgcccga 4680
ttgctgaaca gattaataat agattttagc tttttatttg ttgaaaaaag ctaatcaaat 4740
tgttgtcggg atcaattact gcaaagtctc gttcatccca ccactgatct tttaatgatg 4800
tattggggtg caaaatgccc aaaggcttaa tatgttgata taattcatca attccctcta 4860
cttcaatgcg gcaactagca gtaccagcaa taaacgactc cgcacctgta caaaccggtg 4920
aatcattact acgagagcgc cagccttcat cacttgcctc ccatagatga atccgaacct 4980
cattacacat tagaactgcg aatccatctt catggtgaac caaagtgaaa cctagtttat 5040
cgcaataaaa acctatactc tttttaatat ccccgactgg caatgccggg atagactgta 5100
acattctcac gcataaaatc ccctttcatt ttctaatgta aatctattac cttattatta 5160
attcaattcg ctcataatta atcctttttc ttattacgca aaatggcccg atttaagcac 5220
accctttatt ccgttaatgc gccatgacag ccatgataat tactaatact aggagaagtt 5280
aataaatacg taaccaacat gattaacaat tattagaggt catcgttcaa aatggtatgc 5340
gttttgacac atccactata tatccgtgtc gttctgtcca ctcctgaatc ccattccaga 5400
aattctctag cgattccaga agtttctcag agtcggaaag ttgaccagac attacgaact 5460
ggcacagatg gtcataacct gaaggaagat ctgattgctt aactgcttca gttaagaccg 5520
aagcgctcgt cgtataacag atgcgatgat gcagaccaat caacatggca cctgccattg 5580
ctacctgtac agtcaaggat ggtagaaatg ttgtcggtcc ttgcacacga atattacgcc 5640
atttgcctgc atattcaaac agctcttcta cgataagggc acaaatcgca tcgtggaacg 5700
tttgggcttc taccgattta gcagtttgat acactttctc taagtatcca cctgaatcat 5760
aaatcggcaa aatagagaaa aattgaccat gtgtaagcgg ccaatctgat tccacctgag 5820
atgcataatc tagtagaatc tcttcgctat caaaattcac ttccaccttc cactcaccgg 5880
ttgtccattc atggctgaac tctgcttcct ctgttgacat gacacacatc atctcaatat 5940
ccgaataggg cccatcagtc tgacgaccaa gagagccata aacaccaata gccttaacat 6000
catccccata tttatccaat attcgttcct taatttcatg aacaatcttc attctttctt 6060
ctctagtcat tattattggt ccattcacta ttctcattcc cttttcagat aattttagat 6120
ttgcttttct aaataagaat atttggagag caccgttctt attcagctat taataactcg 6180
tcttcctaag catccttcaa tccttttaat aacaattata gcatctaatc ttcaacaaac 6240
tggcccgttt gttgaactac tctttaataa aataattttt ccgttcccaa ttccacattg 6300
caataataga aaatccatct tcatcggctt tttcgtcatc atctgtatga atcaaatcgc 6360
cttcttctgt gtcatcaagg tttaattttt tatgtatttc ttttaacaaa ccaccatagg 6420
agattaacct tttacggtgt aaaccttcct ccaaatcaga caaacgtttc aaattctttt 6480
cttcatcatc ggtcataaaa tccgtatcct ttacaggata ttttgcagtt tcgtcaattg 6540
ccgattgtat atccgattta tatttatttt tcggtcgaat catttgaact tttacatttg 6600
gatcatagtc taatttcatt gcctttttcc aaaattgaat ccattgtttt tgattcacgt 6660
agttttctgt attcttaaaa taagttggtt ccacacatac caatacatgc atgtgctgat 6720
tataagaatt atctttatta tttattgtca cttccgttgc acgcataaaa ccaacaagat 6780
ttttattaat ttttttatat tgcatcattc ggcgaaatcc ttgagccata tctgacaaac 6840
tcttatttaa ttcttcgcca tcataaacat ttttaactgt taatgtgaga aacaaccaac 6900
gaactgttgg cttttgttta ataacttcag caacaacctt ttgtgactga atgccatgtt 6960
tcattgctct cctccagttg cacattggac aaagcctgga tttacaaaac cacactcgat 7020
acaactttct ttcgcctgtt tcacgatttt gtttatactc taatatttca gcacaatctt 7080
ttactctttc agccttttta aattcaagaa tatgcagaag ttcaaagtaa tcaacattag 7140
cgattttctt ttctctccat ggtctcactt ttccactttt tgtcttgtcc actaaaaccc 7200
ttgatttttc atctgaataa atgctactat taggacacat aatattaaaa gaaaccccca 7260
tctatttagt tatttgttta gtcacttata actttaacag atggggtttt tctgtgcaac 7320
caattttaag ggttttcaat actttaaaac acatacatac caacacttca acgcaccttt 7380
cagcaactaa aataaaaatg acgttatttc tatatgtatc aagataagaa agaacaagtt 7440
caaaaccatc aaaaaaagac accttttcag gtgctttttt tattttataa actcattccc 7500
