CN101189263A - Recombinant E-selectin made in insect cells - Google Patents

Abstract

The inventive features include recombinant mammalian E-selectin peptides, nucleic acids encoding said peptides, vectors and cells having these nucleic acids, and methods of making the peptides. Further inventive features include methods of treating diseases and conditions associated with inflammation using recombinant mammalian E-selectin peptides to induce mucosal tolerance to E-selectin.

Description

The reorganization E-for preparing in insect cell selects albumen

Related application

The application requires the right of priority of the U.S. Provisional Application 60/660,258 of 10 submissions March in 2005.The full text of above-mentioned application is incorporated this paper reference into.

Background of invention

It is a kind of cell surface glycoprotein cell adhesion molecule that E-selects albumen, and it is that cytokine is derivable and only find on endotheliocyte.E-selects the adhesion of protein mediated multiple white corpuscle and activated endothelium, and described white corpuscle comprises neutrophil leucocyte, monocyte, eosinophil, natural killer cell (NK) and T cell subtype.It is by replying inflammation relevant cell factor IL-1 and TNF α and replying lipopolysaccharides (LPS) and just regulate and derivative by transcribing that E-selects the expression of albumen on human endothelial cell.

Conventional anti-inflammatory intervention comprises and exhausts leukocytic cycling pool (circulatory pool), suppresses leukocyte function and use immunosuppressive drug such as cyclosporin A and FK506.Yet most of available immunosuppressor have systemic side effects, have limited its prolonged application.

But mucosa delivery inflammation-inhibiting and disease activity in apoplexy and arteriosclerosis model and in some autoimmune disorder models such as diabetes, sacroiliitis and experiment allergic encephalomyelitis model of autoantigen have been demonstrated.The E-that repeatedly gives low dosage by nose/oral cavity selects protein induced E-to be selected proteic mucosal tolerance.Mucosal tolerance is a generally acknowledged model, instils by nose thus or nasal feeding antigen is induced immunologic tolerance to this specific antigen.The antigen that gives through nose suffers from the relevant Lymphoid tissue of nose, and it has been evolved and has invaded and obtained to prevent the inherent nature of the avirulence proteins react of host and suction for the pathogenic agent of protecting the host to avoid invading.After repeating to give low dosage antigen, produce initiatively tolerance (active tolerance), produce with regulatory T cells.

It is not composing type that E selects protein expression, is limited to basically and replys inflammatory stimulus thing such as IL-I, TNF-α or LPS and the activatory endothelium that becomes.E-selects albumen local inflammation position long-term expression in vivo, and E-selects albumen to tolerate E-as suitable tolerance molecule guidance and selects proteic regulatory T cells arrival endothelium activated part thus.These secrete cytokine such as IL-10 and transforming growth factor (TGF) b1 that suppresses the TH1 immunne response with the regulatory T cells of low dosage scheme tolerance when stimulating again with antigen.Although the activation of these T cells is specific to tolerance antigen (in this case select for E-albumen), reply activation and excretory immunomodulatory cytokine has nonspecific action.Therefore, no matter where described tolerance antigen exists in, and local immunity suppresses all will take place.

By using E-to select albumen as the tolerance agent, can be with the immunosuppression target in activated blood vessel sections (vessel segment).

Summary of the invention

Feature of the present invention comprises that the Mammals E-of reorganization selects protein peptide, and the nucleic acid of these peptides of encoding has the carrier and the cell of these nucleic acid and the method for producing described peptide.Further aspect of the present invention comprises that the Mammals E-that uses reorganization selects protein peptide to induce E-is selected proteic mucosal tolerance and treats the method for inflammatory disease.

The invention provides a series of Mammals E-and select protein peptide.A kind of E-selects protein peptide to select the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E-basically.This peptide can have one or more C-terminal mark that is attached to it, comprises C-terminal dipeptides RS.In addition, the present invention includes this peptide that is attached with the N-terminal secreting signal peptide.Although preferred people's recombinant peptide also can use other mammalian-derived peptides, preferably has the peptide of forming by 200-400 amino acid of at least 60% homogeny with SEQ IDNO:1.Mixture and the combination that Mammals E-selects protein peptide also contained in the present invention.

The C-terminal mark of peptide of the present invention comprises purifying mark and stabilization mark such as c-myc mark and histidine mark.The N-terminal secreting signal peptide comprises Mammals and insect cell deutero-peptide.N-terminal secretion property signal peptide comprises AcMNPV gp64 env secretion sequence MGWSWIFLFLLSGTASVHS (SEQ ID NO:3), signal peptide sequence MGWSWIFLFLLSGTAS (SEQ ID NO:4), and wild-type people signal sequence peptide MIASQFLSALTLVLLIKESGA (SEQ ID NO:2).Peptide of the present invention can be produced in various kinds of cell system, comprises insect cell, mammalian cell, bacterial cell and yeast.

Feature of the present invention a series of Mammals E-that also are to encode select the nucleic acid molecule of protein peptide.Described nucleic acid molecule encoding is selected protein peptide by the E-that wild-type people E-selects the 20-303 position residue of albumen (SEQ ID NO:1) to form basically.This E-that encodes selects the nucleic acid molecule of protein peptide can have one or more C-terminal mark that is attached to it, comprises C-terminal dipeptides RS.In addition, the present invention includes the nucleic acid molecule that coding is attached with this basic E-selection protein peptide of N-terminal secretion property signal peptide.Although optimized encoding preferably has the nucleic acid molecule of 200-400 amino acid whose people's recombinant peptide, also can use coding and SEQ ID NO:1 to have the nucleic acid molecule of other mammalian-derived peptides of at least 60% homogeny.Mixture and the combination that Mammals E-selects protein peptide also contained in the present invention.

Feature of the present invention also be the to encode nucleic acid molecule of purifying mark and stabilization mark such as c-myc mark and histidine mark.The described nucleic acid molecule N-terminal secretion property signal peptide of can encoding comprises Mammals and insect cell deutero-peptide.Described nucleic acid molecule codified N-terminal secretion property signal peptide, comprise AcMNPV gp64 env secretion sequence MGWSWIFLFLLSGTASVHS (SEQ ID NO:3), signal peptide sequence MGWSWIFLFLLSGTAS (SEQ ID NO:4), and wild-type people signal sequence peptide MIASQFLSALTLVLLIKESGA (SEQ ID NO:2).Described nucleic acid molecule is used in the various kinds of cell system and produces peptide of the present invention, comprises insect cell, mammalian cell, bacterial cell and yeast.

Feature of the present invention also is to have the baculovirus that coding E-selects the nucleotide sequence of protein peptide, carrier with nucleotide sequence of coding E-selection protein peptide perhaps comprises coding and the recombinant baculovirus transfer vector of the DNA sections of the baculovirus signal peptide that the nucleic acid of the E-selection protein peptide of encoding is connected.Described dna sequence dna present position makes the E-of coding select translation in protein peptide and the encoded signals peptide frame.This recombinant baculovirus transfer vector preferably operably is connected to express the nucleic acid of coding E-selection protein peptide in host cell with bacilliform virus promoter.Described host cell can comprise insect cell, bacterial cell and mammalian cell.Preferably, described recombinant baculovirus transfer vector comprises and is used for selecting protein peptide to secrete the into sequence of the substratum of described insect host cell E-of the present invention.

Feature of the present invention also is to have the composition that one or more E-selects protein peptide or Nucleotide and carrier (preferred agents acceptable carrier).Comprise that it also is a part of the present invention that E-selects protein peptide or coding E-to select the isolated cells and the cell composition of the Nucleotide of protein peptide.The available cell comprises mammalian cell, bacterial cell and insect cell, preferred insect cell.

The present invention is further characterized in that a kind of method that E-of the present invention selects protein peptide of producing.This method comprises from making up a kind of coding and coding E-of comprising selects the recombinant transfer vector of the DNA sections of the baculovirus signal peptide that the nucleic acid of protein peptide is connected, makes described signal sequence and coding E-select interior translation of nucleic acid frame of protein peptide.The DNA sections of described coding baculovirus signal peptide operably is connected with bacilliform virus promoter, to select protein peptide in expressed in insect cells and secretion E-.With first kind of insect cell with described recombinant transfer vector and baculovirus DNA cotransfection to produce recombinant baculovirus.Gather in the crops described recombinant baculovirus.With the recombinate shape virus infection of second kind of insect cell with described results.The insect cell that infects is cultivated in substratum to express and secretion E-selection protein peptide.Collect described substratum and carry out purifying to collect described E-selection protein peptide.

The present invention also comprises and a kind ofly selects the mucosal tolerance of protein peptide to treat the disease inflammation mediated in the individuality or the method for pathology by inducing to soluble E-.This can select albumen to realize by the E-that intranasal or oral cavity route repeatedly give individual low dosage.

The accompanying drawing summary

Purpose of the present invention and feature can be understood better with reference to the following detailed description and accompanying drawing.

Fig. 1 (SEQ ID NO:8) is aminoacid sequence and the protein structure function aldesignations that the recombinant human E-of supposition selects protein peptide.

Fig. 2 illustrates reorganization E-and selects protein peptide and wild-type people E-to select proteic sequence contrast.

Detailed Description Of The Invention

The invention provides the CD62L peptide of restructuring, the described CD62L peptide of encoding DNA reaches the method for producing and using described peptide. Use as giving a definition in full.

Definition

Unless otherwise indicated, then implement the present invention and use molecule life well known by persons skilled in the art The routine techniques of thing, microbiology and recombinant DNA technology. This technology is filled in the literature Divide and explain. See for example Sambrook, Fritsch ﹠ Maniatis, 1989,Molecular Cloning： A Laboratory Manual，Second Edition； Oligonucleotide Synthesis(MJ. Gait，ed.，1984)； Nucleic Acid Hybridization(B.D.Harnes & SJ.Higgins， eds.，1984)； A Practical Guide to Molecular Cloning(B.Perbal, 1984); AndMethods in Enzymology(Academic Press，Inc.)； Short Protocols In Molecular Biology, (Ausubel et al., ed., 1995) are described. This paper mention all are special Profit, patent application and publication are incorporated into for referencial use at this with it in full.

