CN101194015B - Polypeptides having glucoamylase activity and polynucleotides encoding same - Google Patents

Polypeptides having glucoamylase activity and polynucleotides encoding same Download PDF

Info

Publication number
CN101194015B
CN101194015B CN2005800443174A CN200580044317A CN101194015B CN 101194015 B CN101194015 B CN 101194015B CN 2005800443174 A CN2005800443174 A CN 2005800443174A CN 200580044317 A CN200580044317 A CN 200580044317A CN 101194015 B CN101194015 B CN 101194015B
Authority
CN
China
Prior art keywords
seq
polypeptide
glucoamylase
sequence
amylase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN2005800443174A
Other languages
Chinese (zh)
Other versions
CN101194015A (en
Inventor
宇田川裕晃
萨拉·兰德维克
井原美智子
刘继银
宋子良
埃里克·阿兰
福山志朗
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novo Nordisk AS
Novozymes North America Inc
Original Assignee
Novo Nordisk AS
Novozymes North America Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk AS, Novozymes North America Inc filed Critical Novo Nordisk AS
Priority claimed from PCT/US2005/046724 external-priority patent/WO2006069289A2/en
Publication of CN101194015A publication Critical patent/CN101194015A/en
Application granted granted Critical
Publication of CN101194015B publication Critical patent/CN101194015B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases
    • C12N9/2414—Alpha-amylase (3.2.1.1.)
    • C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
    • C12N9/242—Fungal source
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases
    • C12N9/2428—Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01001—Alpha-amylase (3.2.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01003—Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to polypeptides having glucoamylase activity and isolated polynucleotides encoding said polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides. The invention also relates to the composition comprising a glucoamylase of the invention as well as the use such compositions for starch conversion processes, brewing, including processes for producing fermentation products or syrups.