tgatctcgac ttcgttcttt ttttacctct cggttatgag ttagttcaaa ttcgttcttt 7560
ttaggttcta aatcgtgttt ttcttggaat tgtgctgttt tatcctttac cttgtctaca 7620
aaccccttaa aaacgttttt aaaggctttt aagccgtctg tacgttcctt aag 7673
<210>3
<211>29
<212>DNA
＜213〉artificial
<220>
＜223〉Oligonucleolide primers
<400>3
ggaattccct tatgaaccaa ggaatagca 29
<210>4
<211>31
<212>DNA
＜213〉artificial
<220>
＜223〉Oligonucleolide primers
<400>4
gcggccgcac ccgctctttc ggtaacccgc t 31
<210>5
<211>31
<212>DNA
＜213〉artificial
<220>
＜223〉Oligonucleolide primers
<400>5
gcggccgctt gctaagtgaa tattttcaag t 31
<210>6
<211>28
<212>DNA
＜213〉artificial
<220>
＜223〉Oligonucleolide primers
<400>6
ctgcagcgtc aattccatca cttcacga 28
Claims (21)
1. a thermophilic microorganism is modified so that the alcoholic acid output of its generation increases the wherein said lactate dehydrogenase gene inactivation that is modified to the wild-type thermophilic microorganism described thermophilic microorganism.
2. according to the microorganism of claim 1, wherein said microorganism does not contain restricted system.
3. according to the microorganism of claim 1 or claim 2, wherein said microorganism is that ground bacillus belongs to the kind of (Geobacillus).
4. according to the microorganism of aforementioned each claim, wherein said microorganism is hot Polyglucosidase ground bacillus (Geobacillus Thermoglucosidasius).
5. according to the microorganism of aforementioned each claim, wherein said microorganism is for forming the microorganism of spore.
6. according to the microorganism of aforementioned each claim, wherein said microorganism is stable in containing the most nearly 30% (w/v) alcoholic acid substratum.
7. according to the microorganism of aforementioned each claim, but wherein said microorganism metabolism cellobiose and/or starch, perhaps their oligomer.
8. according to the microorganism of aforementioned each claim, wherein said microorganism can be transformed with high frequency.
9. according to the microorganism of aforementioned each claim, wherein said microorganism grows under 40 ℃-85 ℃ temperature, preferably grows under 50 ℃-70 ℃ temperature.
10. according to the microorganism of aforementioned each claim, wherein said microorganism comprises non-natural pdc gene.
11. according to the microorganism of aforementioned each claim, wherein said microorganism comprises non-natural adh gene.
12. according to the microorganism of aforementioned each claim, wherein said natural lactate dehydrogenase gene or its part are lacked.
13., do not contain integrated element in the lactate dehydrogenase gene of wherein said microorganism according to the microorganism of aforementioned each claim.
14. one kind to be numbered the microorganism of NCIMB 41275 preservations.
15. one kind is used to produce the alcoholic acid method, is included in C
3, C
5Or C
6When sugar or their oligomer exist, under appropriate condition, cultivate the microorganism of aforementioned each claim.
16. according to the method for claim 15, wherein said method is implemented under 40 ℃-70 ℃ temperature.
17. according to the method for claim 16, wherein said temperature is 52 ℃-65 ℃.
18. according to each method of claim 15-17, wherein said microorganism is cultivated in pH is the culture of 4-7.5.
19. this paper is defined as the plasmid of pUB 190-1dh.
20. a thermophilic microorganism comprises the plasmid of claim 19.