As used herein, " N end " zone of peptide refer to by be positioned at gene 5 ' terminal or Peptide sequence at 5 ' terminal (two strands or strand) polynucleotide sequence coding comprises but non-limit 5 ' protein coding region in gene. As used herein, " amino terminal " zone refers to from institute First amino acid of stating peptide begins until front 300 amino acid of described peptide or 1/3 peptide Amino terminal. " amino terminal " zone length of peptide be not shorter than 3 amino acid and no longer than 350 amino acid. Other possible length in " amino terminal " zone of peptide comprises but non-limit In 5,10,20,25,50,100 and 200 amino acid.

As used herein, " carboxyl terminal " of peptide or " C end " refer to by being positioned at gene 3 ' terminal in or be positioned at the polypeptide order of 3 ' terminal (two strands or strand) polynucleotide sequence coding Row comprise but the non-3 ' protein coding region that is limited to gene. As used herein, " carboxyl terminal " The zone refers to begin until 300 amino acid or 1/3 from last amino acid of described peptide The carboxyl terminal of peptide. Described " 3 ' end " do not comprise polyA afterbody (if its existence). " carboxyl terminal " zone length of polypeptide is not shorter than 3 amino acid and reaches no longer than 350 amino Acid. Other of " carboxyl terminal " of peptide zone may length comprise but non-ly be limited to 5,10,20, 25,50,100 and 200 amino acid.

The CD62L peptide that has similar amino acid sequence to second CD62L peptide is Satisfy at least a CD62L peptide of following condition: (a) have with second E-and select The amino acid sequence at least 60%, at least 65%, at least 70%, at least 75% of protein peptides, At least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical ammonia The CD62L peptide of base acid sequence; (b) by under stringent condition with the coding at least 25, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 125 or the nucleotides of the second protein material of at least 150 continuous amino acid residues The nucleotide sequence coded CD62L peptide of sequence hybridization; (c) with coding second E-choosing Select protein peptides nucleotide sequence at least 60%, at least 65%, at least 70%, at least 75%, At least 80%, at least 85%, at least 90%, at least 95% or 99% identical nucleotides The CD62L peptide of sequential coding.

The first kind of CD62L peptide that has analog structure with second CD62L peptide is Refer to that the E-that has similar secondary, three grades or quaternary structure with second CD62L peptide selects Select protein peptides. The structure of CD62L peptide can be passed through method known to those skilled in the art Determine, comprise but non-be limited to peptide sequencing, X-radiocrystallography, nuclear magnetic resonance, circular dichroism and Crystal current sub-microscope method.

In order to determine the homogeny percentage of two amino acid sequences or two nucleotide sequences, will Sequence is carried out the best contrast (for example can import breach in first amino acid or nucleotide sequence To carry out the best contrast with second amino acid or nucleotide sequence). Contrast then at corresponding amino Amino acid residue or the nucleotides of acid position or nucleotide position. In first sequence one The position is when occupying with the same amino acid residue of second sequence relevant position or nucleotides, then Described molecule is identical in this position. Homogeny percentage between two sequences is described The function of the same position number that sequence is total (is the identical lap position number of homogeny %=/ total number of positions * 100%). Described two sequences can be equal length.

The determining of homogeny percentage between two sequences also can use mathematical algorithm to finish. The example of preferred nonrestrictive mathematical algorithm for contrasting two sequences is Karlin and Altschul, 1990, Proc.Natl.Acad.Sci.U.S.A.87:2264-2268 is described, by Karlin and Altschul, 1993, Proc.Natl.Acad.Sci.U.S.A.90:5873-5877 repaiies The algorithm that changes. This algorithm mixes Altschul et al., 1990, J.MoI.Biol.215:403's In NBLAST and the XBLAST program. The BLAST nucleotide search can be used NBLAST The nucleotides program parameter carries out, score=100 for example, and wordlength=12 is to obtain and this The nucleotide sequence of bright nucleic acid molecules homology. The BLAST protein search can be used The XBLAST program parameter carries out, score-50 for example, and wordlength=3 is to obtain and this The amino acid sequence of bright protein molecule homology. In order to obtain series arrangement jaggy to advance The row contrast utilizes such as Altschul et al. 1997, Nucleic Acids Res.25:3389-3402 Described Gapped BLAST. Perhaps, can use PSI-BLAST repeatedly to search for, To detect the close and distant relation (Id.) between two molecules. When utilizing BLAST, Gapped BLAST During with the PSI-Blast program, can use each program default parameters (for example XBLAST and The parameter of NBLAST) (sees for example NCBI website). Another preferred nonrestrictive for The example of the mathematical algorithm of sequence contrast is Myers and Miller, 1988, CABIOS The described algorithm of 4:11-17. This algorithm mixes ALIGN program (version 2 .0), and it is GCG The part of sequence comparison software bag. When utilizing ALIGN program contrast amino acid sequence, Can use PAM 120 weighting residue tables (weight residue table), the notch length penalties 12 and breach penalties 4.

Homogeny per-cent between two sequences can use and allow to above-mentioned similar technology or do not allow the existence of breach and determine.In calculating homogeny per-cent, typically only calculate accurately coupling.

As used herein, select the term " analogue " of protein peptide analogue to be meant another kind of organic or inorganic molecule about E-, it has to E-selects the similar or identical functions and structurally similar to E-selection protein peptide of protein peptide.Term " analogue " comprises that its core texture and E-select protein peptide identical or closely similar but have molecule through chemistry or physical modification.Term " analogue " comprises that the E-that can be connected with other atom or molecule selects the multipolymer of protein peptide." biologic activity analogue " and " analogue " interchangeable application have been contained and have been presented the organic or inorganic molecule that identical E-selects protein peptide agonist or antagonist effects substantially.

As used herein, E-selects " nucleotide analog " of protein peptide to be meant that wherein pentose and/or one or more phosphoric acid ester are by its analogue displacement separately.The phosphoric acid ester analogue for example comprises but non-phosphonate ester, methylphosphonate, phosphoramidate, phosphotriester, thiophosphatephosphorothioate, phosphorodithioate, seleno phosphoric acid ester (phosphoroselenoates), two seleno phosphoric acid ester (phosphorodiselenoates), phosphoroanilothioates, phosphoroanilidates, amino phosphonates do, the boron phosphoric acid ester (boronophosphates) etc. of being limited to comprise any relevant gegenion (if present).Also comprise in the definition of " nucleotide analog " and can be polymerized to DNA/RNA phosphoric acid ester wherein and/or sugar phosphoric ester main chain nuclear base monomer by dissimilar key metathetical polynucleotide analogues." nucleotide analog " further comprise its center base portion be unconventional, promptly be different from the Nucleotide of one of G, A, T, U or C.Common unconventional nuclear base have with adjacent reverse polynucleotide chain at least one nuclear base portion of existing form the ability of hydrogen bond or provide non-interaction non-interferential base.

As used herein, term " significant quantity " be meant E-select protein peptide or nucleic acid be enough to reduce or improve progress, severity and/or time length, prevention inflammation or its one or more symptom of inflammation or its one or more symptom generation, stop the progress of inflammation or its one or more symptom or strengthen or improve the amount of the prevention or the therapeutic action of another methods of treatment.

As used herein, term " significant quantity " is meant that E-selects protein peptide to give to be enough to induce the amount of E-being selected proteic tolerance by intranasal.

As used herein, " fragment " of term E-selection protein matter is meant the peptide or the polypeptide of the aminoacid sequence of at least 25,40,50,60,70,80,90,100,125,150,175,200 or at least 250 the continuous amino acid residues that comprise Mammals E-selection Argine Monohydrochloride sequence.The fragment that can be used for protein of the present invention or polypeptide keeps Mammals E-and selects proteic at least a function.The fragment of protein or polypeptide can keep Mammals E-and select proteic two kinds, three kinds, four kinds or more kinds of function.

As used herein, term " combination " is meant the methods of treatment (for example more than one preventive and/or therapeutical agent) of using more than one when being used to describe when treatment is handled.The application of term " combination " does not limit the order of the treatment (for example preventing and/or treating agent) that wherein gives object.First kind of treatment (for example first kind is prevented or therapeutical agent) can give second kind of treatment (for example second kind is prevented or therapeutical agent) (for example 5 minutes before, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, before 8 weeks or 12 weeks), while or (for example 5 minutes afterwards, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, after 8 weeks or 12 weeks) give object.

As used herein, " isolating " or " purifying " is meant that when being used for describing peptide or nucleic acid the sequence of natural generation shifts out from its normal cell (for example karyomit(e)) environment, perhaps in non-natural environment synthetic (for example synthetic).Therefore, " isolating " or " purifying " sequence can or be placed in the different cellular environments in cell-free solution.Term " purifying " does not mean that Nucleotide or the peptide that described sequence just exists, but does not have (approximately 90-95% is pure) and its relevant naturally non-nucleotide or non-fret peptide substantially, therefore is different from isolating karyomit(e).

As used herein, be meant do not have cell material basically and do not come from its therefrom proteinaceous substances of the heterologous protein metallic substance of deutero-cell or tissue (being contaminating protein matter) in some embodiments basically about proteinaceous substances (proteinaceous agent) (for example peptide, polypeptide, protein or antibody) used term " isolating " and " purifying ", perhaps when being chemosynthesis, do not have precursor or other compound basically.Term " does not have cell material " and comprises the prepared product of proteinaceous substances basically, wherein said proteinaceous substances from its separate from or reorganization produce from the cellular constituent of cell separate.Therefore, there is not the proteinaceous substances of cell material to comprise to have to be less than about 30%, 20%, 10% or 5% (dry weight) heterologous protein metallic substance (for example protein, polypeptide, peptide or antibody basically; Be also referred to as contaminating protein matter) the prepared product of proteinaceous substances.When described proteinaceous substances is that reorganization produces, it does not preferably have substratum basically yet, i.e. substratum representative is less than the protein prepared product of about 20%, 10% or 5% volume.When described proteinaceous substances produces by chemosynthesis, it does not preferably have precursor or other compound basically, and promptly it separates from the synthetic precursor that participates in described proteinaceous substances or other compound.Therefore, the prepared product of this proteinaceous substances has precursor except the protein of interest metallic substance or the compound that is less than about 30%, 20%, 10%, 5% (dry weight).Preferably, described proteinaceous substances is isolating.