Description

Polynucleotide with the polypeptide of glucoamylase activity and this polypeptide of encoding
The cross reference of related application
The application requires on December 22nd, 2004 and the provisional application 60/638,614 of submission on February 7th, 2005 and 60/650,612 rights and interests according to 35U.S.C.119, incorporates this paper at this content quotation with above-mentioned application.
The cross reference of sequence table
The application comprises the sequence table of computer-reader form.At this, this computer-reader form is quoted and incorporated into this paper.
Background of invention
Invention field
The present invention relates to have the polynucleotide of the polypeptide of glucoamylase activity and these polypeptide of encoding.The present invention also relates to comprise nucleic acid construct, carrier and the host cell of these polynucleotide, and the method that produces and use described polypeptide, also relate to glucoamylase of the present invention and transform to produce tunning for starch, ethanol for example, and syrup (syrups), for example purposes of glucose.The invention still further relates to the composition that comprises glucoamylase of the present invention.
Description of Related Art
Glucoamylase (Isosorbide-5-Nitrae-α-D-dextran glucose hydrolysis enzyme (Isosorbide-5-Nitrae-α-D-glucanglucohydrolase), be EC3.2.1.3) that a kind of catalysis discharges the enzyme of D-Glucose from the non-reducing end of starch or relevant widow/polysaccharide molecule.Glucoamylase is produced by some filamentous fungus and yeast, and wherein the glucoamylase from aspergillus is most important on industry.
On industry, it has been the starchiness material of glucose by the α-amylase partial hydrolysis that glucoamylase is used for transforming.Subsequently, use fermenting organism, glucose directly or indirectly can be converted into tunning.The example of the tunning on industry comprises alcohol (for example, ethanol, methyl alcohol, butanols, 1,3-PD); Organic acid (as, citric acid, acetic acid, methylene-succinic acid, lactic acid, glyconic acid (gluconic acid), gluconate or carbamyl phosphate (gluconate), lactic acid, succsinic acid, 2,5-diketone-glyconic acid); Ketone (as acetone); Amino acid (as L-glutamic acid); Gas is (as H 2And CO 2) and more complicated compound, for example comprise, microbiotic (as, penicillin and tsiklomitsin); Enzyme; VITAMIN (as, riboflavin, B 12, β-carotene); Hormone, and other is difficult to the synthetic compound of producing.Fermentation process be usually used in consuming alcohols (as, beer and grape wine), milk-product (as, the production of yogurt and cheese), leather and tobacco industry.
End product can be also syrup.For example, end product can be glucose, but also can be converted into fructose by for example glucose isomerase, or the mixture that almost is comprised of the glucose that equates and fructose.This mixture, or more enrichment the mixture of fructose, be the most frequently used high-fructose corn syrup (highfructose corn syrup, HFCS), commercialization in the world.
Boel etc., (1984), EMBO is (5) J.3, p.1097-1102 disclosed aspergillus niger (Aspergillusniger) G1 or G2 glucoamylase.
United States Patent (USP) 4,727,046 has disclosed the glucoamylase that is derived from sieve ear photovoltaicing leather bacteria (Corticium rolfsii), and this bacterium claims again Athelia rolfsii.
WO84/02921 has disclosed the glucoamylase that is derived from Aspergillus awamori (Aspergillus awamori).
WO99/28248 has disclosed the glucoamylase that is derived from Talaromyces emersonii (Talaromyces emersonii).
WO00/75296 has disclosed the glucoamylase that is derived from scab shape thermophilic ascomycete (Thermoascus crustaceus).
One of purpose of the present invention is to provide the polypeptide with glucoamylase activity and the polynucleotide of encoding this polypeptide, it provides high yield in the tunning production process, for example in ethanol production process, comprise the step ethanol fermentation process that life (raw) (or not boiling (the uncooked)) starch from ungelatinized begins.
Summary of the invention
The present invention relates to be selected from the following polypeptide with glucoamylase activity:
(a) have the polypeptide of following aminoacid sequence, the mature polypeptide amino acid that this sequence and SEQ ID NO:2 are the 1st to 556 has at least 75% amino acid identity; Or
(a1) have the polypeptide of following aminoacid sequence, the mature polypeptide amino acid that this sequence and SEQ ID NO:37 are the 1st to 561 has at least 75% amino acid identity;
The polypeptide of (b) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 55th to 2166 Nucleotide of SEQ ID NO:1 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1725 Nucleotide of SEQ ID NO:3 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); Or
(b1) by following nucleotide sequence coded polypeptide, described polynucleotide (i) are hybridized with the 55th to 2166 Nucleotide of SEQ ID NO:36 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1737 Nucleotide of SEQ ID NO:38 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); And
(c) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:2 the to 556 amino acids and/or insert;
(c1) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:37 the to 561 amino acids and/or insert.
The invention still further relates to the polynucleotide that coding has the polypeptide of glucoamylase activity, it is selected from following:
(a) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 556 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:2 has at least 75% identity;
(a1) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 561 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:37 has at least 75% identity;
(b) have the polynucleotide of at least 60% identity with the 55th to 2166 Nucleotide of SEQ ID NO:1; Or
(b1) have the polynucleotide of at least 60% identity with the 55th to 2166 Nucleotide of SEQ ID NO:36;
(c) have the polynucleotide of at least 60% identity with the 55th to 1725 Nucleotide of SEQ ID NO:3; Or
(c1) have the polynucleotide of at least 60% identity with the 55th to 1737 Nucleotide of SEQ ID NO:38;
The polypeptide of (d) being encoded by following nucleotide sequence, this nucleotide sequence (i) is hybridized with the 55th to 2166 Nucleotide of SEQ ID NO:1 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1725 Nucleotide of SEQ ID NO:3 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); Or
The polypeptide of (d1) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 55th to 2166 Nucleotide of SEQ ID NO:36 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1737 Nucleotide of SEQ ID NO:38 in contained cDNA sequence hybridization, or (iii), (i) or complementary strand (ii).
In a preferred implementation, peptide source is from the bacterial strain of trametes (Trametes), preferred Trametes cingulata, or be derived from that to be preserved in DSMZ, preserving number be 17106 intestinal bacteria (E.coli) bacterial strain.Preservation strain 17106 comprises plasmid HUda595, and this plasmid comprises the sequence identical with SEQ ID NO:1.A concrete polypeptide of the present invention is polypeptide as described below: when as described in Example 6 at suitable fungal host cells, for example in aspergillus oryzae (Aspergillus oryzae) during expression plasmid pHUda440, the mature polypeptide that obtains.
Aspect second, the invention still further relates to and be selected from the following polypeptide with glucoamylase activity:
(a) has the polypeptide of the aminoacid sequence of at least 70% amino acid identity with the mature polypeptide amino acid of the 1st to 575 of SEQ ID NO:5; Or
(a1) has the polypeptide of the aminoacid sequence of at least 70% amino acid identity with the mature polypeptide amino acid of the 1st to 565 of SEQ ID NO:40;
The polypeptide of (b) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 55th to 2189 Nucleotide of SEQ ID NO:4 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1725 Nucleotide of SEQ ID NO:6 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); Or
(b1) by following nucleotide sequence coded polypeptide, this sequence (i) is hybridized with the 55th to 2182 Nucleotide of SEQ ID NO:39 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1749 Nucleotide of SEQ ID NO:41 in contained cDNA sequence hybridization, or (iii) (i) or the hybridization of complementary strand (ii); And
(c) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:5 the to 575 amino acids and/or insert;
(c1) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:40 the to 565 amino acids and/or insert.
The invention still further relates to the polynucleotide that coding has the polypeptide of glucoamylase activity, it is selected from following:
(a) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 575 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:5 has at least 75% identity; Or
(a1) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 565 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:40 has at least 75% identity;
(b) have the polynucleotide of at least 60% identity with the 55th to 2189 Nucleotide of SEQ ID NO:4; Or
(b1) have the polynucleotide of at least 60% identity with the 55th to 2182 Nucleotide of SEQ ID NO:39;
(c) have the polynucleotide of at least 60% identity with the 55th to 1725 Nucleotide of SEQ ID NO:6; Or
(c1) have the polynucleotide of at least 60% identity with the 55th to 1749 Nucleotide of SEQ ID NO:41;
The polypeptide of (d) being encoded by following nucleotide sequence, described nucleotide sequence (i) under low at least stringent condition with SEQ ID NO:4 in the 55th to 2189 Nucleotide hybridization, or (ii) under medium at least stringent condition with SEQ ID NO:6 in contained cDNA sequence hybridization in the 55th to 1725 Nucleotide, or (iii) (i) or complementary strand (ii); Or
The polypeptide of (d1) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 55th to 2182 Nucleotide of SEQ ID NO:39 under low at least stringent condition, or (ii) under medium at least stringent condition with the 55th to 1749 Nucleotide of SEQ ID NO:41 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii).
In a preferred implementation, described polypeptide belongs to bacterial strain from Pachykytospora, preferred Pachykytospora papyracea, or to be preserved in DSMZ, preserving number be 17105 coli strain.Preservation strain 17105 comprises plasmid HUda594, and this plasmid comprises the identical sequence of SEQ ID NO:4.A concrete polypeptide of the present invention is such polypeptide: when as described in Example 6 at suitable fungal host cells for example in aspergillus oryzae during expression plasmid pHUda450, the mature polypeptide of acquisition.
Aspect the 3rd, the invention still further relates to and be selected from the following polypeptide with glucoamylase activity:
(a) has the polypeptide of the aminoacid sequence of at least 60% amino acid identity with the mature polypeptide amino acid of the 1st to 556 of SEQ ID NO:26; Or
(a1) has the polypeptide of the aminoacid sequence of at least 60% amino acid identity with the mature polypeptide amino acid of the 1st to 548 of SEQ ID NO:24; Or
(a2) has the polypeptide of the aminoacid sequence of at least 60% amino acid identity with the mature polypeptide amino acid of the 1st to 523 of SEQ ID NO:43;
The polypeptide of (b) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 117th to 2249 Nucleotide of SEQ ID NO:23 under low at least stringent condition, or (ii) under low at least stringent condition with the 52nd to 1719 Nucleotide of SEQ ID NO:25 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii);
(b1) by following nucleotide sequence coded polypeptide, this sequence (i) under low at least stringent condition with the 52nd to 1620 Nucleotide of SEQ ID NO:42 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); And
(c) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:26 the to 556 amino acids and/or insert;
(c1) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:24 the to 548 amino acids and/or insert;
(c2) variant that comprises one or more amino acid whose conservative replacements, disappearance in the 1st of SEQ ID NO:43 the to 523 amino acids and/or insert.
The invention still further relates to and be selected from the polynucleotide that following coding has the polypeptide of glucoamylase activity:
(a) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 556 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:26 has at least 60% identity; Or
(a1) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 548 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:24 has at least 60% identity; Or
(a2) coding has the polynucleotide of the polypeptide of following aminoacid sequence, and the 1st to 523 the mature polypeptide amino acid of described aminoacid sequence and SEQ ID NO:43 has at least 60% identity;
(b) have the polynucleotide of at least 60% identity with the 117th to 2249 Nucleotide of SEQ ID NO:23; Or
(c) have the polynucleotide of at least 60% identity with the 52nd to 1719 Nucleotide of SEQ ID NO:25; Or
(c1) have the polynucleotide of at least 60% identity with the 52nd to 1620 Nucleotide of SEQ ID NO:42;
The polypeptide of (d) being encoded by following nucleotide sequence, described nucleotide sequence (i) is hybridized with the 117th to 2249 Nucleotide of SEQ ID NO:23 under low at least stringent condition, or (ii) under low at least stringent condition with the 52nd to 1620 Nucleotide of SEQ ID NO:42 in contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii); Or
The polypeptide of (d1) being encoded by following nucleotide sequence, described nucleotide sequence (i) under low at least stringent condition with the 52nd to 1719 of SEQ ID NO:25 the contained cDNA sequence hybridization, or (iii) (i) or complementary strand (ii).
In a preferred implementation, described polypeptide can be derived from white stake mushroom and belong to (Leucopaxillus) bacterial strain, Leucopaxillus giganteus (Sow.: Fr.) Sing. (Leucopaxillus giganteus) preferably, or be derived from sequence as shown in SEQ ID NO:26.A specific polypeptide of the present invention is such polypeptide: when as described in embodiment 11 at suitable fungal host cells for example in aspergillus niger during expression plasmid pENI3372, the mature polypeptide of acquisition.
The invention still further relates to nucleic acid construct, recombinant expression vector and recombinant host cell, it comprises respectively the polynucleotide in following sequence: SEQ ID NOS:1 or 3 (cDNA) or 36 or 38 (cDNA); Or SEQ ID NO:4 or 6 (cDNA) or 39 or 41 (cDNA); Or SEQ ID NO:23 or 25 (cDNA) or 42 (cDNA).
Be used for the requirement of the microbial preservation budapest treaty of patented procedure according to international recognition, the contriver is be sure of that be cloned in identical with SEQ ID NO:1 and 4 was preserved in German microorganism and culture collection center (Deutsche Sammlung von Mikroorganismen undZellkulturen GmbH on February 2nd, 2005, DSMZ) (Mascheroder Weg1b, D-38124BraunschweigDE.).Described clone is given preserving number DSM17106 and DSM17105.
The invention still further relates to the described method with polypeptide of glucoamylase activity of producing, it comprises: (a) cultivate the recombinant host cell that comprises nucleic acid construct under the condition of this polypeptide helping to produce, described nucleic acid construct comprises the polynucleotide of coding said polypeptide; And (b) reclaim described polypeptide.
The invention still further relates to the method for producing tunning or syrup.
Definition
Glucoamylase activity (Glucoamylase activity): term " glucoamylase " (Isosorbide-5-Nitrae-α-D-dextran glucose hydrolysis enzyme) is defined as the enzyme that the catalysis D-Glucose discharges from non-reducing end starch or Related Oligosaccharides and polysaccharide.For the purposes of the present invention, glucoamylase activity is according to the program determination of following " materials and methods " part.
Polypeptide of the present invention has respectively at least 20%, preferred at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, most preferably at least 95%, even most preferably at least 100% glucoamylase activity of the polypeptide that is comprised of following sequence: the 1st to 556 amino acids of SEQ ID NO:2 or the 1st to 561 amino acids of SEQ ID NO:37; Or the 1st to 565 amino acids of the 1st to 575 amino acids of SEQ ID NO:5 or SEQ ID NO:40; Or the 1st to 523 amino acids of the 1st to 556 amino acids of the 1st to 548 amino acids of SEQ ID NO:24 or SEQ IDNO:26 or SEQ ID NO:43.
Polypeptide (Polypeptide): term " polypeptide " refers to when being used for this paper: according to the mensuration of SDS-PAGE, and at least 20% pure, preferred at least 40% pure, more preferably at least 60% pure, more preferably at least 80% pure, at least 90% pure, at least 95% pure isolated polypeptide even most preferably most preferably.
Basically pure polypeptide (substantially pure polypeptide): term " pure polypeptide basically " refers to contain by weight at the most 10% in this article, preferred at the most 8%, more preferably at the most 6%, more preferably at the most 5%, more preferably at the most 4%, at the most 3%, even more preferably at the most 2%, most preferably at the most 1% and even most preferably at the most 0.5% with the polypeptide preparation thing of natural other peptide material that accompanies of this polypeptide.Therefore, preferably, basically whole peptide materials of existing in prepared product by weight of pure polypeptide be at least 92% pure, preferred at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, most preferably at least 99.5% pure, even most preferably 100% pure.
Polypeptide of the present invention is pure form basically preferably.Particularly, preferably polypeptide is " (essentially) pure form in fact ", and namely the polypeptide preparation thing does not contain in fact and natural other peptide material that accompanies of this polypeptide.For example, this can be by adopting well-known recombination method or adopting classical purification process to prepare polypeptide and realize.
In this article, term " pure polypeptide basically " is identical with " polypeptide of unpack format " implication with term " isolated polypeptide ".
Identity (identity): this paper describe between two seed amino acid sequences with parameter " identity " or two kinds of nucleotide sequences between dependency (relatedness).
For the purposes of the present invention, the identity degree between two seed amino acid sequences can use the Clustal method (Higgins, 1989, CABIOS5:151-153) come to determine, use the LASERGENE with identity table (identitytable) TMMEGALIGN TMSoftware (DNASTAR, Inc., Madison, WI) and following a plurality of comparison parameter: breach point penalty 10; Notch length point penalty 10.Pairing comparison parameter: Ktuple=1, breach point penalty=3, window number (windows)=5, diagonal lines number (diagonals)=5.
For the purposes of the present invention, identity degree between two kinds of nucleotide sequences can be used Wilbur-Lipman algorithm (Wilbur and Lipman, 1983, Proceedings of the NationalAcademy of Science USA80:726-730) determine, use the LASERGENE with identity table TMMEGALIGN TMSoftware (DNASTAR, Inc., Madison, WI) and following a plurality of comparison parameter: breach point penalty 10; Notch length point penalty 10.Pairing comparison (pairwise alignment) parameter: Ktuple=3, breach point penalty=3, window number=20.
Polypeptide fragment (Polypeptide fragment): term " polypeptide fragment " is defined as in this article from the N-terminal of following sequence and/or the one or more amino acid whose polypeptide of carboxyl-terminal deletion: SEQ IDNO:2 or 37; Or SEQ ID NO:5 or 40; Or SEQ ID NO:24,26 or 43, or its homologous sequence, wherein said fragment has glucoamylase activity.
Subsequence (Subsequence): term " subsequence " be defined as in this article from 5 of following sequence ' and/or 3 ' terminal deletion the nucleotide sequence of one or more Nucleotide: SEQ ID NO:1,36 or 38; Or SEQ ID NO:4,39 or 41; Or be respectively SEQ ID NO:23,25 or 42, or its homologous sequence; Wherein the subsequence coding has the polypeptide fragment that strengthens glucoamylase activity.
Allelic variant (Allelic variant): term " allelic variant " refers to occupy any in two or more optional forms of gene of same dyeing position in this article.Allelic variation is by natural the causing of sudden change, and can cause polymorphism in population.Transgenation can be reticent (coded polypeptide does not change), and perhaps codified has the polypeptide of the aminoacid sequence of change.The allelic variant of polypeptide is the polypeptide by the allelic variant coding of gene.
Basically pure polynucleotide (Substantially pure polynucleotide): term " pure polynucleotide basically " refers to not contain other external (extraneous) or unwanted Nucleotide when being used for this paper, and the polynucleotide prepared product to be suitable for existing in the form of using in genetic engineering modified protein production system.Therefore, basically pure polynucleotide contain by weight at the most 10%, preferred at the most 8%, more preferably at the most 6%, more preferably at the most 5%, more preferably at the most 4%, more preferably at the most 3%, even more preferably at the most 2%, most preferably at the most 1% and even most preferably at the most 0.5% with natural other polynucleotide material that accompanies of these polynucleotide.Yet pure polynucleotide can comprise naturally occurring 5 ' and 3 ' non-translational region basically, such as promotor and terminator.Preferably, pure polynucleotide are at least 90% pure, preferred at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99% pure and even most preferably at least 99.5% pure by weight basically.Preferably, polynucleotide of the present invention are basically pure forms.Particularly, preferably, polynucleotide disclosed herein are " pure in fact forms ", and namely the polynucleotide prepared product does not contain in fact and natural other polynucleotide material that accompanies of these polynucleotide.In this article, term " pure polynucleotide basically " " separates polynucleotide " with term and " polynucleotide of unpack format " synonym.Polynucleotide can be genome, cDNA, RNA, semi-synthetic, the synthetic source or its arbitrary combination.
CDNA: term " cDNA " is defined as the DNA molecular maturation that can be obtained by eukaryotic cell by reverse transcription, that prepare through the mRNA molecule of montage in this article.CDNA lacks the intron sequences that usually exists in corresponding genomic dna.Initial elementary rna transcription is originally the precursor of mRNA, it become ripe, to pass through a series of procedure of processings through before the mRNA of montage.These steps comprise by the process that is called " montage " removes intron sequences.Therefore, lack any intron sequences by the derivative cDNA of mRNA.
Nucleic acid construct (Nucleic acid construct): term " nucleic acid construct " refers to strand or double-stranded nucleic acid molecule when being used for this paper, it is by naturally occurring gene isolation, or process is modified and contains nucleic acid segment in the non-existent mode of occurring in nature.When nucleic acid construct contained the needed control sequence of expression encoding sequence of the present invention, the term nucleic acid construct was identical with term " expression cassette " implication.
Control sequence (Control sequence): term " control sequence " is defined as in this article and comprises expressing the necessary or favourable all the components of polynucleotide of code book invention polypeptide.Every kind of control sequence can be natural or external concerning the nucleotide sequence of coding said polypeptide.These control sequences include, but not limited to leader sequence, polyadenylation sequence, propeptide sequence, promotor, signal peptide sequence and transcription terminator.At least, control sequence comprises promotor and transcribes and the translation termination signal.So that control sequence is connected with the nucleotide sequence coded district of coded polypeptide, control sequence can be with joint (linkers) in order to introduce special restriction site.
Be operatively connected (Operably linked): term " is operatively connected " and refers in this article a kind of like this structure, wherein control sequence is placed in the appropriate location with respect to the encoding sequence of polynucleotide sequence, makes control sequence instruct the expression of polypeptid coding sequence.
Encoding sequence (Coding sequence): when being used for this paper, term " encoding sequence " means directly to stipulate the nucleotide sequence of the aminoacid sequence of its protein.The border of encoding sequence generally determined by open reading frame, and it originates in ATG initiator codon or alternative initiator codon usually such as GTG and TTG.Encoding sequence can be DNA, cDNA or recombinant nucleotide sequence.
Express (Expression): term " expressions " comprises that polypeptide produces the arbitrary step that relates to, and includes but not limited to: transcribe, post transcriptional modificaiton, translation, posttranslational modification, and secrete.
Expression vector (Expression vector): term " expression vector " is defined as following wire or ring-shaped DNA molecule in this article, and it comprises the polynucleotide of code book invention polypeptide, and itself and help other Nucleotide of its expression to be operatively connected.
Host cell (Host cell): term " host cell " comprise when being used for this paper be easy to the nucleic acid construct that comprises polynucleotide of the present invention or expression vector conversion, transfection, transduction, etc. any cell type.
Modify (Modification): term " modification " refers to any chemically modified of respectively polypeptide that is comprised of following sequence being carried out in this article: the 1st to 556 amino acids of SEQ ID NO:2 or the 1st to 561 amino acids of SEQ IDNO:37; Or the 1st to 565 amino acids of the 1st to 675 amino acids of SEQ ID NO:5 or SEQ ID NO:40; Or the 1st to 523 amino acids of the 1st to 548 amino acids of the 1st to 556 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or SEQ ID NO:43; And to the genetic manipulation of the DNA of this polypeptide of encoding.Modification can be one or more amino acid whose replacements, disappearance and/or insertion, and the replacement of one or more amino acid side chains.
Artificial variant (Artificial variant): when being used for this paper, term " artificial variant " means to have the polypeptide of glucoamylase activity, and it is to be produced by the organism of expressing following modified nucleotide sequence: SEQ ID NOS:1 or 3 (cDNA) or SEQ ID NOS:36 or 38 (cDNA); Or SEQID NO:4 or 6 (cDNA), or SEQ ID NOS:39 or 41 (cDNA); Or SEQ ID NOS:23 or 25 (cDNA) or 42 (cDNA).Modified nucleotide sequence can through manual intervention, obtain by disclosed nucleotide sequence in following sequence number is modified: SEQ ID NO:1 or 3, or SEQID NO:36 or 38; Or SEQ ID NO:4 or 6, or SEQ ID NO:39 or 41; Or SEQ IDNO:23 or 25 or 42.
The accompanying drawing summary
Fig. 1 shows from the comparison of going the branch ability to Trametes cingulata branch starch of the glucoamylase of Athelia rolfsii, aspergillus niger and Talaromyces emersonii.
Detailed Description Of The Invention
Polypeptide with glucoamylase activity
Aspect first, the present invention relates to have the polypeptide of following aminoacid sequence, this aminoacid sequence respectively with the 1st to 556 amino acids of SEQ ID NO:2, or the 1st to 561 amino acids of SEQ ID NO:37; Or the 1st to 565 amino acids of the 1st to 575 amino acids of SEQ ID NO:5 or SEQ ID NO:40; Or the 1-523 amino acids of the 1-548 amino acids of the 1-556 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or SEQ ID NO:43 (being ripe polypeptide) has respectively identity.
In one embodiment, aminoacid sequence has glucoamylase activity, and has at least 75%, preferred at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferably at least 96% and even more preferably at least 97%, even more preferably at least 98% and even more preferably at least 99% identity (following " homeopeptide ") with the maturing part of SEQ IDNO:2 or SEQ ID NO:37.
In another embodiment, aminoacid sequence has glucoamylase activity and has at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferably at least 96% and even more preferably at least 97% and even more preferably at least 98% and even more preferably at least 99% identity (following " homeopeptide ") with the maturing part of SEQ IDNO:5 or SEQ ID NO:40.
In one embodiment, described aminoacid sequence has glucoamylase activity and has respectively at least 60%, at least 65%, at least 70%, at least 75%, preferred at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferably at least 96% and even more preferably at least 97% and even more preferably at least 98% and even more preferably at least 99% identity (following " homeopeptide ") with SEQ ID NO:26,24 or 43 maturing part.
One preferred aspect, the aminoacid sequence of homeopeptide respectively with the 1st to 556 amino acids of SEQ ID NO:2, or the 1st to 561 amino acids of SEQ ID NO:37; Or the 1st to 565 amino acids of the 1st to 575 amino acids of SEQ ID NO:5 or SEQ ID NO:40; Or the 1st to 523 amino acids of the 1st to 548 amino acids of the 1st to 556 amino acids of SEQ IDNO:26 or SEQ ID NO:24 or SEQID NO:43 differs 10 amino acid, preferred 5 amino acid, more preferably 4 amino acid, even more preferably 3 amino acid, most preferably 2 amino acid and 1 amino acid even most preferably.
Polypeptide of the present invention preferably comprises respectively SEQ ID NO:2 or 37; Or SEQ ID NO:5 or 40; Or SEQ ID NO:26,24 or 43 mature amino acid sequence or its allelic variant; It has the fragment of glucoamylase activity, as, catalytic domain.
Catalytic domain
In one aspect, the present invention relates to comprise respectively SEQ ID NO:2 or 37; Or SEQ ID NO:5 or 40; Or the polypeptide in the catalytic domain/territory of SEQ ID NO:26,24 or 43 aminoacid sequence.
Catalytic domain/the territory of Trametes cingulata glucoamylase is arranged in the 1st to 455 amino acids or SEQ ID NO:37 the 1st to 460 amino acids of SEQ ID NO:2.In one embodiment, can think that this district comprises respectively the connector area of the 461st to 470 amino acids in the 456th to 465 amino acids in SEQ ID NO:2 or SEQ IDNO:37, or its part.In conjunction with the territory respectively by the polynucleotide encoding of the 1465th to 1737 in thuja acid more than the 1774th to 2163 or SEQ ID NO:38 in the polynucleotide of the 1423rd to 1725 in SEQ IDNO:3 or SEQ ID NO:36.
Catalytic domain/the territory of Pachykytospora papyracea glucoamylase is positioned at the 1st to 475 amino acids of SEQ ID NO:5 or the 1st to 465 amino acids of SEQ ID NO:40.In one embodiment, this territory is considered to comprise respectively the connector area of the 466th to 474 amino acids in the 476th to 484 amino acids in SEQ ID NO:5 or SEQID NO:40, or its part.In conjunction with the territory respectively by the polynucleotide encoding of the 1477th to 1749 of the 1763rd to 2182 polynucleotide in the polynucleotide of the 1420th to 1725 in SEQID NO:6 or SEQ ID NO:39 or SEQ ID NO:41.
Catalytic domain/the territory of Leucopaxillus giganteus (Sow.: Fr.) Sing. glucoamylase lays respectively at the 1st to 451 amino acids or the 1st to 455 amino acids of SEQ ID NO:24 or the 1st to 418 amino acids of SEQ ID NO:43 of SEQ ID NO:26.In one embodiment, can think that this territory comprises respectively the connector area of the 419th to 429 amino acids of the 456th to 466 amino acids of the 452nd to 461 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or SEQID NO:43, or its part.In conjunction with territory (CBM) respectively by the 1399th to 1620 polynucleotide encoding of the 1854th to 2249 polynucleotide of the 1438th to 1719 polynucleotide of SEQ ID NO:25 or SEQ ID NO:23 or SEQ ID NO:42.
a preferred embodiment of the present invention relates to such catalytic domain, it has respectively at least 60% identity with following sequence, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferably at least 96%, and even more preferably at least 97%, and even more preferably at least 98%, and even more preferably at least 99%, especially at least 100% identity: the 1st to 460 amino acids (trametes) of the 1st to 455 amino acids of SEQ ID NO:2 or SEQ ID NO:37, or the 1st to 465 amino acids (Pachykytospora) of the 1st to 475 amino acids of SEQ ID NO:5 or SEQ ID NO:40, or the 1st to 418 amino acids of the 1st to 455 amino acids of the 1st to 451 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or SEQ ID NO:43 (white stake mushroom belongs to), and described catalytic domain has glucoamylase activity (following " homeopeptide ").One preferred aspect, the aminoacid sequence of homology catalysis region respectively with the 1st to 455 amino acids of SEQ ID NO:2 or the 1st to 460 amino acids (trametes) of SEQ ID NO:37; or the 1st to 418 amino acids of the 1st to 455 amino acids of the 1st to 451 amino acids of the 1st to 465 amino acids (Packykytospora) of the 1st to 475 amino acids of SEQ ID NO:5 or SEQ ID NO:40 or SEQ ID NO:26 or SEQ ID NO:24 or SEQ ID NO:43 (white stake mushroom belongs to) differs 10 amino acid, preferred 5 amino acid, more preferably 4 amino acid, even more preferably 3 amino acid, 2 amino acid most preferably, and 1 amino acid even most preferably.
In conjunction with the territory
In yet another aspect, the present invention relates to have sugared binding affinity, the polypeptide of preferred starch binding affinity.
Be positioned at the 466th to 556 amino acids of SEQ ID NO:2 and coded by the polynucleotide of the 1420th to 1725 of SEQ ID NO:3 in conjunction with the territory in the trametes glucoamylase, or be positioned at the 471st to 561 amino acids of SEQID NO:37 and coded by the 1465th to 1737 polynucleotide of SEQ ID NO:38.
Be positioned at the 485th to 575 amino acids (Pachykytospora) of SEQ ID NO:5 and coded by the 1423rd to 1725 polynucleotide of SID ID NO:6 in conjunction with the territory in the Pachykytos glucoamylase, or be positioned at the 475th to 565 amino acids of SEQ ID NO:40 and coded by the 1477th to 1749 polynucleotide of SEQ IDNO:41.
Lay respectively at the 463rd to 556 amino acids or the 467th to 548 amino acids of SEQ ID NO:24 or the 430th to 523 amino acids of SEQ ID NO:43 of SEQ ID NO:26 in conjunction with the territory in white stake mushroom genus gluconobacter amylase, and coded by the 1339th to 1620 polynucleotide of the 1438th to 1719 polynucleotide of the 1854th to 2249 polynucleotide of SEQ ID NO:23 or SEQ ID NO:25 or SEQ ID NO:42 respectively.
Therefore, aspect this, the present invention relates to be selected from the polypeptide with sugared binding affinity of lower group:
(a) i) comprise the polypeptide of following aminoacid sequence, this sequence has at least 60% identity with the 466th to 556 amino acids of SEQ ID NO:2 or the 471st to 561 amino acids of SEQ ID NO:37 respectively;
Ii) comprise the polypeptide of following aminoacid sequence, this sequence has at least 60% identity with the 485th to 575 amino acids of SEQ ID NO:5 or the 475th to 565 amino acids of SEQ ID NO:40 respectively;
Iii) comprise the polypeptide of following aminoacid sequence, this sequence respectively with the identity of the 430th to 523 amino acids at least 60% of the 467th to 548 amino acids of the 463rd to 556 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or SEQ IDNO:43;
(b) by the polypeptide of following nucleotide sequence coding, this nucleotides sequence is listed under low stringent condition and is selected from following polynucleotide probes hybridization:
(i) complementary strand separately of the 1465th to 1737 Nucleotide of the 1420th of SEQ ID NO:3 the to 1725 Nucleotide or SEQ ID NO:38;
(ii) complementary strand separately of the 1477th to 1749 Nucleotide of the 1423rd of SEQ ID NO:6 the to 1725 Nucleotide or SEQ ID NO:41;
(iii) complementary strand separately of the 1339th to 1620 Nucleotide of the 1854th to 2249 Nucleotide of the 1438th of SEQ ID NO:25 the to 1719 Nucleotide or SEQ ID NO:23 or SEQ ID NO:42;
(c) (a) or the fragment with sugared binding affinity (b).
One preferred embodiment in, described sugared binding affinity is the starch binding affinity.
one preferred embodiment in, the present invention relates to have the polypeptide of sugared binding affinity, this polypeptide respectively with the 466th to 556 amino acids of SEQ ID NO:2 or the 471st to 561 amino acids (trametes) of SEQ ID NO:37, or respectively with the 485th to 575 amino acids of SEQ ID NO:5 or the 475th to 565 amino acids (Pachykytospora) of SEQ ID NO:40, or has at least 60% identity with the 467th to 548 amino acids of the 463rd to 556 amino acids of SEQID NO:26 or SEQ ID NO:24 or the 430th to 523 amino acids of SEQ ID NO:43 (white stake mushroom belongs to) respectively, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferably at least 96%, and even more preferably at least 97%, and even more preferably at least 98%, and even more preferably at least 99%, especially at least 100% identity.
One preferred aspect, homology has such aminoacid sequence in conjunction with the aminoacid sequence in territory, its respectively with the 466th to 556 amino acids of SEQ ID NO:2 or the 471st to 561 amino acids (Trametes cingulata) of SEQ ID NO:37; Or respectively with the 485th to 575 amino acids of SEQ ID NO:5 or the 475th to 565 amino acids (Pachykytospora) of SEQ ID NO:40; Or differ 10 amino acid, preferred 5 amino acid, more preferably 4 amino acid, even more preferably 3 amino acid, most preferably 2 amino acid and 1 amino acid even most preferably with the 467th to 548 amino acids of the 463rd to 556 amino acids of SEQ ID NO:26 or SEQ ID NO:24 or the 430th to 523 amino acids of SEQ ID NO:43 (white stake mushroom belongs to) respectively.
