RU2771581C1 - Recombinant yeast strain komagataella phaffii - producer of secreted endo-dissociative xyloglucanase of the gh74 family, encoded by a mutated gene, and a method for microbiological synthesis of secreted endo-dissociative xyloglucanase based on this strain - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: inventions group relates to biotechnology. A recombinant yeast strain Komagataella phaffii RNCIM Y-4933 is proposed, producing a secreted endo-dissociative xyloglucanase of the GH74 family, encoded by a mutant gene corresponding to SEQ ID NO 1. A method for microbiological synthesis of xyloglucanase using the specified strain is also proposed.

EFFECT: inventions group provides a high level of production of xyloglucanase of the GH74 family with an endo-dissociative mode of action on the substrate, providing an effective decrease in the viscosity of xyloglucan solutions.

2 cl, 3 ex, 2 dwg

Description

The group of claimed inventions relates to biotechnology, in particular to the biosynthesis of xyloglucanase, and is a recombinant yeast strain Komagataella phaffii, carrying on the chromosome the xyloglucanase gene from Myceliophthora thermophila VKPM F-244, containing substitutions (W324A/W325A), aimed at changing the mode of action of the enzyme on a substrate from endo-processive to endo-dissociative, and capable of synthesizing endo-dissociative xyloglucanase, as well as a method for microbiological synthesis of endo-dissociative xyloglucanase based on the claimed strain.

Lignocellulosic biomass is a cheap, renewable source of fermentable sugars that are the substrates of many biosynthetic processes. Enzymatic hydrolysis is an environmentally friendly way to bioconvert plant biomass into sugars. The complex polysaccharide composition of plant cell walls, containing, in addition to cellulose, a variety of binding glycans, necessitates the use of a wide range of enzymes for hydrolysis.

The main structural polysaccharide of the primary cell wall of all dicotyledonous and many monocotyledonous plants is a variety of beta-glucan - xyloglucan (XG). Along with other binding glycans, it forms an amorphous matrix in which cellulose microfibrils are immersed. Therefore, complete hydrolysis of cellulose is impossible without preliminary hydrolysis of matrix polysaccharides, including CG.

The main chain of the CG molecule consists of cellotetraose blocks interconnected by β-(1,4)-bonds. In most cases, every three of the four glucose residues in such a block are linked by α-(1,6)-bonds to D-xylose residues. Some of the glucose residues, in turn, can be linked by β-(1,2)-bonds to D-galactose or, more rarely, L-arabinose residues. In the CG of some plants, D-galactose residues can be linked by α-(1,2)-bonds to L-fucose residues. The species and tissue specificity of modifications of xylose residues determines the diversity of CG types in plants.

Enzymes that specifically cleave the β-(1,4)-bonds of the main chain of the CG molecule are called xyloglucanases.

According to Herissat's classification, carbohydrases are divided into families, united by common structural and functional properties, based on the similarity of amino acid sequences (Henrissat and Bairoch, 1996). Currently, the CAZy database contains more than 140 families of glycosyl hydrolases (http://www.Cazy.org). Xyloglucan hydrolyzing enzymes are found in the glycosyl hydrolase families: GH5, GH7, GH12, GH16, GH26, GH44, and GH74. Unlike other families that contain, in addition to xyloglucanases, enzymes with different substrate specificities, the GH74 family contains only enzymes that have activity on xyloglucan. The GH74 family includes:

1) cellulases (EC 3.2.1.4) that cleave β-(1,4)-D-glucosidic bonds in cellulose, lichenan and β-D-glucans of cereals;

2) cellobiohydrolases specific to the reducing ends of oligosaccharides (OXG-RCBH, EC 3.2.1.150), which cleave cellobiose from the reducing end of the CG molecule or its oligosaccharides;

3) xyloglucan-specific endo-β-1,4-glucanases, xyloglucanases (EC 3.2.1.151), hydrolyzing β-1,4-D-glucosidic bonds at the unsubstituted glucose residue in the CG main chain.

The mode of action of xyloglucanases on the substrate can be endo-processive and endo-dissociative. In the first case, enzymes are randomly attached to the main chain of the CG molecule and make the first cut, after which the “building blocks” of CG (XXXG heptasaccharides, XXLG/XLXG octasaccharides and XLLG nonasaccharides - Fry classification (Fry et al. 1993)) are removed in a processive manner from the end of one of the parts of the molecule, hydrolyzing β-1,4 bonds at the unsubstituted glucose residue. Endo-dissociative xyloglucanases detach from the CG molecule after each hydrolysis event and then randomly reattach to it. As a result of the action of endoprocessive xyloglucanases on CG, the main end products of hydrolysis are the building blocks of CG (XXXG, XXLG, XLXG, and XLLG). In the course of hydrolysis by such enzymes, the total length of the polysaccharide chain, and hence the viscosity of CG solutions, decreases slowly. The end products of endo-dissociative xyloglucanases are oligoxyloglucans of various lengths, and the viscosity of solutions under the action of such enzymes decreases very quickly. Therefore, endo-dissociative xyloglucanases can be used as feed additives to reduce the viscosity of industrial substrates based on lignocellulosic biomass, as well as animal feed.

Information sources contain information about microorganisms - natural producers of xyloglucanases: Geotrichum sp. (Yaoi and Mitsuishi, 2004), Aspergillus japonicus, Chrysosporium lucknowense, Trichoderma reesei (Grishutin et al., 2004; Markov et al., 2005; Qi et al., 2013; Lopes et al., 2021), Phanerochaete chrysosporium (Ishida et al., 2007), Cellvibrio japonicus (Attia et al., 2016), Aspergillus clavatus (Damasio et al., 2014), Sporotrichum thermophile, Myceliophthora thermophila and Sporotrichum pruinosum (Krestyanova et al., 2016), Paenibacillus odorifer (Gusakov et al., 2020). Selection and radiation mutagenesis methods were used to obtain strains synthesizing increased amounts of xyloglucanases: Penicillium verruculosum (RU 2361918), Penicillium funiculosum (RU 2323254), Aspergillus aculeatus (RU 2303057). In a similar way, a highly active strain of mycelial fungus Aspergillus foetidus, a producer of a carbohydrase complex containing xyloglucanase (RU 2323973 C1), was obtained.