As used herein, term " nucleic acid " is used interchangeably with " polynucleotide ", typically refers to any polybribonucleotide or polydeoxyribonucleotide, and it can be the RNA of unmodified or RNA or DNA or its any combination of DNA or modification." nucleic acid " comprises but non-strand and the double-strandednucleic acid of being limited to.As used herein, term " nucleic acid " also comprises above-mentioned DNA or the RNA that also has one or more modified base.Therefore, DNA or the RNA with thereby main chain of modifying former for stability or other is " nucleic acid ".As used herein, term " nucleic acid " comprises this nucleic acid through chemistry, enzyme or metabolism modified forms, and virus and cell comprise for example DNA and the RNA of simple cell and the distinctive chemical species of complex cell." nucleic acid " or " nucleotide sequence " also can comprise zone or its any combination of strand or double-stranded RNA or DNA.

As used herein, " nucleic acid " has contained length is above double-stranded DNA, single stranded DNA and two strands or single stranded RNAs of 8 Nucleotide.Term " polynucleotide " comprises the Nucleotide polymerized form of any length, ribonucleotide or deoxyribonucleotide, it comprises purine and pyrimidine bases, and perhaps other is natural, chemistry or biological chemistry is that modify, non-natural or deutero-nucleotide base.The main chain of described polynucleotide can comprise sugar and the bound phosphate groups that can typical find, the perhaps sugar or the bound phosphate groups of modifying or replacing in RNA or DNA.Polynucleotide can comprise the Nucleotide of modification, as methylated nucleotide and nucleotide analog.The sequence of Nucleotide can be interrupted by the non-nucleotide composition.

As used herein, " patient " or " individuality " is meant and is given the Mammals that E-selects protein peptide, preferred people.

As used herein, phrase " medicine acceptable carrier " comprises but non-water or the nonaqueous phase composition that is limited to the salt that comprises the acidity that can exist in the compound that uses method of the present invention to differentiate or basic group.Naturally Jian Xing compound can form multiple salt with multiple inorganic and organic acid.The acid that can be used for preparing the acid salt of the acceptable this basic cpd of medicine is those acid that form nontoxic acid salt, described salt promptly contains the acceptable anionic salt of medicine, comprise but the non-vitriol that is limited to, Citrate trianion, maleate, acetate, oxalate, the hydrogen chlorate, hydrobromate, hydriodate, nitrate, vitriol, hydrosulfate, phosphoric acid salt, acid phosphate, Yi Yansuan salt, acetate, lactic acid salt, salicylate, Citrate trianion, the acid Citrate trianion, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate salt, succinate, maleate, gentisate (gentisinate), fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutaminate, mesylate, esilate, benzene sulfonate, tosilate and pamoate (pamoate) (promptly 1,1 '-methylene radical-two-(2-hydroxyl-3-naphthoate)).The compound that comprises an amino part can form the acceptable salt of medicine with the multiple amino acids except above-mentioned acid.Be that the tart compound can form basic salt with the acceptable positively charged ion of multiple medicine under the natural condition.The example of this salt comprises basic metal or alkaline earth salt, particularly calcium, magnesium, sodium, lithium, zinc, potassium and molysite.

As used herein, " by ... encoded polypeptides sequence " is meant the aminoacid sequence that obtains after the protein coding region translation of gene.

As used herein, term " protein " and " peptide " reach " polypeptide " interchangeable application, are meant the amino acid chain that links together by peptide bond.In a special embodiment, protein is less than 200, is less than 175, is less than 150, is less than 125, is less than 100, is less than 50, is less than 45, is less than 40, is less than 35, is less than 30, is less than 25, is less than 20, is less than 15, is less than 10 or be less than 5 amino acid and form by what links together by peptide bond.Protein is made up of 200,250,300,350,400,450,500 or the more a plurality of amino acid that link together by peptide bond at least at least at least at least at least at least at least.

" protein coding region " is meant the part of the mRNA of coded polypeptide.

The present invention's part is based on recognizing that E-selects some part of proteic ectodomain or structural domain can have beneficial effect.DNA and cell that people E-selects peptide, preferred the 20-303 fragment and the coding of the reorganization of protein peptide or produces these peptides can be used among the present invention.

Be designed to the composition embodiment of comprising of inducing tolerance of soluble E-selection protein peptide

It is a kind of completely soluble liquid protein soln in phosphate buffered saline (PBS) (PBS) solution that described E-selects protein peptide.Described medicine is derived from the Sf-9S insect cell (the Spodoptera frugzperda of squama wing section) that infects with reorganization AcMNPV baculovirus vector (the Autographica californiica multinuclear polyhedrosis virus of Rhabdoviridae), described vector encoded people E-selects born of the same parents' outside part of protein matter, has lectin bonded Urogastron (EDF) structural domain that merges at N-terminal and gp64 secretion signal and reaches c-myc and polyhistidine peptide-labeled (Fig. 1) at C-terminal.

The cloned genes of coding recombinant human E-selection protein matter is 19 amino acid by AcIVfNPV baculovirus gp64 envelope protein secreting signal peptide, people E-selects 291 amino acid (the born of the same parents' outside part of 20-310 amino acids with EGF structural domain of the lectin binding domains of 40-120 amino acids and 200-275 amino acids) of protein matter, proteinic 9 amino acid of c-myc, 6 amino acid of neutral spacer peptide, and 331 amino acid whose polypeptide of 6 amino acid whose polyhistidine marks (6x HIS) composition.In another form, the c-myc mark is removed, and in another form, c-myc and His mark all are removed (Fig. 2).Promote the intracellular transport of target peptide derived from the secretion signal peptide of AcMINPV baculovirus gp64 envelope protein, processing, and recombinant human E-selects the secretion of protein matter.The people E-of described medicine selects the outer polypeptide portion of albumen born of the same parents as toleragen (tolerogen) effector molecule, in the inhibition and the activation of other immunne response of apoplexy moderate stimulation inflammation of science.Described c-myc peptide is a monoclonal antibody epi-position that is positioned at the non-transferring structure territory of c-myc, selects the homogeny mark of protein matter molecule during protein purification as recombinant human E-.Described 6x HIS peptide is in conjunction with heavy metal such as nickel, cobalt and have strong binding constant (Kd＞10 ^-9M) other heavy metal, it is used for purification of recombinant human E-by fixed metal affinity chromatography and selects protein matter.

Coding E-selects the viral original seed (virus stock) of protein peptide

The recombinant DNA of external synthetic dna fragmentation clone use coding people E-select albumen born of the same parents' outside part (20-310 amino acids residue), merge C-terminal c-myc peptide and the peptide-labeled codon optimized gene of polyhistidine (6x HIS), based on the nucleotide sequence that derives from GenBankAccession No.NM 000655, in rhabdovirus expression vector system (BEVS), to express.To contain people E-at first and select the multiple clone site of the 999bp Eco RIDNA fragment cloning of protein gene, be cloned in the downstream of the polyhedron promotor in the polyhedrosis gene seat of bacmid transfer vector pFASTBACI (InVitrogen) subsequently at subcloning vector pCR-Blunt Il-TOPO (InVitrogen).The Sf-9S insect cell is used the reorganization bacmid DNA transfection that contains the people E-selection protein gene that is positioned at the AcMNPV genome.From the cellular segregation recombinant baculovirus of transfection, and the virus clone of selecting to express high-level recombinant human E-selection protein matter by the plaque purification method.

Main viral original seed (master virus stock) is by being recombinant baculovirus strain isolated (R612) infection Sf-9S insect cell (60th generation of 0.1pfu/ml with the plaque purification of amplification with MOI (9.6L); WCB#38) set up, described virus isolated strain is provided by the virus that high-caliber recombinant human E-selects protein matter and provides height to tire.Identify the viral original seed of described master at gene complete and recombinant protein production.Main viral original seed sample is identified, described evaluation comprises that the aseptic analysis of microorganism, detection of mycoplasma analysis, the check and analysis of spiral shell substance, LAL intracellular toxin chrornogenic analyze, external exotic test (in vitro adventitiousagent testing), and the inside and outside come thing test (AnMed/Taconic).But exotic test can detect infected insect cell or can be the existence of the RNA viruses of vector virus.

The homogeny of selecting protein gene sequence with the recombinant human E-of c-myc and the peptide-labeled fusion of polyhistidine is by selecting two DNA chains of the insertion of baculovirus genomic dna of recombinant baculovirus of protein gene and flanking nucleotide sequence to carry out nucleotide sequence from the viral original seed of described master and coding people E-to determine and analyze to show to separating.Nucleotide sequence analysis show from the genomic dna of the viral original seed of described master with select protein gene sequence 100% coupling at external synthetic and the people E-that is used among the baculovirus transfer vector pFASTBACl of clone gene.From selecting speculating acid sequence the nucleotide sequence of genome DNA sample of the proteic aminoacid sequence of inferring 100% coupling with people E-.The viral original seed of described master is tested by homogeny.

Main viral original seed supports ability that high titer virus duplicates by being under the condition of 0.1 plaque forming unit (pfu)/cell the clarification supernatant that infects 3 days Sf-9S insect cell to be carried out the analysis of baculovirus plaque to determine in infection multiplicity (MOI).In the Sf-9S insect cell 5 * 10 ⁷The virus titer of pfu/ml is determined by the analysis of baculovirus agarose plaque, uses the viral original seed sample of master that goes down to posterity in the Sf9S insect cell to carry out.By to carrying out SDS-PAGE and Western engram analysis with product of cell lysis and the supernatant that the MOI of 3-5pfu/ cell infects 1-3 days Sf-9S insect cell, select proteic production further to estimate main viral original seed at recombinant human E-with the viral original seed of described master.It is 50kDa and specificity are selected protein matter in conjunction with people E-monoclonal antibody (BBA2 that product of cell lysis and cell conditioned medium contain molecular weight; R﹠amp; D) recombinant protein.