In another embodiment, the present invention relates to be selected from the following polypeptide with sugared binding affinity:
(a) by the coded polypeptide of following nucleotide sequence, this nucleotides sequence is listed under low stringent condition, preferred medium stringent condition, more preferably under high stringent condition be selected from following polynucleotide probes hybridization:
(i) complementary strand separately of the 1465th to 1737 Nucleotide of the 1420th of SEQ ID NO:3 the to 1725 Nucleotide or SEQ ID NO:38;
(ii) complementary strand separately of the 1477th to 1749 Nucleotide of the 1423rd of SEQ ID NO:6 the to 1725 Nucleotide or SEQ ID NO:41;
(iii) complementary strand separately of the 1339th to 1620 Nucleotide of the 1854th to 2249 Nucleotide of the 1438th of SEQ ID NO:25 the to 1719 Nucleotide or SEQ ID NO:23 or SEQ ID NO:42;
(b) (a) the fragment with sugared binding affinity.
The invention still further relates to the polypeptide with sugared binding affinity, wherein this polypeptide is artificial variant, comprise following aminoacid sequence, this sequence respectively with the 466th to 556 amino acids of SEQ ID NO:2 or the 471st to 561 amino acids (trametes) of SEQ ID NO:37; Or respectively with the 485th to 575 amino acids of SEQ ID NO:5 or the 475th to 565 amino acids (Pachykytospora) of SEQ ID NO:40; Or compare with the 467th to 548 amino acids of the 463rd to 556 amino acids of SEQ ID NO:26 or SEQID NO:24 or the 430th to 523 amino acids of SEQ ID NO:43 (white stake mushroom belongs to) respectively, have amino acid whose replacement, disappearance and/or an insertion at least.
the invention still further relates to the polypeptide with sugared binding affinity, wherein this polypeptide is the artificial variant that comprises following aminoacid sequence, this sequence is combined respectively the aminoacid sequence of territory encoding part coding and is compared with the sugar of following polynucleotide sequence, has an amino acid whose replacement at least, disappearance and/or insert: the polynucleotide sequence of the 1465th to 1737 in the 1420th to 1725 or SEQ ID NO:38 in SEQ IDNO:3, or the 1423rd to 1725 or the polynucleotide sequence of the 1477th to 1749 of SEQ ID NO:41 of SEQ ID NO:6, or the 1438th to 1719 or the 1854th to 2249 or the polynucleotide sequence of the 1339th to 1620 of SEQ ID NO:42 of SEQ IDNO:23 of SEQ ID NO:25.
Heterozygote (hybrids)
Glucoamylase of the present invention or catalysis region can be connected by joint sequence or the direct territory (being also referred to as binding modules (binding modules, CBM)) of being combined with one or more external sources." external source " (foreign) in conjunction with the territory right and wrong from wild-type glucoamylase of the present invention in conjunction with the territory.Preferably sugared in conjunction with territory (namely having the affinity in conjunction with sugar), especially starch binding domain or cellulose binding domain in conjunction with the territory.In conjunction with the territory preferably from fungi or bacterium.The example of the special starch binding domain of considering is disclosed by WO2005/003311, incorporates described document here into as a reference.
In a preferred implementation, the joint in glucoamylase of the present invention is replaced by more stable joint, that is to say, more is not easy to the joint of shearing than this parent (parent) joint.This is for fear of being sheared in conjunction with the territory.The special stable joint of considering comprises valley aspergillus (Aspergilluskawachii) joint:
TTTTTTAAATSTSKATTSSSSSSAAATTSSS(SEQID NO：22)
Therefore, in one of the present invention preferred embodiment, the present invention relates to a kind of heterozygosis glucoamylase, it has respectively by the aminoacid sequence shown in SEQ ID NO:2 or 37, and the natural joint or its part that wherein lay respectively at 461 to 470 amino acids in the 456th to 465 amino acids in SEQ ID NO:2 or SEQ ID NO:37 are replaced by the valley aspergillus joint shown in SEQ ID NO:22.
Therefore, another preferred embodiment in, the present invention relates to a kind of heterozygosis glucoamylase, it has respectively by the aminoacid sequence shown in SEQ ID NO:5 or 40, and the natural joint or its part that wherein lay respectively at 466 to 474 amino acids in the 476th to 484 amino acids in SEQ IDNO:5 or SEQ ID NO:40 are replaced by the valley aspergillus joint shown in SEQ ID NO:22.
Therefore, another preferred embodiment in, the present invention relates to a kind of heterozygosis glucoamylase, it has respectively by the aminoacid sequence shown in SEQ ID NO:26 or 24, and the natural joint or its part that wherein lay respectively at 419 to 429 amino acids in 456 to 466 amino acids in the 452nd to 462 amino acids in SEQ IDNO:26 or SEQ ID NO:24 or SEQ ID NO:24 are replaced by the valley aspergillus joint shown in SEQ IDNO:22.
Therefore, the invention still further relates to such crossbred, it is comprised of following component: glucoamylase of the present invention or have the catalytic domain of the present invention of glucoamylase activity, with suitable joint (for example valley aspergillus joint); And one or more sugar merge in conjunction with the territory; Described sugar for example by the page 5 of WO2005/003311, the disclosed carbohydrate binding modules (CBM) of the 30th, 12 row of the 8th page, is incorporated described document here into as a reference in conjunction with the territory.
Hybridization
In yet another aspect, the present invention relates to by the coded polypeptide with glucoamylase activity of following polynucleotide, described polynucleotide (i) are under low at least stringent condition, preferred medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringent condition and most preferably under very high stringent condition are with the nucleotide sequence hybridization of the 55th to 2166 Nucleotide (trametes genomic dna) of the 55th to 2166 Nucleotide that has respectively SEQ ID NO:1 or SEQ ID NO:36; Or (ii) medium at least stringent condition, preferably medium-Gao stringent condition, more preferably high stringency condition, more preferably under very high stringent condition respectively with nucleotide sequence (trametes cDNA) hybridization of the 55th to 1737 the contained cDNA sequence of Nucleotide of the 55th to 1725 Nucleotide of SEQ ID NO:3 or SEQ IDNO:38; Or (iii) (i) or subsequence (ii); Or (iv) (i), (ii) or complementary strand (iii) (J.Sambrook, E.F.Fritsch and T.Maniatis, 1989, " Molecular Cloning, A Laboratory Manual ", second edition, Cold Spring Harbor, New York).SEQ ID NOS:1 or 3, or the sub-series of packets of SEQ ID NOS:36 or 38 (trametes) contains at least 100 continuous Nucleotide or preferred at least 200 continuous nucleotides.In addition, subsequence can be encoded and be had the polypeptide fragment of glucoamylase activity.
The present invention also relates to by the coded isolated polypeptide with glucoamylase activity of following polynucleotide, described polynucleotide (i) under low at least stringent condition, preferred medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 55th to 2182 Nucleotide (Pachykytospora genomic dna) hybridization of the 55th to 2189 Nucleotide with SEQ ID NO:4 or SEQ ID NO:39; Or (ii) medium at least stringent condition, preferably medium-Gao stringent condition, more preferably high stringency condition, more preferably under very high stringent condition respectively with nucleotide sequence (Pachykytospora cDNA) hybridization of the 55th to 1749 the contained cDNA sequence of Nucleotide of the 55th to 1725 Nucleotide with SEQ ID NO:6 or SEQ ID NO:41; Or (iii) (i) or subsequence (ii); Or (iv) (i), (ii) or complementary strand (iii).
The invention still further relates to the isolated polypeptide with glucoamylase activity by following polynucleotide encoding, described polynucleotide (i) are under low at least stringent condition, preferred medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition, with nucleotide sequence (a white stake mushroom the belongs to genomic dna) hybridization of the 117th to 2249 Nucleotide with SEQ ID NO:23; Or (ii) under low at least stringent condition, preferably medium, more preferably medium-Gao stringent condition, more preferably high stringent condition, more preferably under very high stringent condition respectively with nucleotide sequence (a white stake mushroom the belongs to cDNA) hybridization that has in SEQ ID NO:25 in the 52nd to 1719 Nucleotide or SEQ ID NO:42 cDNA sequence contained in the 52nd to 1620 Nucleotide; Or (iii) (i) or subsequence (ii); Or (iv) (i), (ii) or complementary strand (iii).
can use SEQ ID NO:1, 3, 36 or 38 separately nucleotide sequences, or its subsequence, or SEQ ID NO:4, 6, 39 or 41 separately nucleotide sequences, or its subsequence, or SEQ IDNO:23, 25 or 42 nucleotide sequence separately, or its subsequence, and SEQ ID NO:2 or 37 aminoacid sequence separately, or its fragment, or SEQ ID NO:5 or 40 aminoacid sequence separately, or its fragment, or SEQ ID NO:26, 24 or 43 separately aminoacid sequences, or its fragment, come the designing nucleic acid probe according to method well known in the art, identify and clone from the bacterial strain of different genera the DNA that coding has the polypeptide of glucoamylase activity.Especially, can use such probe to follow genome or the cDNA hybridization of standard Southern western blot procedure and target species or genus, thereby identify and the corresponding gene of separating wherein.These probes can be than complete sequence much shorter, but length should be at least 14, preferably at least 25, more preferably at least 35 and at least 70 Nucleotide most preferably.Yet the length of preferred nucleic acid probe is at least 100 Nucleotide.For example, the length of nucleic acid probe can be at least 200 Nucleotide, preferably at least 300 Nucleotide, more preferably at least 400 Nucleotide or at least 500 Nucleotide most preferably.Can use longer probe, for example length is at least 600 Nucleotide, preferred at least at least 700 Nucleotide, more preferably at least 800 Nucleotide or the nucleic acid probe of at least 900 Nucleotide most preferably.DNA and rna probe all can use.Usually probe is carried out mark, (for example use for detection of corresponding gene 32P、 3H、 35S, vitamin H or avidin).These probes are contained in the present invention.
Therefore, can screen such DNA from the genomic dna of such other organism preparation or cDNA library: its and above-mentioned probe are hybridized, and encode and have the polypeptide of glucoamylase activity.Can separate by agarose or polyacrylamide gel electrophoresis or other isolation technique from the genome of other such organism or other DNA.Can will transfer to and be fixed on nitrocellulose or other appropriate carrier material from the DNA in described library or the DNA of separation.In order to identify respectively and SEQ ID NO:1,3,36 or 38 or its subsequence homology, or respectively with SEQ ID NO:4,6,39 or 41 or its subsequence homology, or respectively with SEQ ID NO:23,25 or 42 or clone or the DNA of its subsequence homology, solid support material is used for the Southern trace.
For the purpose of the present invention, " hybridization " refers to hybridize being low to moderate very much under very high stringent condition the nucleic acid probe of nucleotide sequence and mark, wherein nucleic acid probe corresponds respectively to SEQ ID NO:1,3,36 or 38, or correspond respectively to SEQ ID NO:4,6,39 or 41, or correspond respectively to SEQ ID NO:23,25 or 42, its complementary strand, or its subsequence.Molecule with nucleic acid probe generation hybridization can detect with X-ray film under these conditions.
In a preferred implementation, described nucleic acid probe is the 55th to 2166 Nucleotide of SEQ ID NO:1 or the 55th to 2166 Nucleotide of SEQ ID NO:36, or the 55th to 1737 Nucleotide (trametes cDNA) of the 1st to 1725 Nucleotide of SEQ ID NO:3 or SEQ ID NO:38.In a preferred implementation, nucleic acid probe is the 55th to 2186 Nucleotide of SEQ ID NO:4 or the 55th to 2182 Nucleotide of SEQ ID NO:39 or the 1st to 1725 Nucleotide of SEQ ID NO:6 or the 55th to 1749 Nucleotide of SEQ ID NO:41 (Pachykytospora belongs to cDNA).In a preferred implementation, described nucleic acid probe is the 117th to 2249 Nucleotide of SEQ ID NO:23 or the 52nd to 1719 Nucleotide of SEQ ID NO:25 (white stake mushroom belongs to cDNA) or the 52nd to 1620 Nucleotide of SEQ ID NO:42 (white stake mushroom belongs to cDNA).in another preferred implementation, described nucleic acid probe is the polynucleotide sequence of coding catalytic domain, described catalytic domain is: between SEQID NO:2 the 1st to 455 amino acids or between SEQ ID NO:37 the 1st to 460 amino acids (trametes), or between SEQ ID NO:5 the 1st to 475 amino acids or between SEQ ID NO:40 the 1st to 465 amino acids between (Pachykytospora genus) or SEQ ID NO:24 the 1st to 455 amino acids or between SEQ ID NO:26 the 1st to 451 amino acids or the catalytic domain between SEQ ID NO:43 the 1st to 418 amino acids (white stake mushroom belongs to).
Another preferred aspect, nucleic acid probe in conjunction with the territory the present invention relates to encode, described is to be respectively the 466th to 556 amino acids of SEQ ID NO:2 or the 471st to 561 amino acids of SEQ ID NO:37 in conjunction with the territory, or be respectively the 485th to 575 amino acids of SEQ ID NO:5 or the 475th to 565 amino acids of SEQ IDNO:40, or the 430th to 523 amino acids of the 467th to 548 amino acids of the 463rd to 556 amino acids of the SEQ ID NO:26 that encodes respectively or SEQ ID NO:24 or SEQ ID NO:43.
Another preferred aspect, nucleic acid probe is respectively the mature polypeptide encoded district of SEQ ID NO:1,3,36 or 39 (trametess).Another preferred aspect, nucleic acid probe is respectively the mature polypeptide encoded district of SEQ IDNO:4,6,39 or 41 (Pachykytospora genus).Another preferred aspect, nucleic acid probe is respectively the mature polypeptide encoded district of SEQ ID NO:23,25 or 42 (white stake mushroom belong to).Another preferred aspect, nucleic acid probe is the part of the sequence in plasmid pHUda595 and pHUda594 respectively, encode the respectively mature polypeptide of plasmid pHUda595 of the present invention and pHUda594, these two plasmids are included in respectively in intestinal bacteria DSM17106 and intestinal bacteria DSM17105, and coding has the polypeptide of glucoamylase activity.
It is the long probe of at least 100 Nucleotide for length, being low to moderate very much very high stringent condition is defined as and follows standard Southern western blot procedure, in 42 ℃, 5X SSPE, 0.3%SDS, 200 μ g/ml through shear and through the salmon sperm DNA of sex change, and 25% methane amide (low stringency), 35% methane amide (medium and medium-high stringency) or 50% methane amide (high and very high stringency) in carry out prehybridization and the hybridization of best 12-24 hour.
It is the long probe of at least 100 Nucleotide for length, at last preferably under at least 50 ℃ (low stringencies), more preferably at least 55 ℃ (medium stringency), more preferably at least 60 ℃ (medium-high stringency), more preferably at least 65 ℃ (high stringency), most preferably at least 70 ℃ (very high stringency) conditions, solid support material is cleaned 3 times each 15 minutes with 2 * SSC, 0.2%SDS.
Be that about 15 Nucleotide are to the short probe of about 70 Nucleotide for length, stringent condition is defined as follows standard Southern western blot procedure, beguine according to the method for calculation of Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA48:1390) calculate T mThe temperature that value is low about 5 ℃ to about 10 ℃ carries out cleaning after prehybridization, hybridization and hybridization in 0.9M NaCl, 0.09M Tris-HClpH7.6,6mM EDTA, 0.5%NP-40,1X DenhardtShi solution, 1mM trisodium phosphate, 1mM SODIUM PHOSPHATE, MONOBASIC, 0.1mM ATP and 0.2mg/ml yeast rna.
Be about 15 Nucleotide to the short probes of about 70 Nucleotide for length, in the temperature than low about 5 ℃ to 10 ℃ of Tm calculated value, solid support material added 0.1%SDS cleaning 1 time 15 minutes with 6X SCC, then use 6X SSC than T mClean twice, each 15 minutes at the temperature that calculated value is low 5 ℃ to 10 ℃.
Under the hybridization conditions of saliferous, effective T mControlling the identity degree between the DNA of combination on the desired probe of successful hybridization and filter membrane.Can come effective T with following formula m, hybridize required identity degree to determine two DNA under different stringency conditions.
Effective T m=81.5+16.6 (log M[Na +])+0.41 (%G+C)-0.72 (% methane amide)
(referring to www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm)
The G+C content of the 55th to 2166 Nucleotide of the G+C content of SEQ ID NO:1 or SEQ ID NO:1 is 60.5%.The G+C content of the 55th to 1725 Nucleotide of the G+C content of SEQ ID NO:3 (cDNA) or SEQ ID NO:3 is 62.3%.
The G+C content of the 55th to 2189 Nucleotide of the G+C content of SEQ ID NO:4 or SEQ ID NO:4 is 60.7%.The G+C content of the 55th to 1725 Nucleotide of the G+C content of SEQ ID NO:6 (cDNA) or SEQ ID NO:6 is 63.7%.
For medium stringency, methane amide concentration is the Na of 35%, 5 * SSPE +Concentration is 0.75M.These values are used this formula, effectively T mIt is 79.0 ℃.
Another kind of important relation is: every 1% the mispairing of two DNA reduces the T of 1.4 ℃ mValue.For determining that two DNA 42 ℃ of identity degree that hybridization is required, use following formula under medium stringency condition:
The effective T of % homology=100-[( m-hybridization temperature)/1.4]
(referring to www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm)
These values are used this formula, and two DNA are 100-[(79.0-42 42 ℃ of required identity degree of hybridization under medium stringency condition)/1.4]=51%.
Variant
In yet another aspect, the present invention relates to artificial variant, its respectively SEQ ID NOS:2,5,24,26,37,40 and 43 or its mature polypeptide in comprise one or more amino acid whose conservative replacements, disappearance and/or insert.Preferably, the character of amino acid change is less important, can obviously not affect protein folding and/or active conserved amino acid replacement or insertion that is:; Normally 1 extremely about 30 amino acid whose segment lacks; Segment amino or C-terminal extend, such as aminoterminal methionine residues; Can reach the segment joint peptide of about 20-25 residue; Or the segment that is easy to purifying by changing net charge or another function extends, such as polyhistidine tract, antigenic epitopes or in conjunction with the territory.
The conservative example that replaces is in following each group: basic aminoacids (arginine, Methionin and Histidine), acidic amino acid (L-glutamic acid and aspartic acid), polare Aminosaeren (glutamine and l-asparagine), hydrophobic amino acid (leucine, Isoleucine and α-amino-isovaleric acid), die aromatischen Aminosaeuren (phenylalanine, tryptophane and tyrosine) and p1 amino acid (glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually the aminoacid replacement that does not change specific activity is known in the art, and for example H.Neurath and R.L.Hill are at (1979, Academic Press, NewYork) described in " The Proteins ".The replacement that the most often occurs is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly.
Except 20 kinds of standard amino acids, also available non-standard amino acid (such as 4-oxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline and Alpha-Methyl Serine) replaces the amino-acid residue of wild type peptide.Can come the substituted amino acid residue with a limited number of non-conservative amino acid, non-amino acid and alpha-non-natural amino acid by the genetic code coding." alpha-non-natural amino acid " modified after protein synthesis, and/or has the chemical structure different from standard amino acid on their side chain.But the chemosynthesis alpha-non-natural amino acid preferably can be bought by commercial sources, and alpha-non-natural amino acid comprises nipecotic acid, thiazolidine carboxylic acid, dehydroproline, 3-and 4-methylproline and 3,3-dimethyl proline(Pro).
Perhaps, amino acid change has such character, makes the physics-chem characteristic of polypeptide be changed.For example, amino acid change can improve polypeptide thermostability, change substrate specificity, change best pH etc.
Key amino acid in parent's polypeptide can determine according to program known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science244:1081-1085).In rear a kind of technology, each residue place in molecule introduces single alanine mutation, and the biologic activity (being glucoamylase activity) of testing resulting mutating molecule is to identify the vital amino-acid residue of molecular activity.Also can be referring to people such as Hilton, 1996, J.Biol.Chem.271:4699-4708.Also can pass through in conjunction with the amino acid whose sudden change in contact site of supposition the mensuration structure of technology such as nucleus magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, structure is carried out physics analysis, thereby determine that the avtive spot of enzyme or other biological interact.Such as referring to the people such as de Vos, 1992, Science255:306-312; The people such as Smith, 1992, J.Mol.Biol.224:899-904; The people such as Wlodaver, 1992, FEBS Lett.309:59-64.Also can infer the identity of key amino acid from the identity analysis of the polypeptide relevant to polypeptide of the present invention.
Single or multiple amino acid whose replacements and detection can followingly be carried out: use known mutagenesis, restructuring and/or reorganization (shuffling) method, the screening procedure of being correlated with subsequently, such as Reidhaar-Olson and Sauer, 1988, Science241:53-57; Bowie and Sauer, 1989, Proc.Natl.Acad.Sci.USA86:2152-2156; WO95/17413; Or WO95/22625 is disclosed.Spendable other method comprise fallibility PCR, phage display (such as people such as Lowman, 1991, Biochem.30:10832-10837; U.S. Patent number 5,223,409; WO92/06204), He Ding district's mutagenesis (region-directed mutagenesis) (people such as Derbyshire, 1986, Gene46:145; The people such as Ner, 1988, DNA7:127).
Mutagenesis/Shuffling Method can be combined with high-throughput, auto-screening method, for detection of by the clone of host cell expression, through the activity of the polypeptide of mutagenesis.Can use the standard method of this area to reclaim also checking order fast through mutagenized dna molecule of coding active polypeptide from host cell.But the importance of single amino acids residue in these method Fast Measurement desired polypeptides, and can be applicable to the polypeptide of structure the unknown.
The the 1st to 556 or the 1st to 561 of the SEQ ID NO:37 (trametes glucoamylase) of SEQ ID NO:2; Or in the 1st to 575 of SEQ ID NO:5 or SEQ ID NO:40 the 1st to 565 (Pachykytospora genus gluconobacter amylase) or the 1st to 556 of SEQ ID NO:26 or the 1st to 548 of SEQ IDNO:24 or SEQ ID NO:43 the 1st to 523 (white stake mushroom genus gluconobacter amylase), aminoacid replacement separately, disappearance and/or insert add up to 10, preferred 9, more preferably 8, more preferably 7, more preferably at the most 6, more preferably at the most 5, more preferably 4, even more preferably 3, most preferably 2 and even most preferably 1.
Source with polypeptide of glucoamylase activity
Can obtain polypeptide of the present invention from the microorganism of any genus.For purposes of the invention, term " from ... obtain " when the coupling of the source of this paper and appointment, should mean by nucleotide sequence coded polypeptide by this source generation, or the nucleotide sequence that comes from this source has inserted wherein bacterial strain generation.One preferred aspect, be secreted into the extracellular from the polypeptide of specifying the source to obtain.
In a preferred implementation, glucoamylase of the present invention is from Basidiomycetes (Basidiomycetes).In a preferred embodiment, glucoamylase of the present invention is from the trametes bacterial strain, more preferably from the bacterial strain of species Trametes cingulata, or the clone DSM17106 of preservation, or Pachykytospora belongs to bacterial strain, the clone DSM17105 of the more preferably bacterial strain of species Pachykytospora papyracea, or preservation, or a stake mushroom belongs to bacterial strain in vain, is more preferably the bacterial strain of species Leucopaxillus giganteus (Sow.: Fr.) Sing..
Should be appreciated that for above-mentioned species, no matter what known kind name is, the present invention had both comprised perfect state (perfect state) and imperfect state (imperfect state), also comprised other taxonomy Equivalent, for example anamorph.Those skilled in the art can easily identify the identity of suitable Equivalent.
Trametes cingulata bacterial strain gathered in Zimbabwe in 1995 to 1997.
Pachykytospora papyracea bacterial strain gathered in Zimbabwe in 1995 to 1997.
The Leucopaxillus giganteus (Sow.: Fr.) Sing. bacterial strain gathered in Denmark in 2003.
In addition, utilize above-mentioned probe, can originate from other, comprise from the microorganism that nature (such as soil, compost, water etc.) separates and identify and obtain these polypeptide.The technology of separate microorganism is well-known in art technology from natural habitat.Then can obtain polynucleotide by genome or the cDNA library of the another kind of microorganism of similar screening.In case go out the polynucleotide sequence of coded polypeptide with probe in detecting, just can separate or clone this polynucleotide by technology well known to those of ordinary skill in the art (such as referring to people such as Sambrook, 1989, the same).
Polypeptide of the present invention also comprises the fusion polypeptide of fusion polypeptide or cleavable, and wherein another polypeptide merges at the N-of described polypeptide or its fragment end or C-end.Can merge with nucleotide sequence of the present invention (or its part) by the nucleotide sequence (or its part) of another polypeptide of encoding and produce fusion polypeptide.Technology for generation of fusion polypeptide is known in this area, comprises the encoding sequence of connection coded polypeptide like this, and the expression that makes them be total to reading frame (in frame) and fusion polypeptide is subjected to identical promotor and the control of terminator.
Polynucleotide
The invention still further relates to the separation polynucleotide of the nucleotide sequence with code book invention polypeptide.One preferred aspect, described nucleotide sequence is respectively in SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 42 shown in arbitrary sequence.In another more preferred aspect, nucleotide sequence is sequence contained in plasmid pHuda595 or pHuda594, and these plasmids are included in respectively in intestinal bacteria DSM17106 and intestinal bacteria DSM17105.Another preferred aspect, nucleotide sequence is SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 42 mature polypeptide encoded district separately.Such nucleotide sequence is also contained in the present invention, its coding has respectively the polypeptide of the aminoacid sequence of SEQ IDNO:2,5,24,26,37, arbitrary sequence of 40 or 43 or its mature polypeptide, and its degeneracy because of genetic code is different from respectively SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 42.The invention still further relates to SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 42 subsequence separately, described subsequence encode respectively SEQ ID NO:2,5,24,26,37,40 or 43 the fragment with glucoamylase activity.
the invention still further relates to the sudden change polynucleotide, it is at SEQ ID NO:1, 3, 4, 6, 23, 25, 36, 38, 39, comprise the sudden change of at least one place in 41 or 42 in the mature polypeptide encoded sequence separately of arbitrary sequence, the nucleotide sequence coded polypeptide that is comprised of following sequence respectively wherein suddenlys change: the 1st to 556 amino acids of SEQ IDNO:2, the the 1st to 575 amino acids of SEQ ID NO:5, the the 1st to 548 amino acids of SEQ IDNO:24, the the 1st to 556 amino acids of SEQ ID NO:26, the the 1st to 561 amino acids of SEQID NO:37, the the 1st to 565 amino acids of SEQ ID NO:40 or the 1st to 523 amino acids of SEQ ID NO:43.
For separating of or the technology of the polynucleotide of clones coding polypeptide be known in this area, comprise from genomic dna and separating, from cDNA preparation, perhaps both combinations.For example, by utilize well-known polymerase chain reaction (PCR) or with the antibody screening expression library to detect the cloned DNA fragment with common structure feature, can realize from these genomic dna clonings polynucleotide sequence of the present invention.Such as referring to people such as Innis, 1990, " PCR:AGuide to Methods andApplication ", Academic Press, New York.Can also use other nucleic acid amplification program, such as ligase chain reaction (LCR) (LCR), connect activated transcription (LAT) and based on the amplification (NASBA) of nucleotide sequence.Can belong to bacterial strain from trametes bacterial strain, Pachykytospora, white stake mushroom belong to bacterial strain or other or relevant organism clone polynucleotide, so it can be for example in nucleotide sequence the equipotential of polypeptid coding area or plant between variant.
the invention still further relates to the polynucleotide with following nucleotide sequence, this nucleotide sequence and following mature polypeptide encoded sequence: SEQ ID NO:1 (i.e. 55 to 2166 Nucleotide), or SEQ IDNO:3 (i.e. 55 to 1725 Nucleotide), or SEQ ID NO:4 (i.e. 55 to 2182 Nucleotide), or SEQ ID NO:6 (i.e. 55 to 1725 Nucleotide), or SEQ ID NO:25 (i.e. 52 to 1719 Nucleotide), or SEQ ID NO:38 (i.e. 55 to 1737 Nucleotide), or SEQ ID NO:41 (i.e. 55 to 1749 Nucleotide), or SEQ ID NO:42 (i.e. 55 to 1620 Nucleotide) has at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 96%, even more preferably at least 97%, even more preferably at least 98%, and at least 99% identity most preferably, this polynucleotide encoding active polypeptide.
For polypeptide synthetic and that polypeptide of the present invention is substantially similar, may the essential nucleotide sequence of modifying coded polypeptide.Term and certain polypeptide " substantially similar " refer to the non-natural form of this polypeptide.These polypeptide may be different from from its natural origin isolated polypeptide aspect engineered at some, such as at different artificial variants in aspect such as specific activity, thermostability, best pH.The structure of variant sequence can pass through following manner: build on the basis of the nucleotide sequence shown in SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 42 mature polypeptide encoded district separately, for example its subsequence; And/or replace by introducing such Nucleotide: it can not cause the coded polypeptide of nucleotide sequence to have another kind of aminoacid sequence but be consistent with the codon usage of the host organisms that will be used for producing enzyme; Perhaps replace by introducing the Nucleotide that can cause the different aminoacids sequence.The generality that replaces for Nucleotide is described can be referring to such as people such as Ford, 1991, Protein Expression andPurification2:95-107.
To those skilled in the art, it is evident that these kinds replacement can carry out and still can obtain active polypeptide outside the critical area of molecular function.Can differentiate for amino-acid residue vital by the activity of the coded polypeptide of separation polynucleotide of the present invention so that preferably do not replace according to the known procedure of this area, such as site-directed mutagenesis or alanine scanning mutagenesis (for example referring to Cunningham and Wells, 1989, Science244:1081-1085).In rear a kind of technology, each positively charged residue place's introducing sudden change, then test glucoamylase activity to identify the vital amino-acid residue of molecular activity to the mutating molecule that obtains in molecule.Substrate-enzyme interacting site also can be determined by three-dimensional structural analysis, wherein three-dimensional structure can be measured by technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (such as referring to people such as de Vos, 1992, Science255:306-312; The people such as Smith, 1992, Journal of Molecular Biology224:899-904; The people such as Wlodaver, 1992, FEBS Letters309:59-64).
The invention still further relates to the separation polynucleotide of code book invention polypeptide as described below: (i) low stringent condition, more preferably medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 55th to 2166 Nucleotide of SEQ ID NO:1 or with the 55th to 2166 the Nucleotide hybridization of SEQ ID NO:36; Or (ii) medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 55th to 1725 Nucleotide of SEQ ID NO:3 or with the 55th to 1737 Nucleotide of SEQ IDNO:38 in contained cDNA sequence hybridization; Or (iii), (i) or complementary strand (ii); Or its allelic variant and subsequence (people such as Sambrook, 1989, the same), as defined herein.
The invention still further relates to the separation polynucleotide of code book invention polypeptide as described below: (i) low stringent condition, more preferably medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 55th to 2182 the Nucleotide hybridization of the 55th to 2189 Nucleotide or the SEQ ID NO:39 of SEQ ID NO:4; Or (ii) medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 55th to 1725 Nucleotide of SEQ ID NO:6 or with the 55th to 1749 Nucleotide of SEQ IDNO:41 in contained cDNA sequence hybridization; Or (iii) (i) or complementary strand (ii); Or its allelic variant and subsequence (people such as Sambrook, 1989, the same), as herein defined.
The invention still further relates to the separation polynucleotide of code book invention polypeptide as described below: (i) low stringent condition, more preferably medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 117th to 2249 the Nucleotide hybridization of SEQ ID NO:23; Or (ii) low stringent condition, preferred medium stringent condition, more preferably medium-Gao stringent condition, even more preferably high stringency condition and most preferably under very high stringent condition respectively with the 52nd to 1719 Nucleotide of SEQ IDNO:25 or with the 52nd to 1620 Nucleotide of SEQ ID NO:42 in contained cDNA sequence hybridization; Or (iii) (i) or complementary strand (ii); Or its allelic variant and subsequence (people such as Sambrook, 1989, the same), as defined herein.
The invention still further relates to the separation polynucleotide of following acquisition: (a) under low, medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 55th to 2166 Nucleotide of (i) SEQ ID NO:1 or with the 55th to 2166 the Nucleotide hybridization of SEQ ID NO:36; (ii) under medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 55th to 1725 Nucleotide of SEQ ID NO:3 or with the 55th to 1737 Nucleotide of SEQ ID NO:38 in contained cDNA sequence hybridization; Or (iii) (i) or complementary strand (ii); And the polynucleotide of hybridization (b) separate to occur; This polynucleotide encoding has the polypeptide of glucoamylase activity.
The invention still further relates to the separation polynucleotide of following acquisition: (a) under low, medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 55th to 2189 Nucleotide of (i) SEQ ID NO:4 or with the 55th to 2182 the Nucleotide hybridization of SEQ ID NO:39; (ii) under medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 55th to 1725 Nucleotide of SEQ ID NO:6 or with the 55th to 1749 Nucleotide of SEQ ID NO:41 in contained cDNA sequence hybridization; Or (iii) (i) or complementary strand (ii); And the polynucleotide of hybridization (b) separate to occur; This polynucleotide encoding has the polypeptide of glucoamylase activity.
The invention still further relates to the separation polynucleotide of following acquisition: (a) under low, medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 117th to 2249 the Nucleotide hybridization of (i) SEQ ID NO:23; (ii) under medium, medium-Gao, height or very high stringent condition with DNA colony respectively with the 52nd to 1719 Nucleotide of SEQ ID NO:25 or with the 52nd to 1620 Nucleotide of SEQ ID NO:42 in contained cDNA sequence hybridization; Or (iii) (i) or complementary strand (ii); And the polynucleotide of hybridization (b) separate to occur; This polynucleotide encoding has the polypeptide of glucoamylase activity.
Nucleic acid construct
The invention still further relates to and comprise the nucleic acid construct that separates polynucleotide of the present invention that is operatively connected with one or more control sequences, described control sequence is suitably instructing the expression of encoding sequence in host cell under the condition compatible with control sequence.
Can utilize the separation polynucleotide of several different methods operate coding polypeptide of the present invention so that the expression of polypeptide to be provided.According to the difference of expression vector, may wish or must operate on it before with the polynucleotide sequence insertion vector.The technology of utilizing recombinant DNA method to modify polynucleotide sequence is for well-known in the art.