21. an animal-feed comprises each the microorganism according to claim 1-14.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0509068.3 | 2005-05-04 | ||
| GBGB0509068.3A GB0509068D0 (en) | 2005-05-04 | 2005-05-04 | Ethanol production |
| GB0511603.3 | 2005-06-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101203602A true CN101203602A (en) | 2008-06-18 |
Family
ID=34674299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2006800152991A Pending CN101203602A (en) | 2005-05-04 | 2006-05-03 | Thermophilic microorganisms with inactivated lactate dehydrogenase gene(LDH) for ethanol production |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN101203602A (en) |
| GB (1) | GB0509068D0 (en) |
| ZA (1) | ZA200709858B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102757918A (en) * | 2011-10-31 | 2012-10-31 | 崔荣 | Thermophilic bacillus and application thereof |
-
2005
- 2005-05-04 GB GBGB0509068.3A patent/GB0509068D0/en not_active Ceased
-
2006
- 2006-05-03 ZA ZA200709858A patent/ZA200709858B/en unknown
- 2006-05-03 CN CNA2006800152991A patent/CN101203602A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102757918A (en) * | 2011-10-31 | 2012-10-31 | 崔荣 | Thermophilic bacillus and application thereof |
| CN102757918B (en) * | 2011-10-31 | 2014-06-25 | 崔荣 | Thermophilic bacillus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| GB0509068D0 (en) | 2005-06-08 |
| ZA200709858B (en) | 2009-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101223271B (en) | Modified microorganisms with inactivated lactate dehydrogenase gene | |
| KR20080012934A (en) | Thermophilic microorganisms with inactivated lactate dehydrogenase gene(ldh) for ethanol production | |
| CN110088275A (en) | The ethyl alcohol of improved no glycerol produces | |
| JP5185940B2 (en) | Production of ethanol using a xylitol synthetic mutant of xylose-utilizing Zymomonas | |
| CN109749976B (en) | Recombinant bacillus subtilis for efficiently synthesizing guanosine diphosphate fucose and construction method and application thereof | |
| US7354755B2 (en) | Stable zymomonas mobilis xylose and arabinose fermenting strains | |
| CN108424870B (en) | Corynebacterium glutamicum for producing N-acetylglucosamine and application thereof | |
| EP2007897B1 (en) | Enhancement of microbial ethanol production | |
| CN101679939A (en) | The re-engineering bacteria that is used for alcohol production | |
| CN107699535B (en) | Recombinant bacillus subtilis for induced synthesis of guanosine diphosphate fucose and construction method and application thereof | |
| AU2001249926B2 (en) | Stable zymomonas mobilis xylose and arabinose fermenting strains | |
| CN107805622B (en) | Recombinant bacillus subtilis for synthesizing guanosine diphosphate rock sugar and construction method and application thereof | |
| AU2001251397B2 (en) | Method of site-specific insertion in zymomonas mobilis | |
| AU2001249926A1 (en) | Stable zymomonas mobilis xylose and arabinose fermenting strains | |
| AU2001251397A1 (en) | Method of site-specific insertion in zymomonas mobilis | |
| CN101203602A (en) | Thermophilic microorganisms with inactivated lactate dehydrogenase gene(LDH) for ethanol production | |
| KR101639424B1 (en) | Method for Detecting and Quantitating Cellulase Using Artificial Genetic Circuit | |
| CN106978432A (en) | Knock out carrier construction method and the application of chlamydomonas endogenous gene and expression alien gene | |
| KR101246884B1 (en) | Transformed Pseudomonas Aeruginosa for Over-expression of Fatty Acid Biosynthesis Pathway and Method of Preparing the Same | |
| CN111909957B (en) | Genetic transformation method of haematococcus pluvialis | |
| KR101035731B1 (en) | Leuconostoc lacking dextransucrase and vector for making and using the same | |
| CN116555061A (en) | Saccharomyces cerevisiae mutant and application thereof in preparation of alcohol | |
| RU2771581C1 (en) | Recombinant yeast strain komagataella phaffii - producer of secreted endo-dissociative xyloglucanase of the gh74 family, encoded by a mutated gene, and a method for microbiological synthesis of secreted endo-dissociative xyloglucanase based on this strain | |
| KR102247462B1 (en) | Recombinant Lactic acid bacteria having enhanced Productivity for Riboflavin | |
| US20120045821A1 (en) | Methods and compositions for genetic engineering of cyanobacteria to produce ethanol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20080618 |