The viral original seed of master that will be suitable for producing viral original seed is used for the production that predetermined production recombinant human E-selects the work virus original seed (working virus stock) of protein matter product.The viral original seed (9.6L) of working is by using inoculum infection Sf-9S insect cell (the 52nd generation of main viral original seed under the MOI of 0.1pfu/ cell; WCB#37) set up.To lead viral original seed and be stored in the PETG bottle of lucifuge packing in the lucifuge cold box (2-8 ℃), be lower than the medium-term and long-term storage of-70 ℃ of Ultralow Temperature Freezers with the viral original seed short-term of work (＜3 months).

Cell bank

Recombinant human E-selects being expressed in of protein matter to be able to best the realization in the Sf-9S insect cell.The master cell bank of Sf-9S insect cell is set up from one bottle of Sf-9S cell, it is adapted to serum free medium (suspension cell culture), and select at the secretion situation of the recombinant protein of from the baculovirus vector of the parental generation Sf-9 cell that derives from ATCC, expressing.The Sf-9S master cell bank with initial derived from Spodoptera frugiperda ovarian epithelial cell but through several times effectively adaptive process so that the recombinant protein Sf-9 clone that maximization is expressed as suspension culture in serum free medium in extensive bio-reactor and setting up.

The Sf-9S master cell bank is made up of the 48th generation Spodoptera frugiperda cell in the freezing substratum of insect cell (7.5% dimethyl sulfoxide (DMSO), 46%Sf-900II SFM, 47% conditioning substratum) of 586 3.5ml cryovials.The working cardial cell storehouse is by the cryovial in automatic cells storehouse in the future (totally 3.5 * 10 ⁷Individual cell) thaw and with cell inoculation in (shaking in the bottle) fresh HyQ SFX serum-free insect cell substratum (100ml in 500ml; Lot no.ALF14050) in and set up.Make cell adapted environment several days, under 28 ℃ and 125rpm condition, grow with suspension culture.When cell density reaches 0.6 * 10 ⁷During individual cell/ml, culture was separated score with 1: 20 go into more to shake in the bottle, final volume is that 800ml/2L shakes bottle.The culture that this is new is similar to carry out time cultivation and goes down to posterity several times, to guarantee cell optimum growh and not contaminated.It is 5.36 * 10 that the Sf-9S cell culture in the 49th generation reaches cell density ⁶Individual cell/ml, viability is 94%, in the freezing substratum of insect cell, described substratum comprises following composition by low speed (500xg) centrifugal separating cell and resuspending:

46.5 the HyQ SFX serum-free insect cell substratum (conditioning) of part

46.5 the HyQ SFX serum-free insect cell substratum (fresh) of part

7.0 the dimethyl sulfoxide (DMSO) (Sigma lot no.68H1092) of part

With cell (1 * 10 ⁷Aseptic being scattered in 49 cryovials (3.5ml/ bottle) and 30 cryovials (1.0ml/ bottle) of individual cell/ml) reduced in the Ultralow Temperature Freezer that 1 ℃ of slow refrigerated storage is being lower than-70 ℃ with per minute.

Codon optimized recombinant human E-selects proteic nucleotide sequence

Following sequence comes the genomic codon optimized recombinant human E-of autonomous viral original seed baculovirus to select the nucleotide sequence of protein gene to select protein matter with the people E-that produces reorganization.

1?ATGGGTTGGTCTTGGATTTTCTTGTTCTTGTTGTCTGGTACTGCTTCTGT

51?TCACTCTTGGTCTTACAACACTTCTACTGAAGCTATGACTTACGACGAAG

101?CTTCTGCTTACTGTCAACAAAGATACACTCACTTGGTTGCTATTCAAAAC

151?AAGGAAGAAATTGAATACTTGAACTCTATTTTGTCTTACTCTCCATCTTA

201?CTACTGGATTGGTATTAGAAAGGTTAACAACGTTTGGGTTTGGGTTGGTA

251?CTCAAAAGCCATTGACTGAAGAAGCTAAGAACTGGGCTCCAGGTGAACCA

30I?AACAACAGACAAAaGGACGAAGACTGTGTTGAAATTTACATTAAGAGAGA

351?AAAGGACGTTGGTATGTGGAACGACGAAAGATGTTCTAAGAAGAAGTTG

401?CTTTGTGTTACACTGCTGCTTGTACTAACACTTCTTGTTCTGGTCACGGT

451?GAATGTGTTGAAACTATTAACAACTACACTTGTAAGTGTGACCCAGGTTT

501?CTCTGGTTTGAAGTGTGAACAAATTGTTAACTGTACTGCTTTGGAATCTC

551?CAGAACACGGTTCTTTGGTTTGTTCTCACCCATTGGGTAACTTCTCTTAC

601?AACTCTTCTTGTTCTATTTCTTGTGACAGAGGTTACTTGCCATCTTCTAT

651?GGAAACTATGCAATGTATGTCTTCTGGTGAATGGTCTGCTCCAATTCCAG

701?CTTGTAACGTTGTTGAATGTGACGCTGTTACTAACCCAGCTAACGGTTTC

751?GTTGAATGTTTCCAAAACCCAGGTTCTTTCCCATGGAACACTACTTGTAC

801?TTTCGACTGTGAAGAAGGTTTCGAATTGATGGGTGCTCAATCTTTGCAAT

851?GTACTTCTTCTGGTAACTGGGACAACGAAAAGCCAACTTGTAAGGCTGTT

901?ACTGGTGGTGCTTCTACTAGAGCTGCTGAACAAAAGTTGATTTCTGAAGA

951?AGACTTGAACGGTACTAGATCTGGT(SEQ?ID?NO：5)

Cell amplification

Containing cell amplification that recombinant human E-selects proteic cell is contained in 2.0L Corning plastics and shakes in the bottle (21 are shaken bottle, every bottle of HyQ SFX serum free medium that contains 800ml) 16.8 liters.With culturing bottle insulation in the platform shaking table incubator (Fisher) of the bottle folder of having equipped springload.Cell is incubated under 28 ± 1 ℃ and 125 ± 25rpm condition.

Virus infection

Is 2.0 * 10 with fresh serum free medium dilution for final cell density with the Sf-9S cell ⁶Individual cell/ml is distributed in 21 culturing bottles (2L) with the 800ml equal portions.With containing the baculovirus infection that HuE-selects protein peptide, MOI is the 3pfu/ cell with insect cell.From viral original seed, reclaim virus, be allocated in the culturing bottle in the Class 100 biological safety Fume Hoodss.The cell culture that infects is maintained 28 ℃ and 125rpm.Regularly detect pathological changes caused by virus effect (CPE), cell density and the cell viability of the cell culture that infects.Virus infection carried out 3 days.

In infection back 3 days, viral CPE reached+3 (being that inclusion body forms and the film gauffer), and cell density is 1.1 * 10 ⁶Individual cell/ml, cell viability is reduced to 50%.Cell culture as following results infection.

Results

The cell suspending liquid that infects is moved to from culturing bottle in the 500ml centrifugal bottle in the biological safety cupboard.The cell suspending liquid that infects was carried out low-speed centrifugal 10 minutes at 4 ℃ with 2300rpm in Sorval RC-5B whizzer, to remove the cell of infection.Containing the outer recombinant human E-of born of the same parents selects the cell culture supernatant of proteic infection by clarifying in centrifugal 45 minutes with 7500rpm at 4 ℃ in Sorval RC-5B whizzer.Clarifying supernatant is poured in the 20L glass carboy in the Class 100 biological safety Fume Hoodss, and spending the night 2-8 ℃ of storage in cryostat further concentrates and diafiltration carrying out.

Concentrate and diafiltration through ultrafiltration

To contain the outer recombinant human E-of born of the same parents and select the clarifying cells and supernatant (16.0L) of protein peptide to use A/G Technologies Flex StandBenchtop Pilot ultrafiltration system to concentrate, to obtain accessible volume to be further purified.Use this system, with clarifying cells and supernatant with 230ml/ minute flow velocity by having from 20L glass carboy, moving in the A/G Tech UFP-10-C-9A hollow fiber membrane ultrafiltration device of Masterfiex peristaltic pump through disinfectant silicone tubular system, described ultra-fine filter has 10kDa molecular weight filtration cutoff value (MWCO).From filtrate, collect separately and contain the retentate (retentate) that recombinant human E-selects protein peptide, twine ultra-fine filter (spiral woundultrafiltration cartridge) simmer down to 0.8L (20 times) through spiral by Continuous Flow.After concentrating, with spissated cells and supernatant with Q damping fluid 1 diafiltration of 10L 90 minutes.Twice rinsing liquid (each 0.7L) of spissated diafiltration thing (0.8L) filter is collected in (3.2L altogether) in the aseptic Nalgene bottle, stores at cryostat (2-8 ℃) and spend the night to carry out the protein purification that passes through the Q anion-exchange chromatography subsequently.

Q agarose anion-exchange chromatography

Initial protein capture step in the downstream work program of recombinant human E-selection protein peptide medicine is the anion-exchange chromatography step, uses reinforcing yin essence ion exchange resin, Q SepharoseFast Flow to carry out.Expect that this step can remove intracellular toxin, processing vehicle and host protein pollutent from recombinant human E-selects protein peptide.Described Q anion-exchange chromatography step use confirm by Unicorn

The Pharmacia AKTA ExplorerBiopilot FPLC system of software control carries out.With Q Sepharose Fast Flow resin (400ml) application of sample in Pharmacia XX 50/30 chromatography column.Regenerate with 10ml/ minute flow velocity with the sterilization of described Q post and with the Q damping fluid [0.5N sodium hydroxide and 1.0M sodium-chlor] of regenerating, with the WFI water of 5 column volumes (2000ml) with flow velocity rinsing in 10ml/ minute to pH be 7.1, with the Q damping fluid 1 of 5 column volumes (2000ml) with 10ml/ minute flow velocity balance.