Control sequence can be suitable promoter sequence, namely is subject to the nucleotide sequence that host cell identifies to express the polynucleotide of code book invention polypeptide.Promoter sequence comprises the transcriptional control sequence of regulating expression of polypeptides.Promotor can be any nucleotide sequence that shows transcriptional activity in selected host cell, comprises sudden change, brachymemma and promotor heterozygosis, and can be in the extracellular of coding and host cell homology or allos or cell obtains the gene of polypeptide.
example for the suitable promotor that instructs nucleic acid construct of the present invention to transcribe at filamentous fungal host cell is from aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartate protease, the aspergillus niger neutral alpha-amylase, α-amylase is stablized in aspergillus niger acid, aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triosephosphate isomerase, Aspergillus nidulans (Aspergillus nidulans) acetamidase, Fusarium venenatum glucoamylase (WO00/56900), Fusarium venenatum Daria (WO00/56900), Fusariumvenenatum Quinn (WO00/56900), fusarium oxysporum (Fusarium oxysporum) trypsin-like proteolytic enzyme (WO96/00787), Trichoderma reesei beta-glucosidase enzyme, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei endoglucanase i, Trichoderma reesei EG II, Trichoderma reesei EG III, Trichoderma reesei EG IV, Trichoderma reesei EGV, Trichoderma reesei xylanase I, Trichoderma reesei xylanase I I, the promotor that obtains in Trichoderma reesei xylobiase gene, and NA2-tpi promotor (from the hybrid promoter of aspergillus niger neutral alpha-amylase and aspergillus oryzae phosphotriose isomerase gene), and sudden change, brachymemma and promotor heterozygosis.
In yeast host, useful promotor is to obtain from yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae galactokinase (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), yeast saccharomyces cerevisiae triosephosphate isomerase (TPI), brewing yeast metallothionein (CUP1) and yeast saccharomyces cerevisiae 3-phoshoglyceric acid kinase gene.Also have the people such as Romanos, described other the useful promotor that is used for yeast host cell in 1992, Yeast8:423-488.
Control sequence can be also suitable Transcription Termination subsequence, namely identifies by host cell the sequence that stops transcribing.The terminator sequence is operatively connected in 3 of the nucleotide sequence of coded polypeptide ' end.Any terminator that works in selected host cell all can be used for the present invention.
To obtain from the gene of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, aspergillus niger alpha-glucosidase and fusarium oxysporum trypsin-like proteolytic enzyme for the preferred terminator of filamentous fungal host cell.
To obtain from the gene of yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate, brewing yeast cell pigment C (CYC1) and yeast saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase for the preferred terminator of yeast host cell.Also have the people such as Romanos, 1992, with other useful terminator that is used for yeast host cell of upper description.
Control sequence can also be suitable leader sequence, the important mRNA non-translational region of translation that namely host cell is carried out.Leader sequence is operatively connected in 5 of the nucleotide sequence of coded polypeptide ' end.Any leader sequence that works in selected host cell all can be used for the present invention.
For filamentous fungal host cell, preferred leader sequence obtains from aspergillus oryzae TAKA amylase and Aspergillus nidulans phosphotriose isomerase gene.
For yeast host cell, suitable leader sequence is to obtain from the gene of yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, yeast saccharomyces cerevisiae α-factor and Ethanol in Saccharomyces cerevisiae desaturase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
Control sequence can also be the polyadenylation sequence, and it is a kind of being operatively connected in the sequence of nucleotide sequence 3 ' end, can be identified as by host cell when transcribing and add poly-adenosine residue on the mRNA that transcribes signal.Any polyadenylation sequence that works in selected host cell all can be used for the present invention.
For filamentous fungal host cell, preferred polyadenylation sequence is that the gene from aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, fusarium oxysporum trypsin-like proteolytic enzyme and aspergillus niger alpha-glucosidase obtains.
The people such as Guo and Sherman has described the polyadenylation sequence useful to yeast host cell in 1995, Molecular Cellular Biology15:5983-5990.
Control sequence can also be signal peptide coding region, and the N-terminal that the aminoacid sequence of its coding is connected in polypeptide and guides the polypeptide of coding to enter the emiocytosis approach.5 of the encoding sequence of nucleotide sequence ' end can comprise signal peptide coding region inherently, it the translation reading frame in the coding secrete polypeptide natural connection of coding section.Perhaps, 5 of encoding sequence ' end can comprise the signal peptide coding region for the encoding sequence external source.If the natural signal peptide coding region that do not contain of encoding sequence may need the signal peptide coding region of external source.Perhaps, the signal peptide coding region of external source can directly be replaced the natural signals peptide-coding region in order to strengthen the secretion of polypeptide.Yet any signal peptide coding region that instructs the polypeptide of expressing to enter selected secretory host cell approach all can be used for the present invention.
It is the signal peptide coding region that obtains from the gene of aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, Rhizomucor miehei aspartate protease, Humicola insolens cellulase and Humicola lanuginosa lipase for the effective signal peptide coding region of filamentous fungal host cell.
To obtain from the gene of yeast saccharomyces cerevisiae α-factor and yeast saccharomyces cerevisiae saccharase for the useful signal peptide of yeast host cell.Also have the people such as Romanos, 1992, with upper other useful signal peptide coding region of having described.
Control sequence can also be propetide (propeptide) coding region, and its coding is positioned at the aminoterminal aminoacid sequence of polypeptide.The polypeptide of gained is called proenzyme (proenzyme) or propolypeptide (propolypeptide) (or sometimes being called proenzyme (zymogen)).Propolypeptide is generally not have activatedly, and can catalysis or autocatalysis cutting by propetide be transformed into ripe activated polypeptide from propolypeptide.Front peptide-coding region can obtain from the gene of bacillus subtilis alkali proteinase (aprE), subtilis neutral protease (nprT), yeast saccharomyces cerevisiae α-factor, Rhizomucor miehei aspartate protease and Myceliophthora thermophila laccase (WO95/33836).
When signal peptide and propetide district all were present in the N-terminal of polypeptide, the propetide district was positioned at the position adjacent with the N-terminal of polypeptide, and the signal peptide district is positioned at the position adjacent with the N-terminal in propetide district.
The expression of polypeptide also may need to add the adjusted sequence so that can be regulated with respect to the growth of host cell.The example of regulation system is can respond chemistry or physical stimulation (comprising the existence of regulating compound) and cause the unlatching of genetic expression or close.In prokaryotic system, regulation system comprises lac, tac and trp operon system.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, can use TAKA α-amylase promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor as regulating sequence.Other example of regulating sequence is that those sequences of condition are provided for gene amplification.In eukaryotic system, these are included in the dihydrofolate reductase gene that methotrexate (methotrexate) increases when existing, and the metallothionein gene of have heavy metal to exist time amplification.In these situations, the nucleotide sequence of coded polypeptide will be operatively connected with the adjusting sequence.
Expression vector
The invention still further relates to and comprise polynucleotide of the present invention, promotor and transcribe recombinant expression vector with the translation termination signal.Various nucleic acid as herein described and control sequence can be coupled together to produce recombinant expression vector, this recombinant expression vector can comprise that one or more suitable restriction sites make the nucleotide sequence that can insert or replace coded polypeptide in these sites.Perhaps, nucleotide sequence of the present invention can be expressed by nucleotide sequence or the nucleic acid construct that contains this sequence are inserted suitable expression vector.During construction of expression vector, encoding sequence is placed in carrier so that encoding sequence and suitable expression control sequenc are operatively connected.
Recombinant expression vector can be can accept aptly the recombinant DNA operation and can cause any carrier (for example plasmid or virus) that nucleotide sequence is expressed.The selection of carrier is generally depended on carrier and will be introduced consistency between the host cell of this carrier.Carrier can be plasmid linear or closed hoop.
Carrier can be autonomously replicationg vector, namely carrier can karyomit(e) the form of outer entity exist, it copies and is independent of chromosomal copying, for example plasmid, extra-chromosomal element, minichromosome or artificial chromosome.Carrier can comprise any means be used to guaranteeing self-replacation.Perhaps, carrier can be so a kind of carrier, and it is incorporated in genome and copies together with karyomit(e) that it is integrated into after importing host cell.In addition, single carrier or plasmid be can use, or two or more carriers or the plasmid of all DNA of host cell gene group to be introduced, perhaps transposon contained together.
Carrier of the present invention preferably comprises one or more selective markers, described selective marker allow to be easy to select to transform cell.Selective marker is a kind of gene, and its product helps to produce biocide or virus resistance, heavy metal resistance, auxotroph becomes prototroph etc.
The mark example that is suitable for yeast host cell has ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.the selective marker of using in thread host cell includes but not limited to: amdS (acetamidase), argB (ornithine transcarbamylase), bar (phosphinothricin acetyltransferase), hph (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5 '-phosphate decarboxylase), sC (sulfate adenylyl transferase (sulfate adenyltransferase)), and trpC (o-amino benzoyl acid synthase) and Equivalent thereof.What be preferred for the Aspergillus cell is the amdS of Aspergillus nidulans or aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus).
Carrier of the present invention preferably comprises the permission carrier and is incorporated in the host cell gene group or allows carrier not rely on the element of genome self-replicating in cell.
In order to be incorporated into the host cell gene group, the polynucleotide sequence of the responsible coded polypeptide of carrier or any other carrier element and by homology or non-homogeneous recombination and integration in genome.Perhaps, carrier can comprise additional nucleotide sequence and is used in reference to conducting and crosses homologous recombination in the karyomit(e) exact position is integrated into the host cell gene group.In order to improve the possibility of integrating in the exact position, the nucleic acid that has height identity with corresponding target sequence that integrated element should preferably comprise enough numbers, such as 100-10,000 base pair, preferred 400-10,000 base pair and 800-10 most preferably, 000 base pair, thereby the probability of raising homologous recombination.Integrated element can be with the host cell gene group in any sequence of target sequence homology.In addition, integrated element can be non-coding or coding nucleotide sequence.On the other hand, carrier can be by non-homogeneous recombination and integration in the genome of host cell.
For self-replicating, carrier also can comprise the replication orgin that can make carrier self-replicating in the host cell of discussing.Replication orgin can be any plasmid replication factor of the adjusting self-replicating that works in cell.Term " replication orgin " or " plasmid replicon " are defined as the nucleotide sequence that plasmid or carrier are copied in vivo in this article.
The example that is used for the replication orgin of yeast host cell is the combination of 2 μ m replication orgin, ARS1, ARS4, ARS1 and CEN3, the combination that reaches ARS4 and CEN6.
The example that can be used for the replication orgin of filamentous fungal cells has AMA1 and ANS1 (people such as Gems, 1991, Gene98:61-67; The people such as Cullen, 1987, Nucleic Acids Research15:9163-9175; WO00/24883).The separation of AMA1 gene and the plasmid or the Vector construction that comprise this gene can be completed according to disclosed method in WO00/24883.
Can with in the more than one copy Insertion Into Host Cell of polynucleotide of the present invention to improve the output of gene product.Improving the polynucleotide copies number can realize by following means: at least one additional copies of sequence is integrated in the host cell gene group; Or make and comprise the selectable marker gene that can increase in polynucleotide, and cultivate this cell under suitable selective agent exists, with the more multiple copied that filters out the described polynucleotide of the amplification copy that comprises described selectable marker gene-therefore also comprise-cell.
Be used for connecting said elements is (such as referring to people such as Sambrook, 1989, the same) well-known to those skilled in the art with the method that builds recombinant expression vector of the present invention.
Host cell
The invention still further relates to the recombinant host cell that comprises polynucleotide of the present invention, they can be advantageously used in the recombinant production of polypeptide.Can will comprise the carrier of polynucleotide of the present invention import host cell so that carrier remains chromosomal intasome or as the outer carrier of the karyomit(e) of self-replicating, as previously mentioned.Term " host cell " comprise all that due to the sudden change that occurs between replicative phase the offspring of the parental cell identical with parental cell not.The gene that being chosen in of host cell depends on coded polypeptide to a great extent and its source.
Host cell can be eukaryote, for example Mammals, insect, plant or fungal cell.
One preferred aspect, host cell is the fungal cell." fungi " comprises Ascomycota (Acomycota) when being used for this paper, Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota), and Zygomycota (Zygomycota) is (as people such as Hawksworth, at " Ainsworth and Bisby ' sDictionary of The Fungi ", the 8th edition, 1995, CAB International, University Press, Cambridge, defined in UK), and oomycetes door (Oomycota) is (as people such as Hawksworth, 1995, quote in the same the 171st page) and all mitospore fungies (mitosporicfungi) (people such as Hawksworth, 1995, the same).
One preferred aspect, fungal host cells is yeast cell." yeast " comprises ascosporogenous yeast (Endomycetale Endomycetales), product sporidium yeast and belongs to the yeast (gemma guiding principle Blastomycetes) of imperfect fungi when being used for this paper.Because the classification of yeast also can change from now on, for the present invention, yeast should be as at " Biology and Activities ofYeast " (Skinner, F.A., Passmore, S.M. and Davenport, R.R. compile Soc.App.Bacteriol.Symposium SeriesNo.9,1980) in defined.
One preferred aspect, yeast host cell is that mycocandida (Candida), Hansenula anomala belong to (Hansenula), Crewe Vickers yeast belong (Kluyveromyces), pichia belongs to (Pichia), yeast belong (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or Yarrowia and belongs to cell.
One most preferred aspect, yeast host cell is saccharomyces carlsbergensis (Saccharomycescarlsbergenis), yeast saccharomyces cerevisiae, saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces douglasii, Crewe not yeast (Saccharomyces kluyveri), promise yeast (Saccharomyces norbenis) or Saccharomyces oviformis cell.Another most preferred aspect, yeast host cell is newborn Crewe Vickers yeast (Kluyveromyces lactis) cell.Another most preferred aspect, yeast host cell is Yarrowia lipolytica cell.
In another more preferred aspect, fungal host cells is filamentous fungal cells." filamentous fungus " comprises all filaments (as people such as Hawksworth, 1995, with upper defined) of Mycophyta (Eumycota) and oomycetes Men Yamen (Oomycota).Filamentous fungus normally take by chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans, and the mycelia wall that forms of other complex polysaccharides as feature.Nourishing and growing is to extend by mycelia, and the carbon metabolism is obligate aerobic.On the contrary, nourishing and growing of yeast such as yeast saccharomyces cerevisiae is by the sprouting of unicellular thalline, and the carbon metabolism can be fermentable.
one even preferred aspect, filamentous fungal host cell is Acremonium (Acremonium), Aspergillus, Aureobasidium (Aureobasidium), smoke pipe Pseudomonas (Bjerkandera), Ceriporiopsis belongs to, Coprinus (Coprinus), Coriolus Qu61 (Coriolus), Cryptococcus (Cryptocoecus), Filibasidium belongs to, fusarium (Fusarium), Humicola (Humicola), Magnaporthe belongs to, Mucor (Mucor), myceliophthora (Myceliophthora), Neocallimastix belongs to, Neurospora (Neurospora), paecilomyces (Paecilomyces), Penicillium (Penicillium), Phanerochaete belongs to, penetrate arteries and veins Pseudomonas (Phlebia), Piromyces belongs to, pleurotus (Pleurotus), Schizophyllum (Schizophyllum), Talaromyces belongs to (Talaromyces), thermophilic ascomycete belongs to (Thermoascus), Thielavia (Thielavia), Tolypocladium belongs to, trametes (Trametes), or the cell of Trichoderma (Trichoderma).
One most preferred aspect, filamentous fungal host cell is Aspergillus awamori, Aspergillus fumigatus (Aspergillus fumigatus), smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillusiaponicus), Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.another most preferred aspect, filamentous fungal host cell is bar spore shape sickle spore (Fusarium bactridioides), Fusariumcerealis, Fusarium crookwellense, machete sickle spore (Fusarium culmorum), fusarium graminaria (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusarium heterosporium), albizzia sickle spore (Fusarium negundi), fusarium oxysporum, racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.another most preferred aspect, filamentous fungal host cell is without smoke pipe bacterium (Bjerkandera adusta), Ceriporiopsisaneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsispannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsissubvermispora, ash lecher's umbrella (Coprinus cinereus), hairy fungus (Coriolus hirsutus), Humicola insolens, Humicola lanuginosa, graceful hertz of Mucor (Mucor miehei), Myceliophthora thermophila, Neuraspora crassa (Neurospora crassa), penicillium purpurogenum (penicillum purpurogenum), Phanerochaete chrysosporium, arteries and veins bacterium (Phlebia radiata) is penetrated in radiation, Pleurotus eryngii, autochthonal shuttle spore shell (Thielavia terrestris), long wool hair bolt bacterium (Trametes villosa), Trametes versicolor, trichoderma harziarum (Trichodermaharzianum), healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichoderma reesei, or viride (Trichoderma viride) cell.
The fungal cell can transform by the process that relates to protoplastis formation, protoplast transformation and cell walls regeneration in a manner known way.EP238,023 and the people such as Yelton, the process that suitable Aspergillus and Trichoderma host cell transform has been described in 1984, Proceedingsof the National Academy of Sciences USA81:1470-1474.The people such as Malardier have described the method for suitable conversion fusarium species in 1989, Gene78:147-159 and WO96/00787.Can utilize Becker and Guarente at Abelson, J.N. and Simon, " the Guide to Yeast Genetics andMolecular Biology " that M.I. compiles, Methods in Enzymology, Vol.194, pp182-187, AcademicPress company, New York; The people such as Ito, 1983, Journal of Bacteriology153:163; And the people such as Hinnen, the program transformed yeast described in 1978, Proceedings of the National Academy of Sciences USA75:1920.
Production method
The invention still further relates to the method for production polypeptide of the present invention, comprising: (a) helping to produce culturing cell under the condition of described polypeptide, the wild-type of described cell can produce described polypeptide; And (b) reclaim described polypeptide.One preferred aspect, described cell is that trametes, Pachykytospora belong to or a white stake mushroom belongs to cell, and is more preferably Trametes cingulata, Pachykytospora papyracea or Leucopaxillus giganteus (Sow.: Fr.) Sing..
The invention still further relates to the method for production polypeptide of the present invention, comprising: (a) cultivate host cell helping to produce under the condition of described polypeptide; And (b) reclaim described polypeptide.
The invention still further relates to the method for production polypeptide of the present invention, comprise: (a) helping to produce under the condition of described polypeptide, cultivation comprises the host cell of following nucleotide sequence, described nucleotide sequence has SEQ ID NO:1,3,4,6,23,25,36,38,39,41 or 43 mature polypeptide encoded district separately, this nucleotide sequence coded polypeptide wherein, this polypeptide is respectively by the 1st to 556 amino acids of SEQ ID NO:2 or the 1st to 561 amino acids of SEQ ID NO:37; Or the 1st to 565 amino acids of the 1st to 575 amino acids of SEQ ID NO:5 or SEQ ID NO:40 forms; Or formed by the 1st to 556 amino acids of SEQ ID NO:26 or the 1st to 548 amino acids of SEQ ID NO:24 or the 1st to 523 amino acids of SEQ ID NO:43 respectively; And (b) reclaim this polypeptide.
In production method of the present invention, utilize method well-known in the art culturing cell in being suitable for producing the nutritional medium of described polypeptide.For example; cell cultures can be in laboratory or industrial fermentation tank in suitable substratum with the condition that allows described polypeptide be expressed and/or separate under, undertaken by shake-flask culture, small-scale or large scale fermentation (comprising continuous, in batches, feed supplement-in batches or solid state fermentation).Cultivation can use program known in the art to carry out in the suitable nutrient medium that contains carbon source, nitrogenous source and inorganic salt.Suitable substratum can obtain from commercial supplier, perhaps can prepare according to published formula (for example disclosed in the catalogue of American type culture collection).If polypeptide is secreted in nutritional medium, can directly reclaim polypeptide from substratum so.If polypeptide is not secreted in substratum, it can reclaim from cell lysate.
Described polypeptide can detect by the method to polypeptid specificity known in the art.These detection methods can comprise the use of specific antibody, the generation of enzyme product, the perhaps disappearance of enzyme substrates.For example, can determine with enzymatic determination as described herein the activity of enzyme.
The gained polypeptide can reclaim by methods known in the art.For example, described polypeptide can reclaim from nutritional medium by conventional procedure, and described program includes but not limited to: centrifugal, filtration, extraction, spraying drying, evaporation or precipitation.
Polypeptide of the present invention can pass through multiple programs purifying known in the art, include but not limited to following program: chromatography (for example ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis (for example preparation property isoelectrofocusing), difference solubleness (for example ammonium sulfate precipitation), SDS-PAGE or extraction are (for example referring to " Protein Purification ", J.-C.Janson and Lars Ryden compile, VCHPublishers, New York, 1989), to obtain basically pure polypeptide.
Plant
The invention still further relates to the nucleotide sequence conversion that the present invention that is encoded has the polypeptide of glucoamylase activity, thereby reach and produce transgenic plant, plant part or the vegetable cell of this polypeptide with recyclable scale.Described polypeptide can reclaim from plant or plant part.Perhaps, plant or the plant part itself that will contain recombinant polypeptide are used for improving food or quality of the fodder, for example improve nutritive value, palatability (palatability) and rheological or destroy antinutritional factor (antinutritive factor).
Transgenic plant can be dicots (dicotyledonss) or monocotyledonous (monocotyledons).Monocotyledonous example has dogstail (grasses), for example meadow grass (meadow grass) (bluegrass (bluegrass), Poa L. (Poa)); Forage grass (forage grass) belongs to (Festuca), lolium (Lolium) such as the sheep lance; Temperate zone grass (temperate grass), for example Agrostis (Agrostis); And cereal (cereals), for example wheat (wheat), oat (oat), rye (rye), barley (barley), rice (rice), Chinese sorghum (sorghum) and Zea mays (maize) (corn (corn)).
The example of dicotyledons has: tobacco; Beans (legumes), for example lupine (lupins); Potato; Beet; Pea; Kidney bean (bean) and soybean, and Cruciferae (Brassicaceae) plant, for example Cauliflower (cauliflower), Semen Brassicae campestris (rape seed) and sibship model animals Arabidopis thaliana (Arabidopsis thaliana) closely with it.
The example of plant part has stem, callus, leaf, root, fruit, seed and stem tuber, and the independent tissue that consists of these parts, for example epidermis, mesophyll, parenchyma, vascular tissue, meristematic tissue.Special vegetable cell compartment (compartments) is also thought plant part such as chloroplast(id), apoplast, plastosome, vacuole, peroxysome and tenuigenin.In addition, any vegetable cell, whatsoever tissue-derived, also think plant part.Similarly, plant part is helped particular organization and the cell of application of the present invention and is also thought plant part, for example embryo, endosperm, aleuron and kind skin such as separated use.
The offspring of these plants, plant part and vegetable cell also is included in the scope of the present invention.
Can be according to transgenic plant or the vegetable cell of methods known in the art construction expression polypeptide of the present invention.In brief, the structure of plant or vegetable cell can pass through: the expression construct of one or more code book invention polypeptide is incorporated in plant host genome or chloroplast gene group, and makes the modified plant of gained or vegetable cell propagation form transgenic plant or vegetable cell.
Described expression construct is nucleic acid construct suitably, and it comprises code book invention polypeptide and the polynucleotide that are connected of the suitable regulating and controlling sequence required with express this nucleotide sequence in selected plant or plant part operationally.In addition, this expression construct can also comprise: the selective marker that can be used for identifying the host cell of having integrated described expression construct; And this construct is imported the DNA sequence dna (latter is depended on the DNA introduction method of use) that described plants needs.
Regulate the selection of sequence (for example promotor and terminator sequence, and optional signal or transhipment (transit) sequence), according to for example wanting to express this polypeptide when, where, how to determine.For example, the expression of the gene of code book invention polypeptide can be composing type or induction type, perhaps can be development-specific, phasic specificity or tissue-specific, and gene product can be by target in concrete tissue or plant part for example seed or leaf.Have such as Tague etc. to the description of regulating sequence, 1988, Plant Physiology86:506.
For the constructive expression, can use 35S-CaMV, corn ubiquitin 1 and rice actin promotor (Franck etc., 1980.Cell21:285-294, Christensen AH, Sharrock RA and Quail, 1992, Plant Mo.Biol.18:675-689; Zhang W, McElroy D. and Wu R., 1991, PlantCell3:1155-1165).organ specific promotor can be, for example, from storage property storage tissue (storage sink tissues) for example stem tuber of seed, potato and promotor (Edwards and the Coruzzi of fruit, 1990, Ann.Rev.Genet.24:275-303), perhaps from metabolic storage tissue (metabolic sink tissues), such as merismatic promotor (Ito etc., 1994, Plant Mol.Biol.24:863-878), or the promotor of seed-specific, for example from the gluten of rice, prolamine, sphaeroprotein or albumin promoter (Wu etc., 1998, Plant and CellPhysiology39:885-889), from the legumin B4 of broad bean (Vicia faba) and the broad bean promotor (Conrad etc. of the Seed Storage Protein gene of the unknown, 1998, Journal of Plant Physiology152:708-711), promotor (Chen etc. from a kind of seed oil body (seed oil body) albumen, 1998, Plant and CellPhysiology39:935-941), storage albumen napA promotor from colea (Brassica napus), or the promotor of any other seed-specific known in the art, for example WO91/14772 is described.In addition, this promotor can be the specific promotor of leaf, such as the rbcs promotor (Kyozuka etc., 1993, Plant Physiology102:991-1000) from rice or tomato; Chlorella virus VITAMIN B4 methyl transferase gene promotor (Mitra and Higgins, 1994, PlantMolecular Biology26:85-93), or from the aldP gene promoter (Kagaya etc. of rice, 1995, Molecular and General Genetics248:668-674); Or be the promotor of wound-induced (woundinducible), such as potato pin2 promotor (Xu etc., 1993, Plant MolecularBiology22:573-588).Similarly, this promotor also can by the processing of inanimate for example temperature, arid or salinity change induce, the material of the activation promotor that is perhaps added, for example ethanol, oestrogenic hormon, plant hormone such as ethene, dormin and gibberic acid, and heavy metal induce.
Also can use the promotor enhancer element to realize the more high expression level of polypeptide of the present invention in plant.For example, the promotor enhancer element can be the intron between the nucleotide sequence of promotor and code book invention polypeptide.Such as people such as Xu, 1993, utilize the First Intron of rice actin 1 gene to strengthen expression with upper disclosing.
Any other part of selectable marker gene and expression construct can be from this area can with those select.
Can nucleic acid construct be integrated in Plant Genome according to routine techniques known in the art, comprise that the conversion of edaphic bacillus (Agrobacterium) mediation, virus-mediated conversion, microinjection, particle bombardment, biological projectile transform (biolistic transformation) and the electroporation (people such as Gasser, 1990, Science244:1293; Potrykus, 1990, Bio/Technology8:535; The people such as Shimamoto, 1989, Nature338:274).
At present, the transgenosis of Agrobacterium tumefaciems (Agrobacterium tumefaciens) mediations is to produce the prefered method of transgenosis dicotyledons (its summary can be referring to Hooykas and Schilperoort, 1992, Plant Molecular Biology19:15-38), and can be used for transforming monocots, although these plants are often used other method for transformation.At present, being preferred for producing the monocotyledonous method of transgenosis is particle bombardment (minimum gold or tungsten particle, the DNA that is used to transform is coated with) embryo callus or developmental embryo (Christou, 1992, Plant Journal2:275-281; Shimamoto, 1994, Current Opinion Biotechnology5:158-162; The people such as Vasil, 1992, Bio/Technology10:667-674).The method of another optional transforming monocots is based on protoplast transformation, and as Omirulleh etc., 1993, Plant Molecular Biology21:415-428 is described.
After conversion, select the transformant that is integrated into expression construct according to method well known in the art, and make its regeneration become complete plant.Usually the design method for transformation to be optionally to remove Select gene in regenerative process or follow-up generation, for example by with two independent T-DNA construct cotransformations, or by specific recombinase-site specific the cutting-out Select gene.
The invention still further relates to the method for production polypeptide of the present invention, comprise that (a) helping to produce under the condition of described polypeptide, cultivation contains transgenic plant or the vegetable cell of following polynucleotide, and described polynucleotide encoding the present invention has the polypeptide of glucoamylase activity; And (b) reclaim described polypeptide.
Composition
The invention still further relates to the composition that comprises polypeptide of the present invention.Preferably, described composition enrichment such polypeptide.The glucoamylase activity of term " enrichment " expression said composition is increased, and for example increases to be at least 1.1 enrichment factor (enrichment factor).
Described composition can comprise polypeptide of the present invention as the Major Enzymes component, for example the one-component composition.perhaps, said composition can contain the plurality of enzymes activity, aminopeptidase for example, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase, the halo peroxidase, saccharase, laccase, lipase, mannosidase, oxydase, pectin decomposing enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases or zytase.More enzyme can by, for example, belong to the microorganisms of lower dependent of dead military hero: Aspergillus, preferred microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori, Aspergillus fumigatus, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger or aspergillus oryzae; Fusarium, preferred bar spore shape sickle spore, Fusarium cerealis, Fusariumcrookwellense, machete sickle spore, fusarium graminaria, the red sickle spore of standing grain, different spore sickle spore, albizzia sickle spore, fusarium oxysporum, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, Fusariumsulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusariumvenenatum; Humicola, preferred Humicola insolens or Humicola lanuginosa; Or Trichoderma, preferred trichoderma harziarum, healthy and free from worry wood are mould, Trichoderma longibrachiatum, Trichodermareesei or viride.
Described peptide composition can prepare according to methods known in the art, and can be the form of liquid or dry composition.For example, this peptide composition can be the form of particle or particulate (microgranulate).Can be with the polypeptide that will comprise in the methods known in the art stable composition.
The combination of glucoamylase and acid alpha-amylase
According to this aspect of the invention, glucoamylase of the present invention can be combined with 0.3 to 5.0AFAU/AGU ratio with acid alpha-amylase.More preferably, the active ratio with glucoamylase activity of acid alpha-amylase is at least 0.35, at least 0.40, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.85 or 1.9AFAU/AGU even at least.Yet, the active ratio with glucoamylase activity of acid alpha-amylase should be preferably less than 4.5, less than 4.0, less than 3.5, less than 3.0, less than 2.5 or less than 2.25AFAU/AGU.In AUU/AGI, acid alpha-amylase ratio active and glucoamylase activity preferably is present between 0.4 to 6.5AUU/AGI.More preferably, the active ratio with glucoamylase activity of acid alpha-amylase is at least 0.45, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4 or 2.5AUU/AGI even at least.Yet, the active ratio with glucoamylase activity of acid alpha-amylase should be preferably less than 6.0, less than 5.5, less than 4.5, less than 4.0, less than 3.5 or less than 3.0AUU/AGI.
Above-mentioned composition is suitable for use in following starch conversion process, to produce syrup and tunning, for example ethanol.
The following example that has provided the preferable use of peptide composition of the present invention.Other condition of the consumption of peptide composition of the present invention and use said composition can be determined according to this area method commonly used.
The group of Trametes cingulata glucoamylase and other glucoamylases and acid alpha-amylase Close
Trametes cingulata glucoamylase of the present invention is found to have than other glucoamylase, Athelia rolfsii, aspergillus niger and the high 4-7 of Talaromyces emersonii α-1 doubly for example, 6-removes branch active (referring to embodiment 12).
Therefore, according to the present invention, Trametes cingulata glucoamylase can be combined with acid alpha-amylase and another kind of glucoamylase.Such enzyme combination is suitable for use in the process that comprises that starch transforms, and comprises alcohol production, comprises the one-step fermentation method.
α-amylase can be any α-amylase.In a preferred implementation, α-amylase is any α-amylase that following " α-amylase " part is listed.In a preferred implementation, α-amylase is fungal alpha-amylase, those that " fungal alpha-amylase " part below particularly is disclosed, especially valley aspergillus α-amylase.the disclosed hybrid alpha-amylases of " fungi hybrid alpha-amylases " part below preferably also having, comprise the disclosed heterozygote of U.S. Patent Publication No. 2005/0054071 (considering especially the heterozygote that table 3 is listed), and the Application No. 60/638 of while pending trial, 614 disclosed heterozygotes, especially comprise and have catalytic domain JA118 and Athelia rolfsiiSBD (SEQ ID NO:28 herein and Application No. 60/638, 614 SEQ ID NO:100) Fungamyl variant, Rhizomucor pusillus (Rhizomucor pusillus) α-amylase (SEQ ID NO:29 herein and Application No. 60/638 with AtheliarolfsiiAMG joint and SBD, 614 SEQ ID NO:101), with the Meripilus giganteus α-amylase with Athelia rolfsii glucoamylase joint and SBD (the SEQ ID NO:102 of SEQ ID NO:30 herein and Application No. 60/638,614).