Also described are strains of Escherichia coli obtained by genetic engineering methods - producers of recombinant xyloglucanases from Geotrichum sp. M128 (US 2004038367; Yaoi and Mitsuishi, 2002), Fusarium graminearum (Habrylo et al., 2012), Rhizomucor miehei (Song et al., 2013), Aspergillus cervinus (RU 2625013 C1), Xanthomonas citri (Feng et al., 2014), Xanthomonas campestris (de Araujo et al., 2013). Different strains of fungi are used as recipients for the heterologous expression of fungal xyloglucanases: xyloglucanases from Malbranchea cinnamomea (US 6500658) are expressed in Aspergillus oryzae, xyloglucanase from Trichoderma reesei (US 2004067569 A1) is expressed in Fusarium venenatum, xyloglucanase from Pensillium canescenes (RU 2358756), in Aspergillus niger - xyloglucanase from Thielavia australiensis and its own xyloglucanase (WO 2014138983; Hasper et al., 2002), in Aspergillus nidulans - xyloglucanase from Aspergillus terreus (Vitcosque et al., 2016).

Also, bacterial recipients other than E. coli are used for heterologous expression of fungal xyloglucanases, for example, Acidothermus cellulolyticus is used for heterologous expression of xyloglucanases from Acremonium sp. Myceliophthora thermophila (Vlasenko et al., 2010).

Yeast strains Komagataella phaffii, obtained by genetic engineering, are also described as producers of recombinant xyloglucanases from Phanerochaete chrysosporium (Ishida et al., 2007), Aspergillus cervinus VKPM F-612 (RU 2639248 C1) and endoxyloglucanase Penicillium oxalicum (CN 104388406 A. Xian et al. , 2016). In addition, a method has been developed for microbiological synthesis in Komagataella phaffii of a thermostable recombinant xyloglucanase encoded by a synthetic gene based on the nucleotide sequence of xyloglucanase of the GH74 family from Myceliophthora thermophila VKPM F-244 (RU 2605629 C1).

Heterologous expression systems based on bacteria and microscopic fungi have their own advantages and disadvantages. The disadvantages of producer strains based on microscopic fungi of the genera Aspergillus and Penicillium include a low level of synthesis of recombinant enzymes compared to E. coli and difficulties in performing genetic manipulations on strains due to non-standardized and insufficiently developed genetic tools (Demain and Vaishnav, 2009). Methylotrophic yeasts (Pichia, Komagataella, Hansenula) are highly efficient producers of recombinant proteins. The advantage of methylotrophic yeasts is that they can be cultured in fermenters to higher densities than the traditionally used Saccharomyces cerevisiae yeasts, allowing for a higher level of target protein production (Gellissen, 2000). Methylotrophic yeasts have some of the most potent promoters in nature. Unlike E. coli, methylotrophic yeasts are capable of all post-translational modifications characteristic of eukaryotes (glycosylation, phosphorylation, formation of disulfide bonds between cysteine residues, secretion of recombinant proteins into the cultivation medium). The low level of secretion of its own proteins greatly facilitates the isolation and purification of the target recombinant product (Macauley-Patrick and Fazenda, 2005). Recombinant proteins in methylotrophic yeast, in contrast to E. coli, do not form inclusion bodies.

The closest analogue of the claimed strain is a recombinant yeast strain Komagataella phaffii VKPM Y-4933 - a producer of secreted thermostable xyloglucanase of the GH74 family from Myceliophthora thermophila VKPM F-244, encoded by the mt74sin gene integrated into the chromosome of P. pastor is under the control of the AOX1 promoter (RU 2605629, Berezina et al. 2017). The recombinant enzyme MtXgh74 is a xyloglucan-specific endo-β-1,4-glucanase with an endo-processive mode of action on the substrate. Degradation of the polymeric xyloglucan molecule occurs as a result of sequential cleavage by the enzyme MtXgh74 of the structural hepta-, octa-, and nonasaccharides of xyloglucan by hydrolysis of the β-1,4-glycosidic bond at the unsubstituted residues of the polysaccharide backbone. As a result, the MtXgh74 enzyme effectively saccharifies the substrate, producing short xyloglucan oligosaccharides, but does not effectively reduce the viscosity of xyloglucan solutions. The decrease in the dynamic viscosity of a 1% KH solution in the course of its hydrolysis with the MtXgh74 enzyme at 50°C is 1.79 mPa⋅s in terms of 0.01 μmol of the resulting reducing ends.

The closest analogue of the claimed method of microbiological synthesis of xyloglucanase is a method for the synthesis of recombinant secreted thermostable xyloglucanase MtXgh74 during the fermentation of the yeast strain Komagataella phaffii VKPM Y-4269 (RU 2605629, Berezina et al., 2017). The activity of MtXgh74 xyloglucanase at the end of fermentation in the culture liquid VKPM Y-4269 was at least 60 units/ml.

The task of the claimed group of inventions is to develop a method for the microbiological synthesis of xyloglucanase based on a recombinant strain of Komagataella phaffii, which combines a high level of production of a heterologous enzyme with an endo-dissociative mode of action on the substrate, providing an effective reduction in the viscosity of xyloglucan solutions and designed to reduce the viscosity of xyloglucan-containing substrates.

The problem is solved by:

- construction of a recombinant yeast strain Komagataella phaffii VKPM Y-4933 - a producer of secreted thermostable xyloglucanase GH74 encoded by a mutated mt74sin-mut gene corresponding to SEQ ID NO 1,

- development of a method for the microbiological synthesis of xyloglucanase based on the recombinant yeast strain Komagataella phaffii VKPM Y-4933.

The design process of the proposed strain consists of the following steps:

- construction of a mutated mt74sin-mut gene (SEQ ID NO 1) based on the nucleotide sequence of the mt74sin gene encoding a mutant variant of the GH74 family xyloglucanase from Myceliophthora thermophila VKPM F-244.

- constructing an integrative plasmid DNA (plasmid) pPIC-mt74sin-mut containing the mt74sin-mut gene, which is a mutant variant of the mt74sin xyloglucanase gene.

- construction of a recombinant yeast strain Komagataella phaffii/mt74sin-mut capable of synthesizing xyloglucanase of the GH74 family with an endo-dissociative mode of action on the substrate.

- development of a method for the microbiological synthesis of xyloglucanase based on the recombinant yeast strain Komagataella phaffii/mt74sin-mut, which combines a high level of synthesis of heterologous xyloglucanase of the GH74 family with an endo-dissociative mode of action on the substrate.