With spissated diafiltration thing (3.2L) with 20ml/ minute flow velocity application of sample (13.6mg protein/mlQ resin).The Q post of the application of sample Q damping fluid 1 with 10 column volumes (4000ml) is washed with 20ml/ minute flow velocity.Collect the Q post and flow out fraction (FT; 3200ml) with washing fraction (1600ml), select protein peptide with the remaining unconjugated recombinant human E-of (in-process) test in processing 4 ℃ of storages.With Q post bonded protein with 20ml/ minute flow velocity with Q damping fluid 2 wash-outs, form 0-1000mM sodium-chlor linear gradient.(200 * 10ml), temporary storage is in 4 ℃ of cryostates for the fraction of the Q eluate of collection UV280 absorbancy.The Q post that uses is sterilized with Q regeneration damping fluid.

The sample (0.1ml) of Q elutriated fraction and application of sample, outflow and washing fraction is processed test in (in-process), comprise that end user E-selects the SDS-PAGE and the Western engram analysis of albumen serum.The recombinant human E-that contains as main moiety selects the Q elutriated fraction (fraction 80-112) in unimodal of protein matter to differentiate by SDS-PAGE and Western engram analysis, it is gathered together (320ml).Can not select the amount of protein matter not remarkable by bonded recombinant human E-with the Q post, therefore not need to handle once more the FT fraction.

Ni-NTA agarose affinity chromatography

Selecting the C-terminal of protein matter to exist polyhistidine (6x HIS) mark peptide to make at recombinant human E-can use based on Ni by fixed metal affinity chromatography method ⁺⁺Resin and with these heavy metal conjugated proteins from the elutriated fraction of Q set in remaining other protein purifying come out.Ni-NTA affinity chromatographic step in the work program of downstream is used for purification of recombinant human E-and selects protein matter and remove remaining host protein pollutent and baculovirus.Ni-NTA affinity chromatographic step use to confirm by Unicorn

The Pharmacia AKTA Explorer Biopilot FPLC system of software control carries out.With Ni-NTA AgaroseSuperfiow resin (38ml) application of sample in Pharmacia XK 26 chromatography columns.Ni-NTA is electrically charged with nickel sulfate hexahydrate compound (0.1M), sterilize with 3ml/ minute flow velocity with 0.5N NaOH, with the WFI water of 5 column volumes with flow velocity rinsing in 3ml/ minute, and with the Ni-NTA damping fluid 1 of (190ml) of 5 column volumes with 3ml/ minute flow velocity balance, to pH be 8.5.With the elutriated fraction of Q set with 3ml/ minute flow velocity application of sample (19.8 protein/ml Ni-NTA resin).The Ni-NTA post of the application of sample Ni-NTA damping fluid 1 with 3 column volumes (115ml) is washed with 3ml/ minute flow velocity.Collect Ni-NTA post FT (320ml) and washing fraction (115ml), select protein matter with the remaining unconjugated recombinant human E-of (in-process) test in processing 4 ℃ of storages.With the flow velocity wash-out of Ni-NTA post bonded protein usefulness Ni-NTA damping fluid 2, form the imidazole natrium linear gradient of 0-300mM with 3ml/ minute.(43 * 3ml), temporary storage is in 4 ℃ of cryostates for the Ni-NTA eluate fraction of collection DY280 absorbancy.The Ni-NTA post that uses is sterilized with EDTA regeneration damping fluid.

(in-process) test during the sample (0.1ml) of Ni-NTA elutriated fraction and application of sample, outflow and washing fraction processed comprises that end user E-selects the SDS-PAGE and the Western engram analysis of albumen serum.The recombinant human E-that contains as main moiety selects the Ni-NTA elutriated fraction (fraction 12-26) in unimodal of protein matter to differentiate by SDS-PAGE and Western engram analysis, it is gathered together (43ml).Can not select the amount of protein matter not obvious by bonded recombinant human E-with the NiNTA post, therefore not need to handle once more the FT fraction.

(in-process) test during the sample (2ml) of Ni-NTA wash-out post fraction of set processed comprises that end user E-selects the SDS-PAG of albumen serum and Western engram analysis, BCA protein analysis, and LAL endotoxin analysis.In addition, the elutriated fraction of the Ni-NTA of equal portions set is carried out the analysis of baculovirus agarose plaque, to calculate the amount of the baculovirus that exists in purification phase.Virus titer is 6.42 * 10 ⁷Pfu/ml is 2.76 * 10 altogether ⁹Pfu reduces 3log10 by Q and Ni-NTA chromatographic step virus titer.

Diafiltration

In order to remove processing vehicle imidazoles from the elutriated fraction of Ni-NTA set, reach compounding pharmaceutical in suitable damping fluid PBS solution, the elutriated fraction of Ni-NTA set is carried out diafiltration in cryostat (2-8 ℃).With the Ni-NTA elutriated fraction of set with the PBS solution of 2 * 90 volumes (4L) the dialysis 15 of 22 ℃ of difference and 7 hours.Final dialysis object is long-pending to be 41ml.Take out dialysis matter sample (1ml) process in (in-process) test, comprise SDSPAGE analysiss, Western engram analysis, BCA protein analysis, reach the analysis that adds lustre to of LAL kinetics.

The final filtration

0. remove microbial contamination, dialyzate (41ml) be aseptically filled in the aseptic Nalgene bottle by 0.22～i Millipore Stericap filter membrane in biological safety Fume Hoods (class100).The film that uses is carried out the bubble point analysis to determine film integrality, and gained result (50psi) surpasses the integrity film specification of 32psi, be sure of that microorganism removes from medicine.The final volume of filtrate is 36.5ml.0.2 μ filtrate is being lower than-70 ℃ to be stored in the Ultralow Temperature Freezer.0.2 μ filtrate is thawed, and is 95ml with PBS solution dilution to final volume, to prevent the protein aggregation of increased protein concentration formerly, passes through the sterile filtration of second 0.2 μ film in biological safety Fume Hoods (class 100).Result to the bubble point test of 0.2 μ film of second use shows that described film is complete.

First 0.2 μ filtrate sample is carried out (in-process) test in BCA protein and the LAL processing.First 0.2 μ filtrate is carried out the 5.28mg/ml as a result of BCA protein analysis, and total recovery is 192.72mg.The result that first 0.2 μ filtrate is carried out the LAL endotoxin analysis is 1.84EU/ml, and total amount is 67EU.

From obtaining cumulative volume 95ml final the filtration for the second time.In order to remove remaining baculovirus in the medicine, in the preparation of medicament production and filtration step, utilize Pall DV20sub 0.1 μ membrane filter.Total intracellular toxin load of final gross product (bulk product) (medicine) is 45.6EU; The total protein production of final gross product is 133mg, determines by the BCS protein analysis of confirming.

The delayed hypersensitivity is analyzed (Delayed type hypersentivity assay)

Carrying out the delayed hypersensitivity in through the Hypertensive Rats of selecting protein for treatment in the nose with the recombinant human E-of multiple dosage tests.Carry out the delayed hypersensitivity of drug sample (1.0ml) and analyze, to determine selecting proteic tolerance and to stop product potentiality in the relevant body of the ability of generation apoplexy in the hypertension animal with people E-.In this research DTH suppress to comprise be determined at the recombinant human E-that induces in the mucosal tolerance as various dose select albumen and placebo function because the animal ear thickness that inflammation causes.

The rat (20) that will have essential hypertension apoplexy tendency (SRR-SP) is divided into four groups, and every other day (20 μ l/ nostril) inoculated in the intranasal, gives 5 kinds of treatment measures.

1 group: the PBS placebo, with 40 μ l treatment tolerance, n=5,

2 groups: recombinant human E-selects albumen 5V μ g/40 μ l treatment, n=5

3 groups: recombinant human E-selects albumen μ l/40 μ l treatment, n=5

4 groups: recombinant human E-selects albumen 0.1 μ g/40 μ l treatment, n=5

After the tolerance scheme finished for 2 weeks, select albumen that animal carried out immunity (antigen sensitization) with complete Freund ' s adjuvant (FCA) at the recombinant human E-of 375 μ g/ml antigen final concentrations preparations with equal portions (200 μ l) through subcutaneous.After immune 2 weeks, use standard skin fold calipers to measure ear's thickness of treated animal.Then, (100p.l) recombinant human E-selects albumen in the ear-lobe injection, and antigen concentration is 50 μ g/100 μ l in PBS (using antigen or antigen once more attacks).

After attack, carried out repetition ear thickness measurement with evaluation delayed hypersensitivity in 48 and 72 hours.

Lymphocyte is selected proteic tolerance effect, particularly mucosal tolerance effect to E-, is a kind of effective ways for the treatment of inflammatory disease.

The pro-inflammatory cytokine level raises also relevant with numerous disease and pathology, comprises autoimmune disease.The disease that inflammation is relevant comprises but the non-toxic shock syndrome that is limited to, rheumatoid arthritis, osteoarthritis, diabetes and inflammatory bowel disease, HIV infects relevant dementia, glaucoma, optic neuropathy, optic neuritis, retinal ischemia, the visual impairment that laser causes, the proliferative vitreoretinopathy that operation or wound cause, cerebral blood supply insufficiency, anoxic-ischemia, hypoglycemia, domoic acid is poisoned, anoxia, carbon monoxide or manganese or cyanide poisoning, Huntington ' s disease, Alzheimer ' s disease, Parkinson ' s disease, meningitis, multiple sclerosis and other demyelinating disease, amyotrophic lateral sclerosis, head and Spinal injury, epilepsy, faint from fear, olivopontocerebellar atrophy, neuropathic pain syndrome, diabetic neuropathy, the DPN that HIV-is relevant, MERRF and MELAS syndrome, Leber ' s disease, Wemicke ' s encephalopathic, Rett syndrome, homocystinuria, hyperprolinemia, superelevation Gelucystine mass formed by blood stasis, the non-ketosis hyperglycinemia, the hydroxybutyric acid amino acid uria, sulfite oxidase defective disease, combined system disease, lead encephalopathy, Tourett ' s syndrome, hepatogenic encephalopathy, dopy, resistance, drug dependence, dysthymia disorders, anxiety and schizophrenia, traumatic arthritis, Guillain-Barre syndrome, Crohn ' s disease, ulcerative colitis, psoriatic, graft versus host disease (GVH disease), systemic lupus erythematous, glomerulonephritis, reperfusion injury, septicemia, the bone resorption disease comprises osteoporosis, chronic obstructive pulmonary disease, congestive heart failure, arteriosclerosis, toxic shock syndrome, asthma, contact dermatitis, percutaneous transluminal coronary angioplasty (PTCA) and insulin-dependent diabetes.