Glucoamylase can be any glucoamylase, the glucoamylase that comprises fungi or bacterial origin, it is selected from: the Aspergillus glucoamylase, particularly aspergillus niger G1 or G2 glucoamylase (Boel etc., (1984), EMBO is (5) J.3, the 1097-1102 page) or its variant, as WO92/00381, WO00/04136 and disclosed those of WO01/04273 (from Novozymes, Denmark); Aspergillus awamori glucoamylase (WO84/02921), aspergillus oryzae (Agric.Biol.Chem. (1991), 55 (4), 941-949 page) or its variant.The variant of other Aspergillus glucoamylases comprises the variant that improves thermostability; G137A and G139A (Chen etc., (1996), Prot.Eng.9,499-505); D257E and D293E/Q (Chen etc., (1995), Prot.Engng.8,575-582); N182 (Chen etc., (1994), Biochem.J.301,275-281); Disulfide linkage, and A246C (Fierobe etc., (1996), Biochemistry, 35,8698-8704); With the introducing (Li etc., (1997), Protein Engng.10,1199-1204) at A435 and S436 site proline residue.other glucoamylases comprise sieve ear photovoltaicing leather bacteria (Corticiumrolfsii) (claiming again Athelia rolfsii) glucoamylase (U.S. Patent number 4, 727, 046), Talaromyces genus gluconobacter amylase, especially from the glucoamylase (WO99/28248) of Talaromyces emersonii, Talaromyces leycettanus (United States Patent (USP) Re.32, 153), Talaromycesduponti, Talaromyces thermophilus (United States Patent (USP) 4, 587, 215), Rhizopus nivius is (as from Shin Nihon Chemicals, the available enzyme of Japan, its trade mark is called " CU CONC "), Humicola grisea var.thermoidea (ATCC16453 for example, NRRL15222, NRRL15223, NRRL15224, NRRL15225).
The bacterium glucoamylase of considering comprises from fusobacterium (Clostridium), especially C.thermoamylolyticum (EP135,138) and hot sulfurization hydrogen clostridium (C.thermohydrosulfuricum) glucoamylase (WO86/01831).
The commercially available example that comprises the composition of other glucoamylase comprises AMG200L; AMG300L; SAN TMSUPER, SAN TMEXTRA L, SPIRIZYME TMPLUS, SPIRIZYME TMFUEL, SPIRIZYME TMB4U and AMG TME (from NovozymesA/S); OPTIDEX TM300 (from Genencor Int.); AMIGASE TMAnd AMIGASE TMPLUS (from DSM); G-ZYME TMG900, G-ZYME TMAnd G990ZR (from GenencorInt.).
In a concrete embodiment, Trametes cingulata glucoamylase of the present invention is with combined from the glucoamylase of one of the following: aspergillus niger, Athearolfsii or Talaromycesemersonii, and the Rhizomucor pusillus α-amylase (the SEQ ID NO:101 of SEQ ID NO:29 herein and United States Patent (USP) 60/638,614) with Athelia rolfsiiAMG joint and SBD.
Purposes
The invention still further relates to the process/method that uses the polypeptide with glucoamylase activity of the present invention.
Purposes according to the present invention comprises that the starch of starch transforms, and becomes for example syrup and tunning, comprises ethanol and beverage.Can use the example of the process of glucoamylase of the present invention to disclose in following document: WO2004/081193, WO2004/080923, WO2003/66816, WO2003/66826 and WO92/20777 incorporate described document here into as a reference.
The production of tunning
Process from the material production tunning that contains gelatinization starch
This aspect of the present invention relate to from amyloid material production tunning, especially ethanol process, wherein this process comprises liquefaction step, and respectively or the saccharification of carrying out simultaneously and fermentation step.
The present invention relates to produce from starch-containing material the process of tunning, it comprises the steps:
(a) under α-amylase exists, starch-containing material is liquefied;
(b) use glucoamylase of the present invention, the liquefied mass that step (a) obtains is carried out saccharification;
(c) use fermenting organism that the raw material through saccharification is fermented.
Tunning especially as ethanol, optionally reclaims after fermentation, for example by distillation.Suitable starch-containing starting material is listed in following " starch-containing material " part.Consider enzyme following " enzyme " part in list.Fermentation is preferably carried out when yeast exists, and preferred described yeast is the Saccharomycodes bacterial strain.Suitable fermenting organism is listed in following " fermenting organism body " part.In a preferred implementation, step (b) and step (c) are (the SSF processes) of carrying out simultaneously.
In a concrete embodiment, process of the present invention also comprises the steps: before in step (a)
X) reduce the granularity of starch-containing material, preferably by pulverizing (milling);
Y) form the slurry that comprises described starch-containing material and water.
This aqueous slurry can contain 10-40wt%, the starch-containing material of preferred 25-35wt%.This slurry is heated above gelatinization point, and can adds α-amylase, preferred bacterium and/or acid fungal alpha-amylase cause liquefaction reaction (desaturation (thinning)).In one embodiment, process slurry with α-amylase in step of the present invention (a) before, can with should slurry steam pressurized (jet-cook) with further with its gelatinization.
More specifically, liquefaction can be used as three step heat slurry (hot slurry) processes and carries out.This slurry is heated between 60-95 ℃, between preferred 80-85 ℃, and adds α-amylase to cause liquefaction reaction (desaturation).Can should starch steam pressurized 1-15 minute between preferred 105-125 ℃ between 95-140 ℃ subsequently, preferred 3-10 minute, especially preferred about 5 minutes.This slurry is cooled to 60-95 ℃, and adds more α-amylase to stop hydrolysis reaction (secondary liquefaction of starch (secondary liquefaction)).This liquefaction process is completed under pH4.5-6.5 usually, especially completes under pH5-6.Be called wine with dregs (mash) through the whole grain of pulverizing and liquefy.
Saccharification in step (b) can use condition well known in the art to carry out.For example, fully saccharifying is sustainable reaches approximately 24 to approximately 72 hours, yet, often only at 30-65 ℃, about 60 ℃ of premashings that carry out common approximately 40-90 minute usually, saccharification fully between the yeast phase in saccharification and fermenting process (SSF) at the same time subsequently.Saccharification is normally at 30-65 ℃, especially at approximately 60 ℃, between pH4-5, usually carries out under the condition of about pH4.5.
Process the most frequently used in alcohol production is being synchronous glycosylation and fermentation (SSF) process, wherein there is no maintenance (holding) stage of saccharification, this means to add together fermenting organism (for example yeast) and enzyme.When carrying out SSF, often be added in the step of the temperature premashing more than 50 ℃ in the front of fermentation.
According to the present invention, fermentation step (c) comprising: but be not limited to, for the production of the fermenting process of following material: alcohol (as, ethanol, methyl alcohol, butanols); Organic acid (as citric acid, acetic acid, methylene-succinic acid, lactic acid, glyconic acid); Ketone (as acetone); Amino acid (as L-glutamic acid); Gas is (as H 2And CO 2); Microbiotic (as penicillin and tsiklomitsin); Enzyme; VITAMIN is (as riboflavin, B 12, β-carotene); And hormone.Preferred fermenting process comprises pure fermenting process well known in the art.Preferred fermenting process is anaerobic process well known in the art.
Produce the process of tunning from the starch-containing material of ungelatinized
The present invention relates in aspect this from starch-containing material production tunning, and the process of this starch-containing material of not gelatinization.In one embodiment, only use glucoamylase of the present invention between saccharification and yeast phase.According to the present invention, can produce required tunning under the condition that the water-based slurry that comprises starch-containing material is not liquefied, as ethanol.In one embodiment, process of the present invention comprises: lower than gelatinization point and when having glucoamylase of the present invention, saccharification through pulverizing starch-containing material and produce sugar, this sugar can be fermented into by suitable fermenting organism required degradation production.
Following embodiment 7 and 8 has disclosed and has used the glucoamylase of the present invention that is derived from Trametes cingulata and Pachykytosporapapyracea, the process of producing ethanol from (un-gelatinized) ((uncooked) of not boiling) ground corn of ungelatinized.Compare with the respective process that the glucoamylase that uses respectively from aspergillus niger and Talaromyces emersonii carries out, above-mentioned two kinds of glucoamylases have all shown significantly higher alcohol yied.
Therefore, the present invention relates to the method for producing tunning from starch-containing material in aspect this, and it comprises:
(a) with glucoamylase, starch-containing material is carried out saccharification under the temperature condition lower than the initial gelatinization point of described starch-containing material, described glucoamylase has:
I) sequence shown in the 1st to 561 amino acids in the 1st to 556 amino acids or SEQ ID NO:37 in SEQ ID NO:2, or the glucoamylase that has at least 75% identity with it, and/or
II) sequence shown in the 1st to 565 amino acids in the 1st to 575 amino acids or SEQ ID NO:40 in SEQ ID NO:5, or the glucoamylase that has at least 70% identity with it, and/or
III) sequence shown in the 1st to 523 amino acids of the 1st to 556 amino acids of the 1st of SEQ ID NO:24 the to 548 amino acids or SEQ ID NO:26 or SEQ ID NO:43, or the glucoamylase that has at least 60% identity with it,
(b) use fermenting organism to ferment.
(a) of process of the present invention and (b) step can carry out successively or simultaneously.
Term " initial gelatinization point " (initial gelatinization temperature) means the minimum temperature that starch pasting begins.The starch that heats in water begins gelatinization between 50-75 ℃; Concrete gelatinization point depends on specific starch, and those skilled in the art can easily be determined.Therefore, initial gelatinization point can change according to certain species and the growth conditions of plant species, plant species.In situation of the present invention, the initial gelatinization point of given starch-containing material is to use Gorinstein.S. and Lii.C., Starch/ , (Vol.44 (12) pp.461-466 (1992)) described method, the temperature that in 5% starch granules, double refraction is lost.
In step (a) before, can prepare starch-containing material, the slurry of granular starch (granular starch) for example, this slurry has the dried solid substance of 20-55wt%, preferably the dried solid substance of 25-40%wt%, the more preferably dried solid substance of 30-35%wt%.This slurry can comprise water and/or process water, as stillage (return-enclosure water (backset)), washing water (scrubber water), evaporator condensation thing or distillment, from the side-cut stripper water (side stripper water) or other tunning device procedures water that distill.Because process of the present invention is being carried out lower than gelatinization point, and therefore do not have significant viscosity to increase generation, can use high-caliber stillage if need.In one embodiment, aqueous slurry comprises the stillage of about 1-70vol%, the stillage of preferred 15-60vol%, the stillage of about 30-50vol% in particular.
Starch-containing material can by reducing granularity, preferably by pulverizing, and prepare to 0.05-3.0mm preferred 0.1-0.5mm.After process processing of the present invention, in starch-containing material, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or preferred at least 99% dried solid substance is converted into the Zulkovsky starch hydrolyzate.
Process of the present invention is carried out in the temperature lower than initial gelatinization point.Preferably, step (a) is between 30-75 ℃, and preferably the temperature between 45-60 ℃ is carried out.
In a preferred implementation, step (a) and (b) carry out as synchronous glycosylation and fermenting process.In this preferred implementation, this process is carried out between 28-36 ℃ usually, for example between 29-35 ℃, between 30-34 ℃, as about 32 ℃.According to the present invention, during fermentation, but the temperature up-down adjustment.
In one embodiment, carry out synchronous glycosylation and fermentation with sugar level, for example glucose level remains on low-level, for example below 6wt%, preferred approximately below 3wt%, preferred approximately below 2wt%, more preferably from about below 1wt%, even more preferably from about below 0.5wt%, or even more preferably 0.25wt%, below about 0.1wt%.Low-level like this sugar only can be realized by enzyme and fermenting organism that the amount of adjusting is passed through in use.Those skilled in the art can easily determine to use enzyme and the fermenting organism of how many amounts.Also can select the amount of enzyme and fermenting organism to keep low malt sugar content in fermented liquid.For example, the maltose level can be maintained at about below 0.5wt% or approximately below 0.2wt%.
Process of the present invention can the scope between pH3-7 be carried out, and preferably at pH3.5-6, or more preferably carries out at pH4-5.
Starch-containing material
According to the present invention, can use any suitable starch-containing material, comprise granular starch.Starting material is selected according to required tunning usually.the example that is suitable for the starch-containing starting material that uses in process of the present invention comprises stem tuber (tubers), root (roots), stem (stems), whole grain (wholegrains), corn (corns), corn cob (cobs), wheat (wheat), barley (barley), rye (rye), buy sieve Chinese sorghum (milo), west paddy rice (sago), cassava (cassava), tapioca, Chinese sorghum (sorghum), ricepeas, beans (beans), or sweet potato (sweet potatos), or its mixture, or cereal (cereals), sugary raw material, as molasses, the fruit material, sugarcane (sugar cane) or beet (sugar beet), potato, with the cellulose material, as timber or plant residue, or its mixture.Waxy (waxy) corn and barley, and non-waxy (non-waxy) corn and barley are all within considering.
Term " granular starch " means the thick starch that does not boil, and namely is present in the starch of the natural form in cereal, stem tuber or grain.Starch is formed in vegetable cell as water-fast molecule.When being placed in cold water, granular starch may absorb this a small amount of liquid and expand (swell).Reversible at height to the temperature expansion of 50-75 ℃.Yet in higher temperature, " gelatinization " irreversible expansion (gelatinization) will be called.Granular starch to be processed have a highly refined starch quality, be preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure, perhaps granular starch can be also thicker starch-containing material, the whole grain that comprises pulverizing comprises for example plumule resistates (germ residues) and fiber.With described raw material for example whole grain pulverized with Unclosing structure so that further processing.According to the present invention, preferred two kinds of breaking methods: wet-milling and dry grinding.In dry grinding, full particle (whole kernel) is pulverized and used.Wet-milling is separated plumule and meal (granular starch and protein) preferably, and often is applied to use starch hydrolyzates to produce the occasion of syrup.Dry grinding and wet-milling are all known in the starch process field, when the process of the present invention to both giving equal consideration.
Reduce the size of starch-containing material, preferably by pulverizing, to expose more surface-area.In one embodiment, granularity is between 0.05-3.0mm, preferably between 0.1-0.5mm, or make at least 30%, preferred at least 50%, more preferably at least 70%, even more preferably at least 90% the starch-containing material through pulverizing is by having the 0.05-3.0mm sieve, preferably has the sieve in 0.1-0.5mm hole.
Tunning
Term " tunning " means the product of producing via such process, and this process comprises the fermentation step that makes fermenting organism.The tunning of considering according to the present invention comprises alcohol (as ethanol, methyl alcohol, butanols); Organic acid (as citric acid, acetic acid, methylene-succinic acid, lactic acid, glyconic acid); Ketone (as acetone); Amino acid (as L-glutamic acid); Gas is (as H 2And CO 2); Microbiotic (as penicillin and tsiklomitsin); Enzyme; VITAMIN (as, riboflavin, B 12, β-carotene); And hormone.In a preferred implementation, tunning is ethanol, as, alcohol fuel; Drinking alcohol, i.e. drinkable refining alcohol (potableneutral spirites); Or industrial ethyl alcohol or be used for the product of following industry: consumption alcohol industry (as beer and grape wine), dairy products industry (as, cultured milk prod), leather industry and tobacco industry.preferred beer comprises likes youngster's beer (ale), top fermented stout (stouts), the alms bowl that is stout (porters) thoroughly, old storage beer (lagers), bitter (bitters), malt liquor (malt liquors), sparkling wine (happoushu), high alcohol beer (high-alcohol beer), low alcohol beer (low-alcohol beer), low calory beer (low-calorie beer) or light beer (light beer).Preferred fermenting process used comprises alcohols fermenting process well known in the art.Preferred fermenting process is anaerobic fermentation process well known in the art.
Fermenting organism
" fermenting organism " (fermenting organism) refers to be suitable for using during the fermentation and can produce any biology of required tunning, comprises bacterium and fungal organism.Specially suitable fermenting organism can fermenting carbohydrate (sugar), as glucose or maltose, is about to it and directly or indirectly is converted into required tunning.The example of fermenting organism body comprises the fungal organisms such as yeast.Preferred yeast comprises the bacterial strain of bacterial strain, the especially cereuisiae fermentum (Saccharomycescerevisiae) of some kind of Saccharomycodes (Saccharomyces spp.).The obtainable yeast of business comprises, for example, and Red Star TM/ Lesaffre EthanolRed is (from Red Star/Lesaffre, the U.S.), FALI is (from Fleischmann ' s Yeast, BurnsPhilp Food Inc., the Subsidiary Company of the U.S.), SUPERSTART (from Alltech), GERTSTRAND (from Gert Strand AB, Sweden) and FERMIOL (from DSM Specialties).
Enzyme
Glucoamylase
This glucoamylase is glucoamylase of the present invention preferably.Yet as mentioned above, glucoamylase of the present invention can make up with other glucoamylase.
This glucoamylase can 0.001-10AGU/g DS amount add, the amount of preferred 0.01-5AGU/g DS, as 0.1,0.3,0.5,1 or 2AGU/g DS, especially 0.1-0.5AGU/g DS or 0.02-20AGU/g DS, preferred 0.1-10AGU/g DS.
α-amylase
α-amylase can be from any source according to the present invention.The α-amylase of fungi or bacterial origin preferably.
In a preferred implementation, α-amylase is acid alpha-amylase, for example fungi acid alpha-amylase or bacterium acid alpha-amylase.Term " acid alpha-amylase " refers to such α-amylase (E.C.3.2.1.1), and it adds fashionable scope at pH3-7 with significant quantity, preferred active pH3.5-6 or more preferably the pH of pH4-5 have optimum activity.
Bacterialα-amylase
According to the present invention, but the bacterialα-amylase preferred source is from bacillus (Bacillus).
In a preferred implementation, the genus bacillus α-amylase is from Bacillus licheniformis (B.licheniformis), bacillus amyloliquefaciens (B.amyloliquefaciens), subtilis (B.subtilis) or bacstearothermophilus (B.stearothermophilus), but also can derive from other genus bacillus.The specific examples of the α-amylase of considering is included in the bacillus licheniformis alpha-amylase (BLA) shown in SEQ ID NO:4 in WO99/19467, bacillus amyloliquefaciens α-amylase (BAN) in WO99/19467 shown in SEQ ID NO:5, and in WO99/19467 the bacillus stearothermophilus alpha-amylase (BSG) shown in SEQ ID NO:3.In an embodiment of the invention, described α-amylase is such enzyme, is expressed as SEQ ID NOS:1, arbitrary sequence of 2,3,4 or 5 in itself and WO99/19467 and has respectively at least 60% identity degree, preferred at least 70%, more preferably at least 80%, even more preferably at least 90%, the identity degree as at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.
The genus bacillus α-amylase can be variant and/or heterozygote, and especially in WO96/23873, WO96/23874, WO97/41213, WO99/19467, WO00/60059 and WO02/10355 (incorporating these documents into this paper as a reference), any is described.The concrete alpha-amylase variants of considering is disclosed in United States Patent (USP) 6,093,562,6,297,038 or United States Patent (USP) 6,187,576 (being incorporated herein this paper as a reference), and comprise bacillus stearothermophilus alpha-amylase as described below (BSG α-amylase) variant: this variant has one or two aminoacid deletion in 179 to 182, have preferably that WO1996/023873 (being incorporated herein by reference) discloses two disappearances (for example referring to 20 pages, 1-10 is capable); Preferably, compare with the wild-type BSG α-amylase aminoacid sequence shown in SEQ ID NO:3 that WO99/19467 discloses, this variant is corresponding to Δ (181-182), perhaps, use the numbering (being incorporated herein by reference) of the SEQ ID NO:3 of WO99/19467 disclosure, this variant is corresponding to the disappearance of 179 and 180 amino acids.Genus bacillus α-amylase more preferably, especially such bacillus stearothermophilus alpha-amylase: compare with wild-type BSG α-amylase aminoacid sequence shown in disclosed SEQ ID NO:3 in WO99/19467, this enzyme has the two disappearances that are equivalent to Δ (181-182) position, comprises that also a N193F replacement (represents again I181 *+ G182 *+ N193F).
α-amylase is also produced maltose (maltogenic) α-amylase." product maltogenic alpha-amylase enzyme " (dextran Isosorbide-5-Nitrae-α-maltose lytic enzyme E.C.3.2.1.133) can be hydrolyzed amylose starch and amylopectin to the maltose of α configuration.Product maltogenic alpha-amylase enzyme from bacstearothermophilus bacterial strain NCIB11837 can be from Novozymes A/S, and Denmark is purchased.This produces maltogenic alpha-amylase enzyme at United States Patent (USP) 4,598, discloses in 048,4,604,355 and 6,162,628, incorporates these documents into this paper as a reference.
The bacterium hybrid alpha-amylases
A kind of hybrid alpha-amylases of concrete consideration comprises: 445 C terminal amino acid residues (as shown in SEQ ID NO:4 in WO99/19467) of bacillus licheniformis alpha-amylase; With from 37 n terminal amino acid residues of the α-amylase of bacillus amyloliquefaciens (as shown in SEQ ID NO:3 in WO99/19467), and comprise one or more, especially whole in wherein following replacement:
G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the numbering of Bacillus licheniformis).The variant (or the corresponding sudden change in other genus bacillus α-amylase skeleton) that also preferably has one or more following sudden changes: H154Y, A181T, N190F, A209V and Q264S and/or between 176 and 179 the disappearance of two residues, the disappearance of preferred E178 and G179 (using the numbering of the SEQ ID NO:5 of WO99/19467).
Bacterialα-amylase can add with amount well known in the art.When measuring with KNU unit (following " materials and methods " part is described), alpha-amylase activity is preferably with 0.5-5, the amount of the amount of 000NU/g DS, 1-500NU/g DS or more preferably 5-1, the amount of 000NU/g DS exists as the amount of 10-100NU/g DS.
Fungal alpha-amylase
The fungi acid alpha-amylase comprises the acid alpha-amylase from the Aspergillus bacterial strain, as aspergillus oryzae, aspergillus niger, valley aspergillus α-amylase.
Preferred acid fungal alpha-amylase is class Fungamyl α-amylase, and it is preferably from aspergillus oryzae strain.In the disclosure, term " class Fungamyl α-amylase " refers to such α-amylase, the maturing part of the aminoacid sequence that shows in SEQ ID NO:10 in itself and WO96/23874 has high identity, namely surpasses 70%, surpasses 75%, surpasses 80%, surpasses 85%, surpasses 90%, surpasses 95%, surpasses 96%, surpasses 97%, surpasses 98%, surpasses 99% or even 100% identity.
Another kind of preferred acid alpha-amylase is from Aspergillus niger strain.In a preferred implementation, acid fungal alpha-amylase is the α-amylase from aspergillus niger, it is disclosed in the Swiss-prot/TeEMBL database as " AMYA_ASPNG ", main accession number (primary access no.) is P56271, and in WO89/01969, it has been made more detailed description (embodiment 3).The also SEQ ID NO:1 demonstration in WO2004/080923 (Novozymes) of erie black aspergillus acid alpha-amylase is incorporated the document into this paper as a reference at this.This paper considers that also SEQ ID NO:1 in described acid fungal amylase and WO2004/080923 has the variant of at least 70% identity, the identity as at least 80% or even at least 90%, the identity as at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.Suitable commercially available aspergillus niger acid alpha-amylase has SP288 (can derive from NovozymesA/S, Denmark).
In a preferred implementation, α-amylase is from valley aspergillus, it is by people such as Kaneko, and J.Ferment.Bioeng.81:292-298 (1996) " Molecular-cloning and determination ofthe nucleotide-sequence of a gene encoding an acid-stable alpha-amylase fromAspergillus kawachii. " is open; Also be disclosed as in addition EMBL:#AB008370.
The fungi acid alpha-amylase also comprises the wild-type enzyme (that is, non-heterozygote) of carbohydrate binding modules (CBM) and α-amylase catalytic domain, or its variant.In one embodiment, the wild-type acid alpha-amylase is from the valley Aspergillus strain.
The fungi hybrid alpha-amylases
In a preferred implementation, the fungi acid alpha-amylase is hybrid alpha-amylases.The preferred embodiment of fungi hybrid alpha-amylases comprises that WO2005/003311 or United States Patent (USP) disclose 2005/0054071 (Novozymes) or U.S. Patent application 60/638, those α-amylase that 614 (Novozymes) are disclosed are incorporated above-mentioned document into this paper as a reference at this.Hybrid alpha-amylases can comprise that α-amylase catalytic domain (CD) and sugar are in conjunction with territory/module (CBM) and optional joint.
the specific examples of the hybrid alpha-amylases of considering comprises U.S. Patent application 60/638, those α-amylase that disclose in 614, comprising Fungamyl variant (SEQ ID NO:28 herein and U.S. Patent application 60/638 with catalytic domain JA118 and Athelia rolfsii SBD, SEQ ID NO:100 in 614), Rhizomucor pusillus α-amylase (SEQ ID NO:29 herein and U.S. Patent application 60/638 with Athelia rolfsiiAMG joint and SBD, SEQ ID NO:101 in 614), with Meripilus giganteus α-amylase (SEQ ID NO:30 herein and U.S. Patent application 60/638 with Athelia rolfsii glucoamylase joint and SBD, SEQ IDNO:102 in 614).
Other particular instance of considering hybrid alpha-amylases comprises that United States Patent (USP) discloses those α-amylase that disclose in 2005/0054071, be included in described those α-amylase of table 3 of the 15th page, for example have the aspergillus niger α-amylase of valley aspergillus joint and starch binding domain.
Commercialization α-amylase product
The business composition that preferably comprises α-amylase comprises the MYCOLASE from DSM (Gist Brocades); BAN TM, TERMAMYL TMSC, FUNGAMYL TM, LIQUOZYME TMX and SAN TMSUPER, SAN TMEXTRA L (Novozymes A/S) and CLARASE TML-40,000, DEX-LO TM, SPEZYME TMFRED, SPEZYME TMAA, and SPEZYME TMDELTA AA (Genencor Int.), and the acid fungal alpha-amylase of selling with trade(brand)name SP288 (can be from Novozymes A/S, Denmark obtains).
According to the present invention, acid alpha-amylase can 0.1 to 10AFAU/g DS, preferred 0.10 to 5AFAU/g DS, particularly the amount of 0.3 to 2AFAU/g DS adds.
The production of syrup
The present invention also provides a kind of use glucoamylase of the present invention to produce syrup from starch-containing material, such as the method for glucose etc.Suitable starting material has example in above-mentioned " starch-containing material " part.Normally, described method comprises the following steps: part hydrolysising starch-containing material (liquefaction) under α-amylase exists, and further saccharification under glucoamylase of the present invention exists subsequently is from the non-reducing end release glucose of starch or Related Oligosaccharides and polysaccharide molecule.
Can liquefy and saccharification as above-mentioned, to be used for the production of tunning.
Glucoamylase of the present invention can use under immobilized form.This be suitable for and by often for the production of special syrup, as maltose syrups, can be used for fructose syrups in addition, for example high fructose syrups (HFS) is produced relevant oligosaccharides raffinate.
Therefore, this aspect of the present invention relates to the method for producing syrup from starch-containing material, comprising:
(a) under α-amylase exists, starch-containing material is liquefied;
(b) use glucoamylase of the present invention, the material that obtains in step (a) is carried out saccharification;
The saccharification material recycle syrup that can obtain from step (b).
Details about conditions suitable can see above.
Brewage (brewing)
Glucoamylase of the present invention also can be used for brewing process.Glucoamylase of the present invention adds with the significant quantity that those skilled in the art can easily determine.For example, at " low sugar " (low carb) or super subtract the production of sugar (super attenuated) beer, the remaining dextrin of a high proportion of pure and mild low levels is that people expect.These beer are to use the enzyme composition of external source to prepare, and described enzyme composition comprises can go to limit dextrin the enzymic activity of branch.Can apply glucoamylase of the present invention, preferred Trametes cingulata is to reduce content and the hydrolyzing alpha-Isosorbide-5-Nitrae key of limit dextrin.
This paper describes the scope that also claimed invention is not limited to embodiment disclosed herein, because these embodiments intentions are to illustrate several aspect of the present invention.This paper is intended to any embodiment that is equal to is included within the scope of the invention.Certainly, according to above describing, except this paper shown and description, should be apparent to those skilled in the art to various modifications of the present invention.These modifications also should comprise within the scope of the appended claims.In case conflict occurs, will be as the criterion to comprise the disclosure in being defined in.
This paper has quoted many parts of reference, incorporates by reference its full content into this paper.Following embodiment has further described the present invention, and these descriptions should not thought limitation of the scope of the invention.
Materials and methods
Glucoamylase
*Disclosed in SEQ ID NO:2, as to be derived from Trametes cingulata glucoamylase, it can obtain from Novozymes A/S.
*Disclosed in SEQ ID NO:5, as to be derived from Pachykytospora papyracea glucoamylase, and it can obtain from Novozymes A/S.
*Disclosed in SEQ ID NO:24, as to be derived from Leucopaxillus giganteus (Sow.: Fr.) Sing. glucoamylase, it can obtain from Novozymes A/S.
*Disclosed (J.3 (5) p.1097-1102 for EMBO for Boel etc., (1984)), as to be derived from aspergillus niger glucoamylase, it can obtain from Novozymes A/S.
*Disclosed in WO99/28448, as to be derived from Talaromyces emersonii glucoamylase, it can obtain from Novozymes A/S.
Be used for the DNA operation enzyme (as, restriction enzyme, ligase enzyme etc.) can be from New EnglandBiolabs, Inc. obtains, and is used according to the indication of manufacturers.
α-amylase
Hybrid alpha-amylases A: have the Rhizomucor pusillus α-amylase of Atheli α rolfsii glucoamylase joint and SBD, be disclosed in U.S. Patent application no.60/638,614 and SEQ ID NO:29 in.
Yeast: Red Star TM, can be from Red Star/Lesaffre, USA obtains.
Microorganism strains
-intestinal bacteria DH12 α (GIBCO BRL, Life Technologies, USA)
-aspergillus oryzae IFO4177 can be from Institute for Fermentation, Osaka (IFO) CultureCollection of Microorganisms, 17-85, Juso-honmachi, 2-chome, Yodogawa-ku, Osaka532-8686, Japan obtains.
-aspergillus oryzae BECh-2 describes in WO2000/39322 (Novozymes).It is the mutant strain (describing in WO98/12300) of JaL228, and JaL228 is the mutant strain of IFO4177.
-Aspergillus niger strain Mbin119 describes in WO2004/090155 (referring to embodiment 11).
Other material
Pullulan (pullulan) can obtain from Wako Pure Chemical (Japan).
The preservation of biomaterial
Following biomaterial is preserved in German microorganism and culture collection center (Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ) according to the regulation of budapest treaty, Mascheroder Weg1b, D-38124Braunschweig DE,), and be given following registration number:
Preserved material registration number preservation date
Intestinal bacteria NN049798 DSM17106 on 02 02nd, 2005
Intestinal bacteria NN049797 DSM17105 on 02 02nd, 2005
This bacterial strain has carried out preservation under the following conditions: guarantee in present patent application pending trial process, culture is for any personnel that are defined as having the right obtaining these cultures according to 37C.F.R. § 1.14 and 35U.S.C § 122 by the United States Patent (USP) chief of trademark office can obtain state.Described preserved material is the pure culture basically of described preservation strain.Submit to the corresponding application of this main application or its son application in foreign country, described preserved material is according to the requirement of this state's patent law can obtain state.But should be appreciated that, preserved material is in can obtain state, do not consist of for enforcement license of the present invention, thus the patent right that infringement is authorized by action by government.
Substratum and reagent
The commodity of SILVER REAGENT at least as the chemical of buffer reagent and substrate.
PDA2:39g/L potato dextrose agar (Potato Dextrose Agar), 20g/L agar, 50ml/L glycerine.
Cove:342.3g/L sucrose, 20ml/L COVE salts solution, 10mM ethanamide, the pure agar of 30g/L.
Cove salts solution: every liter of 26g KCl, 26g MgSO 47H 2O, 76g KH 2PO 4With 50mlCove trace-metal solution.
COVE trace-metal solution (Cove trace metals): every liter of 0.04g NaB 4O 710H 2O, 0.4g CuSO 45H 2O, 1.2g FeSO 47H 2O, 0.7g MnSO 4H 2O, 0.7g Na 2MoO 22H 2O and 0.7g ZnSO 47H 2O。
YPG:4g/L yeast extract, 1g/L KH 2PO 4, 0.5g/L MgSO 47H 2O, 5g/L glucose, pH6.0.
STC:0.8M sorbyl alcohol, 25mM Tris pH8,25mM CaCl 2
40%PEG4000 in the SPTC:STC damping fluid.
Cove top agarose: 342.3g/L sucrose, 20ml/L COVE salts solution, 10mM ethanamide, 10g/L low melting-point agarose.
MS-9: every liter of 30g soyflour, 20g glycerine, pH6.0.
MDU-pH5: every liter of 45g one hydration maltose (maltose-1aq), 7g yeast extract, 12g KH 2PO 4, 1g MgSO 47H 2O, 2g K 2SO 4, 0.5ml AMG trace-metal solution and 25g2-morpholino ethyl sulfonic acid (2-morpholinoethanesulfonic acid), pH5.0.
Method
Unless otherwise indicated, use the standard molecular biological method described in following document carry out the DNA operation and transform: Sambrook etc., (1989) Molecular cloning:A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; And Ausubel, F.M. etc., (volume) " Current protocols in Molecular Biology ", John Wiley and Sons, 1995; Harwood, C.R., and Cutting, S.M. (volume) " Molecular Biological Methodsfor Bacillus " .JohnWiley and Sons, 1990.
Glucoamylase activity
Glucoamylase activity can be with AGI unit or glucose starch unit of enzyme (AGU) tolerance.
Glucoamylase activity (AGI)
Glucoamylase (being equal to amyloglucosidase) is converted into glucose with starch.Here, measure the amount of glucose by the method for cracking that is used for determination of activity.Describe in the method document below: the 76-11 joint, Starch-Glucoamylase Method with SubsequentMeasurement of Glucose with Glucose Oxidase is in " Approved methods of theAmerican Association of Cereal Chemists " .Vol.1-2AACC, from AmericanAssociation of Cereal Chemists, (2000); ISBN:1-891127-12-8.
A glucose starch unit of enzyme (AGI) is under the standard conditions of the method, and per minute forms the enzyme amount of 1 μ mol glucose.
Standard conditions/reaction conditions:
Substrate: Zulkovsky starch, concentration be 16g dry-matter/L approximately
Buffer reagent: acetate, about 0.04M, pH=4.3
pH： 4.3
Heated culture temperature: 60 ℃
Reaction times: 15 minutes
Reaction terminating: NaOH is to the about 0.2g/L (pH～9) of concentration
Enzyme concn: 0.15-0.55AAU/mL
Starch should be Lintner starch, and it is a kind of (thin-boiling) starch that gently boils, and is used as the colorimetric indicator in the laboratory.Lintner starch is processed native starch and obtains with dilute hydrochloric acid, makes it keep the ability that iodine becomes indigo plant of meeting.
Glucoamylase activity (AGU)
Novo glucose starch unit of enzyme (AGU) is defined as, and is under the damping fluid of 23.2mM maltose, 0.1M acetate, standard conditions that the reaction times is 5 minutes at 37 ℃, pH4.3, substrate, the enzyme amount of per minute hydrolysis 1 μ mol maltose.