Step 1. Construction of the mutated mt74sin-mut gene based on the nucleotide sequence of the mt74sin gene integrated into the genome of the Komagataella phaffii VKPM Y-4933 strain and encoding the mutant form of MtXgh74 xyloglucanase with endo-dissociative mode of action on the substrate.

Xyloglucanase MtXgh74 is an endo-processive enzyme. To change the way the enzyme acts on the substrate from endo-processive to endo-dissociative, a mutant form of MtXgh74-mut (W324A/W325A) is constructed. The design of the mt74sin-mut nucleotide sequence is developed based on the mt74sin gene (GenBank: KY549923.1) integrated into the genome of the Komagataella phaffii VKPM Y-4933 strain and encoding MtXgh74 xyloglucanase from Myceliophthora thermophila VKPM F-244 (GenBank: ARR73955.1), (RU 2605629, Berezina et al., 2017). The introduction of mutations in the mt74syn gene was carried out by the method of overlapping PCR products (Overlap PCR) using primers and the mt74syn gene as a template. The following primers were used for mutagenesis: F_mtgh74syn_BgIII - AAGAGATCTGGTACCGCTACGGC, R_mtgh74syn_XhoI - GCCCCTCGAGTTATTAATTGGCAGC, SP_II (VATLNSAA) - TAATAGCGCTGCTCCAGATGCCCAGATT, ASP_II (VATLNSAA) - ATCTGGAGCAGCGCTATTAAGGGTAG.

The result is a DNA fragment containing the mutated mt74sin-mut gene. The correctness of the introduced mutation is confirmed by Sanger sequencing.

Step 2. Construction of the pPIC-mt74sin-mut integrative plasmid construct

Plasmid pPIC-mt74sin-mut was constructed by cloning the DNA fragment obtained in step 1 containing the mutated mt74sin-mut gene into the pPIC-101 vector designed for integration into strains of Komagataella phaffii (his 4, mut+). The 7404 base pair pPIC-101 vector contains the AOX1 promoter; terminator AOX1; the coding region of the HIS4 gene; the coding region of the bla gene, which provides resistance of E. coli strains to ampicillin; replicon pBR-322; the sequence encoding the yeast α-factor signal peptide.

The pPIC-mt74sin-mut 9285 bp plasmid, along with the pPIC-101 vector genes, contains the coding region of the mutated mt74sin-mut xyloglucanase gene under the control of the AOX1 promoter. (Fig. 2).

Stage 3. Obtaining a recombinant strain of Komagataella phajfii/mt74sin-mut

The recipient strain is Komagataella phaffii (his 4, mut+), which does not synthesize xyloglucanase. Competent cells of this strain are transformed with the plasmid pPIC-mt74sin-mut. As a result, a recombinant Komagataella phaffii/mt74sin-mut strain is obtained, capable of synthesizing xyloglucanase of the GH74 family with an endo-dissociative mode of action on the substrate.

The Komagataella phaffii/mt74sin-mut strain was deposited in the All-Russian Collection of Industrial Microorganisms as Komagataella phaffii VKPM Y-4933;

The claimed strain Komagataella phaffii VKPM Y-4933 has the following morphological and physiological-biochemical characteristics:

Morphological features

When cultivated at a temperature of 28°C for 48 hours on YPD agar medium of the following composition (wt.%):

peptone - 2

yeast extract - 1

glucose - 2

agar - 2

water is the rest.

Cells are oval, 3-4 μm in diameter; bud; budding true, many-sided; do not form true mycelium. Light beige colonies with a smooth edge, matte surface, lenticular profile and pasty consistency are formed on YPD agar medium. When growing in a liquid YPD medium at 28°C for 24 hours of cultivation, the liquid is cloudy, the precipitate is white, no coagulation is observed, and the culture does not form parietal films.

Physiological and biochemical signs

The strain is a facultative anaerobe. Growth temperature - 20-33°C (optimum - 28°C). pH of the cultivation medium - 4.8-7.4 (optimum - 6.0). The strain can use glucose, glycerol, methanol, oleate, sorbitol, rhamnose as carbon sources. Does not utilize galactose, xylose, arabinose. As nitrogen sources, the strain can use amino acids, ammonium sulphate, ammonium nitrate. The essential features of the strain is the absence of the need for histidine. The Komagataella phaffii VKPM Y-4933 strain synthesizes a recombinant secreted xyloglucanase with an endo-dissociative mode of action on the substrate.

The method of microbiological synthesis of xyloglucanase in general

The inoculum, which is the cells of a recombinant producer strain, is prepared by incubation for 15-24 hours at a temperature of 29°C on YPD medium with constant aeration on a thermostatically controlled shaker (250 rpm). Then the grown culture is transferred in a ratio of 1:200 (by volume) to the YPgM medium of the following composition (wt.%):

peptone - 2

yeast extract - 1

glycerin 0.5

methanol - 0.5

water is the rest.

The process of biosynthesis is carried out in Erlenmeyer flasks containing 100 ml of YPgM medium, for 62 hours in a rotary shaker-thermostat (250 rpm), at a temperature of 28°C. Every 24 hours, an induction with methanol is carried out by aseptically adding a 50% methanol solution to the tubes, to a final concentration of 0.5%. After 62 hours, the biomass is separated by centrifugation. The presence of recombinant xyloglucanase in the culture medium is determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate followed by a zymogram (Maniatis et al., 1984). Quantification of the specific activity of recombinant xyloglucanase is carried out using the DNS method (Miller, 1959).

The level of synthesis of xyloglucanase by the claimed method is not less than 60 U/ml of culture fluid, which is comparable to the closest analogue.

The invention is illustrated by the following figures of graphic images:

Fig. 1 - Diagram of pPIC-101 plasmid DNA. Plasmid vector pPIC-101: AOX1 promoter; terminator AOX1; HIS4 gene; the bla gene conferring resistance to ampicillin (ApR).

Fig. 2 - Scheme of recombinant plasmid DNA pPIC-mt74sin-mut. Plasmid vector pPIC-mt74sin-mut: AOX1 promoter; terminator AOX1; HIS4 gene; the bla gene conferring resistance to ampicillin (ApR); mt74syn-mut.