Those skilled in the art are known can to change, revise the present invention as herein described and otherwise carry out under prerequisite without departing from the spirit and scope of the present invention.It is for referencial use that reference provided below is incorporated this paper at this paper into its full content.All patents, patent application and publication that this paper quotes are all incorporated into for referencial use with its full content at this paper.

Though with reference to its embodiment preferred the present invention is disclosed especially and describes, those skilled in the art are known can to carry out various changes aspect form and the detail file to the present invention under the prerequisite that does not depart from the scope of the invention that appended claims contains.Those skilled in the art recognize that other embodiment known in the art and configuration comprise within the spirit and scope of the present invention.

Sequence table

＜110〉Novavax Inc.

＜120〉the reorganization E-for preparing in insect cell selects albumen

<130>219065/2522

<150>60/660258

<151>2005-03-10

<160>9

<170>PatentIn?version?3.3

<210>1

<211>610

<212>PRT

<213>Homo?sapiens

<220>

<221>misc_feature

<223>Wild?type?human?E-Selectin

<400>1

Met?Ile?Ala?Ser?Gln?Phe?Leu?Ser?Ala?Leu?Thr?Leu?Val?Leu?Leu?Ile

1 5 10 15

Lys?Glu?Ser?Gly?Ala?Trp?Ser?Tyr?Asn?Thr?Ser?Thr?Glu?Ala?Met?Thr

20 25 30

Tyr?Asp?Glu?Ala?Ser?Ala?Tyr?Cys?Gln?Gln?Arg?Tyr?Thr?His?Leu?Val

35 40 45

Ala?Ile?Gln?Asn?Lys?Glu?Glu?Ile?Glu?Tyr?Leu?Asn?Ser?Ile?Leu?Ser

50 55 60

Tyr?Ser?Pro?Ser?Tyr?Tyr?Trp?Ile?Gly?Ile?Arg?Lys?Val?Asn?Ash?Val

65 70 75 80

Trp?Val?Trp?Val?Gly?Thr?Gln?Lys?Pro?Leu?Thr?Glu?Glu?Ala?Lys?Asn

85 90 95

Trp?Ala?Pro?Gly?Glu?Pro?Asn?Asn?Arg?Gln?Lys?Asp?Glu?Asp?Cys?Val

100 105 110

Glu?Ile?Tyr?Ile?Lys?Arg?Glu?Lys?Asp?Val?Gly?Met?Trp?Asn?Asp?Glu

115 120 125

Arg?Cys?Ser?Lys?Lys?Lys?Leu?Ala?Leu?Cys?Tyr?Thr?Ala?Ala?Cys?Thr

130 135 140

Asn?Thr?Ser?Cys?Ser?Gly?His?Gly?Glu?Cys?Val?Glu?Thr?Ile?Asn?Asn

145 150 155 160

Tyr?Thr?Cys?Lys?Cys?Asp?Pro?Gly?Phe?Ser?Gly?Leu?Lys?Cys?Glu?Gln

165 170 175

Ile?Val?Asn?Cys?Thr?Ala?Leu?Glu?Ser?Pro?Glu?His?Gly?Ser?Leu?Val

180 185 190

Cys?Ser?His?Pro?Leu?Gly?Asn?Phe?Ser?Tyr?Asn?Ser?Ser?Cys?Ser?Ile

195 200 205

Ser?Cys?Asp?Arg?Gly?Tyr?Leu?Pro?Ser?Ser?Met?Glu?Thr?Met?Gln?Cys

210 215 220

Met?Ser?Ser?Gly?Glu?Trp?Ser?Ala?Pro?Ile?Pro?Ala?Cys?Asn?Val?Val

225 230 235 240

Glu?Cys?Asp?Ala?Val?Thr?Asn?Pro?Ala?Asn?Gly?Phe?Val?Glu?Cys?Phe

245 250 255

Gln?Asn?Pro?Gly?Ser?Phe?Pro?Trp?Asn?Thr?Thr?Cys?Thr?Phe?Asp?Cys

260 265 270

Glu?Glu?Gly?Phe?Glu?Leu?Met?Gly?Ala?Gln?Ser?Leu?Gln?Cys?Thr?Ser

275 280 285

Ser?Gly?Asn?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Lys?Ala?Val?Thr?Cys

290 295 300

Arg?Ala?Val?Arg?Gln?Pro?Gln?Asn?Gly?Ser?Val?Arg?Cys?Ser?His?Ser

305 310 315 320

Pro?Ala?Gly?Glu?Phe?Thr?Phe?Lys?Ser?Ser?Cys?Asn?Phe?Thr?Cys?Glu

325 330 335

Glu?Gly?Phe?Met?Leu?Gln?Gly?Pro?Ala?Gln?Val?Glu?Cys?Thr?Thr?Gln

340 345 350

Gly?Gln?Trp?Thr?Gln?Gln?Ile?Pro?Val?Cys?Glu?Ala?Phe?Gln?Cys?Thr

355 360 365

Ala?Leu?Ser?Asn?Pro?Glu?Arg?Gly?Tyr?Met?Asn?Cys?Leu?Pro?Ser?Ala

370 375 380

Ser?Gly?Ser?Phe?Arg?Tyr?Gly?Ser?Ser?Cys?Glu?Phe?Ser?Cys?Glu?Gln

385 390 395 400

Gly?Phe?Val?Leu?Lys?Gly?Ser?Lys?Arg?Leu?Gln?Cys?Gly?Pro?Thr?Gly

405 410 415

Glu?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Glu?Ala?Val?Arg?Cys?Asp?Ala

420 425 430

Val?His?Gln?Pro?Pro?Lys?Gly?Leu?Val?Arg?Cys?Ala?His?Ser?Pro?Ile

435 440 445

Gly?Glu?Phe?Thr?Tyr?Lys?Ser?Ser?Cys?Ala?Phe?Ser?Cys?Glu?Glu?Gly

450 455 460

Phe?Glu?Leu?His?Gly?Ser?Thr?Gln?Leu?Glu?Cys?Thr?Ser?Gln?Gly?Gln

465 470 475 480

Trp?Thr?Glu?Glu?Val?Pro?Ser?Cys?Gln?Val?Val?Lys?Cys?Ser?Ser?Leu

485 490 495

Ala?Val?Pro?Gly?Lys?Ile?Asn?Met?Ser?Cys?Ser?Gly?Glu?Pro?Val?Phe

500 505 510

Gly?Thr?Val?Cys?Lys?Phe?Ala?Cys?Pro?Glu?Gly?Trp?Thr?Leu?Asn?Gly

515 520 525

Ser?Ala?Ala?Arg?Thr?Cys?Gly?Ala?Thr?Gly?His?Trp?Ser?Gly?Leu?Leu

530 535 540

Pro?Thr?Cys?Glu?Ala?Pro?Thr?Glu?Ser?Asn?Ile?Pro?Leu?Val?Ala?Gly

545 550 555 560

Leu?Ser?Ala?Ala?Gly?Leu?Ser?Leu?Leu?Thr?Leu?Ala?Pro?Phe?Leu?Leu

565 570 575

Trp?Leu?Arg?Lys?Cys?Leu?Arg?Lys?Ala?Lys?Lys?Phe?Val?Pro?Ala?Ser

580 585 590

Ser?Cys?Gln?Ser?Leu?Glu?Ser?Asp?Gly?Ser?Tyr?Gln?Lys?Pro?Ser?Tyr

595 600 605

Ile?Leu

610

<210>2

<211>21

<212>PRT

<213>Artificial

<220>

<223>WILD?TYPE?HUMAN?SIGNAL?SEQUENCE?PEPTIDE

<400>2

Met?Ile?Ala?Ser?Gln?Phe?Leu?Ser?Ala?Leu?Thr?Leu?Val?Leu?Leu?Ile

1 5 10 15

Lys?Glu?Ser?Gly?Ala

20

<210>3

<211>19

<212>PRT

<213>Artificial?Sequence

<220>

<223>THe?AcMNPV?gp64env?secretory?sequence

<400>3

Met?Gly?Trp?Ser?Trp?Ile?Phe?Leu?Phe?Leu?Leu?Ser?Gly?Thr?Ala?Ser

1 5 10 15

Val?His?Ser

<210>4

<211>16

<212>PRT

<213>Artificial?Sequence

<220>

<223>signal?peptide?sequence

<400>4

Met?Gly?Trp?Ser?Trp?Ile?Phe?Leu?Phe?Leu?Leu?Ser?Gly?Thr?Ala?Ser

1 5 10 15

<210>5

<211>974

<212>DNA

<213>artificial?sequence

<220>

<223>nucleotide?sequence?of?codon-optimized?recombinant?human

E-selectin?gene

<400>5

atgggttggt?cttggatttt?cttgttcttg?ttgtctggta?ctgcttctgt?tcactcttgg 60

tcttacaaca?cttctactga?agctatgact?tacgacgaag?cttctgctta?ctgtcaacaa 120

agatacactc?acttggttgc?tattcaaaac?aaggaagaaa?ttgaatactt?gaactctatt 180

ttgtcttact?ctccatctta?ctactggatt?ggtattagaa?aggttaacaa?cgtttgggtt 240

tgggttggta?ctcaaaagcc?attgactgaa?gaagctaaga?actgggctcc?aggtgaacca 300

aacaacagac?aaaaggacga?agactgtgtt?gaaatttaca?ttaagagaga?aaaggacgtt 360

ggtatgtgga?acgacgaaag?atgttctaag?aagaagttgc?tttgtgttac?actgctgctt 420

gtactaacac?ttcttgttct?gctcacggtg?aatgtgttga?aactattaac?aactacactt 480

gtaagtgtga?cccaggtttc?tctggtttga?agtgtgaaca?aattgttaac?tgtactgctt 540

tggaatctcc?agaacacggt?tctttggttt?gttctcaccc?attgggtaac?ttctcttaca 600

actcttcttg?ttctatttct?tgtgacagag?gttacttgcc?atcttctatg?gaaactatgc 660

aatgtatgtc?ttctggtgaa?tggtctgctc?caattccagc?ttgtaacgtt?gttgaatgtg 720

acgctgttac?taacccagct?aacggtttcg?ttgaatgttt?ccaaaaccca?ggttctttcc 780

catggaacac?tacttgtact?ttcgactgtg?aagaaggttt?cgaattgatg?ggtgctcaat 840

ctttgcaatg?tacttcttct?ggtaactggg?acaacgaaaa?gccaacttgt?aaggctgtta 900

ctggtggtgc?ttctactaga?gctgctgaac?aaaagttgat?ttctgaagaa?gacttgaacg 960

gtactagatc?tggt 974

<210>6

<211>307

<212>PRT

<213>Artificial?Sequence

<220>

<223>Recombinant?E-Selectin：Chitanase?Signal，His?Tag

<400>6

Met?Pro?Leu?Tyr?Lys?Leu?Leu?Asn?Val?Leu?Trp?Leu?Val?Ala?Val?Ser

1 5 10 15

Asn?Ala?Ile?Trp?Ser?Tyr?Asn?Thr?Ser?Thr?Glu?Ala?Met?Thr?Tyr?Asp

20 25 30

Glu?Ala?Ser?Ala?Tyr?Cys?Gln?Gln?Arg?Tyr?Thr?His?Leu?Val?Ala?Ile

35 40 45

Gln?Asn?Lys?Glu?Glu?Ile?Glu?Tyr?Leu?Asn?Ser?Ile?Leu?Ser?Tyr?Ser

50 55 60

Pro?Ser?Tyr?Tyr?Trp?Ile?Gly?Ile?Arg?Lys?Val?Asn?Asn?Val?Trp?Val

65 70 75 80

Trp?Val?Gly?Thr?Gln?Lys?Pro?Leu?Thr?Glu?Glu?Ala?Lys?Asn?Trp?Ala

85 90 95

Pro?Gly?Glu?Pro?Asn?Asn?Arg?Gln?Lys?Asp?Glu?Asp?Cys?Val?Glu?Ile

100 105 110

Tyr?Ile?Lys?Arg?Glu?Lys?Asp?Val?Gly?Met?Trp?Asn?Asp?Glu?Arg?Cys

115 120 125

Ser?Lys?Lys?Lys?Leu?Ala?Leu?Cys?Tyr?Thr?Ala?Ala?Cys?Thr?Asn?Thr

130 135 140

Ser?Cys?Ser?Gly?His?Gly?Glu?Cys?Val?Glu?Thr?Ile?Asn?Asn?Tyr?Thr

145 150 155 160

Cys?Lys?Cys?Asp?Pro?Gly?Phe?Ser?Gly?Leu?Lys?Cys?Glu?Gln?Ile?Val

165 170 175

Asn?Cys?Thr?Ala?Leu?Glu?Ser?Pro?Glu?His?Gly?Ser?Leu?Val?Cys?Ser

180 185 190

His?Pro?Leu?Gly?Asn?Phe?Ser?Tyr?Asn?Ser?Ser?Cys?Ser?Ile?Ser?Cys

195 200 205

Asp?Arg?Gly?Tyr?Leu?Pro?Ser?Ser?Met?Glu?Thr?Met?Gln?Cys?Met?Ser

210 215 220

Ser?Gly?Glu?Trp?Ser?Ala?Pro?Ile?Pro?Ala?Cys?Asn?Val?Val?Glu?Cys

225 230 235 240

Asp?Ala?Val?Thr?Asn?Pro?Ala?Asn?Gly?Phe?Val?Glu?Cys?Phe?Gln?Asn

245 250 255

Pro?Gly?Ser?Phe?Pro?Trp?Asn?Thr?Thr?Cys?Thr?Phe?Asp?Cys?Glu?Glu

260 265 270

Gly?Phe?Glu?Leu?Met?Gly?Ala?Gln?Ser?Leu?Gln?Cys?Thr?Ser?Ser?Gly

275 280 285

Asn?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Lys?Ala?Val?Thr?His?His?His

290 295 300

His?His?His

305

<210>7

<211>301

<212>PRT

<213>Artificial?Sequence

<220>

<223>Recombinant?E-selectin；Chitanase?signal，no?tags

<400>7

Met?Pro?Leu?Tyr?Lys?Leu?Leu?Asn?Val?Leu?Trp?Leu?Val?Ala?Val?Ser

1 5 10 15

Asn?Ala?Ile?Trp?Ser?Tyr?Asn?Thr?Ser?Thr?Glu?Ala?Met?Thr?Tyr?Asp

20 25 30

Glu?Ala?Ser?Ala?Tyr?Cys?Gln?Gln?Arg?Tyr?Thr?His?Leu?Val?Ala?Ile

35 40 45

Gln?Asn?Lys?Glu?Glu?Ile?Glu?Tyr?Leu?Asn?Ser?Ile?Leu?Ser?Tyr?Ser

50 55 60

Pro?Ser?Tyr?Tyr?Trp?Ile?Gly?Ile?Arg?Lys?Val?Asn?Asn?Val?Trp?Val

65 70 75 80

Trp?Val?Gly?Thr?Gln?Lys?Pro?Leu?Thr?Glu?Glu?Ala?Lys?Asn?Trp?Ala

85 90 95

Pro?Gly?Glu?Pro?Asn?Asn?Arg?Gln?Lys?Asp?Glu?Asp?Cys?Val?Glu?Ile

100 105 110

Tyr?Ile?Lys?Arg?Glu?Lys?Asp?Val?Gly?Met?Trp?Asn?Asp?Glu?Arg?Cys

115 120 125

Ser?Lys?Lys?Lys?Leu?Ala?Leu?Cys?Tyr?Thr?Ala?Ala?Cys?Thr?Asn?Thr

130 135 140

Ser?Cys?Ser?Gly?His?Gly?Glu?Cys?Val?Glu?Thr?Ile?Asn?Asn?Tyr?Thr

145 150 155 160

Cys?Lys?Cys?Asp?Pro?Gly?Phe?Ser?Gly?Leu?Lys?Cys?Glu?Gln?Ile?Val

165 170 175

Asn?Cys?Thr?Ala?Leu?Glu?Ser?Pro?Glu?His?Gly?Ser?Leu?Val?Cys?Ser

180 185 190

His?Pro?Leu?Gly?Asn?Phe?Ser?Tyr?Asn?Ser?Ser?Cys?Ser?Ile?Ser?Cys

195 200 205

Asp?Arg?Gly?Tyr?Leu?Pro?Ser?Ser?Met?Glu?Thr?Met?Gln?Cys?Met?Ser

210 215 220

Ser?Gly?Glu?Trp?Ser?Ala?Pro?Ile?Pro?Ala?Cys?Asn?Val?Val?Glu?Cys

225 230 235 240

Asp?Ala?Val?Thr?Asn?Pro?Ala?Asn?Gly?Phe?Val?Glu?Cys?Phe?Gln?Asn

245 250 255

Pro?Gly?Ser?Phe?Pro?Trp?Asn?Thr?Thr?Cys?Thr?Phe?Asp?Cys?Glu?Glu

260 265 270

Gly?Phe?Glu?Leu?Met?Gly?Ala?Gln?Ser?Leu?Gln?Cys?Thr?Ser?Ser?Gly

275 280 285

Asn?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Lys?Ala?Val?Thr

290 295 300

<210>8

<211>331

<212>PRT

<213>Artificial?Sequence

<220>

<223>Recombinant?E-Selectin；Mouse?Ig?Signal，，c-myc，His?tag

<220>

<221>SIGNAL

<222>(1)..(19)

<223>AcMNPV?gp64env?secretory?signal?sequeence

<220>

<221>extracellular

<222>(20)..(310)

<223>Human?E-selectin?extracellular?portion

<220>

<221>lectin-binding

<222>(40)..(120)

<223>Human?E-selectin?lectin-binding?domain

<220>

<221>EGFdomain

<222>(200)..(275)

<223>Human?E-selectin?EGFdomain

<220>

<221>c-myc-epitope

<222>(311)..(319)

<223>c-myc-epitope (to?be?removed)

<220>

<221>6x?HIS?tag

<222>(326)..(331)

<223>6x?his?tag

<400>8

Met?Gly?Trp?Ser?Trp?Ile?Phe?Leu?Phe?Leu?Leu?Ser?Gly?Thr?Ala?Ser

1 5 l0 15

Val?His?Ser?Trp?Ser?Tyr?Asn?Thr?Ser?Thr?Glu?Ala?Met?Thr?Tyr?Asp

20 25 30

Glu?Ala?Ser?Ala?Tyr?Cys?Gln?Gln?Arg?Tyr?Thr?His?Leu?Val?Ala?Ile

35 40 45

Gln?Asn?Lys?Glu?Glu?Ile?Glu?Tyr?Leu?Asn?Ser?Ile?Leu?Ser?Tyr?Ser

50 55 60

Pro?Ser?Tyr?Tyr?Trp?Ile?Gly?Ile?Arg?Lys?Val?Asn?Asn?Val?Trp?Val

65 70 75 80

Trp?Val?Gly?Thr?Gln?Lys?Pro?Leu?Thr?Glu?Glu?Ala?Lys?Asn?Trp?Ala

85 90 95

Pro?Gly?Glu?Pro?Asn?Asn?Arg?Gln?Lys?Asp?Glu?Asp?Cys?Val?Glu?Ile

100 105 110

Tyr?Ile?Lys?Arg?Glu?Lys?Asp?Val?Gly?Met?Trp?Asn?Asp?Glu?Arg?Cys

115 120 125

Ser?Lys?Lys?Lys?Leu?Ala?Leu?Cys?Tyr?Thr?Ala?Ala?Cys?Thr?Asn?Thr

130 135 140

Ser?Cys?Ser?Gly?His?Gly?Glu?Cys?Val?Glu?Thr?Ile?Asn?Asn?Tyr?Thr

145 150 155 160

Cys?Lys?Cys?Asp?Pro?Gly?Phe?Ser?Gly?Leu?Lys?Cys?Glu?Gln?Ile?Val

165 170 175

Asn?Cys?Thr?Ala?Leu?Glu?Ser?Pro?Glu?His?Gly?Ser?Leu?Val?Cys?Ser

180 185 190

His?Pro?Leu?Gly?Asn?Phe?Ser?Tyr?Asn?Ser?Ser?Cys?Ser?Ile?Ser?Cys

195 200 205

Asp?Arg?Gly?Tyr?Leu?Pro?Ser?Ser?Met?Glu?Thr?Met?Gln?Cys?Met?Ser

210 215 220

Ser?Gly?Glu?Trp?Ser?Ala?Pro?Ile?Pro?Ala?Cys?Asn?Val?Val?Glu?Cys

225 230 235 240

Asp?Ala?Val?Thr?Asn?Pro?Ala?Asn?Gly?Phe?Val?Glu?Cys?Phe?Gln?Asn

245 250 255

Pro?Gly?Ser?Phe?Pro?Trp?Asn?Thr?Thr?Cys?Thr?Phe?Asp?Cys?Glu?Glu

260 265 270

Gly?Phe?Glu?Leu?Met?Gly?Ala?Gln?Ser?Leu?Gln?Cys?Thr?Ser?Ser?Gly

275 280 285

Asn?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Lys?Ala?Val?Thr?Gly?Gly?Ala

290 295 300

Ser?Thr?Arg?Ala?Ala?Glu?Gln?Lys?Leu?Ile?Ser?Glu?Glu?Asp?Leu?Asn

305 310 315 320

Gly?Thr?Arg?Ser?Gly?His?His?His?His?His?His

325 330

<210>9

<211>346

<212>PRT

<213>Artificial?Sequence

<220>

<223>Wild?type?Human E-Selectin(genBank?Acc.#M30640，amino?acids

1-350

<400>9

Met?Ile?Ala?Ser?Gln?Phe?Leu?Ser?Ala?Leu?Thr?Leu?Val?Leu?Leu?Ile

1 5 10 15

Lys?Glu?Ser?Gly?Ala?Trp?Ser?Tyr?Asn?Thr?Ser?Thr?Glu?Ala?Met?Thr

20 25 30

Tyr?Asp?Glu?Ala?Ser?Ala?Tyr?Cys?Gln?Gln?Arg?Tyr?Thr?His?Leu?Val

35 40 45

Ala?Ile?Gln?Asn?Lys?Glu?Glu?Ile?Glu?Tyr?Leu?Asn?Ser?Ile?Leu?Ser

50 55 60

Tyr?Ser?Pro?Ser?Tyr?Tyr?Trp?Ile?Gly?Ile?Arg?Lys?Val?Asn?Asn?Val

65 70 75 80

Trp?Val?Trp?Val?Gly?Thr?Gln?Lys?Pro?Leu?Thr?Glu?Glu?Ala?Lys?Asn

85 90 95

Trp?Ala?Pro?Gly?Glu?Pro?Asn?Asn?Arg?Gln?Lys?Asp?Glu?Asp?Cys?Val

100 105 110

Glu?Ile?Tyr?Ile?Lys?Arg?Glu?Lys?Asp?Val?Gly?Met?Trp?Asn?Asp?Glu

115 120 125

Arg?Cys?Ser?Lys?Lys?Lys?Leu?Ala?Leu?Cys?Tyr?Thr?Ala?Ala?Cys?Thr

130 135 140

Asn?Thr?Ser?Cys?Ser?Gly?His?Gly?Glu?Cys?Val?Glu?Thr?Ile?Asn?Asn

145 150 155 160

Tyr?Thr?Cys?Lys?Cys?Asp?Pro?Gly?Phe?Ser?Gly?Leu?Lys?Cys?Glu?Gln

165 170 175

Ile?Val?Asn?Cys?Thr?Ala?Leu?Glu?Ser?Pro?Glu?His?Gly?Ser?Leu?Val

180 185 190

Cys?Ser?His?Pro?Leu?Gly?Asn?Phe?Ser?Tyr?Asn?Ser?Ser?Cys?Ser?Ile

195 200 205

Ser?Cys?Asp?Arg?Gly?Tyr?Leu?Pro?Ser?Ser?Met?Glu?Thr?Met?Gln?Cys

210 215 220

Met?Ser?Ser?Gly?Glu?Trp?Ser?Ala?Pro?Ile?Pro?Ala?Cys?Asn?Val?Val

225 230 235 240

Glu?Cys?Asp?Ala?Val?Thr?Asn?Pro?Ala?Asn?Gly?Phe?Val?Glu?Cys?Phe

245 250 255

Gln?Asn?Pro?Gly?Ser?Phe?Pro?Trp?Asn?Thr?Thr?Cys?Thr?Phe?Asp?Cys

260 265 270

Glu?Glu?Gly?Phe?Glu?Leu?Met?Gly?Ala?Gln?Ser?Leu?Gln?Cys?Thr?Ser

275 280 285

Ser?Gly?Asn?Trp?Asp?Asn?Glu?Lys?Pro?Thr?Cys?Lys?Ala?Val?Thr?Cys

290 295 300

Arg?Ala?Val?Arg?Gln?Pro?Gln?Asn?Gly?Ser?Val?Arg?Cys?Ser?His?Ser

305 310 315 320

Pro?Ala?Gly?Glu?Phe?Thr?Phe?Lys?Ser?Ser?Cys?Asn?Phe?Thr?Cys?Glu

325 330 335

Glu?Gly?Phe?Met?Leu?Gln?Gly?Pro?Ala?Gln

340 345

Claims (25)

1. isolating mammalian-derived peptides that is selected from as next group: the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically, be attached to the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically of one or more C-terminal mark, be attached to the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically of C-terminal dipeptides RS, be attached to the 20 1 303 peptide that residue is formed selecting albumen (SEQ IDNO:1) basically by wild-type people E of N-terminal secretion property signal peptide, and, reach the mixture or the combination of aforementioned peptide by having 200-400 the peptide that amino acid is formed of at least 60% homogeny with SEQ ID NO:1.

2. the peptide of claim 1, wherein said one or more C-terminal mark is selected from purifying mark and stabilization mark.

3. the peptide of claim 2, wherein said purifying mark is selected from cmyc mark and histidine mark.

4. the peptide of claim 1, wherein said N-terminal secretion property signal peptide is selected from SEQ IDNO:3 and SEQ ID NO:4.

5. the peptide of claim 1, wherein said peptide produces in insect cell.

6. coding is selected from the nucleic acid as next group peptide: the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically, be attached to the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically of one or more C-terminal mark, be attached to the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically of C-terminal dipeptides RS, be attached to the peptide of selecting the 20-303 position residue of albumen (SEQ ID NO:1) to form by wild-type people E basically of N-terminal secretion property signal peptide, and, reach the mixture or the combination of aforementioned peptide by having 200-400 the peptide that amino acid is formed of at least 60% homogeny with SEQ ID NO:1.

7. the nucleic acid of claim 6, wherein said one or more C-terminal mark is selected from purifying mark and stabilization mark.

8. the nucleic acid of claim 7, wherein said purifying mark is selected from cmyc mark and histidine mark.

9. the nucleic acid of claim 6, wherein said N-terminal secretion property signal peptide is selected from SEQID NO:3 and SEQ ID NO:4.

10. the nucleic acid of claim 6, wherein said peptide is made up of the C-terminal mark that one or more is selected from purifying mark and stabilization mark, and wherein said N-terminal mark is selected from SEQ IDNO:3 and SEQ ID NO:4.

11. the nucleic acid of claim 10, wherein said purifying mark is selected from cmyc mark and histidine mark.

12. the baculovirus of the nucleotide sequence of a peptide that comprises the claim 1 of encoding.

13. the carrier of the nucleotide sequence of a peptide that comprises the claim 1 of encoding.

14. a recombinant baculovirus transfer vector, it comprises the DNA sections of the coding baculovirus signal peptide that is connected with the nucleic acid of peptide of coding claim 1, translates in the DNA sections frame of described nucleic acid and the described signal peptide of coding.

15. the recombinant baculovirus transfer vector of claim 14, it operably is connected to form steerable the connection to express the nucleic acid of the peptide of described coding claim 1 in insect host cell with bacilliform virus promoter.

16. the recombinant baculovirus transfer vector of claim 15, it comprises the secretion of the peptide of claim 1 is entered sequence in the substratum of described insect host cell.

17. comprise the isolated cells of the peptide of claim 1.

18. comprise the isolated cells of the nucleic acid of claim 10.

19. the isolated cells of claim 18, wherein said cell is selected from mammalian cell, bacterial cell and insect cell.

20. the isolated cells of claim 19, wherein said cell is an insect cell.

21. a method of producing the peptide of claim 1 comprises the steps:

A) make up the recombinant transfer vector of the DNA sections comprise the coding baculovirus signal peptide that is connected with the nucleic acid of claim 10, described nucleic acid and the DNA sections frame of the described signal peptide of coding be interior to be translated and operably is connected with at the peptide of expressed in insect cells claim 1 and secrete described peptide with bacilliform virus promoter;

B) use recombinant transfer vector and first kind of insect cell of baculovirus DNA cotransfection to produce recombinant baculovirus;

C) gather in the crops described recombinant baculovirus;

D) in substratum, cultivate to express and to secrete the peptide of claim 1 with second kind of insect cell of recombinate shape virus infection of results and with the insect cell that infects; And

E) collect the also peptide of purifying secreted claim 1 of described substratum.

22. one kind by induce mucous membrane to soluble E-select protein peptide tolerance and in its individuality of needs the inflammation mediated disease of treatment or the method for pathology, comprise that by nose administration the E-that repeatedly gives described individual low dosage selects albumen, wherein said E-selects albumen to be made up of the peptide of claim 1.

23. the method for claim 22, wherein said E-selects albumen to be made up of the peptide of claim 1 basically.

24. a composition comprises the peptide and the carrier of claim 1.

25. a composition comprises the nucleic acid and the carrier of claim 10.

Images