Can use automatic analyser (autoanalyzer) system.Mutarotase (mutarotase) is added in Hexose phosphate dehydrogenase reagent, so that any alpha-D-glucose that exists changes β-D-Glucose into.Hexose phosphate dehydrogenase specifically with above-mentioned reactant in β-D-Glucose reaction and form NADH, use photometer 340nm this NADH of mensuration of place measuring as former glucose concn.
The AMG incubation:
Substrate: 23.2mM maltose
Buffer reagent: 0.1M acetate
pH： 4.30±0.05
Heated culture temperature: 37℃±1
Reaction times: 5 minutes
The enzyme working range: 0.5-4.0AGU/mL
Color reaction:
GlucDH： 430U/L
Mutarotase 9U/L
NAD： 0.21mM
Buffer reagent: 0.12M phosphoric acid salt, 0.15M NaCl
pH： 7.60±0.05
Heated culture temperature: 37℃±1
Reaction times: 5 minutes
Wavelength: 340nm
The brochure of this analytical procedure of more detailed description ( EB-SM-0131.02/01) can be to Novozymes A/S, Denmark asks for, and this brochure is incorporated herein with for referencial use.
Alpha-amylase activity (KNU)
Alpha-amylase activity can use yam starch to be measured as substrate.The method is based on this enzyme to the degraded (break-down) of sex change (modified) yam starch, and by starch/enzyme solution sample is mixed to follow the trail of this reaction with iodine solution.The initial blueness that forms with somber, but in the starch degradation process, blueness dies down and gradually becomes with pale red brown, and this color and tinted shade standard are compared.
1,000 Novo α-amylase units (Kilo Novo alpha amylase Unit, KNU) be defined as under standard conditions (namely 37 ℃+/-0.05,0.0003M Ca 2+And pH5.6), the enzyme amount of the Merck Amylum solubile of dextrinization 5260mg starch dry matter.
Can be to Novozymes A/S, Denmark ask for this analytical procedure of more detailed description brochure ( EB-SM-0009.02/01), this brochure is incorporated herein with for referencial use.
Acid alpha-amylase is active
When used according to the invention, the activity of any acid alpha-amylase all available AFAU (acid fungal alpha-amylase unit) is measured.Perhaps, can measure with AAU (acid alpha-amylase unit) activity of acid alpha-amylase.
Acid alpha-amylase unit (AAU)
The active available AAU of acid alpha-amylase (acid alpha-amylase unit) measures, and this is a kind of absolute method.An acid starch unit of enzyme (AAU) is such enzyme amount, it is under normalization condition, per hour 1g starch (100% dry-matter) is converted into following product: this product with the reaction of the iodine solution of concentration known after, have the transmission (transmission) identical with color reference (color reference) at the 620nm place.
Standard conditions/reaction conditions:
Substrate: Zulkovsky starch, concentration be 20g DS/L approximately
Buffer reagent: the about Citrate trianion of 0.13M, pH=4.2
Iodine solution: 40.176g potassiumiodide+0.088g iodine/L
15 ° of-20 ° of dH of tap water (Deutschland hardness)
pH： 4.2
Heated culture temperature: 30 ℃
Reaction times: 11 minutes
Wavelength: 620nm
Enzyme concn: 0.13-0.19AAU/mL
Enzyme working range: 0.13-0.19AAU/mL
Starch should be Lintner starch, and it is a kind of (thin-boiling) starch that gently boils, and is used as the colorimetric indicator in the laboratory.Lintner starch is processed native starch and obtains with dilute hydrochloric acid, makes it keep the ability that iodine becomes indigo plant of meeting.More details can EP0140410B2In find, this document is incorporated herein with for referencial use.
Acid alpha-amylase active (AFAU)
The active available AFAU of acid alpha-amylase (acid fungal alpha-amylase unit) measures, and this unit is definite with respect to the enzyme standard substance.1 AFAU is defined as under following standard conditions, the enzyme amount of the 5.260mg starch dry matter of per hour degrading.
Acid alpha-amylase is that (Isosorbide-5-Nitrae-α-D-dextran-glucan hydrolase, E.C.3.2.1.1), the α-Isosorbide-5-Nitrae in the interior region of its hydrolyzed starch molecule-glycosidic link forms dextrin and the oligosaccharides of different chain length to a kind of inscribe-α-amylase.The colour intensity that forms to iodine is directly proportional to starch concentration.The minimizing of using inverse ratio color method (reverse colorimetry) to measure starch content under the analysis condition of regulation is used as amylase activity.
Figure S05844317420070627D000591
＝590nm
Blue/purple t=23 decolour second (decoloration)
Standard conditions/reaction conditions:
Substrate: Zulkovsky starch, approximately 0.17g/L
Buffer reagent: Citrate trianion, approximately 0.03M
Iodine (I 2): 0.03g/L
CaCl 2： 1.85mM
pH： 2.50±0.05
Heated culture temperature: 40 ℃
Reaction times: 23 seconds
Wavelength: 590nm
Enzyme concn: 0.025AFAU/mL
Enzyme working range: 0.01-0.04AFAU/mL
Can be from Novozymes A/S, Denmark ask for a file of describing in more detail this analytical procedure ( EB-SM-0259.02/01), incorporate this brochure into this paper with for referencial use.
Embodiment
Embodiment 1
The molecular screening of glucoamylase gene
Cultivate Trametes cingulata on the PDA2 substratum, and according to the indication of manufacturers, use FastDNA SPIN Kit for Soil (Qbiogene, USA) from 0.2g mycelium isolation of genomic DNA.
Use degenerated primer ArAF1 and ArAR3 to carry out the PCR reaction to genomic dna:
ArAF1　　5’-CRTRCTYDVCAACATYGG-3’(SEQ ID NO：7)
ArAR3 5’GTCAGARCADGGYTGRRASGTG-3’(SEQ ID NO：8)
Wherein D=A or G or T; R=A or G; S=C or G; V=A or C or G; Y=C or T
Amplified reaction thing (13 μ l) consists of: the ArAF1 primer of l μ l genomic dna solution, l μ M, the ArAR3 primer of 1 μ M, the Extensor Hi-Fidelity PCR Master Mix (ABgene, UK) of 11 μ l.With reactant incubation in DNA Engine Dyad PTC-0220 (MJ Research, USA), it is programmed for: 1 circulation, 94 ℃ 2 minutes; 20 circulations, each be 94 ℃ 30 seconds, 65 ℃ 45 seconds, and the annealing temperature of each circulation descend 1 ℃ and 72 ℃ 1 minute and 30 seconds; 20 circulations subsequently, each is 94 ℃ 30 seconds, 45 ℃ 45 seconds and 72 ℃ 1 minute and 30 seconds; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances.According to the indication of manufacturers, use ExoSAP-IT (USB, USA) purified pcr product and to its order-checking.Subsequently this sequence is compared with the aspergillus niger glucoamylase gene, show this PCR product part glucoamylase of having encoded.
Embodiment 2
The molecular screening of glucoamylase gene
Cultivate Pachykytospora papyracea on the PDA2 substratum, and according to the indication of manufacturers, use FastDNA SPIN Kit for Soil (Qbiogene, USA) from 0.2g mycelium isolation of genomic DNA.
Use degenerated primer AM2F and AM4R2 to carry out PCR reaction (PCR1): AM2F 5 '-TGGGGIMGNCCNCARMGNGAYGG-3 ' (SEQ ID NO:9) AM4R2 5 ' RTCYTCNGGRTANCKNCC-3 ' (SEQ ID NO:10) to genomic dna
I=inosine wherein; K=G or T; M=A or C; N=A or C or G or T; R=A or G; Y=C or T
Amplified reaction thing (25 μ l) consists of: the AM2F primer of 1 μ l genomic dna solution, 2 μ M, the AM4R2 primer of 2 μ M, the Reddy PCR Master Mix (ABgene, UK) of 22 μ l.With reactant incubation in DNA Engine Dyad PTC-0220 (MJ Research, USA), it is programmed for: 1 circulation, 94 ℃ 2 minutes; 20 circulations, each is 94 ℃ 1 minute, 55 ℃ 1 minute and the every circulations of annealing temperature descend 1 ℃ and 72 ℃ 1 minute; 20 circulations subsequently, each is 94 ℃ 1 minute, 40 ℃ 1 minute and 72 ℃ 1 minute; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances.
Subsequently, a PCR reactant (PCR1) of getting equal portions uses degenerated primer AM3F and AM4R2 to carry out the PCR reaction:
AM3F 5’-TAYGAYYTNYGGGARGA-3’(SEQ ID NO：11)
AM4R2 5’-RTCYTCNGGRTANCKNCC-3’(SEQ ID NO：10)
Wherein K=G or T; N=A or C or G or T; R=A or G; Y=C or T
Amplified reaction thing (13 μ l) consists of: the PCR reactant (PCR1) of 1 μ l, the AM3F primer of 1 μ M, the AM4R2 primer of 1 μ M, the Reddy PCR Master Mix (ABgene, UK) of 11 μ l.With reactant incubation in DNA Engine Dyad PTC-0220 (MJ Research, USA), it is programmed for: 1 circulation, 94 ℃ 2 minutes; 5 circulations, each is 94 ℃ 45 seconds, 45 ℃ 45 seconds and 72 ℃ 1 minute; 30 circulations subsequently, each is 94 ℃ 45 seconds, 40 ℃ 45 seconds and 72 ℃ 1 minute; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances.Obtained the PCR band of the amplification of 0.5kb.Use tbe buffer liquid to separate this reaction product on 1.0% sepharose, and it is downcut from this gel, use GFX PCR DNA and Gel band Purification Kit (Amersham Biosciences, UK) to be purified.To the band order-checking of downcutting and compare with the aspergillus niger glucoamylase gene subsequently, show this PCR product part glucoamylase of having encoded.
Embodiment 3
From Trametes cingulata clone glucoamylase gene
From the partial sequence of Trametes cingulata glucoamylase, use that the gene walking (gene walking) by PCR-based has obtained more polygene sequence from the Vectorette Kit of SIGMA-Genosys.Gene walking carries out according to the description of the rules of manufacturers substantially.Use independently EcoRI, the Trametes cingulata genomic dna of BamHI and HindIII digestion 0.15 μ g.Use the DNA Engine Dyad PTC-0220 (MJ Research, USA) of programming to be connected with the corresponding Vectorette unit that manufacturers provides through the DNA that digests, described program is: 1 circulation, 16 ℃ 60 minutes; 4 circulations, each be 37 ℃ 20 minutes, 16 ℃ 60 minutes, 37 ℃ 10 minutes; 1 circulation subsequently, 16 ℃ 60 minutes; And 4 ℃ of maintenances.With sterilized water, ligation reaction is diluted 5 times subsequently.
As template, use the DNA Engine Dyad PTC-0220 (MJ Research, USA) of programming to carry out the PCR reaction with the Trametes cingulata genomic dna that is connected with joint, described program is: 1 circulation, 94 ℃ 2 minutes; 40 circulations, each be 94 ℃ 15 seconds, 72 ℃ 1 minute, 72 ℃ 1 minute; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances, wherein PCR reaction use the Vectorette primer that provides and following shown in the TraF1 primer:
TraF1：5’-TAGTCGTACTGGAACCCCACC-3’(SEQ ID NO:12)
Amplified reaction thing (12.5 μ l) consists of: 0.5 μ l is connected with genomic dna, 400nMVectorette primer, 400nM TraF1 primer, the 11 μ l Extensor Hi-Fidelity PCR MasterMix (ABgene, UK) of joint.
React from the genomic dna of HindIII digestion the amplified band that has obtained a 0.5kb by PCR.Use tbe buffer liquid reaction product isolated on 1.0% sepharose, and it is downcut from gel.Add 100 μ l sterilized waters in the sepharose fragment of downcutting, and by being incubated 5 minutes with its melting, with released dna at 95 ℃.Use the DNA fragmentation that 0.5 μ l separates to replace the described genomic dna that is connected with joint, repeat above-mentioned PCR reaction, with this DNA band that again increases.
After the PCR reaction, use ExoSAP-IT (USB, USA) according to this DNA of indication purifying of manufacturers, and to its order-checking, then compare with the aspergillus niger glucoamylase gene, show the part of another 250bp of its coding glucoamylase gene.
Owe to lose part for what clone Trametes cingulata glucoamylase gene, according to the indication of manufacturers, use LA PCR TMIn vitro Cloning Kit (TAKARA, Japan) carries out the gene walking of PCR-based.
Digest independently the Trametescingulata genomic dna of 5 μ g with BamHI, EcoRI, HindIII, PstI, SalI and XbaI.The ice-cold ethanol of 200ml is added in reaction mixture (50 μ l), and by reclaimed the DNA of digestion in centrifugal 30 minutes at 4 ℃, 15,000 * g.The DNA that reclaims is connected with the corresponding manual splice that manufacturers provides.Add the ice-cold ethanol of 200ml to reaction mixture (50 μ l), and centrifugal 30 minutes of 4 ℃, 15,000 * g, be connected with the DNA of joint with recovery.
With the Trametes cingulata genomic dna that is connected with joint as template, use the LA PCR (TAKARA of system, Japan) carry out the PCR reaction, wherein PCR uses primer C1 and TC5 ' to clone 5 '-glucoamylase gene of owing to lose, use primer C1 and TC3 ' to clone 3 '-glucoamylase gene of owing to lose, described primer is as follows:
C1：5’-gtacatattgtcgttagaacgcgtaatacgactca-3’(SEQ ID NO：13)
TC5’：5’-cgtatatgtcagcgctaccatgt-3’(SEQ ID NO：14)
TC3’：5’-aaacgtgagcgaccattttctgt-3’(SEQ ID NO：15)
Amplified reaction thing (50 μ l) consists of: the LA Taq polysaccharase (TAKARA, Japan) of 0.1U/ μ l in the primer of the template DNA of 1ng/ μ l, every kind of dNTP, the 250nM of 250mM, the primer of 250nM, 1X damping fluid.Reactant is incubation in DNA Engine PTC-200 (MJ-Research, Japan), and it is programmed for: 1 circulation, 94 ℃ 2 minutes; 30 circulations, each is 94 ℃ 0.5 minute, 55 ℃ 2 minutes and 72 ℃ 2 minutes; 1 circulation, 72 ℃ 10 minutes; And 4 ℃ of maintenances.
Use respectively primer C1 and TC5 ' from the genomic dna of SalI digestion, and obtained the amplified band of 0.4kb and 1.0kb with the genomic dna that primer C1 and TC3 ' digest from XbaI.Use tbe buffer liquid to separate these reaction product on 1.0% sepharose, it is downcut from gel.And use QIAquick according to the indication of manufacturers TMThis reaction product of Gel Extraction Kit (QIAGEN Inc., Valencia, CA) purifying.
The DNA fragmentation of amplification is connected in pT7Blue (Invitrogen, Netherlands) independently.Then will connect mixture and be transformed into intestinal bacteria DH12 α (GIBCO BRL, LifeTechnologies, USA), generate respectively pHUda438 and pHUda439 for 0.4kb amplified band and 1.0kb amplified band.With gained plasmid order-checking and with the aspergillus niger glucoamylase gene relatively, show these clones codings described glucoamylase owe to lose part.
Embodiment 4
The structure of DHUda440 expression vector
Built expression vector pHUda440 for the glucoamylase gene of transcribing from Trametes cingulata.As template, use Expand with Trametes cingulata genomic dna TMPCR system (Roche Diagnostics, Japan) carries out PCR reaction, and described PCR reaction is introduced BamH I site with the TFF primer, and the TFR primer introduces Xho I site, and is as follows.
TFF：5’-tttggatccaccatgcgtttcacgctcctcacctcc-3’(SEQ ID NO：16)
TFR：5’-tttctcgagctaccgccaggtgtcattctg-3’(SEQ ID NO：17)
Amplified reaction thing (50 μ l) is comprised of the Taq polysaccharase (RocheDiagnostics, Japan) of 0.1U/ μ l in the TFR primer of the TFF primer of every kind of dNTP, the 250nM of the template DNA of 1ng/ μ l, 250mM, 250nM, 1X damping fluid.With reactant incubation in DNA Engine PTC-200 (MJ-Research, Japan), it is programmed for: 1 circulation, 94 ℃ 2 minutes; 30 circulations, each is 92 ℃ 1 minute, 55 ℃ 1 minute and 72 ℃ 2 minutes; 1 circulation, 72 ℃ 10 minutes; And 4 ℃ of maintenances.
Use tbe buffer liquid reaction product isolated on 1.0% sepharose, downcut the product band of 2.2kb from this gel, use QIAquick according to the indication of manufacturers TMGel Extraction Kit (QIAGEN Inc., Valencia, CA) is purified.
The amplification of DNA fragments of this 2.2kb is digested with BamH I and Xho I, and be connected in the Aspergillus expression cassette pCaHj483 that uses BamHI and Xho I digestion.Then should connect mixture and be transformed in intestinal bacteria DH12 α (GIBCO BRL, LifeTechnologies, USA), to generate expression plasmid pHUda440.According to the indication of manufacturers, use
Figure S05844317420070627D000641
Spin Miniprep Kit (QIAGEN Inc., Valencia, CA) reclaims the plasmid of amplification.
Plasmid pCaHj483 comprises the expression cassette based on following elements: with the aspergillus niger neutral starch enzyme II promotor (Na2/tpi promotor) of Aspergillus nidulans triosephosphate isomerase untranslated leader fusion, and aspergillus niger glucoamylase terminator (AMG terminator), from the selective marker amdS of Aspergillus nidulans, this mark is given the ability of the growth take ethanamide as only nitrogen source.
Embodiment 4
From Pachykytospora papyracea clone glucoamylase gene
For clone from the glucoamylase gene of Pachykytospora papyracea owe to lose part, use LA PCR TMIn vitro Cloning Kit (TAKARA, Japan) carries out the gene walking of PCR-based according to the indication of manufacturers.
Digest independently the genomic dna of the Pachykytospora papyracea of 5 μ g with BamHI, EcoRI, HindIII, PstI, SalI and XbaI.The ice-cold ethanol of 200ml is added in reaction mixture (50 μ l), then centrifugal 30 minutes of 15,000 * g, 4 ℃ to reclaim the DNA through digestion.The DNA that reclaims is connected with the corresponding manual splice that manufacturers provides.Ice-cold ethanol by adding 200ml centrifugal 30 minutes of 15,000 * g, 4 ℃, reclaims the DNA that is connected with joint subsequently to reaction mixture (50 μ l).
With the Pachykytospora papyracea genomic dna that is connected with joint as template, use the LA PCR (TAKARA of system, Japan) carry out the PCR reaction, wherein PCR uses primer C1 and PP5 ' to clone 5 '-glucoamylase gene of owing to lose, use primer C1 and PP3 ' to clone 3 '-glucoamylase gene of owing to lose, described primer is as follows:
C1：5’-gtacatattgtcgttagaacgcgtaatacgactca-3’(SEQ ID NO：13)
PP5’：5’-cctccctgagtgagcgatgctgc-3’(SEQ ID NO：18)
PP3’：5’-caactccggcctctcctccagcg-3’(SEQ ID NO：19)
Amplified reaction thing (50 μ l) consists of: the LA Taq polysaccharase (TAKARA, Japan) of the primer of the template DNA of 1ng/ μ l, every kind of dNTP, the 250nM of 250mM, the primer of 250nM, the 0.1U/ μ l in the 1X damping fluid.Reactant is incubation in DNA Engine PTC-200 (MJ-Research, Japan), and it is programmed for: 1 circulation, 94 ℃ 2 minutes; 30 circulations, each be 94 ℃ 0.5 minute, 55 ℃ 2 minutes, and 72 ℃ 2 minutes; 1 circulation, 72 ℃ 10 minutes; And 4 ℃ of maintenances.
The genomic dna of using respectively primer C1 and PP5 ' to digest from EcoRI from the genomic dna of XbaI digestion, with primer C1 and PP3 ' has obtained the amplified band of 0.5kb and 0.9kb.Use the TAE damping fluid to separate these reaction product on 1.0% sepharose, it is downcut from gel.And use QIAquick according to the indication of manufacturers TMThis reaction product of Gel Extraction Kit (QIAGEN Inc., Valencia, CA) purifying.
The DNA fragmentation of amplification is connected in pT7Blue (Invitrogen, Netherlands) independently.Then will connect mixture and be transformed into intestinal bacteria DH12 α (GIBCO BRL, Life Technologies, USA), generate respectively pHUda448 and pHUda449 for 0.5kb amplified band and 0.9kb amplified band.With gained plasmid order-checking and with the aspergillus niger glucoamylase gene relatively, show these clones codings described glucoamylase owe to lose part.
Embodiment 5
The structure of DHUda450 expression vector
Built expression vector pHUda450 for the glucoamylase gene of transcribing from Pachykytospora papyracea.As template, use Expand with Pachykytospora papyracea genomic dna TMPCR system (Roche Diagnostics, Japan) carries out the PCR reaction, and described PCR reaction is introduced BamH I site with PPF primer as follows, and the PPR primer is introduced Xho I site.
PPF：5’-tttggatccaccatgcgcttcaccctcctctcctcc-3’(SEQ ID NO：20)
PPR：5’-tttctcgagtcaccgccaggtgtcgttctg-3’(SEQ ID NO：21)
Amplified reaction thing (50 μ l) is comprised of the PPR primer of the PFF primer of every kind of dNTP, the 250nM of the template DNA of 1ng/ μ l, 250mM, 250nM, the Taq polysaccharase (Roche Diagnostics, Japan) of 0.1U/ μ l in the 1X damping fluid.With reactant incubation in DNA Engine PTC-200 (MJ-Research, Japan), it is programmed for: 1 circulation, 94 ℃ 2 minutes; 30 circulations, each is 92 ℃ 1 minute, 55 ℃ 1 minute and 72 ℃ 2 minutes; 1 circulation, 72 ℃ 10 minutes; And 4 ℃ of maintenances.
Use TAE damping fluid reaction product isolated on 1.0% sepharose, downcut the product band of 2.2kb from this gel, use QIAquick according to the indication of manufacturers TMGel Extraction Kit (QIAGEN Inc., Valencia, CA) is purified.
Digest the amplification of DNA fragments of this 2.2kb with BamH I and Xho I, and be connected in the Aspergillus expression cassette pCaHj483 that uses BamHI and Xho I digestion.Then should connect mixture and be transformed in intestinal bacteria DH12 α (GIBCO BRL, Life Technologies, USA), to generate expression plasmid pHUda450.According to the indication of manufacturers, use Spin Miniprep Kit (QIAGENInc., Valencia, CA) reclaims the plasmid of amplification.
Embodiment 6
Express from Trametes cingulata and Pachykytospora papyracea in aspergillus oryzae Glucoamylase gene
Aspergillus oryzae strain BECh-2 is inoculated in 100mL YPG substratum and incubation 16 hours under 32 ℃, 80rpm.Collect centrifugation, with 0.6M KCl washing, and be resuspended in and contain commercialization beta-glucan enzyme product (GLUCANEX TM, Novozymes A/S, Bagsvaerd, Denmark) 20mL0.6M KCl in, final concentration is 600 μ l/mL.With this suspension at 32 ℃, 80rpm incubation until protoplastis forms, then use STC damping fluid washed twice.Described protoplastis is counted with hematimeter, more resuspended and be adjusted to 2.5x10 in the STC:STPC:DMSO of 8:2:0.1 solution 7The final concentration of protoplastis/mL.The pHUda440 or the pHUda450 that add about 3 μ g in this protoplastis suspension of 100 μ L, are incubated 20 minutes at soft the mixing on ice.Add 1ml SPTC, and with this protoplastis suspension 37 ℃ of incubations 30 minutes.After adding the Cove top agarose of 10mL50 ℃, reactant is layered on the COVE agar plate, and with these flat boards at 32 ℃ of incubations.After 5 days, select transformant from described COVE substratum.
Four transformant of selecting at random are inoculated in 100mL MS-9 substratum, and cultivated 1 day at 32 ℃.The MS-9 culture medium inoculated of 3mL in the MDU-pH5 of 100mL substratum, and was cultivated 3 days at 30 ℃.Obtained supernatant liquor in centrifugal 10 minutes by 3,000 * g.
Determine the increase of the NADH that the glucose response of Hexose phosphate dehydrogenase and mutarotase and generation produces by the absorbancy of measuring 340nm, as the glucose-amylase activity in supernatant samples.6 μ L enzyme samples (being dissolved in the damping fluid of 100mM sodium acetate, pH4.3) are mixed with the maltose (being dissolved in the damping fluid of 100mM sodium acetate, pH4.3) of 31 μ L23.2mM, and 37 ℃ of incubations 5 minutes.Then add the color reagent (430U/L Hexose phosphate dehydrogenase, 9U/L mutarotase, 0.21mM NAD and 0.15M NaCl are in the phosphate buffered saline buffer of 0.12M, pH7.6) of 313 μ l in the reaction mixture, 37 ℃ of incubations 5 minutes.Measure active on spectrophotometer at 340nm.Distilled water with 6 μ l replaces the enzyme sample in contrast.
Table 1 and table 2 have shown that selected transformant is with respect to the glucose-amylase activity of the activity (it has been normalized to 1.0) of host strain aspergillus oryzae BECh-2.
The shaking flask result of the expression Trametes cingulata glucoamylase transformant that table 1. is selected
Bacterial strain T.cingulata glucoamylase (AGU/ml) relative reactivity
#13-1 180
#13-2 199
#19-1 148
#19-2 169
BECh-2 1.0
The shaking flask result of the transformant of the expression Pachykytospora papyracea glucoamylase that table 2. is selected
Bacterial strain P.papyracea glucoamylase (AGU/ml) relative reactivity
#B11-1 42
#B11-2 48
#B11-3 36
#B11-4 50
BECh-2 1.0
Embodiment 7
The evaluation of Trametes cingulata glucoamylase in the alcohol fuel fermentation of one step
Ferment by small-scale, estimate Trametes cingulata glucoamylase for the relative performance of aspergillus niger glucoamylase and Talaromyces emersonii glucoamylase.The ground corn of about 380g (sieve through 1.65mm in pilot scale level beater grinder was ground) is added in the tap water of about 620g.Replenish the penicillin of 3mL1g/L to mixture.H with 40% 2SO 4PH regulator to 5.0 with this slurry.Record in triplicate dried solid substance (DS) level and be approximately 32%.The described slurry of about 5g is added in the test tube of 15mL.
Every kind of enzyme is carried out the docs-effect of two dosage and measure (dose-response).The dosage that uses is 0.3 and 0.6nmol/g DS.Process for every group and all carry out six repetitions.
After according to dosage applying, Yeast proliferation thing (yeastpropagate) (the RED STAR of inoculation 0.04mL/g mash in each test tube TMYeast), described Yeast proliferation thing was cultivated on the corn mash 22.5 hours.Test tube is covered with screw-cap (screw on top), wherein should bore a hole for air release with fine needle by lid; Weigh after of short duration vortex mixed and at 32 ℃ of incubations.Fermentation was carried out 70 hours, and measured the output of ethanol by the test tube of weighing.Before weighing with the of short duration vortex mixed of test tube.Experimental result is shown in table 1.
As seen from Table 1, when using Trametes cingulata glucoamylase, the ethanol production of the every gram DS significantly output than wild-type aspergillus niger and Talaromyces emersonii glucoamylase is high.
Table 1
Figure S05844317420070627D000681
Embodiment 8
The evaluation of Pachykytospora papyracea glucoamylase in the alcohol fuel fermentation of one step
Ferment by small-scale, estimate Pachykytospora papyracea glucoamylase for the relative performance of aspergillus niger glucoamylase and Talaromyces emersonii glucoamylase.The ground corn of about 380g (sieve through 1.65mm in pilot scale level beater grinder was ground) is added in the tap water of about 620g.Replenish the penicillin of 3mL1g/L to mixture.H with 40% 2SO 4PH regulator to 5.0 with this slurry.Record in triplicate dried solid substance (DS) level and be approximately 32%.The described slurry of about 5g is added in the test tube of 15mL.
Every kind of enzyme being carried out the docs-effect of two dosage measures.The dosage that uses is 0.3 and 0.6nmol/g DS.Process for every group and all carry out six repetitions.
After according to dosage applying, the Yeast proliferation thing (REDSTAR of inoculation 0.04mL/g mash in each test tube TMYeast), wherein said Yeast proliferation thing was cultivated on the corn mash 22.5 hours.Test tube is covered with screw-cap, wherein should bore a hole for air release with fine needle by lid; Weigh after of short duration vortex mixed and at 32 ℃ of incubations.Fermentation was carried out 70 hours, and measured the output of ethanol by the test tube of weighing.Before weighing with the of short duration vortex mixed of test tube.Experimental result is shown in table 2.
As seen from Table 2, when using Pachykytospora papyracea glucoamylase, the ethanol production of every gram DS is significantly higher than the output of wild-type aspergillus niger and Talaromyces emersonii glucoamylase.
Table 2
Figure S05844317420070627D000691
Embodiment 9
Trametes cingulata glucoamylase with from the hybrid alpha-amylases A of Rhizomucor pusillus group Share in one-step fermentation
All processing all ferment to estimate by small-scale.With adding in the 590g tap water through grinding corn of 410g.Replenish penicillin and the 1g urea of 3.0ml1g/L to this mixture.The pH regulator to 4.5 that to starch with 5N NaOH (the initial pH before regulating is about 3.8).Recording dried solid substance (DS) level is 35%.This slurry of about 5g is added in the bottle of 20ml.The enzyme that according to dosage adds appropriate amount to each bottle adds 200 μ l Yeast proliferation thing/5g fermented products subsequently.Actual dosage is based on the accurate weight of corn steep liquor in each bottle.At 32 ℃ of incubation bottles, each is processed and all carries out the fermentation of 9 repetitions.Selecting three repeat samples carried out 24 hours, 48 hours and 70 hours point analysiss.At 24 hours, 48 hours and 70 hours, bottle is carried out vortex mixed.The time point analysis is comprised of following step: the bottle of weighing reaches the sample for the preparation of HPLC.The HPLC preparation is comprised of the following step: the 40%H that adds 50 μ l 2SO 4Filter with termination reaction, filter centrifugal, that also pass through 0.45 μ m.Treat that the Storage of sample of HPLC analysis is at 4 ℃.
The enzyme that is used for this research:
Figure S05844317420070627D000701
Indicate: T.cingulata glucoamylase (49AGU/ml) and are all purifying enzyme from Novozymes Japan from the hybrid alpha-amylases A (17AFAU/ml) of Rhizomucor pusillus.The dried solid substance of DS=
Result
The synergy that has shown α-amylase and glucoamylase in following table.When separately using the T.cingulata glucoamylase in one-step fermentation, it has produced respectively 54.1,81.2 and the ethanol of 99.0g/l after 24 hours, 48 hours and fermentation in 70 hours.When the hybrid alpha-amylases A that uses separately in one-step fermentation from Rhizomucor pusillus, it has produced respectively 90.5,124.6 and the ethanol of 138.1g/l after 24 hours, 48 hours and fermentation in 70 hours.
The T.cingulata glucoamylase is approximately 6.5AGU/AFAU (upper table) with best proportion from the hybrid alpha-amylases A of Rhizomucor pusillus α-amylase.Observed basic similarly performance (in the ethanol production after fermentation in 70 hours) in the AGU/AFAU ratio is the scope of 0.76-38.7, this mixture that shows T.cingulata glucoamylase and hybrid alpha-amylases A has sane performance in wider active proportional range.
Embodiment 10
The DNA extraction of Leucopaxillus giganteus (Sow.: Fr.) Sing. and pcr amplification
Use the sporulation layer (lamella) of the new fresh sporophore of Leucopaxillus giganteus (Sow.: Fr.) Sing. of 0.2-2g, use FastDNA SPIN Kit for Soil (Qbiogene, USA) to carry out extracting genome DNA according to the indication of manufacturers.
With degenerated primer ArAF1 and ArAR3, this genomic dna is carried out the PCR reaction
ArAF1　　5’-CRTRCTYDVCAACATYGG-3’(SEQ ID NO：7)
ArAR3 5’GTCAGARCADGGYTGRRASGTG-3’(SEQ ID NO：8)
Wherein D=A or G or T, R=A or G, S=C or G, V=A or C or G, Y=C or T
Amplified reaction thing (13 μ l) is comprised of the Extensor Hi-Fidelity PCRMaster Mix (ABgene, UK) of l μ l genomic dna solution, 1 μ M ArAF1 primer (25pmol/ μ l), 1 μ M ArAR3 primer (25pmol/ μ l), 11 μ l.Reaction is incubation in DNA Engine Dyad PTC-0220 (MJ-Research, USA), and it is programmed for: 1 circulation, 94 ℃ 2 minutes; 20 circulations are respectively descend 1 ℃ and 72 ℃ 1 minute and 30 seconds of each circulation of 94 ℃ 30 seconds, 65 ℃ 45 seconds and annealing temperatures; 20 circulations subsequently, be respectively 94 ℃ 30 seconds, 45 ℃ of 45 seconds and 72 ℃ 1 minute and 30 seconds; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances.According to the indication of manufacturers, use ExoSAP-IT (USB, USA) to carry out purifying to the PCR product, and use its order-checking of primer pair used in described amplified reaction.Subsequently sequence is compared with the aspergillus niger glucoamylase gene, show this PCR product part glucoamylase of having encoded.
From the partial sequence of Leucopaxillus giganteus (Sow.: Fr.) Sing. glucoamylase, use the Vectorette test kit from SIGMA-Genosys, the gene walking by PCR-based has obtained more gene order.Gene walking is undertaken by as described in the rules of manufacturers.Digest independently the Leucopaxillus giganteus (Sow.: Fr.) Sing. genomic dna of 0.15 μ g with EcoRI, BamHI and HindIII.The DNA Engine DyadPTC-0220 (MJ Research, USA) that uses following programming is connected the DNA through digestion with the corresponding Vectorette unit that manufacturers provides: 1 circulation, 16 ℃ 60 minutes; 4 circulations, be respectively 37 ℃ 20 minutes, 16 ℃ 60 minutes, 37 ℃ 10 minutes; 1 circulation subsequently, 16 ℃ 60 minutes; And 4 ℃ of maintenances.With sterilized water, ligation reaction is diluted 5 times subsequently.
As template, use the DNAEngine Dyad PTC-0220 (MJ Research, USA) of following programming to carry out the PCR reaction with the Leucopaxillus giganteus (Sow.: Fr.) Sing. genomic dna that is connected with joint: 1 circulation, 94 ℃ 2 minutes; 40 circulations, be respectively 94 ℃ 15 seconds, 72 ℃ 1 minute, 72 ℃ 1 minute; 1 circulation, 72 ℃ 7 minutes; And 4 ℃ of maintenances, wherein primer uses respectively specificity Leucopaxillus giganteus (Sow.: Fr.) Sing. AMG primer Nc1R2 and NC1F0 as follows, and the Vectorette primer that provides:
Nc1R2：　　5’-GGTAGACTAGTTACCTCGTTGG-3’(SEQ ID NO：31)
Nc1F0： 5’-GCTTCCCTAGCCACTGCCATTGG-3’(SEQ ID NO：32)
Amplified reaction thing (12.5 μ l) is connected with the genomic dna of joint, the Vectorette primer of 400nM, the Leucopaxillus giganteus (Sow.: Fr.) Sing. Auele Specific Primer of 400nM, the Extensor Hi-FidelityPCR Master Mix (ABgene, UK) of 11 μ l by 0.5 μ l and forms.
After the PCR reaction, use ExoSAP-IT (USB, USA) to carry out purifying to the PCR product according to the indication of manufacturers, order-checking is compared with the aspergillus niger glucoamylase gene subsequently.
Carry out pcr amplification with the Nc1R2 primer from the genomic dna that HindII digests, obtained the amplified band of a 1.7kb.Use the order-checking of this PCR product of this primer pair, result shows encoded all the other 600 base pairs of 5 ' direction in described glucoamylase gene of this product.
Carry out pcr amplification with the Nc1F0 primer from the genomic dna that HindII digests, obtained the amplified band of a 1.8kb.Use the order-checking of this PCR product of this primer pair, result shows this product approximately 530 base pairs of having encoded in described glucoamylase gene in addition, but does not reach the end of this gene.So, designed another sequencing primer Nc1F2 according to the additional sequences of the glucoamylase gene of new acquisition.Use Nc1F2 as the downstream primer of Nc1F0, same PCR product to be checked order, result shows this product all the other 520 base pairs of 3 ' direction in the glucoamylase gene of having encoded.
Nc1F25’GTTGATTTAACTTGGAGCTATGC(SEQ ID NO：33)
Embodiment 11
The clone of Leucopaxillus giganteus (Sow.: Fr.) Sing. glucoamylase and expression
Obtained more gene order from the partial sequence of Leucopaxillus giganteus (Sow.: Fr.) Sing. glucoamylase.
Used following PCR clone primer:
Forward primer:
5’TCCCTT GGATCCAGGATGCATTTCTCTGTCCTCTC3’(SEQ ID NO：34)
　　　　 BamHI
Reverse primer:
5’CTTATC CTCGAGCTACTTCCACGAGTCATTCTGG3’(SEQ ID NO：35)
XhoI
Since from the gDNA of Leucopaxillus giganteus (Sow.: Fr.) Sing. as template, use Phusion as polysaccharase, and the above-mentioned primer of introducing respectively BamHI and XhoI carries out PCR.Detect the PCR product of 5 μ l in 1% sepharose, shown a band at about 2.2kb place.This PCR product of purifying on the QIAquick post.
With BamHI and purified product and the Aspergillus carrier pENI2516 Leucopaxillus giganteus (Sow.: Fr.) Sing. (referring to WO2004/069872) of XhoI digestion.Use the QIAquick method, be purified into described carrier and Insert Fragment from 1% preparation type sepharose.The fragment of 2.2kb is connected in carrier pENI2516 and is transformed in the TOP10 competent escherichia coli cell.With gained plasmid called after pENI3372.
Conversion in aspergillus niger
The protoplastis of preparation Aspergillus niger strain Mbin119 (referring to WO2004/090155).The pENI3372 of about 5 μ g is transformed in this protoplastis.Detect the glucoamylase activity of gained aspergillus niger transformant.
Embodiment 12
Trametes cingulata glucoamylase goes branch active to pullulan
Studied the α-1 of the glucoamylase that is derived from Trametes cingulata, Athelia rolfsii, aspergillus niger and Talaromycesemersonii, 6-goes branch active.
Pullulan (MW50,000～100,000) is dissolved in MilliQ water, add in reaction mixture to final concentration be 3%, wherein this mixture contains the 50mM sodium acetate buffer, pH4.0, enzyme dosage are 0.42 μ g enzyme/mg pullulan, temperature is 37 ℃.Periodically analyze the oligosaccharides graphic representation by HPLC.
This detection the results are shown in Fig. 1.
This paper describes and the scope of invention that requires is not limited to concrete aspect disclosed herein, because these aspects intentions are to illustrate several aspect of the present invention.Scope intention of the present invention comprises any aspect that is equal to.Certainly, according to above describing, except this paper shown and description, should be apparent to those skilled in the art to various modifications of the present invention.These modifications also should fall in the scope of claims.In case conflict occurs, will be as the criterion to comprise the disclosure in being defined in.
This paper has quoted many parts of reference, and it discloses complete introducing as a reference.
Figure IYZ000001936807300011
Figure IYZ000001936807300021
Figure IYZ000001936807300041
Figure IYZ000001936807300061
Figure IYZ000001936807300071
Figure IYZ000001936807300081
Figure IYZ000001936807300091
Figure IYZ000001936807300101
Figure IYZ000001936807300131
Figure IYZ000001936807300141
Figure IYZ000001936807300151
Figure IYZ000001936807300161
Figure IYZ000001936807300171
Figure IYZ000001936807300181
Figure IYZ000001936807300191
Figure IYZ000001936807300201
Figure IYZ000001936807300211
Figure IYZ000001936807300221
Figure IYZ000001936807300231
Figure IYZ000001936807300241
Figure IYZ000001936807300251
Figure IYZ000001936807300261
Figure IYZ000001936807300271
Figure IYZ000001936807300281
Figure IYZ000001936807300291
Figure IYZ000001936807300301
Figure IYZ000001936807300311
Figure IYZ000001936807300321
Figure IYZ000001936807300331
Figure IYZ000001936807300341
Figure IYZ000001936807300351
Figure IYZ000001936807300361
Figure IYZ000001936807300371
Figure IYZ000001936807300381
Figure IYZ000001936807300391
Figure IYZ000001936807300401
Figure IYZ000001936807300411
Figure IYZ000001936807300421
Figure IYZ000001936807300451
Figure IYZ000001936807300461
Figure IYZ000001936807300471
Figure IYZ000001936807300481
Figure IYZ000001936807300491
Figure IYZ000001936807300501
Figure IYZ000001936807300511
Figure IYZ000001936807300521
Figure IYZ000001936807300531
Figure IYZ000001936807300541
Figure IYZ000001936807300551
Figure IYZ000001936807300561
Figure IYZ000001936807300581
Figure IYZ000001936807300591
Figure IYZ000001936807300601
Figure IYZ000001936807300611
Figure IYZ000001936807300621
Figure IYZ000001936807300631
Figure IYZ000001936807300641
Figure IYZ000001936807300651