Example 1 Construction of pPIC-mt74sin-mut recombinant plasmid DNA containing the synthetic mt74sin-mut gene encoding the GH74 family xyloglucanase with endo-dissociative mode of action on the substrate

All standard genetic engineering and microbiological manipulations are carried out according to known methods (Maniatis et al., 1984).

Synthetic gene mt74sin-mut (SEQ ID NO 1) is obtained by introducing mutations in the gene mt74syn method of overlapping PCR products.

The pPIC-mt74sin-mut plasmid was constructed by cloning a fragment containing the mt74sin-mut gene into the pPIC-101 integrative vector (FIG. 1).

Hydrolysis of plasmid pPIC-101 and a DNA fragment containing the mt74sin-mut gene was carried out with BglII and XhoI restrictases (Fermentas, Latvia). The reaction mixture was purified with a kit for DNA isolation from reaction mixtures (Biosilika, Russia) according to the manufacturer's instructions. Ligation is carried out in a 20 μl reaction mixture containing 20 ng of vector DNA, 1.5 ng of DNA fragment, and 5 units. T4 DNA ligase (Fermentas, Latvia), according to the manufacturer's method. Competent cells of E. coli XL1 blue MRF' strain (Stratagene, USA) (genotype - Δ(mcrΔ)183 Δ(mcrCB-hsdSMR-mrr)173 end A1 supE44 thi-1 recA1 gyrA96 relA1 lac [F'proAB lacIqZΔM15 Tn10 (Tetr)]). Plasmid DNA obtained transformants analyzed by digestion with restrictases BglII and XhoI. As a result, clones containing BglII/XhoI fragments with a size equal to the original fragment of the insert are selected. The correctness of cloning is confirmed by sequencing each of the recombinant inserts by the Sanger method on an ABI 3500 genetic analyzer (Life technology, USA). As a result, a recombinant plasmid pPIC-mt74sin-mut with a size of 9285 base pairs is obtained, which, along with the genes of the pPIC-101 vector, also contains a mutated mt74sin-mut gene encoding a secreted xyloglucanase of the GH74 family with an endo-dissociative mode of action on the substrate (SEQ ID NO 2) (Fig. 2).

Example 2. Obtaining the claimed strain Komagataella phaffii VKPM Y-4933 - producer of endo-dissociative xyloglucanase of the GH74 family

In order to obtain a recombinant strain of Komagataella phaffii VKPM Y-4933, a xyloglucanase producer, cells of the Komagataella phaffii GS115 (his 4, mut+) (Invitrogen) strain were transformed with the plasmid pPIC-mt74sin-mut. Transformation is carried out with 5 mg of linearized plasmid DNA, to obtain which the original plasmid is treated with restriction endonuclease MluI.

The culture of yeast strain Komagataella phaffii GS115 (his 4, mut+) is grown on YPD medium, under aerobic conditions (250 rpm) to an optical density of 1-2 units. Biomass cells separated by centrifugation at 3000g for 5 minutes are resuspended in a buffer containing 1 mM dithiothreitol and 100 mM HEPES, then incubated on a shaker for 30 minutes and, after washing twice with cold deionized water, resuspended in 1 ml of 1 M sorbitol. The suspension is divided into aliquots of 40 μl. Electroporation is carried out on a GenePulser Xcell (Biorad) in cuvettes with a gap of 2 mm at 1500 V, 25 μF, 600 Ohm. After electroporation, 1 ml of a cold solution of 1 M sorbitol is quickly added, incubated for 1 hour at 30°C, and plated on a selective medium for selection of transformants. The selection of transformants is carried out on the minimum medium M9 containing (wt.%):

KN ₂ RO ₄ - 0.1

MgSO ₄ - 0.05

NaCl - 0.01

CaCl ₂ - 0.01

(NH4) ₂ SO4 - 0.35

glucose - 2

thiamine - 0.02

riboflavin - 0.02

nicotinic acid - 0.02

p-aminobenzoic acid - 0.02

calcium pantothenate - 0.02

biotin - 0.0002

pyridoxine - 0.02

inositol - 1

folic acid - 0.02

water is the rest.

Cells are incubated at 29°C for 3 days. Transformants are detected by PCR screening. The result is the claimed strain Komagataella phaffii VKPM Y-4933, which produces a secreted xyloglucanase with an endo-dissociative mode of action on the substrate.

Example 3. Microbiological synthesis of thermostable secreted xyloglucanase by the claimed strain Komagataella phaffii VKPM Y-4933

The inoculum is grown by incubating the cells of the strain Komagataella phaffii VKPM Y-4933 for 15-24 hours at a temperature of 29°C on YPD medium with constant aeration (250 rpm). The YPgM medium is inoculated with the prepared inoculum and the biosynthesis process is carried out under aerobic conditions at a temperature of 28°C, by induction with methanol.

The level of synthesis of xyloglucanase by the claimed method is not less than 60 U/ml, which is comparable to that of the closest analogue - Komagataella phaffii strain VKPM Y-4269. When the enzyme preparation is incubated for an hour at 50°C, pH 5.0, 100% of enzymatic activity is retained, which is not inferior to the closest analogue.

The end products of CG hydrolysis by the MtXgh74-mut enzyme are oligoxyloglucans of various lengths, while the end products of CG hydrolysis with the closest analog of MtXgh74 are the building blocks of CG (XXXG, XXLG, XLXG, and XLLG).

The kinetic constants V _max and k _cat for MtXgh74-mut are 76 U/mg protein and 97 s ^-1 , which exceeds the data for the closest analogue, MtXgh74 xyloglucanase (44 U/mg protein and 56 s ^-1 , respectively). The kinetic constant K _m for MtXgh74-mut and the closest analog MtXgh74 is 24 and 0.45 mg Kg/mL, respectively, which explains the difference in the way the enzymes act on the substrate: endo-dissociative for MtXgh74-mut and endo-processive for MtXgh74.

The decrease in the dynamic viscosity of a 1% solution of CG during its hydrolysis with endo-dissociative xyloglucanase MtXgh74-mut at 50°C is 3.55 mPa⋅s in terms of 0.01 µmol of the resulting reducing ends, which is two times higher than this value for the closest analogue - endo-processive xyloglucanase MtXgh74 (1.79 mPa⋅s in terms of 0.01 μmol of the formed reducing ends).

Thus, a recombinant yeast strain Komagataella phaffii VKPM Y-4933 was obtained, capable of biosynthesis of the secreted endo-dissociative xyloglucanase of the GH74 family encoded by the mutated gene. When cultivated by the claimed method, the level of synthesis of the target product in the claimed strain is comparable to that of the closest analogue, but unlike the closest analogue, the produced enzyme is an endo-dissociative xyloglucanase and effectively reduces the viscosity of xyloglucan solutions.

Information sources

1. Berezina OV, Herlet J, Rykov SV, Kornberger P, Zavyalov A, Kozlov D, Sakhibgaraeva L, Krestyanova I, Schwarz WH, Zverlov VV, Liebl W, Yarotsky SV. Thermostable multifunctional GH74 xyloglucanase from Myceliophthora thermophila: high-level expression in Komagataella phaffii and characterization of the recombinant protein. Appl Microbiol Biotechnol. 2017 Jun; 101(14): 5653-5666. doi: 10.1007/s00253-017-8297-2.

2. RU 2605629 // Recombinant yeast strain Komagataella phaffii - producer of secreted thermostable xyloglucanase encoded by a synthetic gene, and method for microbiological synthesis of secreted thermostable xyloglucanase based on this strain // Priority date: 12/16/2015.

3. Maniatis T., Fritsch E., Sambrook J., Molecular cloning, M.: Mir, 1984; DNA cloning. Methods. Ed. D. Glover, Trans. from English, Moscow, Mir, 1988.

4. Fry SC, York WS, Albersheim P, Darvill A, Hayashi T, Joseleau JP, Kato Y, Laurences EP, Maclachlan GA, McNeil M, Mort AJ, Reid JSG, Seitz HU, Selvendran RR, Voragen AGJ, White AR ( 1993) An unambiguous nomenclature for xyloglucan-derived oligosaccharides. Physiol Plant, 89(1): 1-3. doi: 10.1111/j.1399-3054.1993.tb01778.x.

5. Demain AL, Vaishnav P. // Production of recombinant proteins by microbes and higher organisms // Biotechnol Adv., 2009.

6. Grishutin S.G., Gusakov A.V., Markov A.V., Ustinov B.B., Semenova M.V., Sinitsyn A.P. // Specific xyloglucanases as a new class of polysaccharide-degrading enzymes.// Biochim Biophys Acta, 2004.

7. Habrylo O., Song X., Forster A., Jeltsch J.M., Phalip V. // Characterization of the four GH12 Endoxylanases from the plant pathogen Fusarium graminearum. // J. Microbiol Biotechnol., 2012.

8. Hasper A.A., Dekkers E., van Mil M., van de Vondervoort P.J., de Graaff L.H. // EglC, a new endoglucanase from Aspergillus niger with major activity towards xyloglucan. // Appl Environ Microbiol., 2002.

9. Ishida T., Yaoi K., Hiyoshi A., Igarashi K., Samejima M. // Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium. // FEBS J., 2007.

10. Markov A.V., Gusakov A.V., Kondratyeva E.G., Okunev O.N., Bekkarevich A.O., Sinitsyn A.P. // New effective method for analysis of the component composition of enzyme complexes from Trichoderma reesei. // Biochemistry (Mosc), 2005.

11. Miller, G.L. // Use of dinitrosalicylic acid reagent for determination of reducing sugar // Analytical Chemistry. 1959.

12. Qi H., Bai F., Liu A.// Purification and characteristics of xyloglucanase and five other cellulolytic enzymes from Trichoderma reesei QM9414. // Biochemistry (Mosc), 2013.

13. Yaoi K., Mitsuishi Y.// Purification, characterization, cloning, and expression of a novel xyloglucan-specific glycosidase, oligoxyloglucan reducing end-specific cellobiohydrolase.// J Biol Chem., 2002.

14. Yaoi K., Mitsuishi Y. // Purification, characterization, cDNA cloning, and expression of a xyloglucan endoglucanase from Geotrichum sp. M128. // FEBS Lett., 2004.

15. Song S., Tang Y., Yang S., Yan Q., Zhou P., Jiang Z. // Characterization of two novel family 12 xyloglucanases from the thermophilic Rhizomucor miehei. // Appl Microbiol Biotechnol., 2013.

M., Cherry J., Xu F. // Substrate specificity of family 5, 6, 7, 9, 12, and 45 endoglucanases. // Bioresour Technol., 2010.16. Vlasenko E.,

M., Cherry J., Xu F. // Substrate specificity of family 5, 6, 7, 9, 12, and 45 endoglucanases. // Bioresour Technol., 2010.

17. Macauley-Patrick S, Fazenda ML (2005) Heterologous protein production using the Komagataella phaffii expression system. Yeast 22: 249-270.

18. Gellissen G (2000) Heterologous protein production in methylotrophic yeasts. Appl. microbiol. Biotechnol. 54(6): 741-750.

19. RU 2358756 // Method for obtaining an enzyme preparation for the cleavage of hemicellulose heteropolysaccharides of the plant cell wall and an enzyme preparation (options) // Priority date: 26.11.2007.

20. RU 2303057 // Strain of mycelial fungus Aspergillus aculeatus - producer of carbohydrase complex containing xylanases, beta-glucanases, pectinases and xyloglucanases // Priority date: 11/14/2005.

21. RU 2323254 // Strain of the filamentous fungus Penicillium funiculosum - producer of a complex of carbohydrases containing cellulases, glucanases, glucosidases, xylanases and xyloglucanases, and a method for obtaining an enzyme preparation of the carbohydrase complex for saccharification of lignocellulosic materials // Priority date: 04.04.2006.

22. RU 2361918 // A strain of mycelial fungus Penicillium verruculosum - a producer of a complex of cellulases, xylanase and xyloglucanase and a method for obtaining an enzyme preparation of a complex of cellulases, xylanase and xyloglucanase for the hydrolysis of cellulose and hemicellulose // Priority date: 26.02.2008.

23. US 6500658 // Xyloglucanase from Malbranchea // Priority date: US 20000653778 20000901; WO 2000DK00450 20000811; US 19990149397 P 19990817.

24. US 2004038367 // Novel xyloglucan oligosaccharide-degrading enzyme, polynucleotide encoding the enzyme, and method of preparing the enzyme // Priority date: JP 20020083433 20020325.

25. US 2004067569 A1 // Polypeptides having xyloglucanase activity and nucleic acids encoding same // Priority date: US 20030420191 20030418; US20020373987 P20020419.

26. WO 2014138983 A1 // Novel cell wall deconstruction enzymes of Malbranchea cinnamomea, Thielavia australiensis, and Paecilomyces byssochlamydoides, and uses thereof // Priority date: US 201361783222 P 20130314; US201361783313 P20130314; US201361783485 P20130314.

--->

Sequence listing

<110> Federal State Budgetary Institution "State

Research Institute of Genetics and Selection of Industrial

microorganisms of the National Research Center

"Kurchatov Institute"

<120> Recombinant yeast strain Komagataella phaffii - producer

secreted endo-dissociative xyloglucanase of the GH74 family,

encoded by a mutated gene, and a method for microbiological synthesis

secreted endo-dissociative xyloglucanase based on this strain

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 2336

<212> DNA

<213> Artificial sequence: mt74syn-mut

<220>

<221> gene

<222> (37)..(2242)

<223> mt74syn-mut

<400> 1

agtgcaccaa ttggtcgacc tcgagttaat taacgtaaga tctggtaccg ctacggcttg 60

gaagaatgtc aacattggag gcggtggtgg ttttgtccca ggtataatct ttcaccctaa 120

agagaagggt gttgcctatg ctagaactga cataggaggc ttgtacagac tgaacccaga 180

tgatgactct tggacaccat tgacggataa tttgggcact aatgagaagt ggggaagatg 240

gggtattgac gcagttgcag ttgatccgca agatgctgac agagtctacg ctgctgtagg 300

catgtataca aacgattggg accccaatcc aggctctatt atccgtagtt ctgatcgagg 360

agctacatgg gaggttaccg aattaccctt caaagtggga ggtaatatgc ctggaagagg 420

tatgggtgag agattggctg tagatcctgc caacagtgac atcttgttct ttggtgctag 480

gtctggtaat ggtctgtgga agtctgcaga cggaggtgtt acttgggcaa gagtagaatc 540

cttcaccaat gtcggaactt atgctcctga cccatctgat gctaccggtt tgaactctga 600

660

ttcccgtata tttgtcggta ctgcagacaa caagactgca tcggtttacg tttccgagga 720

tgctggagcc acatggaaac cagtagaagg acaaccaggt gcattctttc ctcacaaatg 780

cgtgttgcaa ccagaggaaa aggccctata tctatcctat tctaatggag ctggccctta 840

tgacggaacg ttgggagctg tctaccgata cgatttggct gcacgaacct ggacggacat 900

cacaccagct tcaggagggg acctttactt tgggttcggt ggactatcag ttgacttgag 960

gaaacccggt actcttatgg tagctaccct taatagctgg tggccagatg cccagattta 1020

1080

tgtacacaga caaagcccct tggataaacg ccggtttcat 1140

ctctcaggac acccacatga tgggttggat gattgaggca ttagagattg acccacatga 1200

ttccgatcac tggctatatg gcaccggtct aactttgtat ggtggtcatg accttaccaa 1260

atgggataca gttacaagga acgttactat ttccagcctt gctgctggaa ttgaagaaat 1320

ggctgtctta ggcttagcat ctccacctaa tggaagtgaa ctgctggctg ctgttggtga 1380

tgactgtgga ttcacttttc gtgaatctca ggatttaggt acgtcaccgc aaaccccttg 1440

gatgaatcct atttggactt caactactga tgtggattat gccggaaacg aacccgacca 1500

tgttgtgaga gtcggtaatt ctcaaggtgc acctcaagta gctgtttcgg aagatggtgg 1560

agtaacttgg tcagcacatc caggggcaga cgggaccacc aacagtggaa ctttagcata 1620

ttcagccgat gccgatacta tcgtctggag ttcaggttcc gcaggggtgc tgaggtccca 1680

aaaccaggga gcttttgctg ctgtcgggtc tttgccaagc ggcgccacag tggctgccga 1740

tagaagaaat aacacagtct tttacgctgc aagtggagct tccttttaca gatccactga 1800

cactggcgcc acatttgcca aagttgccag cgcctttgga tcgaaggttg ccgctgtcaa 1860

ggctattgct gcacatcccg tggttgctgg agaagtatgg gttgccactg acgctggatt 1920

gttccgttcc atcgattatg gggccacttt ctctgctgct tctggttcca ttaccgatgc 1980

aattcaggtg tctttaggaa aaggagatgg ttcagcttgg aacgtgtacg tatttgggac 2040

cggtcctgaa gggaccaagt tgtatgcaag cgctgatgaa ggtgccacat gggtggatat 2100

ccaaggagag cagggcttcg gttctttgtc agctaacaga cttgttggtt caggaaatgt 2160

ggctggtcaa gtctacgttg gcacaaatgg tagaggtgtt ttctatgcaa aggttagtct 2220

ttctgctgct gccaattaat aactcgaggt gggcgatcgc tctagagcta gcgaattcct 2280

gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag cataaa 2336

//

<210> 2

<211> 9285

<212> DNA

<213> Artificial sequence: pPIC-mt74sin-mut

<220>

<221> promoter

<222> (6100)..( 6834)

<223> AOX1

<224> gene

<225> (585)..(3119)

<226> HIS4, complement

<227> terminator

<228> (6)..( 356)

<229>AOX1ter

<230> gene

<231> (4627)..( 5487)

<232> ApR, complement

<233> gene

<234> (7071)..( 9284)

<235> mt74sin-mut, complement

<400> 1

tcgaggggcc gcgaattaat tcgccttaga catgactgtt cctcagttca agttgggcac 60

ttacgagaag accggtcttg ctagattcta atcaagagga tgtcagaatg ccatttgcct 120

gagagatgca ggcttcattt ttgatacttt tttatttgta acctatatag tataggattt 180

tttttgtcat tttgtttctt ctcgtacgag cttgctcctg atcagcctat ctcgcagctg 240

atgaatatct tgtggtaggg gtttgggaaa atcattcgag tttgatgttt ttcttggtat 300

ttcccactcc tcttcagagt acagaagatt aagtgagaag ttcgtttgtg caagctatcg 360

tccattccga cagcatcgcc agtcactatg gcgtgctgct agcgctatat gcgttgatgc 420

aatttctatg cgcacccgtt ctcggagcac tgtccgaccg ctttggccgc cgcccagtcc 480

tgctcgcttc gctacttgga gccactatcg actacgcgat catggcgacc acacccgtcc 540

tgtggatcta tcgaatctaa atgtaagtta aaatctctaa ataattaaat aagtcccagt 600

ttctccatac gaaccttaac agcattgcgg tgagcatcta gaccttcaac agcagccaga 660

tccatcactg cttggccaat atgtttcagt ccctcaggag ttacgtcttg tgaagtgatg 720

aacttctgga aggttgcagt gttaactccg ctgtattgac gggcatatcc gtacgttggc 780

aaagtgtggt tggtaccgga ggagtaatct ccacaactct ctggagagta ggcaccaaca 840

aacacagatc cagcgtgttg tacttgatca acataagaag aagcattctc gatttgcagg 900

atcaagtgtt caggagcgta ctgattggac atttccaaag cctgctcgta ggttgcaacc 960

gatagggttg tagagtgtgc aatacacttg cgtacaattt caacccttgg caactgcaca 1020

gcttggttgt gaacagcatc ttcaattctg gcaagctcct tgtctgtcat atcgacagcc 1080

aacagaatca cctgggaatc aataccatgt tcagcttgag acagaaggtc tgaggcaacg 1140

aaatctggat cagcgtattt atcagcaata actagaactt cagaaggccc agcaggcatg 1200

tcaatactac acagggctga tgtgtcattt tgaaccatca tcttggcagc agtaacgaac 1260

tggtttcctg gaccaaatat tttgtcacac ttaggaacag tttctgttcc gtaagccata 1320

gcagctactg cctgggcgcc tcctgctagc acgatacact tagcaccaac cttgtgggca 1380

acgtagatga cttctggggt aagggtacca tccttcttag gtggagatgc aaaaacaatt 1440

tctttgcaac cagcaacttt ggcaggaaca cccagcatca gggaagtgga aggcagaatt 1500

gcggttccac caggaatata gaggccaact ttctcaatag gtcttgcaaa acgagagcag 1560

actacaccag ggcaagtctc aacttgcaac gtctccgtta gttgagcttc atggaatttc 1620

ctgacgttat ctatagagag atcaatggct ctcttaacgt tatctggcaa ttgcataagt 1680

tcctctggga aaggagcttc taacacaggt gtcttcaaag cgactccatc aaacttggca 1740

1800

aattccataa tctgttccgt ttttctggata ggacgacgaa gggcatcttc aatttcttgt 1860

gaggaggcct tagaaacgtc aattttgcac aattcaatac gaccttcaga agggacttct 1920

ttaggtttgg attcttcttt aggttgttcc ttggtgtatc ctggcttggc atctcctttc 1980

cttctagtga cctttaggga cttcatatcc aggtttctct ccacctcgtc caacgtcaca 2040

ccgtacttgg cacatctaac taatgcaaaa taaaataagt cagcacattc ccaggctata 2100

tcttccttgg atttagcttc tgcaagttca tcagcttcct ccctaatttt agcgttcaac 2160

aaaacttcgt cgtcaaataa ccgtttggta taagaacctt ctggagcatt gctcttacga 2220

tcccacaagg tggcttccat ggctctaaga ccctttgatt ggccaaaaca ggaagtgcgt 2280

tccaagtgac agaaaccaac acctgtttgt tcaaccacaa atttcaagca gtctccatca 2340

caatccaatt cgatacccag caacttttga gttcgtccag atgtagcacc tttataccac 2400

aaaccgtgac gacgagattg gtagactcca gtttgtgtcc ttatagcctc cggaatagac 2460

tttttggacg agtacaccag gcccaacgag taattagaag agtcagccac caaagtagtg 2520

aatagaccat cggggcggtc agtagtcaaa gacgccaaca aaatttcact gacagggaac 2580

tttttgacat cttcagaaag ttcgtattca gtagtcaatt gccgagcatc aataatgggg 2640

attataccag aagcaacagt ggaagtcaca tctaccaact ttgcggtctc agaaaaagca 2700

taaacagttc tactaccgcc attagtgaaa cttttcaaat cgcccagtgg agaagaaaaa 2760

ggcacagcga tactagcatt agcgggcaag gatgcaactt tatcaaccag ggtcctatag 2820

ataaccctag cgcctgggat catcctttgg acaactcttt ctgccaaatc taggtccaaa 2880

atcacttcat tgataccatt attgtacaac ttgagcaagt tgtcgatcag ctcctcaaat 2940

tggtcctctg taacggatga ctcaacttgc acattaactt gaagctcagt cgattgagtg 3000

aacttgatca ggttgtgcag ctggtcagca gcatagggaa acacggcttt tcctaccaaa 3060

ctcaaggaat tatcaaactc tgcaacactt gcgtatgcag gtagcaaggg aaatgtcata 3120

gtagtcttga gaaattctga agccgtattt ttattatcag 3180

tgagtcagtc atcaggagat cctctacgcc ggacgcatcg tggccggcat caccggcgat 3240

ctaacatcca aagacgaaag gttgaatgaa acctttttgc catccgacat ccacaggtcc 3300

attctcacac ataagtgcca aacgcaacag gaggggatac actagcagca gaccgttgca 3360

aacgcaggac ctccactcct cttctcctca acacccactt ttgccatcga aaaaccagcc 3420

cagttattgg gcttgattgg cacgcgtgag cttggcgtaa tcatggtcat agctgtttcc 3480

3540

taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc 3600

cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 3660

gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 3720

ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 3780

agaatcaggg gtaacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 3840

ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 3900

caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 3960

gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 4020

cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 4080

tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 4140

gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 4200

cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 4260

tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 4320

tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 4380

caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 4440

aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 4500

cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 4560

ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 4620

tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 4680

atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 4740

tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 4800

aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 4860

catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 4920

gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 4980

ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 5040

aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 5100

atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 5160

cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 5220

gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 5280

agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 5340

gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 5400

caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 5460

ggcgacacgg aaatgttgaa tactcatact cttcctttttt caatattatt gaagcattta 5520

tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 5580

aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat 5640

catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 5700

tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 5760

agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 5820

gggctggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg 5880

tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgccatt cgccattcag 5940

gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc 6000

6060

acgttgtaaa acgacggcca gtgaattaat tcacgcgtgc gctcattcca attccttcta 6120

ttaggctact aacaccatga ctttattagc ctgtctatcc tggcccccct ggcgaggttc 6180

atgtttgttt atttccgaat gcaacaagct ccgcattaca cccgaacatc actccagatg 6240

agggctttct gagtgtgggg tcaaatagtt tcatgttccc caaatggccc aaaactgaca 6300

6360

agtttggttc gttgaaatgc taacggccag ttggtcaaaa agaaacttcc aaaagtcgcc 6420

ataccgtttg tcttgtttgg tattgattga cgaatgctca aaaataatct cattaatgct 6480

tagcgcagtc tctctatcgc ttctgaaccc cggtgcacct gtgccgaaac gcaaatgggg 6540

aaacacccgc ttttggatg attatgcatt gtctccacat tgtatgcttc caagattctg 6600

gtgggaatac tgctgatagc ctaacgttca tgatcaaaat ttaactgttc taacccctac 6660

ttgacagcaa tatataaaca gaaggaagct gccctgtctt aaaccttttt ttttatcatc 6720

attattagct tactttcata attgcgactg gttccaattg acaagctttt gattttaacg 6780

acttttaacg acaacttgag aagatcaaaa aacaactaat tattcgaagg atcaaaatga 6840

gattgttact gttgctgtta ttgctgttgc ctgcagcatt aggtgctcca gtcaacacta 6900

caacagaaga tgaaacggca caaattccgg ctgaagctgt catcggttac tcagatttag 6960

aaggggattt cgatgttgct gttttgccat tttccaacag cacaaataac gggtttattgt 7020

ttataaatac tactattgcc agcattgctg ctaaagaaga aggggtatcc atggaaaaga 7080

gatctggtac cgctacggct tggaagaatg tcaacattgg aggcggtggt ggttttgtcc 7140

caggtataat ctttcaccct aaagagaagg gtgttgccta tgctagaact gacataggag 7200

gcttgtacag actgaaccca gatgatgact cttggacacc attgacggat aatttgggca 7260

ctaatgagaa gtggggaaga tggggtattg acgcagttgc agttgatccg caagatgctg 7320

acagagtcta cgctgctgta ggcatgtata caaacgattg ggaccccaat ccaggctcta 7380

ttatccgtag ttctgatcga ggagctacat gggaggttac cgaattaccc ttcaaagtgg 7440

gaggtaatat gcctggaaga ggtatgggtg agagattggc tgtagatcct gccaacagtg 7500

acatcttgtt ctttggtgct aggtctggta atggtctgtg gaagtctgca gacggaggtg 7560

ttacttgggc aagagtagaa tccttcacca atgtcggaac ttatgctcct gacccatctg 7620

atgctaccgg tttgaactct gacttgatag gtctgacttt tgttaccttc gattcgactt 7680

caaacgttgt tggtggagca acttcccgta tatttgtcgg tactgcagac aacaagactg 7740

catcggttta cgtttccgag gatgctggag ccacatggaa accagtagaa ggacaaccag 7800

gtgcattctt tcctcacaaa tgcgtgttgc aaccagagga aaaggcccta tatctatcct 7860

attctaatgg agctggccct tatgacggaa cgttgggagc tgtctaccga tacgatttgg 7920

ctgcacgaac ctggacggac atcacaccag cttcaggagg ggacctttac tttgggttcg 7980

gtggactatc agttgacttg aggaaacccg gtactcttat ggtagctacc cttaatagct 8040

ggtggccaga tgcccagatt tacagaagta cggattcggg cgccacatgg agtaagattt 8100

gggagtgggc tgcttacccg gatatgaact ggtactacgg tttgtacaca gacaaagccc 8160

cttggataaa cgccggtttc atctctcagg acaccaaaag actgggttgg atgattgagg 8220

cattagagat tgacccacat gattccgatc actggctata tggcaccggt ctaactttgt 8280

atggtggtca tgaccttacc aaatgggata cagttacaag gaacgttact atttccagcc 8340

ttgctgctgg aattgaagaa atggctgtct taggcttagc atctccacct aatggaagtg 8400

aactgctggc tgctgttggt gatgactgtg gattcacttt tcgtgaatct caggatttag 8460

gtacgtcacc gcaaacccct tggatgaatc ctatttggac ttcaactact gatgtggatt 8520

atgccggaaa cgaacccgac catgttgtga gagtcggtaa ttctcaaggt gcacctcaag 8580

tagctgtttc ggaagatggt ggagtaactt ggtcagcaca tccaggggca gacgggacca 8640

ccaacagtgg aactttagca tattcagccg atgccgatac tatcgtctgg agttcaggtt 8700

ccgcaggggt gctgaggtcc caaaaccagg gagcttttgc tgctgtcggg tctttgccaa 8760

gcggcgccac agtggctgcc gatagaagaa ataacacagt cttttacgct gcaagtggag 8820

cttcctttta cagatccact gacactggcg ccacatttgc caaagttgcc agcgcctttg 8880

gatcgaaggt tgccgctgtc aaggctattg ctgcacatcc cgtggttgct ggagaagtat 8940

gggttgccac tgacgctgga ttgttccgtt ccatcgatta tggggccact ttctctgctg 9000

cttctggttc cattaccgat gcaattcagg tgtctttagg aaaaggagat ggttcagctt 9060

ggaacgtgta cgtatttggg accggtcctg aagggaccaa gttgtatgca agcgctgatg 9120

aaggtgccac atgggtggat atccaaggag agcagggctt cggttctttg tcagctaaca 9180

gacttgttgg ttcaggaaat gtggctggtc aagtctacgt tggcacaaat ggtagaggtg 9240

ttttctatgc aaaggttagt ctttctgctg ctgccaatta ataac 9285

//

<---

Claims (2)

1. Recombinant yeast strain Komagataella phaffii VKPM Y-4933 is a producer of secreted endo-dissociative xyloglucanase of the GH74 family encoded by the mutant gene corresponding to SEQ ID NO 1. 2. A method for the microbiological synthesis of xyloglucanase, which involves the cultivation of recombinant microorganisms containing the xyloglucanase gene under aerobic conditions in a nutrient medium, including sources of carbon, nitrogen and mineral additives until the maximum accumulation of the target product, characterized in that a recombinant strain according to claim 1 is used as a producer. one.

Images