Claims (7)

1. be selected from the following isolated polypeptide with glucoamylase activity:
(a) polypeptide that is formed by the sequence of the 1st to 556 amino acids of SEQ ID NO:2;
(b) by the polypeptide that is included in the contained polynucleotide encoding of plasmid pHUda595 in intestinal bacteria DSM 17106, this polypeptide can be expressed in filamentous fungus;
(c) by the polypeptide that is included in the contained polynucleotide encoding of plasmid pHUda440, this polypeptide can be expressed in filamentous fungus.
2. composition, it comprises polypeptide and the α-amylase of claim 1.
3. the composition of claim 2, wherein said α-amylase is fungal alpha-amylase.
4. the composition of claim 3, wherein said α-amylase belongs to or Rhizomucor available from Aspergillus, Meripilus.
5. the composition of claim 4, wherein said α-amylase is available from Aspergillus awamori, valley aspergillus, aspergillus niger, aspergillus oryzae, Meripilus giganteus or Rhizomucor pusillus.
6. the composition of claim 2, the aminoacid sequence of wherein said α-amylase is selected from the aminoacid sequence of SEQ IDNO:28, SEQ ID NO:29 or SEQ ID NO:30.
7. produce the method for tunning from starch-containing material, comprise the following steps:
(a) under α-amylase exists, starch-containing material is liquefied;
(b) polypeptide of right to use requirement 1 carries out saccharification to the liquefied mass that obtains in step (a); And
(c) use fermenting organism that the material through saccharification is fermented.
CN2005800443174A 2004-12-22 2005-12-22 Polypeptides having glucoamylase activity and polynucleotides encoding same Active CN101194015B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US63861404P 2004-12-22 2004-12-22
US60/638,614 2004-12-22
US65061205P 2005-02-07 2005-02-07
US60/650,612 2005-02-07
PCT/US2005/046724 WO2006069289A2 (en) 2004-12-22 2005-12-22 Polypeptides having glucoamylase activity and polynucleotides encoding same

Publications (2)

Publication Number Publication Date
CN101194015A CN101194015A (en) 2008-06-04
CN101194015B true CN101194015B (en) 2013-05-08

Family

ID=39096041

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201610591291.5A Pending CN106397601A (en) 2004-12-22 2005-12-22 Enzymes for starch processing
CN2005800443174A Active CN101194015B (en) 2004-12-22 2005-12-22 Polypeptides having glucoamylase activity and polynucleotides encoding same
CN200580048598.0A Active CN101128580B (en) 2004-12-22 2005-12-22 For the enzyme of starch processing

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201610591291.5A Pending CN106397601A (en) 2004-12-22 2005-12-22 Enzymes for starch processing

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN200580048598.0A Active CN101128580B (en) 2004-12-22 2005-12-22 For the enzyme of starch processing

Country Status (1)

Country Link
CN (3) CN106397601A (en)

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8916359B2 (en) * 2009-11-30 2014-12-23 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
CA2782128C (en) * 2009-11-30 2019-01-15 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
ES2534067T3 (en) * 2009-12-01 2015-04-17 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding them
DK3101127T3 (en) * 2010-01-04 2019-05-13 Novozymes North America Inc Alpha-amylase variants with improved stability
EP2637515B1 (en) * 2010-11-08 2017-09-06 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
ES2605235T3 (en) * 2010-11-08 2017-03-13 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding them
BR112013032861A2 (en) * 2011-07-22 2017-01-24 Novozymes North America Inc methods for increasing cellulolytic enzyme activity during hydrolysis of cellulosic material, for hydrolyzing a pretreated cellulosic material, for producing a fermentation product, and for fermenting a pretreated cellulosic material
WO2013029494A1 (en) * 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2013034097A1 (en) * 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
CN103509720B (en) * 2012-06-19 2015-07-01 中国农业大学 Method for preparing alpha-amylase and dedicated strain thereof and related protein
CN104640994A (en) * 2012-08-16 2015-05-20 丹尼斯科美国公司 Method of using alpha-amylase from aspergillus clavatus and isoamylase for saccharification
CN104769106A (en) * 2012-10-10 2015-07-08 丹尼斯科美国公司 Method of using alpha-amylase from talaromyces emersonii for saccharification
CN104903458A (en) * 2012-12-14 2015-09-09 丹尼斯科美国公司 Method of using alpha-amylase from aspergillus fumigatus and isoamylase for saccharification
CN104903459A (en) * 2012-12-14 2015-09-09 丹尼斯科美国公司 Method of using alpha-amylase from aspergillus fumigatus and pullulanase for saccharification
US20160010128A1 (en) * 2012-12-20 2016-01-14 Danisco Us Inc. Method of using alpha-amylase from aspergillus terreus and pullulanase for saccharification
WO2016100871A1 (en) * 2014-12-19 2016-06-23 Danisco Us Inc Glucoamylase blends
EP3274461A1 (en) * 2015-03-27 2018-01-31 Cargill, Incorporated Glucoamylase-modified yeast strains and methods for bioproduct production
CN106479996B (en) * 2015-08-24 2021-03-02 丰益(上海)生物技术研发中心有限公司 Novel amylase
BR112019002238A2 (en) 2016-08-05 2019-05-14 Cargill, Incorporated manipulated polypeptide and cell, and fermentation method.
CN107475219B (en) * 2017-09-29 2020-06-09 天津科技大学 Three recombinant saccharifying enzymes and preparation method and application thereof
CN108410841B (en) * 2018-01-25 2020-06-30 中国农业大学 Efficient preparation and application of Dupont thermophila α -amylase
CN108588056B (en) * 2018-03-12 2020-03-27 中国农业科学院饲料研究所 Low-temperature α -amylase Tcamy and gene and application thereof
WO2019197318A1 (en) * 2018-04-09 2019-10-17 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
CN111117986B (en) * 2020-01-16 2022-04-22 南京林业大学 Encoding gene of calcium-dependent heat-resistant alpha-L-arabinofuranosidase, preparation technology and application
CN111944790B (en) * 2020-07-01 2022-09-09 深圳润康生态环境股份有限公司 Neutral protease gene, neutral protease, preparation method and application thereof
CN113201518A (en) * 2021-04-29 2021-08-03 广州博识生物科技有限公司 High-activity alpha-amylase
CN113151220A (en) * 2021-04-29 2021-07-23 广州博识生物科技有限公司 Acid-resistant alpha-amylase

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1526821A (en) * 1999-03-22 2004-09-08 诺沃奇梅兹生物技术有限公司 New glucoamylase and coding its nucleic acid sequence

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4551097A (en) * 1996-10-11 1998-05-11 Novo Nordisk A/S Alpha-amylase fused to cellulose binding domain, for starch degradation
CN100412191C (en) * 2002-12-17 2008-08-20 诺和酶股份有限公司 Thermostable alpha-amylases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1526821A (en) * 1999-03-22 2004-09-08 诺沃奇梅兹生物技术有限公司 New glucoamylase and coding its nucleic acid sequence

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J.ZHAO et al.Molecular cloning, Characterization, and differentialexpression of a Glucoamylase gene from the basidiomycetousFungus Lentinula edodes.APPLIED and ENVIRONMENTAL MICROBIOLOGY66 6.2000,66(6),第2531-2535页.
J.ZHAO et al.Molecular cloning, Characterization, and differentialexpression of a Glucoamylase gene from the basidiomycetousFungus Lentinula edodes.APPLIED and ENVIRONMENTAL MICROBIOLOGY66 6.2000,66(6),第2531-2535页. *
Y.NAGASAKA et al.Cloning of Corticium rolfsii Glucoamylase cDNA and itsexpression in Saccharomyces cerevisiae..APPLIED MICROBIOLOGY AND BIOTECHNOLOGY44.1995,44第451-458页. *

Also Published As

Publication number Publication date
CN106397601A (en) 2017-02-15
CN101128580A (en) 2008-02-20
CN101194015A (en) 2008-06-04
CN101128580B (en) 2016-08-24

Similar Documents

Publication Publication Date Title
CN101194015B (en) Polypeptides having glucoamylase activity and polynucleotides encoding same
US10316307B2 (en) Polypeptides having glucoamylase activity and polynucleotides encoding same
US10125380B2 (en) Polypeptides having glucoamylase activity and polynucleotides encoding same
JP5160899B2 (en) Polypeptides having glucoamylase activity and polynucleotides encoding them
US9102928B2 (en) Polypeptides having glucoamylase activity and polynucleotides encoding same
CN101443447A (en) Polypeptides having glucoamylase activity and polynucleotides encoding same
CN102869770B (en) There are the polypeptide of glucoamylase activity and the polynucleotide of this polypeptide of coding
CN103298359B (en) There are the polypeptide of glucoamylase activity and the polynucleotide of this polypeptide of coding
CN102933596B (en) There are the polypeptide of glucoamylase activity and the polynucleotide of this polypeptide of coding

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant