CN101180395A - Influenza therapeutic - Google Patents

Abstract

The present invention provides compositions comprising an RNAi-inducing entity targeted to an influenza virus transcript and any of a variety of delivery agents. The invention further includes methods of use of the compositions for inhibiting a biological activity of an influenza virus and/or for treatment or prevention of influenza. The invention provides target portion sequences that are favorably conserved for RNAi across a plurality of influenza virus A strains isolated from human hosts and/or avian hosts and RNAi-inducing entities, e.g., siRNAs and shRNAs, targeted to such favorably conserved target portions. The invention provides a variety of nucleic acids comprising sequences identical or complementary to at least a portion of one or more of these favorably conserved target portion sequences. The invention further provides methods and compositions for delivering RNAi-inducing agents to an organ or tissue of a mammalian subject, e.g., to the lung. Methods of diagnosing influenza and determining the susceptibility of an influenza virus to inhibition by an RNAi-inducing agent are also provided. Transgenic animals that express an RNAi-inducing agent targeted to an influenza gene are another aspect of the invention.

Description

Influenza therapeutic

The cross reference of related application

The application's case is advocated the U.S. Provisional Patent Application case 60/664 of application on March 22nd, 2005, on April 8th, 580 and 2005, the title of application was the 11/102nd of Influenza Therapeutic, the right of priority of No. 097 U.S. patent application case, described application case is incorporated into by reference at this.

Government supports

In research and development of the present invention, United States Government provides financial support.Specifically, research and development of the present invention obtain the support of NIH (National Institutes of Health) fund number 5-R01-AI44477,5-R01-AI44478,5-ROI-CA60686 and 1-RO1-AI50631.Government has some right of the present invention.

Technical field

Background technology

Influenza is one of infection of worldwide wide-scale distribution.In the U.S., the people between annual 20000 and 40,000 dies from influenza A virus and infects or its complication.According to estimates, during influenza A virus in 1918 is very popular, 2,000 ten thousand to 4,000 ten thousand people's death are arranged.During epidemic, the quantity of being in hospital that influenza is relevant is single just can to surpass 300,000 examples in the winter time.

The epidemiology success of influenza virus is owing to several characteristics.At first, influenza virus is being propagated (droplet infection) between men by aerosol easily.Secondly, minor variations (antigenic drift (antigenic drift)) so that virus frequently take place and are easy to escape by before to the exposure of the different variants of virus and the effect of inductive protective immunity in influenza antigen.Once more, reprovision or the mixing (antigenic shift (antigenic shift)) by genetic material between the different strains can easily produce the new bacterial strain of influenza virus.Under the situation of influenza A virus, described mixing can take place between hypotype of attacking different plant species or bacterial strain.Be very popular in 1918 is considered to be caused by the hybrid strain of the virus that reprovision produced between pig and the human influenza A virus.

Although made unremitting effort, still be not used in the gratifying therapy of influenza infection, and existing vaccine characteristic owing to above-mentioned antigenic shift and drift on the part degree makes that value is limited.For this reason, the whole world of influenza A virus monitors carries out for many years, and NIH is called one of biophylactic limit priority pathogenic agent with it.Although based on the current vaccine of inactivation virus can be in the healthy individual below 65 years old of about 70-80% preventing disease, described per-cent is lower far away in the elderly or immunoincompetent people.In addition, throw with vaccine that to make described method with relevant expense and possible side effect be not the best.Although 4 kinds of ratifying of current American are used for the treatment of and/or the antiviral of flu-prevention is helpful, owing to relate to side effect, conformability and resistant strain may occur, so its use is restricted.Therefore, still need to research and develop the effective therapy that is used for the treatment of with the flu-prevention virus infection.

Summary of the invention

The invention provides and be used for the treatment of respiratory virus infection, for example by the novel composition and the method for A type, Type B and/or the caused influenza infection of C type influenza virus.Described composition and method are based on RNA and disturb (RNAi).RNAi is a kind of conservative cell method, wherein contains the expression that suppresses target RNA with the existence of target RNA complementary double-stranded RNA partly in the sequence specific mode.Inhibition can or suppress its translation by the division target and cause.Compare with existing influenza therapeutic, RNAi of the present invention induces entity to suppress the expression of influenza virus transcript and prevents that therefore virus protein is synthetic.This represents a kind of novel method of controlling the essence of influenza infection.

The invention provides the RNAi inductor of the target transcript that one or more viruses that relate to viral RNA of target produce, duplicate, infect and/or transcribe etc., such as short interfering rna (siRNA) and bob folder formula RNA (shRNA) molecule.In addition, the invention provides carrier, its existence in cell produces transcribing of one or more RNA, described RNA hybridize each other or self hybridization forming siRNA or shRNA, described siRNA or shRNA suppress to relate to virus generation, virus infection, the virus replication of virus mRNA and/or the expression of at least one target transcript of transcribing etc.Preferably, virus is Respirovirus.Preferred virus is a RNA viruses.RNA viruses comprises positive strand virus and such as the minus-stranded rna virus of influenza virus.Viral genome can be merogenesis or ameristic.According to some embodiment of the present invention, target transcript coding is selected from the protein of the group that is made up of following protein: polysaccharase, nucleocapsid protein matter, neuraminidase, homo agglutinin, stroma protein and nonstructural proteins.In a particular embodiment, target transcript coding is selected from the influenza virus protein matter of the group that is made up of following protein: homo agglutinin, neuraminidase, membrane protein 1, membrane protein 2, nonstructural proteins 1, nonstructural proteins 2, polymerase protein matter PB1, polymerase protein matter PB2, polymerase protein matter PA, NP.

The present invention also provides the composition that comprises RNAi inductor and/or carrier (for example described RNAi inductor and/or carrier) herein, and wherein said composition comprises the delivery agents of the transmission that promotes RNAi inductor or carrier in addition.Preferred delivery agents comprises cationic polymers.

The present invention provides treatment or prophylaxis of viral diseases in addition, especially the disease that is caused by Respirovirus (for example, influenza) method, described method is by before being exposed to virus, exposure takes place in, or after exposing, in the reasonable time window, or during during the person under inspection shows the symptom of the disease that is caused by virus any, will comprise the present composition that RNAi induces entity and throw with the person under inspection and carry out.Can throw by all means and composition.Optimization approach comprises intravenously, or directly enters in the respiratory system by sucking, in the nose, and approach such as aerosol form.

The invention provides the nucleotide sequence of expression as the part of the influenza virus transcript of the preferred target of RNAi.Some preferred target partly is the preferred target of function of RNAi.Some preferred target part is suitably conservative between multiple varient, so that also will suppress the different varient of sequence of its corresponding target part based on the designed RNAi inductor of specific varient.Some preferred target part is a high conservative between multiple varient.

The invention provides nucleic acid, it comprises one or more preferred target part, its complement and fragments of any one.The present invention is provided as the nucleic acid that RNAi induces entity in addition, and for example the RNAi inductor and the RNAi of one or more parts in the described target part of target induce carrier.In a preferred embodiment, RNAi induces entity target NP, PA, PB1 or PB2 gene.The effective RNAi of height that the invention provides some preferred targeting moiety of target induces entity.The effective RNAi of described height induces entity can be specially adapted to treatment or flu-prevention virus infection.

Specifically, the invention provides the RNAi inductor of target influenza virus transcript, wherein said RNAi inductor comprises: nucleic acid moiety, its sequence comprise sequence, its complement or the arbitrary fragment with at least 15 length of nucleotides that is selected from the group that is made up of SEQ ID NO:272-380.The present invention provides target to be selected from RNAi inductor by the influenza virus gene of the group of following genomic constitution in addition: polymerase protein matter PB1 gene, polymerase protein matter PB2 gene, polymerase protein matter PA gene and NP gene.

The present invention also provides isolating nucleic acid or its complement, its sequence comprises the sequence that is selected from the group that is made up of SEQ ID NO:272-380, or comprising the fragment that the sequence that is selected from the group that is made up of SEQ ID NO:272-380 has at least 15 length of nucleotides, wherein said nucleic acid has 100 or 100 following length of nucleotides.In certain embodiments, length is at least 16 Nucleotide.

The invention provides the diagnosis virus infection and determine to suspect whether the person under inspection with virus infection is subjected to the method for infection such as the virus of particular type, bacterial strain.In certain embodiments, described method comprises and determines whether the person under inspection is subjected to susceptible to induce the inhibiting influenza infection of one or more entities in the entity in RNAi of the present invention.In a preferred embodiment, the patient has influenza infection after diagnosing, and the RNAi of throwing and target infection person under inspection's specific influenza bacterial strain induces entity.Therefore the present invention provides the combining method of influenza diagnosis and treatment.Some diagnostic method uses one or more nucleic acid of the present invention.

The present invention also be provided for detecting influenza infection and/or definite influenza virus whether susceptible induce the inhibiting diagnostic kit of entity in RNAi.Test kit can comprise one or more nucleic acid of the present invention and/or be used to detect the probe or the primer of the preferred targeting moiety of influenza virus transcript.

The present invention provides in addition and induces entity to be delivered to method in Mammals person under inspection's the respiratory tract RNAi.The present inventor has been found that when in the respiratory tract that is directly delivered to the Mammals person under inspection, and RNAi induces entity can effectively suppress genetic expression in the lung.The present inventor further finds, can use conventional volume and throwing and method, to be directly delivered in Mammals person under inspection's the vascular system such as the RNAi inductor of siRNA, and can effectively suppress genetic expression in the respiratory system, for example genetic expression in the lung.For example, the siRNA of target influenza virus transcript is when being passed in the mouse by intravenously or inhalation route, and the influenza that suppresses in the lung produces, and shows and can realize by any method that the treatment of genetic expression effectively suppresses in the respiratory system.In addition, the siRNA of target luciferase transcript suppresses luciferase expression by sucking or intravenous route is thrown when giving in the mouse of expressing luciferase, shows and can use described any method to suppress any basically expression of gene.The siRNA of target endogenous gene also effectively is suppressed at the expression in the lung when transmitting by suction.Therefore the present invention provides and allows to use RNAi to treat the method for the disease of the broad range of attacking respiratory system, and described disease comprises the infection that is caused by Respirovirus.Also can use the interior method of transmitting of blood vessel that the RNAi inductor of significant quantity is delivered in the lung organ or tissue in addition.

An aspect the invention provides the method that suppresses the expression of transcript in Mammals person under inspection's organ or tissue, and its RNAi such as the RNAi inductor that comprises the target transcript induces entity directly to introduce in person under inspection's the respiratory system.In a preferred embodiment, organ or tissue is the part of respiratory tract, for example lung.Therefore, the invention provides the method that suppresses the expression of transcript in Mammals person under inspection's respiratory system, its RNAi such as the RNAi inductor that comprises the target transcript induces entity directly to introduce in person under inspection's the respiratory system.In other embodiments, induce entity to be directly delivered in the respiratory system RNAi, be transported to respiratory system reactive site in addition in the intravasation and by vascular system, that is to say that the respiratory tract approach is to be used for the general transmission.

The present invention provides the method that suppresses the expression of transcript in Mammals person under inspection's respiratory system in addition, and it comprises directly introduces the RNAi inductor of target transcript in Mammals person under inspection's the vascular system.

Another aspect the invention provides the method that suppresses the expression of transcript in Mammals person under inspection's organ or tissue, and it comprises directly introduces the RNAi inductor of target transcript in Mammals person under inspection's the vascular system.In another embodiment, the invention provides and suppress transcript in Mammals person under inspection's the organa parenchymatosum or the method for the expression in the tissue, its RNAi such as the RNAi inductor that comprises the target transcript induces entity to introduce in person under inspection's the respiratory system, wherein in the RNAi inductor intravasation system and be transported to intravital other positions.In aforesaid method among some embodiment of any method, in the aqueous medium that is substantially free of the polymkeric substance that lipid or enhancing send, throw and the RNAi inductor.In other embodiments of the invention, in comprising the composition of cationic polymers, throw and the RNAi inductor.

The invention provides and be suitable for the composition sent to respiratory system.Specifically, the invention provides contain liquid or solid particle (for example dry powder) but the respiratory gas sol formulation, described liquid or solid particle comprises RNAi inductor of the present invention and/or RNAi and induces one or more RNAi inductor and/or the RNAi in the carrier to induce carrier.Prescription can comprise delivery agents and/or vehicle.The present invention also provides and comprises the nasal spray that RNAi inductor or RNAi induce carrier.The present invention provides the device of sending the present composition in addition, for example, drying or liquid aersol prescription is delivered to device in the respiratory system, such as sucker or atomizer.Device can be sent the composition of single dose or multiple doses.The present composition can be provided in device inside and/or (for example, as new refill (refill)) can be provided separately.Device can be disposable.

Another aspect the invention provides the non-human transgenic animal of the RNAi inductor of expressing target influenza gene.

The application's case is mentioned various patents, journal of writings and other open cases, and it all incorporates this paper by reference into.In addition, following canonical reference works is to incorporate this paper: Ausubel by reference into, F., Deng people's (volume) CurrentProtocols in Molecular Biology, Current Protocols in Immunology, Current Protocols inProtein Science, and Current Protocols in Cell Biology, John Wiley﹠amp; Sons, N.Y., the version in July, 2002; Sambrook, Russell, and Sambrook, Molecular Cloning:A Laboratory Manual, the 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001; The The Pharmacological Basis of Therapeutics of Goodman and Gilman, the 10th edition .McGraw Hill, 2001.

Unless otherwise defined, otherwise all scientific and technical terminologies used herein have the common identical meanings of understanding with those skilled in the art in the invention.Although being similar to or being equivalent to the method and the material of methods described herein and material can be used for hereinafter describing method and the material that is fit in enforcement of the present invention or the test.When having contradiction, be as the criterion to comprise this specification sheets in being defined in.In addition, described material, method and example only are illustrative and not restrictive.According to following embodiment and claims with apparent other features and advantages of the present invention.When element is listed with Ma Ku (Markush) group form, should be appreciated that, also disclose the subgroup separately of these elements, and can remove any element from group.When providing scope, see obvious difference except as otherwise noted or from context, otherwise comprise end points.

Description of drawings

Figure 1A (from Julkunen hereinafter, people such as I. one literary composition is revised) presents the synoptic diagram of influenza virus.

Figure 1B (revising from one literary composition of Fields ' Virology hereinafter) shows influenza virus and from the genome structure of the transcript of influenza genome acquisition.The fine rule at 5 of mRNA ' end and 3 ' end place is represented non-translational region.Shade or cross hatched regions represent respectively 0 or+coding region in 1 reading frame.Intron is described by V-shaped line.The allos cell RNA of representing to be covalently attached to viral nucleic acid at the little rectangle at 5 ' end place of mRNA.A _(n)Symbol polyadenylic acid tail (polyA tail).

Fig. 2 (from Julkunen hereinafter, people such as I. one literary composition is revised) demonstration influenza virus replicative cycle.

Fig. 3 is presented at the structure of observed siRNA in fruit bat (Drosophila) system.

Fig. 4 schematically illustrates the related step of RNA interference in the fruit bat.

Fig. 5 shows according to the present invention effectively various exemplary siRNA and shRNA structure.

Fig. 6 illustrates substituting inhibition path, and wherein the DICER enzyme divides inhibition product and the inhibition translation that the substrate that has base mispairing in stem (stem) produces the 3 ' UTR that is bonded to the target transcript.

Fig. 7 presents a construct example of directly transcribing of two chains that can be used for siRNA of the present invention.

Fig. 8 describes a construct example of directly transcribing that can be used for single RNA molecule, and described single RNA molecular hybridization is to form according to shRNA of the present invention.

Fig. 9 show between 6 kinds of bacterial strains of influenza virus A with human host source sequence relatively.Dark shadow zone is used to design the siRNA that tests described in example 2.Basic sequence is the sequence of strains A/Puerto Rico/8/34.Slight shaded letter represents to be different from the Nucleotide of basic sequence.

Sequence comparison between 2 kinds of bacterial strains that Figure 10 shows the influenza virus with human host source and the 5 kinds of bacterial strains of influenza virus A with animal host source.Dark shadow zone is used to design the siRNA that tests described in example 2.Basic sequence is the sequence of strains A/Puerto Rico/8/34.Slight shaded letter represents to be different from the Nucleotide of basic sequence.

Figure 11 A-11F shows the experimental result that shows that the influenza virus in the siRNA inhibition mdck cell produces.By electroporation the various virus transcriptions of target 6 kinds of different siRNA are originally introduced in the mdck cells, and use virus infected cell after 8 hours.Figure 11 A shows as the homo agglutinin analysis, with (PR8) metainfective each time of virus strain A/PR/8/34 (H1N1), under the infection multiplicity 0.01 (MOI), measured when having or not existing various siRNA or contrast siRNA, the time-histories of the virus titer in the culture supernatants.Figure 11 B shows as the homo agglutinin analysis, through (WSN) metainfective each time of strains of influenza viruses A/WSN/33 (H1N1), under 0.01 MOI, measured when having or not existing various siRNA or contrast siRNA, the time-histories of the virus titer in the culture supernatants.Figure 11 C shows the plaque analysis, shows hang oneself contrast transfection or the virus titer in the culture supernatants of the virus infected cell of siRNA NP-1496 transfection.Figure 11 D is presented under the siRNA of various dose, to the inhibition of influenza virus generation.Mdck cell is through the NP-1496 of specified amount siRNA transfection, then under 0.01 MOI, through the PR8 virus infection.Infect and measure virus titer after 48 hours.Shown representative data from one of 2 experiments.Figure 11 E shows by throw the caused inhibition that influenza virus is produced with siRNA behind virus infection.Mdck cell is under 0.01 MOI, through PR8 virus infection 2 hours, and then through NP-1496 (2.5nmol) transfection.Measure virus titer in the metainfective fixed time.Demonstration is from the representative data of one of 2 experiments.

Figure 12 show between the part in 3 ' district of NP sequence of 12 kinds of influenza A virus hypotypes with the mankind or animal host source or strain isolated sequence relatively.The shadow zone is used to design the siRNA that tests described in example 2 and 3.Basic sequence is the sequence of strains A/Puerto Rico/8/34.Shaded letter represents to be different from the Nucleotide of basic sequence.

Figure 13 shows and the relevant position with respect to the segmental various siRNA of influenza virus gene of validity that suppresses influenza virus.

Figure 14 A is the synoptic diagram of developmental chicken embryo, shows the zone that is used to inject siRNA and siRNA/ delivery agents composition.

Figure 14 B is presented at the ability of the various siRNA that suppress the influenza virus generation in the developmental chicken embryo.

Figure 15 is the interactional synoptic diagram that shows nucleoprotein and viral RNA molecule.

The difference between Figure 16 A and 16B explicit declaration influenza virus vRNA, mRNA and the cRNA (template ribonucleic acid) and the synoptic diagram of the relation between them.In Figure 16 B, show 12 conservative Nucleotide at the segmental 3 ' end of each influenza A virus vRNA place and 13 Nucleotide at 5 ' end place.MRNA contains m ⁷GpppN ^mCap structure and average 10 to 13 Nucleotide that obtain from the subclass of host cell RNA.The polyadenylic acidization of mRNA occurs among the mRNA site corresponding to 15 to 22 Nucleotide in position before the segmental 5 ' end of vRNA.The arrow indication has the position of specific primer to various RNA species.(revising) from reference (1).

Before Figure 17 is presented at and infects 6-8 hour through the contrast transfection or in siRNA NP-1496 cells transfected, in amount with virus N P and the NS RNA species of each time behind the virus infection.

Figure 18 A shows that the inhibition that influenza virus is produced needs wild-type (wt) antisense strand among the duplex siRNA.Mdck cell is at first used by wt and the formed siRNA transfection of modified (m) chain, and 8 hours after under 0.1 MOI, use the PR8 virus infection.Infect after 24 hours, analyze the virus titer in the culture supernatants.Demonstration is from the representative data of one of 2 experiments.Figure 18 B shows that the M specific siRNA suppresses gathering of specific mRNA.Mdck cell under 0.01 MOI, is used the PR8 virus infection through the M-37 transfection, and after infecting 1,2 and 3 hour, collects to be used for RNA and separate.By using the RNA Auele Specific Primer to carry out reverse transcription, then carry out the content that PCR in real time is measured M specific mrna, cRNA and vRNA.The content standard of various viral RNA species is turned to the content (below figure) of γ in the same sample-Actin muscle mRNA.The relative content of RNA is represented with mean value ± S.D form.Demonstration is from the representative data of one of 2 experiments.

Figure 19 A-D shows, the NP specific siRNA not only suppresses gathering of NP specific mrna, vRNA and cRNA but also suppresses M and the gathering of NS specific mrna, vRNA and cRNA.MDCK (A-C) and Vero (D) cell under 0.1 MOI, are used the PR8 virus infection through the NP-1496 transfection, and collect after infection 1,2 was with 3 hours and separate to be used for RNA.By using the RNA Auele Specific Primer to carry out reverse transcription, then carry out PCR in real time and measure the content that NP, M and NS is had specific mRNA, cRNA and vRNA.The content standard of various viral RNA species is turned to the content (not shown) of γ in the same sample-Actin muscle mRNA.The relative content that shows RNA.Demonstration is from the representative data of one of 3 experiments.

Figure 19 E-G, the right side in each figure shows that the PA specific siRNA not only suppresses gathering of PA specific mrna, vRNA and cRNA but also suppresses M and the gathering of NS specific mrna, vRNA and cRNA.Mdck cell under 0.1 MOI, is used the PR8 virus infection through the PA-1496 transfection, and collects after infection 1,2 was with 3 hours and separate to be used for RNA.By using the RNA Auele Specific Primer to carry out reverse transcription, then carry out PCR in real time and measure the content that PA, M and NS is had specific mRNA, cRNA and vRNA.The content standard of various viral RNA species is turned to the content (not shown) of γ in the same sample-Actin muscle mRNA.The relative content that shows RNA.

Figure 19 H shows that the NP specific siRNA suppresses gathering of PB1 specific mrna (top figure), PB2 specific mrna (middle graph) and PA specific mrna (below figure).Mdck cell under 0.1 MOI, is used the PR8 virus infection through the NP-1496 transfection, and collects after infection 1,2 was with 3 hours and separate to be used for RNA.By using the RNA Auele Specific Primer to carry out reverse transcription, then carry out PCR in real time and measure the content that PB1, PB2 and PA mRNA is had specific mRNA.The content standard of various viral RNA species is turned to the content of γ in the same sample-Actin muscle mRNA (not shown).The relative content that shows RNA.

Figure 20 A shows the sequence of siRNA CD8-61 and its hair clip formula derivative CD8-61F.

Figure 20 B shows the inhibition that CD8-61 and CD8-61F express CD8a.CD8 ⁺CD4 ⁺T clone is by electroporation, through CD8-61 or CD8-61F transfection.After 48 hours, express by flow cytometry CD8a.Unlabelled clone, the contrast transfection.

Figure 20 C shows the synoptic diagram of pSLOOP III carrier, wherein by the expression of H1 RNA pol III promoters driven CD8-61F hair clip formula RNA.Terminator, termination signal sequence.

Figure 20 D presents and shows the graphic representation that uses pSLOOP III to suppress the CD8a in the HeLa cell.Non-transfected cells is not expressed CD8a.Cell through CD8a expression vector and no promotor pSLOOP III-CD8-61F construct, synthesize siRNA or contain the pSLOOP III-CD8-61F transfection of promotor.

Figure 21 A shows the synoptic diagram of NP-1496 and GFP-949 siRNA and its hair clip formula derivative/precursor.

Figure 21 B shows the serial array of the NP-1496H and the GFP-949H that are 2 kinds of different order.

Figure 21 C shows pSLOOP III expression vector.With the hair clip formula precursor of siRNA separately (top figure), be serial array (middle graph), or clone in pSLOOP III carrier with independent startup and terminator sequence (below figure).

Figure 22 A be show when before influenza infection, throw together with cationic polymers PEI and the time, siRNA suppresses the figure of influenza virus generation in the mouse.Solid squares (non-processor); Square hollow (GFP siRNA); Open circles (30 μ g NP siRNA); Filled circles (60 μ g NP siRNA).Each symbolic representation individual animal, the p value between showing not on the same group.

Figure 22 B be show when before influenza infection, throw together with cationic polymers PLL and the time, siRNA suppresses the figure of influenza virus generation in the mouse.Solid squares (non-processor); Square hollow (GFP siRNA); Filled circles (60 μ g NP siRNA).Each symbolic representation individual animal, the p value between showing not on the same group.

Figure 22 C be show when before influenza infection, throw together with cationic polymers jetPEI and the time, with when throwing in PBS with the time compare, siRNA significantly more effectively suppresses the figure of influenza virus generation in the mouse.Square hollow (non-processor); Hollow triangle (the GFP siRNA in PBS); Black triangle (the NP siRNA in PBS); Open circles (GFP siRNA and jetPEI); Filled circles (NP siRNA and jetPEI).Each symbolic representation individual animal, the p value between showing not on the same group.

Figure 22 D be show when together with positively charged ion poly-(β amino ester) (J28) through intravenous route throw and the time, the siRNA of target NP suppresses the figure of influenza virus generation in the mouse.Open circles (non-processor); Solid squares (NP siRNA and J28).

Figure 22 E be show when together with poly-(β amino ester) (J28 or the C32) of positively charged ion through the intraperitoneal approach throw and the time, the siRNA of target NP suppresses that influenza virus produces in the mouse, and contrasts the figure that RNA (GFP) does not have remarkable effect.Open circles (non-processor); Square hollow (GFP siRNA and J28); Solid squares (NP siRNA and J28); Hollow triangle (GFP siRNA and C32); Black triangle (NP siRNA and C32).Show the p value between control group and the treatment group.

Figure 23 be show when before influenza infection, throw together and the time, the figure of the siRNA demonstration additive effect of target influenza virus NP and PA transcript.Solid squares (non-processor); Open circles (60 μ g NP siRNA); Hollow triangle (60 μ g PA siRNA); Filled circles (60 μ g NP siRNA+60 μ g PA siRNA).Each symbolic representation individual animal, the p value between showing not on the same group.

Figure 24 be show when behind influenza infection, throw and the time, siRNA suppresses the figure of influenza virus generation in the mouse.Solid squares (non-processor); Square hollow (60 μ g GFP siRNA); Hollow triangle (60 μ g PA siRNA); Open circles (60 μ g NP siRNA); Filled circles (60 μ g NP+60 μ g PA siRNA).Each symbolic representation individual animal, the p value between showing not on the same group.

Figure 25 A is the synoptic diagram of expressing the lentiviral vectors of shRNA.By transcribing of U6 promoters driven shRNA.Express by CMV promoters driven EGFP.SIN-LTR, Ψ, cPPT and WRE are the slow virus components.The sequence that shows NP-1496shRNA.

Figure 25 B presents flow cytometry result's graphic representation, proves with the Vero cell of the slow virus infection described in Figure 25 B to express EGFP in dosage dependence mode.Slow virus is to produce in the 293T cell by the dna vector of the NP-1496a shRNA that will encode and package carrier cotransfection.Culture supernatants (0.25ml or 1.0ml) is used for vero cells infection.GFP by flow cytometry gained Vero clone (Vero-NP-0.25 and Vero-NP-1.0) and contrast (not infecting) Vero cell expresses.The average fluorescent strength that shows Vero-NP-0.25 (top figure part) and Vero-NP-1.0 (below figure part) cell.The average fluorescent strength of shade curve representation contrast (not infecting) Vero cell.

Figure 25 C is presented to suppress the figure that influenza virus produces in the Vero cell of expressing NP-1496 shRNA.The Vero cell of parental generation and expression NP-1496 shRNA is used the PR8 virus infection under 0.04,0.2 and 1 MOI.Infect after 48 hours, by the virus titer in hamegglution (HA) the assay determination supernatant liquor.

Figure 26 is the throwing and the figure that suppress in mouse influenza virus generation of demonstration by the dna vector of the siRNA of expression target influenza virus transcript.Coding RSV, the NP-1496 (NP) of 60 μ g or the DNA of PB1-2257 (PB1) shRNA are mixed with 40 μ l Infasurf, and by in instil throwing and the mouse.For non-processor (NT) group, to instil 5% glucose of 60 μ l of mouse.After 13 hours, with approach infecting mouse in the PR8 virus intranasal, every mouse 12000pfu.Infect after 24 hours, by the virus titer in the MDCK/ homo agglutinin analysis to measure lung.Each data point is represented a mouse, the p value between the demonstration group.

Figure 27 A shows the result of the electrophoretic mobility shift assay of the mixture formation that detects between siRNA and the poly-L-Lysine (PLL).By at room temperature, the NP-1496 siRNA of 150ng is mixed 30min with the polymkeric substance (0-1200ng) of incremental change form the siRNA-polymer complex.Make reaction mixture on 4% sepharose, run glue then, and utilize ethidium bromide (ethidium-bromide) dyeing observation siRNA.

Figure 27 B shows the result of the electrophoretic mobility shift assay of the mixture formation that detects between siRNA and poly--L-arginine (PLA).By at room temperature, the NP-1496 siRNA of 150ng is mixed 30min with the polymkeric substance (0-1200ng) of incremental change form the SiRNA-polymer complex.Make reaction mixture on 4% sepharose, run glue then, and utilize ethidium bromide staining observation siRNA.

Figure 28 A is the Cytotoxic graphic representation that shows the siRNA/PLL mixture.Handle Vero cell 6 hours in 96 orifice plates with siRNA (400pmol)/polymer complex.Replace the substratum that contains polymkeric substance with DMEM-10%FCS then.Behind the 24h, analyze the metabolic activity of measuring cell by using MTT.Square=PLL (MW～8K); Circle=PLL (MW～42K); Solid squares=25%; Hollow triangle=50%; Black triangle=75%; X=95%.Data are represented with three times mean value.

Figure 28 B is the Cytotoxic graphic representation that shows the siRNA/PLA mixture.Handle Vero cell 6 hours in 96 orifice plates with siRNA (400pmol)/polymer complex.Replace the substratum that contains polymkeric substance with DMEM-10%FCS then.Behind the 24h, analyze the metabolic activity of measuring cell by using MTT.Data are represented with three times mean value.

Figure 29 A is the graphic representation that shows that PLL stimulates the cell of siRNA to absorb.Cultivate Vero cell 6 hours in 24 orifice plates with Lipofectamine+siRNA (400pmol) or with siRNA (400pmol)/polymer complex.Washed cell and under 0.04 MOI is used the PR8 virus infection then.Analyze the virus titer of measuring in the culture supernatants that infects the back different time points by HA.The ratio that shows polymkeric substance and siRNA.Open circles=nothing treatment; Solid squares=Lipofectamine; Black triangle=PLL (MW～42K); Hollow triangle=PLL (MW～8K).

Figure 29 B is the graphic representation that shows the cell absorption of poly--L-arginine stimulation siRNA.Cultivate Vero cell 6 hours in 24 orifice plates with siRNA (400pmol)/polymer complex.Washed cell and under 0.04 MOI is used the PR8 virus infection then.Analyze the virus titer in the culture supernatants of measuring different time points after infection by HA.The ratio that shows polymkeric substance and siRNA.0,25,50,75 and 95% is meant the per-cent of epsilon-amino on the PLL that replaces through the imidazoles ethanoyl.Filled circles=no transfection; Open circles=Lipofectamine; Square hollow and solid squares=0% and 25% (note, 0% be identical with 25% data point); Black triangle=50%; Hollow triangle=75%; X=95%.

Figure 30 A is after being presented at intravenous injection, the histogram of the DNA transfection in the PEI mediation lung.Be presented in 4 days scopes the Luc activity of relative light unit in the 0.5mg protein in the Different Organs.Data are from one of 2 experiments.

Figure 30 B be presented at throw in the tracheae with after, the histogram of the DNA transfection in the PEI mediation lung.This figure is presented at DNA and throws with after 24 hours, the average Luc activity of relative light unit in the 0.5mg protein in the designated organ of every group of 3 mouse.Histogram of error indication standard deviation.

Figure 30 C shows by intravenously to send the histogram that siRNA suppresses the uciferase activity in the lung.This figure is presented at and throws and luciferase construct after 24 hours the average Luc activity of relative light unit in the 0.5mg protein in the designated organ of every group of 3 mouse.Histogram of error indication standard deviation.

Figure 30 D shows by suction to send the histogram that siRNA suppresses the uciferase activity in the lung.This figure is presented at and throws and luciferase construct after 24 hours the average Luc activity of relative light unit in the 0.5mg protein in the mouse lung.Histogram of error indication standard deviation.Every group is used 3 mouse to carry out the double experiment, and obtains similar results.Present the result of one of experiment at this.

Figure 31 A and 31B are presented to throw when not having delivery agents with siRNA to suppress the figure that influenza virus produces in the mouse.

Figure 32 A-32J shows the sequence of the strains of influenza viruses PR8 transcript of the target part be used to select RNAi.

Figure 33 is a table 17, shows the sequence of the function target part of the RNAi that suppresses influenza virus.

Figure 34 is a table 18, shows the sequence that derives from the suitably conservative influenza virus target part that is used for RNAi between the human strains of influenza viruses.

Figure 35 is a table 20, shows the sequence of the suitably conservative influenza virus target part that is used for RNAi between the strains of influenza viruses that derives from the mankind and bird.

Embodiment

Abbreviation

DNA: thymus nucleic acid

RNA: Yeast Nucleic Acid

VRNA: the virus particle RNA in the influenza virus gene group, minus strand

CRNA: complementary RNA, the direct transcript of vRNA, normal chain

MRNA: from the messenger RNA(mRNA) that vRNA or cytogene are transcribed, normal chain is used for the template of protein synthesis

DsRNA: double-stranded RNA

SiRNA: short interfering rna

ShRNA: bob folder formula RNA

MiRNA: microRNA

RNAi:RNA disturbs

Bp: base pair

Nt: Nucleotide

Definition

As used herein, see obviously opposite (except that described numeral will surpass the 100% of probable value) except as otherwise noted or from context, belong to digital 5% the interior numeral (being greater than or less than described numeral) of scope on the either direction otherwise generally include about the term " approximately " of numeral or " pact ".

Term " bird " is used for any species, subspecies or the ethnic organism of presentation class Aves (ava) as used herein, for example, and chicken, turkey, duck, goose, quail, pheasant, parrot, finch, hawk and crow.This term comprises Hongyuan chicken (Gallus gallus), or chicken (for example, white Leghorn (White Leghorn), brown Leghorn (BrownLeghorn), speckle chicken (Barred-Rock), Su Saikesi chicken (Sussex), state of New Hampshire chicken (NewHampshire), Tokushima state, Lip river chicken (Rhode Island), Ausstralorp, Minorca (Minorca), Amrox, California grey chicken, Italy quail look chicken (Italian Partidge-colored)) various known bacterial strain, and turkey, pheasant, quail, duck, the bacterial strain of ostrich and other poultry of raising usually.

Term " complementation " is to use according to field art-recognized meanings under it in this article, is meant the accurate paired ability between particular bases, nucleosides, Nucleotide or the nucleic acid.For example, VITAMIN B4 (A) and uridine (U) are complementary; VITAMIN B4 (A) and thymidine (T) are complementary; And guanine (G) and cytosine(Cyt) (C) are complementary, and are called the Watson-Crick base pairing in affiliated field.If when chain is compared with antiparallel orientations, the Nucleotide complementation of inverted orientation in the Nucleotide of a certain position of first nucleotide sequence and second nucleotide sequence, it is right that so described Nucleotide forms complementary base, and described nucleic acid is complementary in described position.The complementary per-cent of first nucleic acid and second nucleic acid can followingly be assessed: these two nucleic acid are compared with antiparallel orientations, to obtain complementary along the maximum in the evaluation window scope of second nucleic acid, be determined at the nt sum that forms in the window in two right chains of complementary base, divided by the sum of the nt in the window and multiply by 100.For example, AAAAAAAA and TTTGTTAT are 75% complementary, because in 16 nt altogether, have 12 to be the right nt of complementary base.At least 70% complementary nucleic acid is considered to be in the described window ranges complementary in fact in the evaluation window scope.When being calculated as when reaching the required complementary nt quantity of particular complementary per-cent, mark is rounded to immediate integer.The shared position of incomplementarity Nucleotide constitutes mispairing, that is, described position is occupied by the incomplementarity base pair.For reaching maximum complementary, the gap can be introduced among any one or both of nucleic acid in the evaluation window.The Nucleotide relative with the gap is not paired and constitutes protrusion (bulge), that is to say, does not have relative Nucleotide in another nucleic acid.Usually, complementary per-cent is to be at least 15 nt in length, for example measures in the evaluation window scope of 19 nt, and wherein said length does not comprise the gap.In order to measure complementary per-cent, 1 nt protrusion is considered as single incomplementarity nt; Protrusion between 2 and 5 nt is considered as 2 incomplementarity nt; Protrusion between 6 and 10 nt is considered as 3 incomplementarity nt.With length is that the protrusion (wherein K is greater than 10) of K nt is considered as the individual incomplementarity nt of 3+ (K-10).

" directly enter in the respiratory system " and be meant by nose, mouth or tracheae, preferably by nose or mouthful throw with so that respiratory tract above and/or under quite most promoting agent (for example, greater than 10%, being preferably greater than 25%) enters in the composition.

" directly intravasation system in " is meant by injection or conduit or any other method (being usually directed to the penetration rate of blood tube wall) from external intravasation system and throws with in blood vessel (for example, artery or vein)." indirectly in the intravasation system " is meant the not throwing and the pattern of penetration rate of blood guard system.The preferred embodiment that material is delivered in the vascular system indirectly is that material directly is delivered in the respiratory system, then makes material pass vessel wall.Then can be with the target tissue or the organ (and can turn back to lung) of matter transportation other positions in the body.

" significant quantity " of promoting agent is meant the amount of the promoting agent that is enough to cause desirable biological respinse.As be appreciated by one of skill in the art that, for factors such as the visual biological as desired terminal point of absolute magnitude of effective particular agent, medicament to be sent, target tissue change." significant quantity " can single dose or multiple doses throw with.For example, RNAi induces the significant quantity of entity can be to be enough to reach the amount more than or in the and the following: (i) make the expression of target transcript reduce at least 20%, and preferably at least 40%; (ii) make virus titer reduce at least 25%; (iii) make virus titer reduce at least 2 times; (iv) delay or prevent the development of clinical remarkable virus infection; (v) reduce time length of at least a symptom of virus infection or seriousness etc.

If by weight, composition contains a certain material less than 1%, preferably less than 0.5%, be more preferably less than 0.1%, and composition " is substantially free of " described material so.More preferably, described material does not exist in the described composition fully.If be not that polymkeric substance or the lipid of intentionally enhancing being sent is included in the described composition, think that so composition is substantially free of such polymkeric substance or lipid.

As used herein, term " hybridization " is meant 2 kinds of interactions between the nucleotide sequence that comprises or be made up of complementary portion, so that be formed under the specified conditions of being paid close attention to, for example in eukaryotic cell, in the medium stable duplex structure of the molten born of the same parents' thing of fruit bat.Usually, if the Tm of first nucleic acid and the formed duplex of second nucleic acid, than second nucleic acid with identical with second length nucleic acid and and second nucleic acid 100% is complementary and to contain the Tm of the formed duplex of the 3rd nucleic acid of binding between the nucleosides of same type and nucleosides low less than 15 ℃, preferred low less than 10 ℃, think first nucleic acid and second nucleic acid hybridization so.The hybridization conditions that is suitable for various application is known in affiliated field, and/or is found in the canonical reference works, for example among Ausubel above and the Sambrook above.In an one exemplary embodiment, stringent hybridization condition is included in than 6X sodium chloride/sodium citrate (SSC) and 0.1%SDS under the temperature of low 10-15 ℃ of the Tm of complete complementary duplex, then under than the temperature of low 25 ℃ of the Tm of complete complementary duplex in 2 X SSC and 0.1%SDS washing last 30 minutes 1-2 time.

" homology " is meant the same degree of two or more nucleotide sequences.In the evaluation window scope, percent homology between first nucleic acid and second nucleic acid can followingly be calculated: with these two nucleic acid with parallel-oriented comparison, measure the quantity of Nucleotide relative in the evaluation window, divided by the total of window inner nucleotide and multiply by 100 with identical Nucleotide.When being calculated as when reaching the required identical Nucleotide quantity of specific percent homology, mark is rounded to immediate integer.The nucleic acid of at least 70% homology in the evaluation window scope (for example, at least 80%, at least 90%, or more than 90%) is considered in described window ranges homology in fact.Usually, evaluation window is along at least 15 nt of second length nucleic acid, 19 nt for example, and wherein length does not comprise the gap.In order to measure percent homology, 1 nt gap is considered as single not relative with identical nt nt; 2 with 5 nt between the gap be considered as 2 not relative nt with identical nt; 6 with 10 nt between the gap be considered as 3 not relative nt with identical nt.With length is that the gap (wherein K is greater than 10) of K nt is considered as individual not relative with the identical nt nt of 3+ (K-10).

Term " influenza virus " is meant and can causes disease or be any bacterial strain of the influenza virus of being paid close attention to candidate of experimental analysis in animal or human's class person under inspection as used herein.Fields, people such as B. be at Fields ' Virology, and the 4th edition, Philadelphia:Lippincott Williams and Wilkins; ISBN:0781718325 has described influenza virus in 2001.Specifically, described term is contained and can be caused disease or be any bacterial strain of the influenza A virus of being paid close attention to candidate of experimental analysis in animal or human's class person under inspection.A large amount of influenza A strain isolateds are partially or completely checked order.Appendix A only present be deposited with public database (the influenza sequence library (and Influenza Sequence Database, ISD), referring to Macken, C, Lu, H., Goodman, J. ， ﹠amp; Boykin, L., " The value of a database in surveillanceand vaccine selection. " in Options for the Control of Influenza IV.A.D.M.E.Osterhaus, N.Cox ﹠amp; A.W.Hampson (volume) Amsterdam:Elsevier Science, 2001,103-106) the part inventory of the influenza A genomic fragment complete sequence in.Described database also contains the complete sequence of influenza B and C genomic fragment.This database together with allow the user by genomic fragment, by by the species of virus infection with can be by separating the search engine easily that the time searches at World Wide Web Site URL Http:// www.flu.lanl.gov/Last acquisition.The influenza sequence also can obtain on Genbank.Therefore, the those skilled in the art can easily obtain the sequence of influenza gene, perhaps can be determined by the those skilled in the art.

Such as herein about synthetic, the processing of RNAi inductor or active use, term " in vivo " typically refer to cell free system comparatively speaking, occur in intracellular incident.Usually, cell can maintain in the tissue culture or can be the part of complete organism.

" isolating " as used herein, the meaning is 1) relevant component is separated from least some are natural usually; 2) by relating to preparation of artificial method or purifying; And/or 3) do not exist in natural.Any nucleic acid in nucleic acid of Miao Shuing and the nucleic acid construct and nucleic acid construct can be unpack format herein.

" part " meaning is that mechanism by being different from antigen-antibody interaction is specifically in conjunction with the molecule of second molecule as used herein.For example, this term is contained naturally occurring or synthetic polypeptide, peptide and small molecules, comprises the molecule that is createed structure by the people.

" based on the analysis of nucleic acid " is meant existence that detects nucleic acid and/or any analysis or the method for discerning nucleic acid.This analysis can be qualitatively or quantitative.

" nucleic acid base (nucleobase) " meaning is as used herein, can form hydrogen bond, is preferably the Watson-Crick hydrogen bond, with complementary nucleic acid base or the pairing of nucleic acid base analogue, for example with purine or pyrimidine paired nitrogen heterocyclic ring base section.Typical case's nucleic acid base is the analogue (Fasman of naturally occurring nucleic acid base VITAMIN B4, guanine, cytosine(Cyt), uridylic, thymus pyrimidine and naturally occurring nucleic acid base, Practical Handbook ofBiochemistry and Molecular Biology, the 385-394 page or leaf, CRC Press, Boca Raton, Fla., 1989).Term " nucleic acid base " and " base " can alternately be used in this article.

" Nucleotide " comprises nitrogenous base, glycan molecule and phosphate.Nucleosides comprises the nitrogenous base (nucleic acid base) that is connected in glycan molecule.In naturally occurring nucleic acid, phosphate covalently connects contiguous nucleosides, forms polymkeric substance.Nucleic acid (for example can comprise naturally occurring nucleosides, adenosine, thymidine, guanosine, cytidine, uridine, Desoxyadenosine, deoxythymidine, pancreatic desoxyribonuclease and Deoxyribose cytidine), nucleoside analog (for example, the amino adenosine of 2-, 2-sulfo-thymidine, inosine, pyrrolo--pyrimidine, the 3-methyladenosine, C5-proyl cytidine, C5-proyl uridine, the C5-broxuridine, the C5-floxuridine, C5-ioduria glycosides, the C5-methylcytidine, 7-denitrification adenosine, 7-denitrification guanosine, 8-oxo adenosine, 8-oxo guanosine, O (6)-methyl guanine and 2-sulfo-cytidine), base through chemically modified, the base of modifying through biology (for example, methylated base), base through inserting, modified sugar (for example, 2 '-fluorine ribose, ribose, 2-deoxyribosyl, pectinose and hexose).Nucleosides can comprise universal base, that is to say, base can replace a base in the natural base that often is found in the nucleic acid, or preferably, any base (when in duplex, making described base relative) (referring to, for example, 142-149).In certain embodiments of the present invention, nucleic acid comprises no alkaline residue.

" can be operatively connected " 2 relations between the nucleotide sequence that are meant as used herein, wherein the expression of one of nucleotide sequence be by another nucleotide sequence control, regulate, adjustment etc.For example, transcribing by the promoter sequence guiding nucleus acid sequence that can be operatively connected; The post-treatment of transcribing by the job sequence guiding nucleic acid that can be operatively connected; Translation by the translational control sequence guiding nucleus acid sequence that can be operatively connected; Transportation or location by the transportation that can be operatively connected or positioning sequence guiding nucleic acid or polypeptide; And, by the translation post-treatment of the job sequence guiding polypeptide that can be operatively connected.Preferably, it is covalently bound with described sequence directly or indirectly can being operatively connected in the nucleotide sequence of second nucleotide sequence, but also can accept any effective three-dimensional association.

The term " organ " that uses as affiliated field is meant the tissue of the morphology that constitutes organism and the different part of function or organizes group.Example comprises lung, heart, liver, pancreas, breast, kidney, intestines, bladder, bone, skin etc.Being meant, the term " tissue " that uses as affiliated field has similar structures, usually through organizing to carry out one or more cell groups identical or correlation function.Red corpuscle, white corpuscle and thrombocyte are considered to comprise the loop organization of individual cells or cell fragment.

" prevention " is to instigate disease, illness, symptom, or its symptom or performance, or the deterioration of its severity does not take place.Prevention comprises reduction disease, illness, symptom, or its symptom or performance, or the deterioration of its severity is with the risk that takes place.Therefore, if composition or method are based on individuality or colony, reduce disease, illness, symptom, or its symptom or performance, or the deterioration of its severity is with the risk that takes place, so just claim described composition or method to prevent described disease, illness, symptom, or its symptom or performance, or the deterioration of its severity.

Term " primer " is meant as used herein, it no matter is natural or synthetic, as long as in the time of can (for example catalytic primer extension of polysaccharase) is with nucleic acid-templated hybridization under causing the condition of primer extension, take on the oligonucleotide of nucleic acid synthetic starting point.The suitable length of primer is decided on the desired use of primer, but usually in the scope of 15 to 35 nt.In some cases, primer can be longer, and for example length reaches about 60 nt.The short primer molecule needs colder temperature to come to form sufficiently stable hybridization complex with template usually.Primer does not need to reflect the definite sequence of template, but must be enough complementary, so that hybridize with the template that is used for primer extension.

When mentioning nucleic acid, term " probe " is meant the nucleic acid that can hybridize also and then detect the existence of complementary nucleic acid with complementary nucleic acid as used herein.Probe should be enough complementary with the nucleic acid that is detected, so that under used hybridization stringent condition specific hybridization can take place.Available such as marks such as fluorescence part, vitamin H modification probe.

" purifying " meaning is to separate from many other compounds or entity as used herein.Compound or entity can be partially purified, in fact purifying or pure, wherein when from every other in fact compound or entity, removing, claim that it is pure, that is to say, be preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% purity.

Use term " regulating and controlling sequence " to describe guiding, strengthen or suppress the zone of the nucleotide sequence of the expression of the sequence that can be operatively connected (especially transcribe, but be other incidents in some cases) herein such as montage or other processing.This term comprises the expression signal such as promotor, enhanser and other transcriptional control elements.In some embodiments of the invention, the constitutive character of the bootable nucleotide sequence of regulating and controlling sequence is expressed; In other embodiments, bootable tissue specificity of regulating and controlling sequence and/or inducible expression.Regulating and controlling sequence can the only expression of guiding nucleus nucleotide sequence in the cell that infects with infectious agent.For example, regulating and controlling sequence can comprise promotor and/or enhanser, such as by virus protein, and virus-specific promotor or the enhanser discerned such as varial polymerases, transcription factor for example.Perhaps, regulating and controlling sequence can be included in the epithelial cell of airway epithelial cell for example and have active promotor and/or enhanser.For example, can use the promotor of the proteinic gene of coded surface promoting agent.

" respiratory system " is meant any upper respiratory tract component (for example, nostril, nasopharynx, oropharynx) or lower respiratory tract component (for example, tracheae, segmental bronchus, bronchiole and/or alveolar).Larynx can be considered to the component of the upper respiratory tract or lower respiratory tract.Term " respiratory system " and " respiratory tract " can alternately use in this article.

" Respirovirus " is the virus that infects the upper respiratory tract and/or the cell in the lower respiratory tract that are present in the person under inspection.Preferably, virus infection airway epithelial cell.May include, but is not limited to BAM, dendritic cell etc. by infected other cells.The example of Respirovirus comprises: influenza virus, parainfluenza virus (PIV), pneumonitis virus, metapneumovirus, coronavirus, adenovirus, rhinovirus, respiratory syncytial virus (RSV), reovirus, simplexvirus and Hantaan virus (hantavirus).

Term " RNAi inductor " is meant siRNA, shRNA and can processes other duplex structures (for example dsRNA) that produce siRNA or shRNA or disturb other little RNA species of the expression that suppresses the target transcript by RNA.In certain embodiments of the present invention, the RNAi inductor suppresses the expression of target RNA by the RNA interference path that relates to translation repression.

RNA molecule and carrier contained in term " RNAi induces entity ", and its existence in cell produces RNAi and causes that RNAi induces the expression of the transcript of entity institute target to reduce.It for example can be RNAi inductor such as siRNA, shRNA that RNAi induces entity, or RNAi induces carrier.The use of term " RNAi induces entity ", " RNAi inductor " or " RNAi induces carrier " is not planned to hint, described entity, medicament or carrier raise usually or activator RNA i (although may be like this), but show that simply described entity, medicament or carrier reduce in the expression that intracellular existence produces the target transcript of RNAi mediation." RNAi induces entity " is a kind of entity as used herein, be by manually modified or produce and/or its existence in cell is the human intervention result, for example, itself and endogenous RNA species or during the natural process of virus infection, the RNA species difference that in cell, is produced.

" RNAi induces carrier " is a kind of carrier, and it produces transcribing of one or more RNA in intracellular existence, and described RNA is hybridized each other or self hybridized to form the RNAi inductor such as siRNA or shRNA.In various embodiment of the present invention, plasmid or virus contained in described term, and it causes the generation of one or more RNA in intracellular existence, described RNA self hybridization or hybridize each other to form the RNAi inductor.Usually, carrier comprises the nucleic acid that can be operatively connected to expression signal, when being present in the cell with convenient carrier, transcribes one or more hybridization or self hybridization to form the RNA molecule of RNAi inductor.Therefore, carrier is provided for the interior synthetic template of cell of RNAi inductor.In order to induce RNAi, the genomic existence of intracellular virus constitutes the existence of intracellular virus.If carrier is introduced in the cell, carrier enters in the cell or carrier is to get from parental cell heredity, so no matter it is modified in cell subsequently still is processed, thinks that all carrier is present in the cell.If carrier comprises the template of the RNAi inductor that is used to transcribe the target transcript, think that so RNAi induces the described transcript of carrier target.Except that the transcript restraining effect in cell, described carrier has many other purposes.For example, it can be used in vitro producing the RNAi inductor, and/or is used for producing the RNAi inductor at the cell of the transcript that may contain or not contain carrier institute target.

" short interfering rna " comprises two strands (duplex) RNA, its length 15 and about 29 Nucleotide between or any other subrange or particular value in the interval between 15 and 29, for example, 16-18,17-19,21-23,24-27, a 27-29 nt length, and optionally comprise one or two strand overhang in addition, for example 3 ' overhang on one or two chain.In certain embodiments, duplex is that about 19 nt are long.Overhang can be (for example) 1-6 residue length, for example, and 2 nt.SiRNA can be formed by hybridization 2 RNA molecules together, perhaps, is produced by shRNA.In certain embodiments of the present invention, one or two end of 5 of siRNA ' end has phosphate, and in other embodiments, one or more ends of 5 ' end do not have phosphate.In certain embodiments of the present invention, one or two end of 3 ' end has hydroxyl, and in other embodiments, does not have hydroxyl.A chain that is known as the siRNA of " antisense strand " or " guiding chain " comprises the part of hybridizing with the target transcript.In some preferred embodiment of the present invention, zone 100% complementation of the antisense strand of siRNA and target transcript, that is to say, the hybridization of itself and target transcript and length 15 and about 29 nt between, preferred length is at least 16 nt, more preferably length is 18-20, for example none mispairing or protrusion in the target area scope of 19 nt.Complementary any subrange or the particular value of distinguishing in the interval that can be between 17 and 29, for example, 17-18,19-21,21-23,19-23,24-27,27-29.In other embodiments, antisense strand and target area are complementary in fact, that is to say, in by antisense strand and the formed duplex of target transcript, have one or more mispairing and/or protrusion.2 chains of siRNA are complementary, preferably 100% complementation each other in the duplex part in fact.

Term " bob folder formula RNA " is meant a kind of RNA molecule, it comprises at least 2 and maybe can hybridize to form the strand part of sufficiently long with the ring in the zone of the complementary portion of two strands (duplex) structure of mediate rna i (with described the same to the siRNA duplex) and the shRNA that at least one formation is connected to form duplex through hybridization.This structure is also referred to as stem/ring structure, and wherein stem is the duplex part.Described structure can be additionally contained in 5 ' or 3 ' end on overhang (for example, with described the same) to siRNA.Preferably, ring is about 1-20, more preferably from about 4-10 and most preferably from about long the and/or overhang of 6-9 nt be about 1-20, and more preferably from about 2-15 nt grows.5 of the target transcript complementary zone that ring can be positioned at and hope suppresses ' or 3 ' end (that is the antisense part of shRNA).In certain embodiments, overhang comprises one or more U residues, for example between 1 and 5 U.As hereinafter further as described in, utilize conservative cell RNA i machine that shRNA is processed into siRNA.Therefore, shRNA is the precursor of siRNA, and usually can suppress the expression with part (antisense strand or the guiding chain that are called shRNA) the complementary target transcript of shRNA equally.Usually, the feature class of formed duplex is similar to the feature of formed duplex between the guiding chain of siRNA and the target transcript between the antisense strand of shRNA and the target transcript.In certain embodiments of the present invention, 5 of shRNA ' end has phosphate, and does not have phosphate in other embodiments.In certain embodiments of the present invention, 3 of shRNA ' end has hydroxyl, and does not have hydroxyl in other embodiments.

As used herein, term " person under inspection " is meant the individuality of susceptible in the virus infection of for example influenza virus.This term comprises birds and animal, for example raises and train birds and animal (such as chicken, comprising the Mammals of pig, horse, dog, cat etc.) and wildlife, non-human primate, and human.

For purpose as herein described, if (1) the RNAi inductor comprises one and target transcript at least 80%, preferably at least about 85%, more preferably grow at least about 15 to reach at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary chain, more preferably at least about 17, still more preferably at least about 18 or 19 to about 21-23, or a section of 24-29 Nucleotide; And/or chain of (2) RNAi inductor and the hybridization of target transcript, think RNAi inductor " target " target transcript so.Suitably hybridization conditions is to see in the tenuigenin of mammalian cell or the nucleus usually and/or the condition in the molten born of the same parents' thing of fruit bat, for example, as the open case 20020086356 of the U.S. and 20040229266 and reference 21 and 28 described in.In certain embodiments of the present invention, just determine the RNAi inductor whether with regard to the target transcript, does not think to be mispairing by GU or UG base pair in antisense strand and the formed duplex of target transcript.Existence in cell causes that the RNA of generation of the RNAi inductor of target transcript induces carrier also to be considered to the target transcript.The RNAi inductor of target transcript also is considered to target guiding transcript synthetic gene.It is said that the RNAi inductor of expression that suppresses to relate to the target transcript of viral generation, virus replication, virus disease originality and/or virus infection suppresses virus.

" target part " is the zone with the target transcript of the antisense strand of RNAi inductor hybridization.

Term " target transcript " is meant any RNA into the target of RNAi.Messenger RNA(mRNA) is preferred target.Term " target RNA " and " target transcript " can alternately use in this article.

As used herein, " treatment " comprises reverse, slows down and/or suppresses the process of disease, illness or symptom that described term is suitable for, and/or reverses, slows down and/or suppress one or more symptoms or the performance of described disease, illness or symptom.

Term " carrier " is meant that can mediate second nucleic acid molecule enters (for example, transfer, transportation etc.) nucleic acid molecule in the cell.The nucleic acid that is shifted is connected in (for example, inserting) vector nucleic acid molecule usually.Carrier can comprise the spontaneous sequence of duplicating of guiding, maybe can comprise the sequence that is enough to allow to incorporate in the host cell DNA.Useful carrier comprises (for example) plasmid (although the RNA plasmid also is known, normally dna molecular), coemid (cosmid) and virus vector.As knowing in the affiliated field, the term virus vector can refer to comprise the transfer of common promotion nucleic acid molecule or the nucleic acid molecule (for example plasmid) (example comprises retrovirus or lentiviral vectors) of the viral derivative nucleic acids element incorporated into, or refers to mediate virus or the virion (example comprises retrovirus or slow virus) that nucleic acid shifts.Conspicuous as those skilled in the art institute, except that nucleic acid, virus vector also can comprise various virus compositions.

I. influenza virus life cycle and feature

Influenza virus is coating, the minus-stranded rna virus of orthomyxovirus section (Orthomyxoviridae family).It is classified as influenza A type, Type B and C type, and wherein the tool of influenza A is pathogenic and to be considered to be unique type that can experience with the reprovision of animal bacterial strain.Influenza A type, Type B and C type can be distinguished (referring to Fig. 1) by the difference of its nucleoprotein and stroma protein.Such as hereinafter further discussion, influenza A hypotype is that the variation by its homo agglutinin (HA) and neuraminidase (NA) gene defines and usually by distinguishing in conjunction with corresponding proteinic antibody.

The influenza A virus genome is by 10 kinds of genomic constitutions that are distributed in 8 RNA fragments.10 kinds of protein of described genes encoding: envelope glycoprotein cell agglutinin (HA) and neuraminidase (NA); Stroma protein (M1); Nucleoprotein (NP); 3 kinds of polysaccharases (PB1, PB2 and PA) are the components that is called the RNA dependent transcription enzyme of polysaccharase or polysaccharase mixture in this article again; Ionophorous protein matter (M2) and nonstructural proteins (NS1 and NS2).About influenza A virus and nosogenetic other details of its molecule, referring to Julkunen, I. waits the people, Cytokine andGrowth Factor Reviews, 12:171-180,2001.Also referring to Fields, B. waits the people, Fields ' Virology, the 4th edition, Philadelphia:Lippincott Williams and Wilkins; ISBN:0781718325,2001.Influenza B is virus genomic to organize the tissue that extremely is similar to influenza A, and influenza C viral genome contains 7 RNA fragments and do not have NA.

The influenza A virus classification is based on homo agglutinin (H1-H15) and neuraminidase (N1-N9) gene.The World Health Organization's nomenclature is described by the antigenicity of its animal host source (regulation is except that the mankind), geographic origin, bacterial strain quantity, separation time and HA and NA and is defined various virus strain.For example, A/ Puerto Rico/8/34 (H1N1) is called strains A, and strain isolated 8 is in 1934, results among the mankind in Puerto Rico, and has the antigenicity hypotype 1 of HA and NA.As another example, A/ chicken/Hong Kong/258/97 (H5N1) is called strains A, and strain isolated 258 is in 1997, results from the chicken in Hong Kong, and has the antigenicity hypotype 5 of HA and the antigenicity hypotype 1 of NA.Have the N1 type of H1 type, H2 type and H3 type and NA of HA and the virus of N2 type and caused human prevailing disease.

As mentioned above, in influenza virus A, by 2 kinds of main mechanism heritable variation takes place.Genetic drift (geneticdrift), take place by point mutation, because of the selection pressure from host immune response often betides the remarkable position of antigenicity, and genetic shift (genetic shift) (being also referred to as reprovision), the whole viral genome fragment that relates to a kind of hypotype is replaced by another hypotype.Many dissimilar animal species comprise the mankind, pig, birds, horse, aquatic mammalia and can be changed into other animal that infected by influenza A virus.Some influenza A virus are confined to specific species and do not infect different plant species usually.Yet some influenza A virus can infect some different animals species, are mainly birds, pig and the mankind.Described ability is considered to cause the reason that major antigen changes in the influenza A virus.For example, suppose that pig becomes through infecting from the mankind's influenza A virus and becoming simultaneously through the different influenza A virus infectiones from duck.When 2 kinds of different virus were bred in pig cell, the gene of human bacterial strain and duck bacterial strain can " mix ", produced the new virus with the segmental unique combination of RNA.Described process is called genetic resortment.

As other virus, influenza virus is in time multiplexed cell system.Influenza A virus duplicates in the epithelial cell of respiratory tract.Yet monocyte/macrophage and other white corpuscles also can be infected.Many have other cell type susceptibles of containing the sialic cell surface glycoprotein of taking on virus receptor in vitro infecting.

Influenza A infection/replicative cycle is depicted schematically among Fig. 1.As shown in Figure 1A, influenza A virus particle 100 comprises genome 101, and genome 101 is made up of 8 strand RNA fragments: PB2 (102), PB1 (103), PA (104), HA (105), NP (106), NA (107), M (108) and NS (109).From 1 to 8 number PB2=1, PB1=2, PA=3, HA=4, NP=5, NA=6, M=7 and NS=8 by convention.The geneome RNA fragment is packaged in the layer inside of membrane protein M1 120, is double-layer of lipoid 130 around the membrane protein M1 120, and extracellular domain and the ionic channel M2 160 of envelope glycoprotein HA 140 and NA 150 highlight from double-layer of lipoid 130.RNA fragment 102-108 is by nucleoprotein MP 170 coverings and contain the varial polymerases mixture of being made up of polysaccharase PB1, PB2 and PA 180.In virus particle, also find nonstructural proteins NS2 190.In infected cell, find nonstructural proteins NS1 (not shown).

Figure 1B shows influenza virus and the genome structure (not drawn on scale) of the transcript that produces from the influenza genome.6 (PB1 (102), PB2 (103), PA (104), HA (105), NP (106) and NA (107)) in 8 geneome RNA fragments serve as separately and are used to encode corresponding proteinic single, the template of montage transcript not.3 kinds of mRNA transcripts have been identified as and have derived from influenza virus A fragment M (108): coding M ₁ Proteinic collinearity transcript 191, coding M ₂Protein and contain 689 Nucleotide introns through montage mRNA 192 and have coding also not at detected nine amino acid peptide (M in the cell of virus infection ₃) the another kind of ability through montage mRNA193.2 kinds of mRNA transcripts are to derive from influenza virus A fragment NS: coding NS ₁Proteinic not montage mRNA 194 and coding NS ₂Protein and comprise 473 Nucleotide introns through montage mRNA 195.

When virus particle 100 is connected to permissive cell surperficial by its homo agglutinin, infectious cycle (Fig. 2) beginning.Virus through connecting by clathrin (clathrin) dependency endocytosis and endocytosis in coated film bubble 200.Low pH value in the endosome triggers the fusion of viromembrane and endosome film, causes that viral ribonucleoprotein (vRNP) mixture (nucleocapsid) 210 is discharged in the tenuigenin.Virus nucleocapsid is introduced in the nucleus, and thereafter, it is synthetic that the viral rna polymerase mixture of being made up of PB1, PB2 and PA polysaccharase causes elementary virus mRNA.It is synthetic as the virus mRNA of template that the primer that upward produces at host cell precursor mRNA (pre-mRNA) by the proteinic endonuclease activity of PB2 is used for causing use viral RNA (vRNA) 220.PB1 protein catalysis virus-specific mRNA's 230 is synthetic, and mRNA 230 is transported in the tenuigenin and is translated.

New synthetic polysaccharase is transported in the nuclear and regulates duplicate with secondary virus mRNA synthetic.PB1, PB2, PA and NP cause from viral RNA (vRNA) synthesize complementary rna (cRNA) 240, thereafter, and synthetic new vRNA molecule 250.The varial polymerases mixture uses described vRNA to synthesize secondary mRNA 260 as template.Therefore, the vRNA that is undertaken by the transcriptase through encoding viral transcribes the mRNA that generation is used as virus protein synthetic template, and also produces the complementary RNA (cRNA) as the template of synthesizing the vRNA that is used for the neovirion generation in addition.Virus mRNA is transported in the tenuigenin, in tenuigenin, produces virus structural protein matter 270.Protein PB1, PB2, PA and NP are transported in the nuclear, promptly assemble the site of vRNP mixture (nucleocapsid) 280.Virion sprout and release occurs in the plasma membrane place.

Influenza A virus is quick copy in cell, causes host cell because of cytolysis or apoptosis death.Infection causes the cytoactive of broad variety and comprises the change of the method that suppresses the host cell gene expression.New synthetic cell aggregation enzyme II transcript in combination of varial polymerases mixture and the segmentation nucleus.The nuclear output of blocking-up cell precursors mRNA montage of NS1 protein and inhibition host mRNA.The translation of cell mRNA is suppressed greatly, and virus mRNA is effectively translated.Keeping on the part of effective translation of virus mRNA is that virus downward modulation by cell Interferon, rabbit (IFN) reaction realizes, described cell ifn response is a kind ofly to work the host response that suppresses translation effect usually in the cell of virus infection.Specifically, virus N S1 protein bound is through IFN inductive PKR and suppress its activity.Therefore, obviously, influenza infection causes the cell biological synthetic to change deeply, comprises the processing of cell mRNA and the change of translation.

II.RNAi induces selection, the design and synthetic of entity

A.RNAi induces the selection and the design of entity

The RNAi that the invention provides one or more influenza virus transcripts of target induces entity.Various viral RNA transcripts (primary and secondary vRNA, primary and secondary virus mRNA and viral cRNA) exist in the cell of influenza infection and are playing an important role in viral life cycle.Any transcript in the described transcript is to be used for mediating the suitable target that suppresses by the RNAi that direct or indirect mechanism according to the present invention realizes.The preferred RNAi of any virus mRNA transcript of target induces entity for example to reduce the content of transcript self specifically by the degraded that causes transcript with direct mode.In addition, the RNAi inductor of some influenza virus transcript of target (for example NP, PA, PB1) will cause the content reduction of the influenza virus transcript that is not its special target indirectly.

The virus transcription that can serve as according to the target of the therapy based on RNAi of the present invention originally comprises (for example), 1) any influenza virus gene group fragment; 2) transcript of any virus protein of coding comprises the transcript of coded protein PB1, PB2, PA, NP, NS1, NS2, M1, M2, HA or NA.Although it is the data of the unique or main target of RNAi that the present inventor has obtained to hint virus mRNA, vRNA, cRNA and/or the mRNA form of single RNAi inductor possibility target transcript.In special preferred embodiment, target transcript encoding influenza virus protein N P, PA, PB1 or PB2.

The general feature of RNAi inductor is known in affiliated field.RNA disturbs and to be identified as the existence of long dsRNA (hundreds of nt usually) in cell at first and to cause the phenomenon (the 6th, 506, No. 559 United States Patent (USP)s) that contains with the sequence-specific degraded of the mRNA in the chain complementary zone of dsRNA.With described in No. 20030108923 open case of the U.S., siRNA at first is found in the RNAi research in fruit bat as WO01/75164 and No. 20020086356.Specifically, it is found that, in fruit bat, long dsRNA is called the enzyme that the is similar to RNase III (people such as Bernstein of Dicer, Nature 409:363,2001) be processed into the littler dsRNA that forms by 2 21nt chains, each bar all has 5 ' phosphate and 3 ' hydroxyl, and comprise district, so that there is the double-stranded tagma of the 19nt of side joint 2nt 3 ' overhang with the accurate complementary 19nt of another chain.Fig. 3 is presented at the synoptic diagram of the siRNA that finds in the fruit bat.Structure comprises 19 nucleotide double (DS) part 300, and it comprises sense strand 310 and antisense strand 315.Each bar chain has 2nt 3 ' overhang 320.

Described short dsRNA (siRNA) works to suppress any expression of gene that comprises with one of dsRNA chain complementary zone, estimation may be because the helicase activity is untied 19bp duplex among the siRNA, makes the another kind of duplex of formation between the chain (" antisense " or " guiding " chain) of siRNA and target transcript.Antisense strand is merged in the endonuclease enzyme complex, promptly among the RISC, and points to complementary target RNA.Enzymatic activity is present in the single position in the RISC sliver (" section "), produces the not shielded RNA end (Fig. 4) of degrading rapidly by the cell machine.As mentioned below, by the other inhibition mechanism of short rna species (microRNA) mediations also be known (referring to, for example, Ruvkun, G., Science, 294,797-799,2001; Zeng, Y. waits the people, Molecular Cell, 9,1-20,2002).Should be appreciated that, the argumentation of mechanism and the figure that describes mechanism are intended to hint to being used for any restriction of RNA interference mechanism of the present invention.

Homologue (Sharp, the Genes Dev.15 of Dicer enzyme have been found in the mankind's the various species nematode (C.elegans); 485,2001; Zamore, Nat.Struct.Biol.8:746,2001), thus improved following possibility: the mechanism that is similar to RNAi perhaps can suppress to comprise Mammals or even human cell's various different cell types in genetic expression.Yet known long dsRNA (dsRNA that for example, has the double stranded region longer than about 30-50 Nucleotide) activates the ifn response in the mammalian cell.Therefore, suppress, wish that more the existence of long dsRNA in mammalian cell causes the non-specific inhibition to translation that is mediated by Interferon, rabbit, and may cause necrocytosis compared with reaching with the viewed specific gene of fruit bat RNAi mechanism.Therefore do not think that long dsRNA is applicable to the expression that suppresses specific gene in the mammalian cell.

Yet when present inventor and other people had been found that in introducing mammalian cell, siRNA can effectively reduce the target expression of gene that comprises virogene.The present inventor has been found that, in being included in siRNA or shRNA and by hereinafter and coexist the application in patent application case U.S.S.N.10/674, when testing described in 159, use the sequence of first group of selected suitable vast scale of design variable as herein described to be proved to be effectively to suppress sequence., show powerful effect and effectively suppress virus to produce in the cell of the PR8 of influenza virus or WSN strain infection from about 15% siRNA of initial designs group (example 1); About 40% shows significantly effect (that is, in the cell that infects with PR8 and/or in the cell that infects with WSN, existing siRNA not exist the virus of siRNA to have statistically-significant difference (p＜0.05) between producing relatively); About 45% does not show or shows minimum effect.

Specifically, the RNA of the gene of target coding RNA RNA-dependent transcriptase and NP significantly is reduced in the content (example 2,4,5,6) of the virus that is produced in the infected mammalian cell.The present inventor is also verified, and the in vivo influenza virus that the siRNA of target influenza virus transcript can suppress in the complete organism (promptly being subjected to the chicken embryo of influenza infection) is duplicated (example 3).In addition, the present inventor is verified, the siRNA of target influenza virus transcript when before or after virus infection, throw and the time, the virus that can suppress in the mouse produces (example 12,14,16,23-26 etc.).In addition, the present inventor is verified, throws with the dna vector that can be used for siRNA precursor (shRNA) expression and has suppressed the influenza virus generation in the mouse.Use second group of other effective RNAi inductor of standard design, comprise when test suppresses the ability of influenza virus generation in cell and/or mouse, being highly effective many siRNA.Therefore, the present invention proves, uses the RNAi medicament such as siRNA, shRNA, or is used in existence in the cell and causes that the carrier of the expression of described medicament treats, and is to suppress for example infection of the Respirovirus of influenza virus and/or the available strategy of duplicating.Test 2 kinds of highly effectively siRNA at the HPAI (High Pathogenic AI) virus strain subsequently, and show restraining effect, confirm that described siRNA suppresses the ability (Tompkins of the strains of influenza viruses of broad range viral pearl, Deng the people, Proc.Natl.Acad.Sci., 101 (23): 8682-6,2004).Therefore, the invention provides the RNAi inductor that in the cell that any virus strain through multiple different strains of influenza viruses infects, suppresses the virus generation.

Though do not wish to be bound by any theory, present inventor's suggestion, in view of the deep change in the cytoactive such as for example metabolism and biosynthesizing activity etc. that takes place behind influenza infection, described discovery is especially meaningful.Influenza infection suppresses such as elementary cell processes such as cell mRNA montage, transportation and translations, and causes the inhibition of pair cell protein synthesis.No matter described change how, the RNAi inductor of target influenza virus transcript suppresses the discovery hint of virus replication, and the potential cell mechanism that the genetic expression that RNAi mediated suppresses continues to work in by the cell of influenza infection with the level that is enough to suppress influenza genetic expression.

Concerning any selected specific gene target, some criterion will be preferably followed in the design of RNAi inductor used according to the invention.Usually, expectation target sequence is specific (comparing with the host) to virus, and is important or basic to viral function preferably.Therefore, expectation avoids the target transcript not wish the common part of transcript of degrading with other.But the implementation data library searching is determined arbitrary chain and whether will be delivered to its organism (for example, the mankind any sequence complementation in) the genome, and therefore can avoid such sequence in fact with medicament.As described herein, be that conservative virus transcription part originally is preferred target between multiple varient.

Preferred RNAi inductor used according to the invention be included in 15 and about 29 nt between the base pair district of long (for example length is about 19 nt), and can optionally have one or more free end or Cheng Huanduan.Fig. 5 presents the various structures that can be used as the RNAi inductor according to the present invention.Fig. 5 A show to find in above-mentioned fruit bat system and is active structures in the mammalian cell.The present invention is contained the siRNA throwing that will have structure shown in Fig. 5 A and is infected with treatment or flu-prevention with mammalian cell.Yet, do not need throw and medicament to have described structure.For example, throw and composition can comprise any structure that can be processed into Fig. 5 A structure in vivo, if institute throws and medicament do not cause such as not expecting or harmful incident that inducing interferon reacts.The present invention also can comprise the medicament of throwing and accurately not being processed into structure shown in Fig. 5 A, needs only the throwing of described medicament and fully reduces this content of virus transcription as discussed in this article.In some cases, the medicament that is delivered to according to the present invention in the cell may experience one or more procedure of processing (further discuss and vide infra) before becoming activity inhibitor; Under described situation, it will be understood by one of ordinary skill in the art that related agents is preferably designed to comprise it may being that it processes necessary sequence.

Fig. 5 B and 5C represent can be used for the other structure of mediate rna i.Described hair clip formula (stem-ring) structure can directly play the siRNA structure that inhibitory RNA maybe can produce structure described in Fig. 5 A through processing (for example, passing through Dicer) in the cell.Fig. 5 B shows the medicament that comprises the RNA molecule, and described RNA molecule contains 2 complementary districts, and these 2 complementary district hybridization each other form the double-stranded tagma, ring 410 and the overhang 320 that are expressed as stem 400.It is said that described molecule is self hybridization, and the structure of described classification is called shRNA.For the example of shRNA structure, also referring to Figure 20 and 21.Fig. 5 C shows the medicament that comprises the RNA annulus, and described RNA annulus comprises the complementary elements that is enough to form the long stem 400 of about 19 bp.Compare with various other siRNA as herein described, described medicament can show the stability of improvement.

In RNAi inductor and its active description,, often easily medicament is considered as having 2 chains as under the situation of siRNA.Usually, the sequence of the duplex of the RNAi inductor chain part and target transcript are complementary in fact in described zone.The sequence of the duplex part of another chain of RNAi inductor is identical in fact with institute's targeting moiety of target transcript usually.Comprise with target complementary chain partly and be called " antisense strand ", and another chain often is called " sense strand ".Can be called " inhibitory area " with target complementary antisense strand part.

Can think that the duplex structure of shRNA comprises antisense strand and sense strand, wherein antisense strand is the first part that forms duplex with the second section of molecule or can form the molecule of duplex with the second section of molecule, and with institute's targeting moiety complementation of target transcript.Sense strand is the part that forms duplex with first part or can form the molecule of duplex with first part.It will be understood by one of ordinary skill in the art that target will be antisense from " antisense strand " of the vRNA chain of minus-stranded rna virus concerning vRNA, and be " sense strand " with respect to viral cRNA.Similarly, target will be antisense from " antisense strand " of the cRNA chain of minus-stranded rna virus concerning cRNA, and be " sense strand " with respect to the vRNA sequence.

For being described, below discussing and often be meant siRNA.Yet if those skilled in the art institute is apparent, the teaching relevant with 2 chains of siRNA generally be applicable to, for example can be through processing in the cell and the sense strand and the antisense strand of the stem portion of any RNAi inductor of the corresponding shRNA of generation siRNA.Therefore, usually discussion hereinafter also be applicable to RNAi inductor of the present invention design, select and send, for example, produce the shRNA of the RNA that division of mediation target or translation suppress through processing in the cell.

Usually, preferred siRNA antisense strand and the hybridization of target site, described target site comprises or is made up of the exon sequence in the target transcript.In certain embodiments of the present invention, antisense strand and 5 ' or 3 ' non-translational region hybridization.Usually, can utilize any site that can be used for producing cut-out and the degraded and/or the translation inhibition of transcript with antisense strand hybridization.

Can select the RNAi inductor according to the whole bag of tricks.Usually, as mentioned above, RNAi inductor of the present invention preferably includes a zone (described " double-stranded tagma "), a chain wherein contains and the enough inhibitory area of complementary length between 15-29 nt of the part (" target part ") of target transcript, so that can in vivo form hybridization between described chain and target transcript.Should be appreciated that described double-stranded tagma-be called " core area "-not again comprises overhang.If there is overhang, overhang can (but needn't) and the complementation of target transcript so.Preferably, described double-stranded tagma comprises great majority or all duplex structures described in Fig. 3,4 and 5.

Preferably, the inhibitory area is 100% to be complementary to target.Yet, those skilled in the art will realize that mispairing and protrude can be present in the duplex that forms by antisense strand and target.Therefore, the inhibitory area only need be enough complementary with target, so that (for example) under physiological condition, can hybridize in cell and/or in the ex vivo system that RNAi is provided such as above-mentioned fruit bat extract system.Preferably, inhibitory area and target at least 70%, more preferably at least 80%, more preferably at least 90% and most preferably 100% is complimentary to one another.Preferably, in described zone, be less than antisense strand residue interior and target mispairing of 6 residues or about 20% (for example 1,2,3,4) in the window ranges of 15-29 nt (for example, 19 nt).Preferably, in described zone, be less than the antisense strand residue and the target mispairing of 4 residues or about 15%.Preferably, only there are 1 or 2 mispairing.In the mispairing one or more (or owning) mispairing can be the U-G mispairing.For example, long if the inhibitory area is 15-16 nt, can there be 0-3 mispairing so; If it is long that the inhibitory area is 17 nt, can there be 0-4 mispairing so; If it is long that the inhibitory area is 18 nt, can there be 0-5 mispairing so; If it is long that the inhibitory area is 19 nt, can there be 0-6 mispairing so.Each other nt increases the upper limit of a nt up to RNAi inductor inhibitory area, the length of for example about 30 nt to admissible mispairing number in the inhibitory area by being present in.In certain embodiments, mispairing is not on the continuous position.In certain embodiments, be not longer than the misfit segments of 2 nt length.In a preferred embodiment, the evaluation window of 15-19 nt contains 0-1 mispairing (being preferably 0), and the evaluation window of 20-29 nt contains 0-2 mispairing (being preferably 0-1, more preferably 0).The those skilled in the art it should be understood that is protruded the not paired nt that the duplex structure of interrupting can allow bigger quantity usually.The those skilled in the art also it should be understood that the mispairing that can preferably avoid in antisense strand/target RNA duplex centre portions (referring to, for example, people such as Elbashir, EMBO J. 20:6877,2001).For example, the specificity distinguished of the usually not obvious promotion target of 3 ' Nucleotide of the antisense strand of siRNA and not most important for the target division.In certain embodiments, antisense strand and target are in the 10 places complementation of the position of antisense strand inhibitory area.In other embodiments, they are not complementary.

Some RNAi inductor contains the chain with the hybridization of target site, and described target site comprises or is made up of 3 ' UTR sequence fully.It will be understood by one of ordinary skill in the art that the gained duplex can allow the mispairing and/or the protrusion of larger amt, the particularly mispairing in the duplex central section, still produce effectively simultaneously and suppress.For example, one or two chains can comprise that one or more form " extra (extra) " Nucleotide of protrusion as shown in Figure 6.Can there be the long one or more protrusion of (for example) 5-10 nt.Usually, complete at least 5 nt of length of complementary section, the nt more than 6,7 or 7 for example, and that the mispairing district for example can be 1,2,3 or 4 nt is long.Duplex often comprises 2 complete complementary sections that distinguished by mispairing.Various structures are all possible.For example, can there be a plurality of mispairing district.

Some mispairing may be needed, may suppress by the coded protein expression of transcript because form at 3 ' UTR or the duplex in other positions, and the mechanism of described inhibition is relevant but different with the division of the sign that suppresses as classical RNA.As shown in Figure 6, the known Dicer enzyme that produces siRNA in above-mentioned fruit bat system and in various organisms also is processed into inhibitor with little, of short duration RNA (stRNA) substrate, described inhibitor is in the 3 ' UTR that is attached to the target transcript time, the translation of blocking-up transcript is (referring to Grishok, A. wait the people, Cell 106,23-24,2001; Hutvagner, people such as G., Science, 293,834-838,2001; Ketting, people such as R., Genes Dev., 15,2654-2659).Discovery subsequently shows, is called short (about 19-25 Nucleotide) RNA of a class of microRNA (miRNA), the translation of described microRNA inhibition and its part complementary endogenous mRNA nematode to the genome encoding of mammiferous organism.At Barrel, DP., Cell, 116 (2): 281-97,2004; Novina, C. and Sharp, PA, Nature, 430:161-164,2004; With in No. the 20050059005th, the U.S. open case microRNA has been discussed.MiRNA in the complementary site of part in conjunction with target mRNA transcript and stop its translation.The mode that RNAi inductor with structure (Za Jiao 2 indivedual short chains each other) of siRNA can be similar to miRNA works, that is to say, translation by reducing transcript rather than reduce its stability work (Doench, people Genes ﹠amp such as JG; Development, 17:438-442,2003).It is believed that described siRNA produces single stranded RNA through processing in the cell, described single stranded RNA suppresses the path by the miRNA translation and works.For the purposes of the present disclosure,, a chain combination target transcript and reduce its expression (promptly, reduce the content of transcript and/or reduce synthetic by the transcript encoded polypeptide) any part as herein described or complete double-stranded short rna, be considered to the RNAi inductor, and no matter it is by triggering degraded, suppressing to translate or work by other modes.In addition, any precursor RNA structure that can produce described RNAi inductor through processing (that is, in cell or organism) in vivo is applicable among the present invention.

In some cases, select the sequence of RNAi inductor so that whole antisense strand (comprising (if existence) 3 ' overhang) is complementary fully with the target transcript.Yet overhang is also nonessential complementary or identical with the target transcript.Any desired sequence (for example UU) can be additional to antisense simply and/or 3 of adopted core area ' end be arranged to produce 3 ' overhang.Usually, use and contain one or more pyrimidines, be generally the overhang of U, T or dT.When synthetic RNAi inductor, can in overhang, use T rather than U more easily.Use dT rather than T can increase stability.

Preferably, the chain of RNAi inductor 100% complementation each other in core area.Yet the those skilled in the art it should be understood that in by antisense strand and the formed duplex of sense strand can exist mispairing and protrusion.Chain only needs each other enough complementary, so that (for example) under physiological condition, can hybridize in cell and/or in the ex vivo system that RNAi is provided such as above-mentioned fruit bat extract system.Preferably, 2 chains of RNAi inductor are complementary in fact in core area, for example in core area, and at least 70%, more preferably at least 80%, more preferably at least 90% and most preferably 100% is complimentary to one another.For example, 15-16 the long core area of nt can contain 0-3 mispairing; 17 long core areas of nt can contain 0-4 mispairing; 18 nt long core area can contain 0-5 mispairing; 19 long core areas of nt can contain 0-6 mispairing.Each other nt increases the upper limit of a nt up to RNAi inductor inhibitory area, the length of for example about 30 nt to admissible mispairing number in the inhibitory area by being present in.In a preferred embodiment, the core area of 15-19 nt contains 0-1 mispairing (being preferably 0), and the core area of 20-29 nt contains 0-2 mispairing (being preferably 0-1, more preferably 0).The those skilled in the art it should be understood that is protruded the not paired nt that the duplex structure of interrupting can allow bigger quantity usually.

In a word, the RNAi inductor can design by selecting target part and designated rna i inductor, described RNAi inductor comprises: sequence enough complementary with the antisense strand of target hybridization, for example, at 15-29 Nucleotide, for example complementary in fact or 100% complementation in 19 Nucleotide scopes with the target transcript; Sequence enough complementary with the sense strand of antisense strand hybridization, for example complementary in fact or preferred 100% complementation with antisense strand.3 ' overhang such as above-mentioned overhang can be added to then in the described sequence to produce the siRNA structure.

It will be understood by one of ordinary skill in the art that the temperature of fusion (Tm) that can represent certain limit such as the RNAi inductor of siRNA according to mentioned above principle.It is residing temperature in being the duplex of solution state the time that Tm is defined as 50% nucleic acid and its complete complement.Based on the siRNA sequence that discloses in this paper example, the method for knowing in the field under using, experimental ground or use be empirical or theoretical derived equation suitably, can determine to generally acknowledge the representative example of Tm easily.In certain embodiments of the present invention, Tm calculated value by antisense strand and the formed duplex of target transcript, than will target and have and the antisense strand of the complete complementary of target inhibitory area between the Tm calculated value of formed duplex, be low to moderate many 5 ℃, be low to moderate many 10 ℃ or be low to moderate many 15 ℃.In certain embodiments of the present invention, by the antisense strand of RNAi inductor and the Tm calculated value of the formed duplex of sense strand, than will be at antisense strand and the complete Tm calculated value of formed duplex between the sense strand of complementary (optionally getting rid of overhang), be low to moderate many 5 ℃, be low to moderate many 10 ℃ or be low to moderate many 15 ℃.

The those skilled in the art can calculate the Tm value.Several studies has been used the thermodynamics base group that is used for nearest neighbo(u)r interaction, has derived the accurate equation that is used for Tm.The thermodynamical coordinate value can obtain in the literature.For RNA, referring to Freier, S.M. waits the people, Proc.Natl.Acad.Sci.83,9373-9377,1986.Rychlik, W. waits the people, Nucl.Acids Res.18 (21), 6409-6412,1990.Preferably, use Walter, A.E., Proc.Natl.Acad.Sci, 91,9218-9222, nearer value and method in 1994, or more preferably, use Mathews, DH, J.Mol.Biol, 288,911-940, described value and method in 1999.The computer program that is used to calculate Tm is widely available.Referring to, for example, network address URL Www.basic.nwu.edu/biotools/oligocalc.htmlPreferably, be used to calculate the program such as the correlation parameter of AG and Tm, this program can be at URL Www.bioinfo.rpi.edu/applications/mfoldThe mfold webserver on obtain, as Zuker, M., Nucl.Acids.Res., 31 (13), described in 2003.

One aspect of the present invention is when (being commonly referred to as varient) such as the multiple bacterial strain of distinguishing infectious agent, hypotypes exists, whose genome changes in sequence, often needs to select and/or design the RNAi inductor in the zone of target high conservative between different variants.By sequence that compares sufficient amount and the zone of selecting high conservative, may use the multiple varient of single RNAi inductor target in the zone of the described high conservative of target, for example, the antisense strand of described RNAi inductor is complementary in fact with the zone of high conservative in the scope of sufficient length, so that RNAi inductor mediate rna i.According to some embodiment of the present invention,, claim this zone high conservative between these varients so between multiple varient if a zone is identical.According to some embodiment of the present invention, if by the zone of RNAi inductor institute target, for example 15-29 Nucleotide, the zone of preferred 19 Nucleotide, differing maximum Nucleotide (that is, at 0 or 1 nucleotide position place) between varient, is exactly high conservative so.According to some embodiment of the present invention, if a zone differs maximum 2 Nucleotide (that is, at 0,1 or 2 nucleotide position places) between varient, so described zone is a high conservative between multiple varient.According to some embodiment of the present invention, if a zone differs maximum 3 Nucleotide (that is, at 0,1,2 or 3 nucleotide position places), so described zone high conservative between multiple varient between varient.According to some embodiment of the present invention, the zone of high conservative between the varient of RNAi inductor target at least 5,10,15,20,25,30,40, more than 50 kind or 50 kinds.

For being identified in the zone of high conservative between one group of multiple varient, can be used in down program.A member in the selection sequence set that is to say the sequence that other sequences will compare with it as basic sequence.Different embodiment according to the subject invention, basic sequence can be one of sequence in the group that is compared, perhaps can be the concensus sequence that the sequence from group obtains, for example, obtain by the most common Nucleotide in described position among the sequence in determining to organize for each position.

Selected after the basic sequence, relatively each member's of multiple varient group sequence and basic sequence.Between any member of basic sequence and multiple varient group at sequence area (15-29 Nucleotide for example, zone such as 19 Nucleotide) the difference number in the scope is used to determine that the specific region paid close attention to is at basic sequence and high conservative whether just and between group membership of its comparison.As mentioned above, in various embodiment of the present invention, if between 2 zones, the positional number that sequence is different is 0; 0 or 1; 0,1 or 2; Or 0,1,2 or 3, think that so described zone is a high conservative.Can select the antisense sequences of RNAi inductor to have 15-29 Nucleotide with leap, for example high conservative region of 19 Nucleotide and basic sequence complementation maybe can be selected to cross over the complementation of one of high conservative region and other sequences.Usually, select the sense strand sequence identical with one of basic sequence or other sequences, so that 100% complementation each other in the duplex part of RNAi inductor of antisense strand and sense strand to cross over high conservative region.

Usually, select the antisense strand sequence about basic sequence as indicated above.Yet, in certain embodiments of the present invention, if particularly be present in the Nucleotide of the specific location in second sequence in the group that is comparing, in the sequence that is comparing, more to more and see than the corresponding localized Nucleotide in basic sequence, can select antisense strand sequence (for example, with high conservative region 100% complementation that is present in second sequence) about second sequence so.In addition, according to some embodiment of the present invention, if the described Nucleotide that the consistent Nucleotide (Nucleotide of normal existence) in the position that there are differences is different from basic sequence to be found can use consistent Nucleotide so.Note, this measure may produce with any sequence of the sequence that is comparing different sequence (because of using concensus sequence) as basic sequence.

Example 1 is described based on the comparison from the sequence set of 6 kinds of influenza A bacterial strains with human host source, with comparison from the sequence set of 7 kinds of influenza A bacterial strains with different animals host source (comprising the mankind), select the target part of high conservative, and the siRNA sequence of the described part of design target.Can use the different methods of selecting high conservative region.The RNAi inductor is contained in the present invention, and its duplex part (with any overhang optionally) is based on the zone of the high conservative that the standard that provides is provided herein and selects, and selects the zone of high conservative howsoever.Should be appreciated that also the present invention is contained target and do not satisfied RNAi inductor for the influenza virus transcript part of the standard in preferred target as herein described district.For example, target high conservative or suitably conservative target RNAi inductor partly may not remain effective inhibitor that influenza virus produces for some bacterial strain.Not too effectively RNAi induces entity also can be used to assess the target specificity, and the determinative of identification RNAi effect is improved RNAi design etc.

Table 1A lists 21 Nucleotide zones, and it is conservative at segmental each the segmental influenza virus sequence set camber of virogene.Each listed sequence comprises 19nt zone (nt3-21) among the table 1A; With initial 2nt sequence, its in the sense strand of corresponding siRNA, do not exist but with 3 ' overhang complementation of the antisense strand of siRNA.Should be appreciated that the 19nt zone can be used as sense strand, with design various at sense strand and antisense strand arbitrary chain or have the siRNA molecule of different 3 ' overhangs among both.Therefore, can from table 1A, each listed sequence obtain various have justice and antisense siRNA sequences.List 20 kinds of such siRNA sequences in the table 2.

Table 1B lists based on the designed other siRNA of the high conservative region of influenza virus.Article two, chain with 5 ' show to 3 ' direction.DTdT 3 ' overhang is additional on each bar chain.Nucleotide 1 to 19 in each sequence of the sense strand sequence of listing among the table 1B has the sequence identical with the high conservative region of influenza virus transcript.Corresponding antisense sequences and sense strand complementation.In certain embodiments of the present invention, " high conservative region " is meant the nt 3-21 in any sequence in the listed sequence among the table 1A, or the nt 1-19 in any sense strand of listed sense strand among the table 1B.Described zone is present in some RNAi inductor of the present invention with double chain form, so that the part of the antisense strand target high conservative of medicament.The sequence in described zone is called " highly conserved sequence " or " the target part of high conservative ".

The selection of the target part of high conservative is to design a kind of method that the RNAi that will successfully suppress multiple different strains of influenza viruses induces entity.Yet, the present invention also provides the replacement method of selecting preferred target part, described preferred target partly is suitably conservative, so that the RNAi inductor that improves target target part suppresses the possibility of the expression of target transcript in a plurality of different strains, the sequence of described different strains in the target part is different.According to the present invention, if target partly is suitably conservative, antisense strand comprises the RNAi inductor with the target part 100% complementary inhibitory area found in one or more bacterial strains (for example PR8) so, preferably suppress to be present in the expression of the corresponding transcript in one or more other bacterial strains, in described other bacterial strains, the inhibitory area of corresponding target part and antisense strand is less than 100% complementation.

The invention provides the suitably various RNAi inductors of conservative part of target influenza A virus transcript, wherein the method according to this invention is selected suitably conservative target part.In certain embodiments of the present invention, target crosses over partly that to separate a plurality of influenza A virus strains obtain from the mankind be suitably conservative.In certain embodiments of the present invention, described part leap is suitably to guard from a plurality of influenza A virus strains that the animal separation beyond the mankind of for example bird obtains.In certain embodiments of the present invention, described part is crossed over from the mankind and is separated a plurality of influenza A virus strains that obtain and cross over that to separate a plurality of influenza A virus strains that obtain from the non-human animal of for example bird be suitably conservative.For example, described part may be at least 5,10,15, have more than 20 kind or 20 kinds between the varient of the mankind and/or animal-origin suitably conservative.In certain embodiments of the present invention, target partly is suitably conservative and high conservative.

Concerning any viral target, suitably conservative target part can be discerned by the following method: at first will be from the transcript sequence alignment of multiple varient, and with itself and selected basic sequence relatively with Recognition Different, that is different position in the identity of Nucleotide and the basic sequence in one or more sequences in the described sequence.The character of assessment difference determines whether this difference is remarkable.Compared and compare when selecting the sequence set of conserved regions when discussing, " difference " be meant in one or more sequences in the sequence with basic sequence different position, and regardless of there being how many sequences different with basic sequence.Can select basic sequence in every way.For example, can select a sequence by easy-to-use bacterial strain from the height popular or under the assembling of laboratory easily.

When in the varient in the comparative group during existing corresponding target part, suitably conservative target partly satisfies following standard: (1) allows basic sequence is that G or C are the difference of U in any position with A between the corresponding sequence; (2) only to allow basic sequences be that A or C are the difference of A with G between the corresponding sequence to one or more positions in position 1,18 and 19; (3) between position 1 and 9, between basic sequence and corresponding sequence, there is 0,1,2 or 3 difference; (4) between basic sequence and corresponding sequence, exist and be no more than 2 continuous differences; With, between basic sequence and corresponding sequence, there are maximum 1 difference in (5) between position 11 and 17.Can select any bacterial strain as basic bacterial strain.Preferably, more at least 5 kinds of varients are discerned suitably conservative target part.

The round-robin influenza virus obtains to infect human ability sometimes in bird and/or other animal hosts.May be that such bacterial strain usually causes high mortality owing to lack immunizing power among the mankind on the part.Example comprise pandemic disease in 1918 and in Hong Kong (1997) and Vietnam (2004), because of the human death that causes is infected in bird flu.The concern that propagates into the possibility among the human colony about the bacterial strain with bird or other animal hosts source increases day by day, and existing vaccine can not protect the mankind to avoid avian influenza virus or swine influenza virus to infect.The present invention discerns and crosses over a plurality of target parts of separating the bacterial strains (human derivative strain) that obtain and separating suitably guarding of the bacterial strain (avian derived bacterial strain) that obtains and/or high conservative at first from the non-human animal of for example bird from the mankind at first, and the described target of target RNAi inductor partly is provided.Described RNAi inductor can provide protection to resist multiple strains of influenza viruses, comprises human derivative strain and the bacterial strain that obtains from non-human animal host.

Example 17 is described, and is the identification of the influenza transcript target part of suitably conservative target for RNAi.The first step is all possible 19 Nucleotide influenza virus target parts of identification.Considering to list each 19 Nucleotide that is found in PR8 or the another kind of strains of influenza viruses listed among table 15A-15H or the table 19A-19F herein may target sequence partly, just not specifically statement.By with reference to the influenza virus fragments sequence among the figure 32A-32J, can easily discern described sequence.

Next step is the preferred function target part of identification RNAi, that is, the RNAi inductor that the sequence signature hint has the antisense strand of hybridizing with target will effectively suppress the zone of the gene of its expression.The preferred function target partly satisfies about GC content and does not have G or the various standards of the continuous segment of C residue.Table 17 (Figure 33) is listed the sequence of the preferred function target part that is present among the basic virus strain PR8.

In order to discern suitably conservative target part, then will be found in the corresponding function target that a large amount of mankind derive in the strains of influenza viruses and partly compare.Usually, when genome sequence through comparison when reaching maximum homology and/or being homology, for example in different strains at least 50% when identical, " the corresponding target part " in the different strains is present on about same position in the genome of different virus strain usually.Usually, the homology degree of corresponding target part is more than at least 60%, 70%, 80% or 80% when comparing 2 kinds of bacterial strains.For example, corresponding target part can be different from the target part of being found on 1,2,3 or 4 positions in basic virus strain.The easy definite sequence of the described preferred homology target part of identification by the following method: visit is such as the relevant influenza virus fragment sequence in the database of Genbank, with itself and basic bacterial strain sequence alignment, and locate certain part, described part at about identical nucleotide position place and/or with in basic virus strain (for example, PR8) the target part of being found at least 80% is identical, and preferably at least 90% is identical.The homology target partly is one aspect of the present invention.Use standard mentioned above to select suitably conservative target part.Table 18 (Figure 34) has been listed in the sequence that derives from target part suitably conservative between the human influenza bacterial strain, as existing among the basic virus strain PR8.

Except that considering from human host is separated the bacterial strain that obtains, also will separate the bacterial strain comparison that obtains and compare, to be identified in from the strain isolated of human host with from the target part of suitably conservative between the strain isolated of avian host and/or high conservative from avian host.Strain isolated from one or more other animal hosts also can be used for described comparison.With the suitably conservative target part of basic sequence with through the bird sequence of comparison relatively, and be used to discern the identical standard of suitably conservative target part between the human strain isolated, select suitably to guard the target part.Table 20 (Figure 35) has been listed in the sequence that derives from target part suitably conservative between the influenza bacterial strain of the mankind and bird, as existing in basic virus strain PR8.

Each 19 Nucleotide that is found in PR8 or the another kind of strains of influenza viruses that table 15A-15H or table 19A-19F list may target partly be one aspect of the present invention.Each preferred function target that is found in PR8 or the another kind of strains of influenza viruses that table 15A-15H or table 19A-19F list partly is one aspect of the present invention.Each target suitably conservative and/or high conservative that is found in PR8 or the another kind of strains of influenza viruses that table 15A-15H or table 19A-19F list partly is one aspect of the present invention.Each described sequence (that is to say, possible between human derivative strain, preferred function, suitable conservative sequence, the sequence of high conservative between human derivative strain and avian derived bacterial strain, and/or in the human or avian derived bacterial strain or the sequence of high conservative between the two) complementary sequence can be used as the sequence of inhibitory area of antisense strand of the RNAi inductor of target target part.RNAi inductor with the long segmental antisense strand of each sequence of comprising in the described sequence or its at least 15 Nucleotide is one aspect of the present invention.Yet, as described herein, also can use comprise represent with target part not as good as complementary fully or be the various RNAi inductors of shorter or longer antisense strand.The sequence of target part can be served as the sense strand of RNAi inductor.Also can as described hereinly use with the incomplete complementary sense strand of antisense strand.

As mentioned above, the target part of listing in the table 17,18 and 20 is identical with the part of influenza A virus PR8 transcript.In other influenza virus A bacterial strains, find identical or the corresponding target part of each transcript of homologous highly with listed target part in the table 17,18 and 20.In certain embodiments of the present invention, the influenza virus target part that target is possible, the inhibitory area of the antisense strand of the RNAi inductor of the target part of for example listing in the table 17,18 or 20, be not and 100% complementation of PR8 sequence, but be found in corresponding target part 100% complementation in one or more other bacterial strains with table 15A-15H or table are listed among the 19A-19F.The invention provides RNAi and induce entity, for example target possible target part as herein described, function target part, suitably the RNAi inductor of the various piece in the target part of conservative part and high conservative, for example siRNA or shRNA.The present invention also provides RNAi to induce entity, for example target comprises possible target part as herein described, the target RNAi inductor partly that the function target partly, is suitably guarded at least 15 continuous nt of part or high conservative target part, for example siRNA or shRNA.The present invention also provides RNAi to induce entity, for example target comprises possible target part as herein described, function target part, suitably length partly conservative or high conservative target part is the RNAi inductor that reaches the target part of about 29 nt, such as siRNA or shRNA.Other Nucleotide of target part preferably directly be positioned from 5 of the 19nt target part of listing herein ' and/or 3 '.In other words, some other parts that reach about 10 nt in the described longer target part can be the upstreams of 19nt target part, and some can be the downstreams of 19nt target part.Can discern exact nucleotide sequence easily by the following method: visit comprises the suitable inlet from the genomic fragment of the listed target part of any bacterial strain or corresponding target part, and identification directly be listed or corresponding target partly 5 ' and/or 3 ' Nucleotide.Figure 32 A-32J presents the genomic fragment sequence of PR8 (normal chain form).

The invention provides the RNAi inductor, cell culture and/or in animal model through the test with verify its validity and identification can the height effective means by the part of the influenza virus transcript of target.Example 18 is described, and is used to discern the high flux screening (HTS) of siRNA of content of the influenza virus transcript of effective reduction institute target.Example 19-22 describes, and is used for discerning the high flux screening of the siRNA that the influenza virus of effective reduction cell produces.Some preferred effectively siRNA during with cells contacting, makes at least 4 times of influenza A virus titre reductions with the concentration of 100nM.Some preferred highly effectively siRNA during with cells contacting, makes at least 8 times of influenza A virus titre reductions with the concentration of 100nM, or even higher degree.Some preferred effectively siRNA during with cells contacting, makes at least 4 times of influenza A virus titre reductions with the concentration of 1nM.Some preferred effectively siRNA during with cells contacting, makes at least 4 times, at least 8 times or at least 16 times of influenza A virus titre reductions with the concentration of 100nM.Some highly effective siRNA makes the influenza A virus titre reduce at least 2 times with 5nM or concentration below the 5nM and cells contacting the time.Some even more effective siRNA make the influenza A virus titre reduce at least 2 times with 1nM or concentration below the 1nM and cells contacting the time.And more effectively siRNA makes the influenza A virus titre reduce at least 2 times with 0.8pM or concentration below the 0.8pM and cells contacting the time.Concentration is meant when introducing, and siRNA is present in the concentration in the substratum of outside.

In certain embodiments, RNAi inductor target is from the target part in 200 nt of 3 ' end of the gene of for example NP, PA, PB1 or PB2 gene.Find 7 kinds of target parts in the highly effective described zone of siRNA target.Present inventors have observed that, 5 of influenza gene fragment ' and 3 ' to hold to comprise about 10 bases, it is high conservatives with crossing over different strains of influenza viruses that described base is crossed over the different genes fragment.Particularly, the siRNA of 5 ' UTR of 3 kinds of target PB1 transcripts shows that under 100nM virus titer reduces by 4 times.

B.RNAi induces the synthetic of entity

RNAi inductor of the present invention can be according to the preparation of any available techniques, and described technology includes, but is not limited to chemosynthesis, in vivo or in vitro enzymatic or chemistry division, or in vivo or in vitro template is transcribed.For example, can be by enzymatic synthetic or by part/organic synthesis produces RNA fully, and can be by in vitro modified Nucleotide is introduced in enzymatic or organic synthesis.In one embodiment, chemically prepare siRNA.The synthetic method of RNA molecule is known in affiliated field, particularly as Verma and Eckstein, and the chemical synthesis process of describing among the Annu.Rev.Biochem.67:99-134 (1998).In another embodiment, prepare siRNA with enzymatic means.For example, can be processed into desired target RNA by the long dsRNA enzymatic that will have enough complementarity and prepare siRNA.The processing of long dsRNA can (for example) be used suitable cellular lysate and is in vitro finished, and can come purifying siRNA by gel electrophoresis or gel-filtration subsequently.For example, RNA can by extract with solvent or resin, precipitation, electrophoresis, chromatography or its combination and from purifying mixture.Perhaps, RNA can use without purifying or through minimum purifying, with the loss of avoiding being brought by sample processing.

RNAi inductor of the present invention can single shRNA molecular form or is sent with 2 chain forms of hybridization each other.For example, can produce 2 independent 21nt RNA chains, wherein each chain comprises the zone with another chain complementary 19nt, and respective chains can be hybridized together with the structure described in generation such as Fig. 5 A.

In certain embodiments, each bar chain of siRNA is to produce by in vitro or in vivo being transcribed by promotor.For example, but construct can comprise 2 independent transcriptional domains, and wherein each district produces the 21nt transcript that contains with another person's complementary 19nt zone.Perhaps, can utilize single construct, its comprise through the location so that produce opposite promoter P1 and P2 and the terminator t1 and the t2 of 2 kinds of different transcripts, wherein said 2 kinds of different transcripts separately with another person to small part complementation (Fig. 7).In another embodiment, shRNA produces as single transcript, for example, produces by the single transcriptional units in self the complementary district of encoding is transcribed.Fig. 8 describes such embodiment.As described, use the template that comprises the first and second complementary districts and optionally comprise the ring district.The construct of one or more siRNA of coding and/or shRNA chain is contained in the present invention.Except that promotor, construct also optionally comprises one or more other controlling elements, for example terminators.

Can use the various available system that comprises T7, SP6 and T3 promotor/polysaccharase system (for example, can available from the system of Promega, Clontech, New England Biolabs etc.) to carry out in vitro transcribes.When synthetic siRNA in vitro, make its hybridization before can or being delivered to the person under inspection in transfection.Should be appreciated that siRNA composition of the present invention does not need fully by double-stranded (through what hybridize) molecular composition.For example, the siRNA composition can comprise the single stranded RNA of small proportion.Usually, preferred composition comprises about at least 80% dsRNA, about at least 90% dsRNA, about at least 95% dsRNA, or even at least about dsRNA of 99-100%.Yet the siRNA composition can contain the hybridizing rna less than 80%, as long as it contains effectively enough dsRNA.

It will be understood by one of ordinary skill in the art that if siRNA of the present invention or shRNA medicament are in vivo to produce, so usually preferably, produce by one or more transcriptional units are transcribed.Can optionally process (cellular enzymes of for example utilizing one or more) main transcript to produce the final medicament of realizing gene inhibition.Should understand in addition, can easily select suitable promotor and/or controlling element to allow in mammalian cell, the expressing associated retroviral unit.In some embodiments of the invention, may need to utilize regulatable promotor; In other embodiments, possible pattern of wants expression.As not hinting translation about synthetic (transcribing) the employed term " expression " of siRNA or siRNA precursor herein through transcribe rna.

In some preferred embodiment of the present invention, being used to guide the in vivo expression promoter of one or more siRNA or shRNA transcriptional units is the promotor of rna plymerase iii (Pol III).Pol III guides the synthetic of little transcript, and described little transcript stops run into one section 4-5 T residue in template after.The controlling element (being different from the nt that is transcribed earlier) that in the zone of being transcribed, does not need cis acting such as some Pol III promotor of U6 or H1 promotor, and therefore some embodiment according to the present invention is preferred, selects desired siRNA sequence easily because these promotors make.Referring to, for example, Yu, people such as J., Proc.Natl.Acad.Sci., 99 (9), 6047-6052 (2002); Sui, people such as G., Proc.Natl.Acad.Sci., 99 (8), 5515-5520 (2002); Paddison, people such as P., Genes andDev., 16,948-958 (2002); Brummelkamp, people such as T., Science, 296,550-553 (2002); Miyagashi, M. and Taira, K., Nat.Biotech, 20,497-500 (2002); Paul, people such as C, Nat.Biotech, 20,505-508 (2002); Tuschl, people such as T., Nat.Biotech, 20,446-448 (2002).Also can use Pol II promotor, for example, as Xia, people such as H., Nat.Biotechnol, 20, the 1006-1010 are described in 2002 pages.As described herein, can use following construct: wherein hair clip formula sequence concatenation is begun near the of site and follows the polyA box in transcribing, generation is minimized to and does not produce overhang in the hair clip of being transcribed.In certain embodiments of the present invention, but using-system specificity, cell-specific maybe can be induced Pol II promotor, as long as satisfy above-mentioned requirements.Also can use Pol I promotor (McCown 2003) in various embodiments.

Should be appreciated that; be provided for the in vivo expression of the construct (such as described in Fig. 7 and 8) of the template of synthetic siRNA or shRNA; can be following realize ideally: construct is introduced in the carrier such as DNA plasmid or virus vector, and carrier is introduced in the mammalian cell.Although in certain embodiments, may need to select construct to be delivered to the carrier of susceptible in one or more cells of influenza infection, can select any carrier in the various carriers.The carrier that contains siRNA and/or shRNA transcriptional units is contained in the present invention, and contains described carrier or the other cell that contains the transcriptional units of one or more siRNA of coding or shRNA chain through the engineering operation.In some preferred embodiment of the present invention, carrier of the present invention is that the construct that is suitable for expressing siRNA or shRNA is delivered to mammalian cell, most preferably is human cell's gene therapy carrier.Described carrier can be before or after being exposed to influenza virus be thrown with the person under inspection in, to provide poison is due to illness infected and the disease that causes and the prevention or the treatment of symptom.

Therefore the present invention provides various virus vector and non-virus carrier, its existence in cell causes transcribing of one or more RNA, and the RNAi medicament that suppresses the expression of at least a influenza virus transcript in cell to form is hybridized or hybridized each other to described RNA self.In certain embodiments of the present invention, the single carrier that use contains 2 promotors is transcribed 2 independent, complementary siRNA chains, each of described 2 promotors all guides transcribing of single siRNA chain, that is to say, can be operatively connected to the template that is used for siRNA so that transcribe generation.2 promotors can be in same orientation, and in the case, each promotor can be operatively connected to the template that is used for one of siRNA chain.Perhaps, promotor can be in opposed orientation, and the single template of side joint is so that synthesize 2 complementary RNA chains by transcribing of carrying out of promotor.

In other embodiments of the invention, use the carrier that contains a promotor, described promoters driven comprises transcribing of 2 complementary single RNA molecule (for example shRNA) that distinguish.In certain embodiments of the present invention, use the carrier that contains a plurality of promotors, each promoters driven of described promotor comprises transcribing of 2 complementary single RNA molecules of distinguishing.Perhaps, can transcribe a plurality of different shRNA by single promotor or by a plurality of promotors.Various structures are all possible.For example, single promotor is bootable to contain this synthetic of single rna transcription in a plurality of self complementary district, and each zone in described self complementary district can be hybridized to produce a plurality of stem-ring structures.Described structure example is as can in vivo division taking place by Dicer, to produce a plurality of different shRNA.Should be appreciated that described transcript preferably contains termination signal at 3 of transcript ' end rather than between indivedual shRNA unit.In another embodiment of the present invention, carrier comprises a plurality of promotors, and each promotor guiding of described promotor hybridization takes place and forms self complementary RNA molecule synthetic of shRNA.A plurality of shRNA are the same transcript of target all, but the perhaps different transcript of target.But target virus transcription any combination originally.Referring to example 11 and Figure 21.

The those skilled in the art will understand in addition, can be created in the cell of interior over a long time (for example greater than several days, preferably several weeks, more preferably at least one year or longer, possibility throughout one's life to the several months at least) generation medicament according to the in vivo expression of RNAi inductor of the present invention.Described cell can ad infinitum be protected to avoid influenza virus.

Be used for composition and comprise (for example) retroviral vector, lentiviral vectors, adenovirus carrier, adeno-associated virus (AAV) carrier, herpesvirus vector etc. with the preferred virus carrier of cell inner expression that the RNAi inductor is provided.For example, referring to Kobinger, G.P., Deng the people, Nat Biotechnol 19 (3): 225-30,2001, described the carrier-false type HIV carrier based on inovirus (Filovirus) envelope protein matter, this carrier is effectively from the complete airway epithelia of top end surface transduction.Also referring to Lois, C waits the people, Science, and 295:868-872, has described the FUGW lentiviral vectors on February 1st, 2002; Somia, people J. Virol.74 (9): 4420-4424 such as N., 2000; Miyoshi, H. waits the people, Science 283:682-686,1999; With United States Patent (USP) 6,013,516.

It will be understood by one of ordinary skill in the art that, the medicament of all nucleic acid as described in this article, include, but is not limited to have any structure in the structure described in Fig. 5, or the nucleic acid of described any other resulting structure herein, can be fully by forming such as being found in the natural Nucleotide of the Nucleotide in the nucleic acid that exists, perhaps can replace comprises one or more analogue of described Nucleotide, perhaps may otherwise be different from the natural nucleic acid that exists.Contain modified skeleton or non-natural and have that the nucleic acid of binding can be used among the present invention between nucleosides.

Modified nucleic acid needn't be modified equably along whole molecular length.For example, may there be different nucleotide modifications and/or skeleton structure on the position of each in nucleic acid.In certain embodiments of the present invention, may need to make the siRNA Stability Analysis of Structures, for example, go out the digestion that exonuclease causes and realize to reduce (for example) by comprise nucleotide analog at one or more free chain end places.For this reason, can comprise deoxynucleotide at one or more free end place, for example, pyrimidine is such as deoxythymidine.Perhaps or in addition, may need to comprise one or more nucleotide analog, so that particularly when relatively the time, increasing or reduce the stability of 19bp stem with the formed any hybrid of interaction of chain that will be by the RNAi medicament and target transcript.It will be understood by one of ordinary skill in the art that nucleotide analog can be positioned at the target specific activity, for example on the impregnable in fact any position of RNAi mediation activity, for example be arranged in the zone of 5 of RNA molecule ' end and/or 3 ' end.For example, in certain embodiments, 5 of siRNA or shRNA chain ' and/or the 1-5 residue at 3 ' end place between be nucleotide analog.In certain embodiments of the present invention, one or more nucleic acid of the nucleic acid in the RNAi inductor of the present invention comprise at least 50% unmodified rna, at least 80% modified RNA, at least 90% unmodified rna or 100% unmodified rna.In certain embodiments of the present invention, one or more nucleic acid of the nucleic acid in the RNAi inductor of the present invention comprise 100% unmodified rna in the part that the duplex in participating in the RNAi inductor forms.

According to some embodiment of the present invention, in the sense strand of siRNA, shRNA or microRNA precursor or antisense strand, optionally use various nucleotide modifications.For example, preferably can in antisense strand, utilize the unmodified ribonucleotide, and modified ribonucleotide and/or modified or unmodified deoxyribonucleotide are used in some or all positions in sense strand.According to some embodiment of the present invention, in the duplex part of antisense strand and/or sense strand, only use the unmodified ribonucleotide, and the overhang of antisense strand and/or sense strand can comprise modified ribonucleotide and/or deoxyribonucleotide.In certain embodiments of the present invention, one or two siRNA chains comprise the one or more O-ribonucleotide that methylates.

Many nucleotide analogs and nucleotide modification are known in affiliated field, and after deliberation its to effect such as the hybridization and the character of nuclease resistance.Confirm that many modifications change the one or more aspect of oligonucleotide, such as with the ability of complementary nucleic acid hybridization, stability, biological usability, nuclease resistance etc.For example, 2 ' modification comprises halogen, alkoxyl group and allyloxy.In certain embodiments, 2 '-group that the OH group is selected from following group replaces: H, OR, R, halogen, SH, SR ₁, NH ₂, NH _R, NR ₂Or CN, wherein R is C ₁-C ₆Alkyl, alkenyl or alkynyl and halogen are F, Cl, Br or I.The example of modified binding comprise thiophosphatephosphorothioate and 5 '-N-phosphoramidite binding.The 6th, 403, No. 779; The 6th, 399, No. 754; The 6th, 225, No. 460; The 6th, 127, No. 533; The 6th, 031, No. 086; The 6th, 005, No. 087; The 5th, 977, No. 089 United States Patent (USP) and reference have wherein disclosed and can be used for implementing multiple nucleotide analog of the present invention and modification.Also referring to Crooke, S. (volume) " Antisense Drug Technology:Principles, Strategies, and Applications " (the 1st edition), Marcel Dekker; ISBN:0824705661; The 1st edition (2001) and reference wherein.For the purposes of the present disclosure, chemical element is according to Periodic Table of theElements, CAS version, Handbook of Chemistry and Physics, the 75th edition, interior envelope is discerned, and general as described herein definition of concrete functional group.Analogue and modification are tested in analysis or other the suitable analyses that can use (for example) to describe herein, to select effectively to reduce the analogue and the modification of viral gene expression.In certain embodiments, the RNAi inductor comprises one or more the modification to binding between sugar, nucleosides or nucleosides, such as any modification that is described among No. 20030175950, No. 20040192626, No. 20040092470, No. 20050020525, No. 20050032733 open case of the U.S. and/or the reference 137-139.

In certain embodiments of the present invention, produce the nucleic acid with following characteristic by modifying: absorptivity (for example increases, the absorptivity of crossing over slime layer increases oral absorption increase etc.), the stability in blood flow or in cell increases, kidney System Cleaning rate reduces, the ability of crossing cytolemma increases, flee from such as the ability increase of compartment in the cell of endosome etc.As be appreciated by one of skill in the art that, analogue or modification can cause that Tm changes, and can make the mispairing tolerance between homing sequence and the target increase, and still reach effective inhibition simultaneously, can cause that perhaps the specificity to desired target transcript increases or reduces.

The those skilled in the art will understand in addition, and effective RNAi inductor used according to the invention can comprise the part that one or more are not Nucleotide or nucleotide analog.In certain embodiments, nucleic acid mainly comprises nucleotide residue, but also comprises the residue that one or more are not Nucleotide.For example, in certain embodiments, having more than 1,2,3,4,5 or 5 in the residue in arbitrary chain of effective inhibitor is not nucleosides.In certain embodiments, the participation duplex forms and/or is made up of nucleosides with the part of target transcript complementary RNAi inductor, and overhang is made up of non-nucleosides residue.In certain embodiments of the present invention, the sense strand of RNAi inductor and antisense strand are to be connected to each other by the joint that contains non-nucleosides.

III. based on the preferred influenza virus target of identification RNAi inductor and other nucleic acid partly

The invention provides the various nucleic acid of partly, suitably guarding target part and high conservative target part based on the possible target part of identification, function target.Specifically, the invention provides that sequence comprises or possible by mentioned earlier target part in the nucleic acid partly formed of any possible target, described sequence comprises the influenza sequence of listing among table 1A, the 1B, 17,18,20 and/or 34, or its length is the subsequence (fragment) of at least 15 Nucleotide.The SiRNA of some target part of target unexpectedly shows efficient.In order to assess effectiveness, at before influenza infection 6 hours, with siRNA throw with cell in, and the test influenza virus produces after infecting 24 hours.In certain embodiments, sequence is selected from SEQ ID NO:272-380.The SiRNA (comprising and target part 100% complementary antisense strand) of the described target part of target shows that under 100nM the virus in the cell produces and reduces by 4 times (reducing 75%).In certain embodiments, sequence is selected from SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361,364 and 366.The SiRNA (comprising and target part 100% complementary antisense strand) of the described target part of target shows that under 5nM the virus in the cell produces and reduces by 2 times (reducing 50%).In certain embodiments, sequence is selected from SEQ ID NO:297,309,310,311,346,347,364 and 366.The SiRNA of the described target part of target shows under 5nM, virus in the cell produces and reduces by 2 times (reducing 50%), even when target part on maximum 2 positions with PR8 in corresponding target part not simultaneously, that is to say, when between antisense siRNA chain and target part, having maximum 2 mispairing, also be like this.Described nucleic acid and segmental complement also are provided.In certain embodiments, fragment length is 16,17 or 18 nt.Nucleic acid can be strand or two strands and can be unmodified rna or DNA or its modified pattern.Sequence can comprise 3 ' overhang, for example dTdT overhang in addition.The present invention also provides following nucleic acid: identical in fact (for example for the subsequence of at least 15 nt with any sequence or its length in the listed sequence among table 1A, the 1B, 17,18,20 and/or 34, at least 70%, at least 80% identical, at least 90% identical, 100% identical), 100% complementary or complementary in fact (for example, at least 70%, at least 80% complementation, at least 90% complementation, 100% complementation).The present invention provides the carrier that comprises one or more nucleic acid in the above-mentioned nucleic acid in addition.

Nucleic acid comprises the RNAi inductor, such as (i) siRNA; (ii) shRNA; (iii) with the single stranded RNA of complementary single stranded RNA hybridization with formation siRNA; The carrier that (iv) comprises the template of any transcribed nucleic acid that is used for above-mentioned nucleic acid.When sequence was rendered as RNA, the present invention also provided corresponding DNA sequences (vice versa).When sequence was presented in herein, the double-strandednucleic acid that comprises sequence and its complementary sequence was contained in the present invention.Any nucleic acid in the nucleic acid of the present invention can be limited dimensionally.For example, the length of nucleic acid can be 19 nt or following, 29 or 30 nt or following, 35 nt or following, 50 nt or following, or 100 nt or following.

Any structure that contains nucleic acid base is contained in the present invention, wherein for example the residue of Nucleotide with orderly fashion, usually link together with linear mode, so that nucleic acid base sequence can be assigned in the described structure, wherein said sequence is any sequence in the sequence disclosed herein.Above describe various nucleic acid bases and modified Nucleotide and skeleton, can use wherein any one.In various embodiment of the present invention, described structure is nucleic acid, peptide nucleic acid(PNA) (PNA), lock nucleic acid (LNA) or chimeric molecule etc.Referring to, for example, WO92/20702, the 6th, 316, No. 230 United States Patent (USP)s and reference wherein.The present invention is also contained and is comprised the alternately structure of nucleic acid base, and described nucleic acid base has identical base pairing specificity, or can replace the nucleic acid base that is present in the sequence in addition.

Single-chain nucleic acid can be used as such as the antisense strand of the RNAi inductor of siRNA or shRNA or sense strand (adding one or more Nucleotide to form overhang if necessary in 3 ' end).Nucleic acid of the present invention also can be used as (for example) conventional antisense reagent, is used as probe (for example, being used to detect influenza infection) etc." conventional antisense " is meant by in vitro or to person under inspection's throwing and single stranded oligonucleotide suppressing the method that transcript is expressed.It is believed that described inhibition is to operate by the mechanism that is different from RNAi mechanism, and do not need double stranded rna molecule (being different from formed duplex between antisense oligonucleotide and the target transcript).Referring to, for example, Crooke, S., hereinafter.

Therefore the present invention provides the nucleic acid of the target part that comprises the influenza A virus transcript, and the sequence of its amplifying nucleic acid comprises at least 15,16,17,18 or 19 adjacent nt of listed sequence in table 1A, 1B, 17,18, one or more tables of 20 and 34.In certain embodiments, sequence is made up of the sequence listed in table 1A, 1B, 17,18, one or more tables of 20 and 34, or is contained in the listed sequence.The present invention provides the nucleic acid of the target part that comprises influenza A virus mRNA transcript in addition, and the sequence of its amplifying nucleic acid comprises any possible influenza virus target at least 15,16,17,18 or 19 adjacent Nucleotide partly.5 ' and the Nucleotide at 3 ' end place be considered to be contained in the sequence.In certain embodiments, the length of sequence is 30 nt or following, 35 nt or following, 50 nt or following, or 100 nt or following.

The present invention provides in addition, comprise sequence and any possible influenza virus target part (for example showing any target part in the listed target part among 1A, the 1B, 17,18,20 and/or 34) identical in fact (at least 70%, at least 80%, at least 90%, at least 95% or at least 99% is identical) the nucleic acid of part.Some described part there are differences with respect to possible influenza virus target part (for example show list in 1A, 1B, 17,18,20 and/or 34 any table target part) 1,2,3,4 or 5 position.In certain embodiments of the present invention, be to replace C in the target part in the difference of 1,2,3,4 or 5 position, or replace A in the target part by the G in the identical sequence in fact by the U in the identical sequence in fact.The sequence of some nucleic acid of the present invention comprises the contiguous sequence of sequence that is found in influenza virus target in the target transcript and possible part (for example show list among 1A, the 1B, 17,18,20 and/or 34 target part), that is, be positioned at 5 of target part ' or 3 '.

The invention provides the RNAi inductor, it has at least at least at least in the window ranges of at least 15 nt, 16,17 nt, 18 nt, preferred 19 nt, with possible influenza virus target part (for example show list among 1A, the 1B, 17,18,20 and/or 34 target part) complementary antisense strand.For example, antisense strand can with 100% complementation in 15,16,17,18 or 19 nt scopes of listed high conservative target part, perhaps can be complementary in fact, for example with respect to the target part, have the mispairing between 1 and 5.In certain embodiments, the inhibitory area of antisense strand and one or more mispairing between the target, for example all mispairing are U-G mispairing.The sense strand of RNAi inductor can be complementary or complementary in fact with antisense strand 100%.The present invention also provides the RNAi with sense strand inductor, the high conservative listed and/or suitably conserved sequence is 100% identical or identical in fact in 15,16,17,18 or 19 nt scopes in the sequence of described sense strand and table 1A, 1B, 17,18, one or more tables of 20 and/or 34.

For example, the invention provides the RNAi inductor of target influenza virus transcript, wherein the RNAi inductor comprises: nucleic acid moiety, its sequence comprise sequence, its complement or the arbitrary fragment with at least 15 length of nucleotides that is selected from the group that is made up of SEQ ID NO:272-380.The RNAi inductor preferably comprises second nucleic acid moiety that forms the duplex structure with first nucleic acid moiety.In certain embodiments, first and second nucleic acid moieties length separately are 50 nt or following, and for example length is 35 nt or following, and for example length is 21-23 nt etc.In certain embodiments, sequence is selected from the group that is made up of following sequence: SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361,364 and 366, its complement, or the fragment of any one with at least 15 length of nucleotides.In certain embodiments, sequence is selected from the group that is made up of following sequence: SEQ ID NO:297,309,310,311,346,347,364 and 366, its complement, or the fragment with at least 15 length of nucleotides of any one.In certain embodiments of the present invention, sequence based on the antisense strand of the designed RNAi inductor of possible influenza virus target part (for example sequence is listed in the target part among table 1A, the 1B, 17,18,20 and/or 34), comprise and at least 10 of listed sequence 100% complementary, at least 12, at least 15, at least 17 or at least 19 successive nt.The sense strand of described RNAi inductor can be complementary or complementary in fact with antisense strand 100%.In certain embodiments of the present invention, based on the sequence of the sense strand of the designed RNAi inductor of possible influenza virus target part (for example show present among 1A, the 1B, 17,18,20 and/or 34 sequence), comprise at least 10 of listed sequence, at least 12, at least 15, at least 17 and/or at least 19 successive nt.

In certain embodiments of the present invention, sequence based on the antisense strand of the designed RNAi inductor of possible influenza virus target part (for example show present among 1A, the 1B, 17,20 and/or 34 target part), except that may having 1 or 2 mispairing, comprise and at least 10 of listed sequence 100% complementary, at least 12, at least 15, at least 17 and/or at least 19 successive nt.The sense strand of described RNAi inductor can be complementary or complementary in fact with antisense strand 100%.In certain embodiments of the present invention, based on the sequence of the sense strand of the designed RNAi inductor of possible influenza virus target part (for example show list among 1A, the 1B, 17,18,20 and/or 34 sequence), may be different except that 1 or 2 nt with listed sequence, at least 10 successive Nucleotide that comprise listed sequence, more preferably at least 12 successive nt, more preferably at least 15 successive nt, more preferably at least 17 continuous nt, and more preferably 19 successive nt still.

Antisense strand in less than the scope of 19nt with described sequence in fact or in the 100% complementary embodiments of the invention, the remainder of antisense strand can and preferably with complementary in fact or 100% complementation of outside and contiguous with it influenza sequence that is in listed target part.Therefore, the RNAi inductor is contained in the present invention, and the sequence of its contained antisense strand and the nt that " moves " from the sequence of table 1A, the 1B, 17,18,20 and/or 34 more than 1 or 1 are for example up to the influenza sequence complementation of 9 nt.Contiguous sequence is found among Figure 32.

According to some embodiment of the present invention, RNAi inductor target is in natural infection at least 2,3,4, the zone of suitably conservative and/or high conservative between the influenza varient of different plant species organism more than 5 kind or 5 kinds.Species can comprise the mankind, horse (equine/horse), bird, pig and other.In some preferred embodiment of the present invention, species comprise the mankind.

The present invention also provides the carrier of transcribing that can be used for RNAi inductor of the present invention, contains the cell of described carrier and is used for the treatment of and/or the method for flu-prevention A virus infection.

The invention provides the varient of possible influenza virus target part, the varient of any nucleic acid in the nucleic acid of for example showing to list among 1A, the 1B, 17,18,20 and/or 34, with the nucleic acid that comprises varient (for example, the RNAi inductor that comprises described varient), wherein the sequence of varient is different from listed sequence 1,2,3,4,5 or 6 position.In some preferred embodiment of the present invention, the varient of listed sequence is identical or identical in fact with a part from the sequence of the transcript of the strains of influenza viruses beyond the PR8 (such as any virus strain in the influenza A virus strain of listing among table 15A-15H and/or the table 19A-19F).In addition, the subsequence of also containing the various sequences that disclose herein.Preferred sub-sequence length is between 15-18 nt, and for example, length is 15,16,17 or 18 nt.Also contain the particular sequence listed about this paper by the Nucleotide deletion and/or add resulting sequence.For example, contain from the sequence that this paper lists 1,2,3,4,5 or 6 nt of any sequence deletion or to wherein adding 1,2,3,4,5 or 6 resulting nucleotide sequence of nt.In addition, contain 1,2,3,4,5 or 6 nt of varient (as indicated above) deletion of any sequence from the sequence that this paper lists or to wherein adding 1,2,3,4,5 or 6 resulting sequence of nt.The Nucleotide of deleting or adding can be with respect to original series in abutting connection with ground or non-adjacent the location.Can be positioned at inside or be positioned at one or two end.It is interior Anywhere that the Nucleotide that is added can be positioned sequence, maybe can be attached to one or two end.

Nucleic acid of the present invention, for example RNAi inductor or carrier can be introduced in the cell by any available method.For example, the carrier of the nucleic acid or the described nucleic acid of encoding can be introduced in the cell by conventional conversion or rotaring dyeing technology.As used herein, term " conversion " and " transfection " are meant the generally acknowledged various technology in affiliated field that are used for external nucleic acid (for example DNA or RNA) is introduced cell, comprise transfection, lipofection, injection or the electroporation of calcium phosphate or calcium chloride co-precipitation, the mediation of DEAE-dextran.Can use delivery agents, all delivery agents as mentioned below.

Any cell that contains nucleic acid of the present invention through handling is contained in the present invention, and described nucleic acid of the present invention for example be the RNAi inductor, such as siRNA, shRNA, or is provided for synthesizing the carrier of the template of RNAi inductor of the present invention.Cell can be a mammalian cell, for example human cell or non-human mammal cell, or nonmammalian cell.Preferably, cell is the cell of being found in Mammals person under inspection's nostril and/or respiratory tract or lung, and susceptible is in influenza infection.Most preferably, cell is an airway epithelial cell.Optionally, described cell also contains Influenza Virus RNA.

IV. diagnostic method and test kit

The therapy based on RNAi of identification to infectious diseases (for example infection that is caused by Respirovirus) contained in the present invention, can incorporate into ideally in the diagnosis algorithm, be used for determining whether the person under inspection of needs treatment is subjected to susceptible to induce the inhibiting infectious agent of entity to infect in one or more RNAi.The meaning of " susceptible is in restraining effect " is that the biological activity of one or more of infectious agent can be by inducing entity to person under inspection's throwing with RNAi and being suppressed effectively.Preferably, the duplicating of infectious agent, pathogenicity bo, propagation and/or generation are suppressed.For example, preferably, when throwing when inducing entity with RNAi to the person under inspection under tolerance dose, the duplicating of described medicament, pathogenicity bo, propagation and/or generation are suppressed at least 25%.Preferably, suppress to be enough to produce the treatment useful effect.

Influenza virus is adjusted so that the person under inspection's that selection is suitable for being infected RNAi induces entity with an example that explains diagnostic method of the present invention, described diagnostic method process.Certainly, also can (for example) throw with selected RNAi and induce entity being used for prevention to the individuality that contacts with infected individuality, and no matter whether described individuality has developed the symptom of infection.

Therefore the present invention is provided for diagnosing influenza infection and definite person under inspection whether to be subjected to the method for influenza infection.In certain embodiments, method comprises the influenza infection that one or more entities suppressed whether definite person under inspection is subjected to be induced by RNAi of the present invention entity.For example, from the person under inspection that may be under a cloud have the virus infection of influenza for example, obtain sample (for example, sputum, saliva, nose washing lotion, nasal cavity swab, throat swab, segmental bronchus washing lotion, bronchoalveolar lavage (BAL) liquid, biopsy specimen etc.).Sample can stand one or more procedure of processing.Any described sample through processing is considered to obtain from the person under inspection.Analytic sample is to determine whether to contain the influenza virus specific nucleic acid." influenza virus specific nucleic acid " is to come from or derive from influenza virus and can be used as the indication that has influenza virus in the sample, and optionally is used to discern any nucleic acid or its complement of the sequence of influenza bacterial strain and/or influenza gene.Nucleic acid can stand procedure of processing at after separating.For example, can be reversed record, amplification, division etc.Preferably, sequence length is at least 15 nt, 20-25 nt for example, 25-30 nt or longer.In certain embodiments, sequence is different from the sequence of finding in other virus, so that its existence is the clearly indication that influenza virus exists.

In certain embodiments, the sequence that will be present in influenza virus specific nucleic acid in the sample or its complement with such as the sequence of the antisense strand of the RNAi inductor of siRNA or shRNA or sense strand relatively." comparison " but a speech is to make the method that is used to refer to any assessment sequence in a broad sense, for example, can determine whether sequence identical or different in one or more position and reference sequences by described method, maybe can be by described method evaluation difference degree.

Can use any analysis of multiple analysis based on nucleic acid.In certain embodiments, the diagnositc analysis utilization comprises suitably conservative and/or high conservative target part or its complement, or segmental nucleic acid suitably conservative and/or high conservative part or its complement.In certain embodiments, (for example) in a kind of analysis of all analyses as mentioned below, nucleic acid is as amplimer or hybridization probe.

In certain embodiments, the influenza specific nucleic acid in the sample is increased.Any suitable amplification method be can use, index amplification, associating linear amplification comprised, based on the amplification that connects with based on the amplification of transcribing.An example of index nucleic acid amplification method is polymerase chain reaction (PCR), for example, describes to some extent in following document: people ColdSpring Harbor Symp.Quant.Biol.51:263-273 (1986) such as Mullis; PCR Cloning Protocols:FromMolecular Cloning to Genetic Engineering, Methods in Molecular Biology, White, B.A. compiles, the 67th volume (1998); Mullis EP 201,184; People such as Mullis, the 4th, 582,788 and 4,683, No. 195 United States Patent (USP)s; People such as Erlich, EP 50,424, EP 84,796, EP 258,017, EP 237,362; With people such as Saiki R., the 4th, 683, No. 194 United States Patent (USP)s.The associating linear amplification is to be disclosed in the 6th, 027, No. 923 United States Patent (USP)s by people such as Wallace.Based on the example of the amplification that connects is ligation amplification reaction (LAR) and ligase chain reaction (the 0320308th B1 EP application case) by people such as Wu (Genomics 4:560 (1989)) teaching.People such as Hampson (Nucl.Acids Res.24 (23): 4832-4835,1996) have described direction random oligonucleotide primer amplification (DROP) method.

Isothermal target amplification method comprises the amplification (TMA), self-sustained sequence replication (3SR) of transcriptive intermediate, based on amplification (NASBA) and its version of nucleotide sequence.(referring to people Proc.NatL Acad.Sci.U.S.A.87:1874-1878 (1990) such as Guatelli; The 5th, 766, No. 849 (TMA); With 5,654, No. 142 (NASBA) United States Patent (USP)s) and other (for example, as people such as Malek, the 5th, 130, No. 238 United States Patent (USP)s; Kacian and Fultz, the 5th, 399, No. 491 United States Patent (USP)s; People such as Burg are described in the 5th, 437, No. 990 United States Patent (USP)s).

Detect or relatively can use under in the field any method in the known the whole bag of tricks carry out, for example, based on the analysis of increasing, hybridization analysis, primer extension analysis (for example, allele-specific primers extends, wherein the corresponding target of different strains of influenza viruses partly is similar to the not isoallele of gene), oligonucleotide connect to analyze the (the 5th, 185, No. 243, the 5th, 679, No. 524 and the 5th, 573, No. 907 United States Patent (USP)s), splitting analysis, heteroduplex tracer analysis (heteroduplex tracking analysis, HTA) etc.Example comprises that Taqman_ analyzes Applied Biosystems (the 5th, 723, No. 591 United States Patent (USP)s).In this analyzes, 2 PCR primer side joint central authorities probe oligonucleotides.Probe oligonucleotides contains 2 fluorescence parts.During the polymerization procedure of PCR method, polysaccharase division probe oligonucleotides.It is physically separated that division causes that 2 fluorescence partly become, thereby change the fluorescent emission wavelength.When producing more PCR products, the intensity of new wavelength increases.Also can use circle probe technology (CPT), this technology is a kind of nucleic acid detection system (the 5th, 011, No. 769, the 5th, 403, No. 711, the 5th, 660, No. 988 and the 4th, 876, No. 187 United States Patent (USP)s) based on signal or probe amplification rather than target amplification.Invade splitting analysis, for example be described in people such as Eis, P.S., Nat.Biotechnol.19:673, the Invader_ in 2001 analyzes (Third Wave Technologies), also can be used to detect the influenza specific nucleic acid.Can use based on molecular beacon (the 6th, 277, No. 607; The 6th, 150, No. 097; The 6th, 037, No. 130 United States Patent (USP)s) or the analysis of fluorescence energy transfer (FRET).Molecular beacon is the oligonucleotide hair clip of experience conformational change behind the complete matching template of combination.The conformational change of oligonucleotide increases the fluorophore part that is present on the oligonucleotide and the physical distance between quencher (quencher) part.Described physical distance increases and causes that the quencher effect reduces, and therefore strengthens the signal from fluorophore.Open case of No. 20050069908 U.S. and the description of reference wherein can be used for detecting the various additive methods of nucleic acid.Therefore probe of the present invention can comprise one or more and part and one or more parts that design according to particular analysis of influenza specific sequence hybridization.The 5th, 854, No. 033, the 6th, 143, No. 495 and the 6th, 239, No. 150 United States Patent (USP)s have been described the amplification of the molecule of paying close attention to that is used to relate to rolling cycle replication (rolling circle replication) and the composition and the method for multiple detection.This method is applicable to the multiple specific nucleic acid in the while test sample.For example, can be used for determining one or more influenza specific nucleic acid existence in sample.Optionally to nucleic acid sequencing.The open case of No. 20050026180 U.S. describe comprise amplification, detection and gene type be used for doubling the method for (multiplexing) nucleic acid reaction, described method can be suitable for detecting the influenza specific sequence, and determines in the sequence of the specific location of being paid close attention to so that determine RNAi is induced the susceptibility of entity.

In certain embodiments, described analysis determines whether the influenza specific nucleic acid in the sample comprises the sense strand or the identical or different part of antisense strand of inducing entity with RNAi.Optionally, the definite difference (if existence) of identification.Use described information determine influenza virus whether susceptible induce the restraining effect of entity in RNAi.Except that analysis discussed above, at Molecular Microbiology:Diagnostic Principles and Practice, Persing, D.H., Deng the people, (volume) Washington, D.C.:ASM Press has described the detection that is applicable to infectious agent and/or the analysis of gene type in 2,004 one literary compositions.Can use automation system to carry out any analysis in the described analysis.The many systems that are used for carrying out based on the diagnositc analysis of nucleic acid are known in affiliated field, and can easily be used for purpose of the present invention.In one embodiment, will be applied to microarray (claiming " chip " again), connect on the described microarray and various different influenza virus transcripts or the many nucleic acid of its part complementary from the nucleic acid of sample.The hybridization collection of illustrative plates detected and provide enough information with determine influenza virus whether susceptible induce the restraining effect of entity in RNAi.In certain embodiments, to being present in the influenza specific nucleic acid order-checking (usually after amplification) in the sample.Can use multiple different analysis.

Diagnositc analysis can use any nucleic acid in the nucleic acid described in the III part.In certain embodiments of the present invention, nucleic acid comprises not complementary in fact with the influenza virus transcript or identical in fact nucleic acid moiety.For example, nucleic acid can comprise primer binding site (binding site that for example, is used for universal sequencing primer thing or amplimer), hybridization mark (for example can be used for nucleic acid is come out from the sample separation that comprises other nucleic acid) etc.In certain embodiments of the present invention, nucleic acid comprises the non-nucleotide part.The non-nucleotide part can be connected to the terminal nucleotide of nucleic acid, for example, is connected 3 ' end.Described part can protect nucleic acid to avoid degraded.In certain embodiments, non-nucleotide partly is detectable part, such as fluorescence dye, radioactive atom, member that fluorescence energy transfer (FRET) is right, quencher etc.In certain embodiments, non-nucleotide partly is a bound fraction, biological example element or avidin.In certain embodiments, non-nucleotide partly is a haptens, such as digoxin (digoxygenin), and 2,4-dinitrophenyl (TEG) etc.In certain embodiments, non-nucleotide partly is the mark that can be used for separate nucleic acid.

In certain embodiments of the present invention, nucleic acid is to be connected in optionally to be the upholder of magnetic, and particulate for example is such as bead.The present invention provides the array that comprises a lot of nucleic acid of the present invention (for example at least 10,20,50 nucleic acid etc.) in addition.Nucleic acid is covalently or non-covalently to be connected in upholder, and for example smooth in fact upholder is such as slide glass.Referring to, for example, the 5th, 744, No. 305; The 5th, 800, No. 992; The 6th, 646, No. 243 United States Patent (USP)s.

Still whether susceptible is called as " sensitive information " in the inhibiting information that specific RNAi induces entity (siRNA or the shRNA that for example comprise the antisense strand with particular sequence) to have the influenza virus of particular sequence about influenza virus with specific virus strain in the target part.Sensitive information can comprise the quantitative information about sensitivity level.For the purposes of the present disclosure, if such as the RNAi of siRNA or shRNA induce entity when with cells contacting or under tolerance dose, thrown with the person under inspection in the time, make the virus in the infected cell produce reduce at least 25%, so just think that the influenza virus susceptible induces the restraining effect of entity in RNAi.

In a preferred embodiment, if the influenza virus transcript comprise with SEQ ID NO:272-380 in any one is 100% identical, preferably with SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361, in 364 and 366 any one is 100% identical, still more preferably with SEQ ID NO:297,309,310,311,346,347, any one 100% identical target part in 364 and 366 so just thinks that the influenza virus susceptible induces entity in the RNAi that comprises with target part 100% complementary antisense strand.In other embodiments, if the influenza virus transcript is included in 1,2 or 3 position, preferred 1 or 2 position, more preferably only 1 position is different from any one target part among the SEQ ID NO:272-380, so just thinks that the influenza virus susceptible induces entity in the RNAi that comprises with target part 100% complementary antisense strand.In other embodiments, if the influenza virus transcript is included in 1,2 or 3 position, preferred 1 or 2 position, more preferably only 1 position is different from any one target part among the SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361,364 and 366, so just thinks that the influenza virus susceptible induces entity in the RNAi that comprises with target part 100% complementary antisense strand.In other embodiments, if the influenza virus transcript is included in 1,2 or 3 position, preferred 1 or 2 position, more preferably only 1 position is different from any one target part among the SEQ ID NO:297,309,310,311,346,347,364 and 366, so just thinks that the influenza virus susceptible induces entity in the RNAi that comprises with target part 100% complementary antisense strand.

From the experiment of handling the influenza virus that in the target part, has particular sequence or the information that previous experience obtained, also can be used for judging virus whether susceptible induce the restraining effect of entity or its combination in given RNAi.Sensitive information also can comprise based on (for example) theoretical prediction of the predictive role of existing any mispairing between the antisense strand of influenza virus sequence and inhibitor.

Sensitive information can be stored in the computer-readable media by computer-reader form, for example, is stored in the database in mode in a organized way.To offer computerized system in the result of the diagnostic test of carrying out from the sample of person under inspection's acquisition, the susceptibility of described system visit information and definite person under inspection's of infection influenza virus distributes.In certain embodiments, specific RNAi inductor or its combination and/or the dosage of described system recommendation.Therefore the present invention is provided for definite for example virus of influenza virus is induced the susceptibility of entity to RNAi computerized system.The present invention provides the database that contains sensitive information in addition.Computerized system can be the part of single integration automation system or can provide separately with the automation system that is used for execution analysis.

The invention provides the diagnostic kit that is used to detect influenza infection.Some test kit comprises one or more nucleic acid of the present invention.Some test kit comprises one or more nucleic acid of the part of the influenza virus transcript that can be used for detecting the preferred target part that comprises RNAi.Test kit can comprise one or more article that are selected from the group that is made up of following each thing: probe, primer, sequence specific oligonucleotide, enzyme, substrate, antibody, Nucleotide colony, damping fluid, positive control and negative contrast.Nucleotide can be carried out mark.For example, can provide one or more through fluorescent mark Nucleotide colony, such as dNTP, ddNTP etc.

Probe can be the nucleic acid that comprises whole and the part of target part (for example, high conservative or suitably conservative target part) or its complement, or with the target nucleic acid of at least 80% identical or complementary (for example 100% is identical or complementary) partly.In certain embodiments, provide a plurality of probes.Probe is different in one or more position, and can be used for determining the definite sequence of influenza virus transcript in described position.For example, probe can be variantly and transcript hybridization (just hybridizing when for example, having only target part 100% complementation when probe and transcript).

Primer can with the site complementation of the upstream and downstream that is positioned at target part, check order then or stand other processing in and the zone of the influenza nucleic acids that comprises the target part of can be used for increasing.Through the amplification the zone length for example can for 100-200 nt, a 200-300 nt or more than.Select to have with amplification the primer in the zone of the length that required in conjunction with site from the enough distances of target part.Being used for selecting the method for amplimer is known in affiliated field.Test kit can comprise sequence specific oligonucleotide.Oligonucleotide is sequence-specific, because when oligonucleotide during with the hybridization of complementary nucleic acid (for example influenza virus specific nucleic acid) in fact, if 3 ' terminal nucleotide of oligonucleotide and described nucleic acid are complementary fully, oligonucleotide will only be supported by polymerase-mediated extension or connection so.Preferably, provide a plurality of sequence specific oligonucleotides.Therefore oligonucleotide is different at 3 ' end position place, and when being used in oligonucleotide with nucleic acid (for example influenza virus specific nucleic acid) hybridization paid close attention to, establishes the identity that is positioned at described relatively locational Nucleotide.

Test kit of the present invention can comprise sample collection material, for example swab, test tube etc.The assembly of test kit can be encapsulated in indivedual vessel or the test tube, and described vessel or test tube are provided in the container together with the working instructions of test kit usually, for example is suitable for the plastic containers or styrofoam (styrofoam) container of commercial distribution.

V. transgenic animal

The transgenic animal that contain or express RNAi inductor of the present invention through the engineering operation are contained in the present invention.Described animal is applicable to the function and/or the activity of research RNAi medicament of the present invention, and/or is used to the infection/dubbing system that studies flu virus.If this paper uses, " transgenic animal " are the non-human animals, the one or more cell of zooblast wherein, and preferably great majority or all cells comprise transgenosis.Transgenosis is a foreign DNA, or the rearrangement of endogenous chromosomal dna (for example, deletion), preferably is merged in or betides in the genome of transgenetic animal cell.Preferably, transgenosis comprises and can be operatively connected to nucleic acid so that the promotor of expression of nucleic acid takes place in cell.

The bootable RNAi inductor of transgenosis transgenic animal one or more cell type or the tissue in expression.Some preferred transgenic animal is non-human Mammalss, and rodent for example is such as rat or mouse.Other examples of transgenic animal comprise non-human primate, sheep, dog, ox, goat, such as the birds of chicken, Amphibians etc.According to some embodiment of the present invention, transgenic animal are with acting on the animal model (for example, murine, ferret or primate) of testing possible influenza therapeutic.Other non-human animals that the present invention is contained comprise performing animal, include, but is not limited to domestic animal and pet, or any animal of using or raising for profit.Described animal has partially or completely resistibility to influenza infection.The RNAi inductor for example can be siRNA or shRNA.But any possible influenza virus target part of RNAi inductor target is for example shown the target part of listing in any table among 1A, the 1B, 17,18,20 and/or 34.In certain embodiments, RNAi inductor target sequence is selected from the target part of following each sequence: SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361,364 and 366, for example any one among the SEQ ID NO:297,309,310,311,346,347,364 and 366.For example, in a preferred embodiment, the RNAi inductor have with above-mentioned target part in any target part complementary antisense strand and form the sense strand of duplex with antisense strand.

The method of making the transgenic nonhuman animal is known in affiliated field.In brief, described method comprises that (i) will comprise genetically modified suitable carrier by microinjection and introduce in the nuclear of zygote, then transfer to ovum in the reproductive tract of false pregnancy jenny; With, (ii) will comprise genetically modified suitable carrier (for example introduces in the somatocyte through cultivating, use is such as any appropriate technologies such as crosscut, electroporations), select transgenosis wherein to incorporate cell in the genomic dna into, to examine from selected cell transfer to ovocyte or the zygote, optionally ovocyte or zygote are in vitro cultivated morula or blastula stage, and the embryo is transferred in the female receptor.According to additive method, use to comprise genetically modified retroviral vector.Retroviral vector is by infecting, introducing in the cell as the DNA plasmid or as virus particle.Also can use the tenuigenin microinjection in suitable carrier introducing ovocyte or the protoblast.Also contain the transgenosis of sperm mediation.Identification is used the heterozygosis or the chimaeric animals of described method acquisition and is made its breeding to produce homozygote.

The RNAi that carrier is preferably target influenza virus transcript induces carrier.In a preferred embodiment, carrier comprises and is used for the template that the target target RNAi inductor such as siRNA or shRNA is partly transcribed, described target part is suitably conservative and/or high conservative between the influenza virus that derives from the transgenic animal species organism, and if necessary in deriving from such as suitably conservative and/or high conservative between the influenza virus of another species of the mankind.Carrier comprises the promotor that can be operatively connected to being used for the template that the RNAi inductor transcribes.Can produce single RNA molecular form that comprises complementary portion or the RNAi inductor of 2 kinds of RNA molecular form of in cell, hybridizing of being as indicated above.Promotor can (but needn't) derives from the species of transgenic animal.Can use RNA Pol I, II or III promotor.But promotor can be formation type or induction type.

In a preferred embodiment, transgenic animal are birds, for example chicken.The method that is used for making transgenic avian is known in affiliated field, and comprises above-described method and its version.Carrier and the method that is suitable for producing transgenic avian and other transgenic animal is described in the reference of (for example) the 6th, 730, No. 822 United States Patent (USP)s, No. 20020108132 and No. 20030126629 open case of the U.S. and described patent.In certain embodiments, transgenic avian is to use retroviral vector, and for example the avian leukosis virus carrier produces.In other embodiments, transgenic avian is to use the eukaryotic vector that is different from retroviral vector to produce, but this carrier also can comprise and derives from retroviral one or more sequence.In certain embodiments, transgenic avian is expressed multiple RNAi inductor, each self-contained antisense strand with different inhibitory areas sequence of described RNAi inductor.The RNAi inductor is the different strains of influenza viruses of target separately.

The invention provides the transgenic poultry group, wherein fowl group's different members is expressed one or more different RNAi inductors, each self-contained antisense strand with different inhibitory areas sequence of described RNAi inductor.For example, the first kind of RNAi inductor that comprises with the target part 100% complementary antisense strand of first kind of bird flu bacterial strain expressed by fowl group's first part, fowl group's second section is expressed the first kind of RNAi inductor that comprises with the target part 100% complementary antisense strand of second kind of bird flu bacterial strain, and fowl group's third part is expressed the third RNAi inductor comprise with the target part 100% complementary antisense strand of the third bird flu bacterial strain, etc.The member expresses the fowl group of different RNA i inductor, all expresses the situation of identical RNAi inductor with all members and compares, and still less susceptible is in the appearance of resistance strains of influenza viruses.

In a further advantageous embodiment, transgenic animal are Mammalss, for example pig (pig/swine), ox etc.The method that is suitable for making transgene mammal comprises method discussed above, the situation of these methods is described in people such as Gordon in addition, Proc.Natl.Acad.Sci U.S.A., 77:7380-7384,1980 (by the DNA microinjection is carried out in the unicellular embryo kind is to change), people such as Hooper, Nature, 326:292-295,1987; People such as Kuehn, Nature, 326:295-298,1987 (will transfer in the blastocyst) through the embryonic stem cell of genetically engineered operation and, people such as Campbell, Nature, 380:64-66 will be in 1996 (will examine from through the cell transfer of engineering operation to enucleation oocyte).Other reference are described transgenic technology to pig (the 6th, 558, No. 663 United States Patent (USP)s; Machaty, people such as Z, CloningStem Cells, 4 (l): 21-7,2002; People such as Wall, Proc.Natl.Acad.Sci.U.S.A., 88:1696-1700,1991), sheep (people such as Wright, Biotechnology, 9:830-834,1991), goat (Wang, B., wait the people, Mol ReprodDev., 63 (4): 437-43,2002) and ox (people such as Krimpenfort, Biotechnology, 9:844-847,1991; Galli waits the people, Theriogenology, 59 (2): 599-616,2003) application.

In a further advantageous embodiment, transgenic animal are rodents, for example mouse.Used various method produce the mouse of expressed rna i inductor and rat (referring to, for example, people such as Hasuwa, FEBS Lett.2002 Dec4; 532 (1-2): 227-30, Xia waits the people, Nat.Biotechnol., 20 (10): 1006-10,2002; People such as Rubinson, NatGenet, 33 (3): 401-6,2003).

VI. be used to send composition and the method that RNAi induces entity

RNAi induce entity can according to the whole bag of tricks throw with.In one embodiment of the invention, throw and the single RNAi of kind inductor to the person under inspection.A limiting examples is single siRNA species, and it comprises and suitably guarding and/or high conservative target part complementary antisense strand from various strains of influenza viruses.In related embodiment, throw the colony of the RNAi inductor different to the person under inspection with two or more.In one embodiment, the colony of two or more RNAi inductor comprises the medicament that contains antisense strand, and the sequence of described antisense strand is and identical suitably conservative and/or high conservative regional complementary (preferred 100% complementation) in fact from the various bacterial strains of the specific virus of for example influenza virus.In another embodiment, the colony of two or more RNAi inductor comprises the medicament that contains antisense strand, the sequence of described antisense strand be with from the different conservative regions of identical virus strain complementary (preferred 100% complementation) in fact.In another embodiment, the colony of two or more RNAi inductor comprises the medicament that contains antisense strand, the sequence of described antisense strand is and identical suitably conservative and/or high conservative regional complementary (preferred 100% complementation) in fact from the various bacterial strains of the specific virus of for example influenza virus, and the RNAi inductor comprises the medicament that contains antisense strand, the sequence of described antisense strand be with from the different heights conservative region of identical virus strain complementary (preferred 100% complementation) in fact.

The present inventor has realized that the prevention that generally includes influenza infection and treatment in interior effective RNAi therapy, effectively is delivered in the cell in the complete organism by RNAi inductor and/or RNAi being induced carrier, will be enhanced.Under the situation of influenza virus, described medicament must be introduced in the cell in the respiratory tract that influenza infection takes place usually.When being used for the mankind, can preferably use the systemic non-viral method of cell that promotes the RNAi inductor.Therefore the present invention provides composition, and it comprises and is used for strengthening RNAi inductor and/or any delivery agents of carrier in the intracellular various non-viral delivery agents of sending of the complete organism of for example Mammals and bird.As used herein, the notion of " sending " comprises that inducing carrier to enter region from it RNAi inductor or RNAi is transported to the cell position that it works, cell absorbs and/or generation medicament or the interior machinable any subsequent step of RNAi (for example, siRNA or shRNA are from the release of endosome) of pair cell.The present composition also can comprise the component that makes the RNAi inductor stable, as long as suppress medicament degraded (for example, the RNase inhibitor is such as RNAsin) in vivo or in the process that the described medicament of preparation is sent.Usually, can use and completely or partially suppress the active any medicament of RNase.Example comprises RNase inhibitor or its reorganization pattern that obtains from human placenta's purifying.Strengthen sending of RNAi inductor though delivery agents is mainly used in, also can be used for strengthening RNAi and induce sending of carrier.

In certain embodiments of the present invention, delivery agents improves stability, suppresses clearance rate, promotes the cell of composition to absorb, and promotes that RNAi induces entity in intracellular release, reduces cytotoxicity or composition is directed to particular cell types, tissue or organ." inhibition clearance rate " meaning is to reduce the speed that composition is removed from health by the kidney system.Delivery agents can suppress by the cell such as the reticuloendothelial system of scavenger cell to absorb.RNAi induces entity self to pass through and (for example modifies, through covalent modification) improve stability, suppress clearance rate, promote cell to absorb, promote RNAi medicament and/or carrier from release, reduce cytotoxicity or composition is directed to particular cell types, tissue or organ such as compartment in the cell of endosome.For example, can be with RNAi inductor Pegylation, and/or can be bonded to the RNAi inductor with being rich in arginic peptide.

Therefore the present invention is contained composition, and it comprises the RNAi inductor of (i) target transcript, and/or the existence in cell causes that the RNAi of generation of the RNAi inductor of target transcript induces carrier; Any delivery agents in the (ii) various delivery agents, include, but is not limited to cationic polymers, modified cationic polymers, peptide molecule carrier (comprising the peptide that is rich in arginine or Histidine), carbohydrate, lipid (comprising cation lipid, neutral lipid and its combination), liposome, lipid-polycation-DNA mixture (lipopolyplexes), non-cationic polymkeric substance, be suitable for introducing the tensio-active agent in the lung, or the mixture of above-mentioned any reagent etc.Some delivery agents is incorporated into increases sending or suppressing the part that the selectivity in the cell of transcript is sent to needs of RNAi inductor or carrier.In certain embodiments, transcript is the Respirovirus transcript, for example the influenza virus transcript.

Though it is preferred using specific delivery agents in certain embodiments of the present invention, but in other preferred embodiments, such as the RNAi of RNAi inductor induce entity be with " naked " form throw with, that is to say the delivery agents that does not exist any enhancing transfection, cell to enter etc.For example, the RNAi inductor can be thrown to be substantially free of lipid and to be substantially free of with, described aqueous medium in aqueous medium and strengthen the polymkeric substance of sending, for example positively charged ion or non-cationic polymkeric substance, all polymkeric substance as described below.The RNAi inductor can naked form by intravenous route or directly throw with respiratory system in (for example, pass nose or mouth and enter in the lung) by suction.In certain embodiments, the RNAi inductor be with effective treatment or prevention respiratory virus infection, simultaneously cause blood minimal absorption and the amount that therefore realizes the minimum systemic delivery of RNAi inductor throw with.

A. delivering method

The invention provides and be used for and comprise the whole bag of tricks that composition that RNAi induces entity is delivered to the Mammals person under inspection.In certain embodiments, composition directly is delivered in the vascular system and in organ or tissue's (for example, lung) of person under inspection, reaches inhibition the target transcript.In other embodiments, composition directly is delivered in the respiratory system.Some method is used in example 16,22,23 and 24, and wherein in the Mammals person under inspection's who uses described method target organ, the expression of influenza virus generation and luciferase or cyclophilin (cyclophilin) B is inhibited.These results show that described method is widely applicable for the in fact any desired target transcript of inhibition.

Specifically, the invention provides inhibition Mammals person under inspection's the tissue or the method for the genetic expression in the organ, it comprises following steps: do not use the water power rotaring dyeing technology, the composition of RNAi inductor that will comprise the target gene of significant quantity is directly introduced in person under inspection's the vascular system.Preferably, the RNAi inductor suppresses the expression of target transcript in lung.Tissue can be acyclic tissue, that is to say, is different from the tissue of blood.In a related embodiment, the present invention provides the method that suppresses the generation of a kind of virus in Mammals person under inspection's respiratory system in addition, this virus infection airway epithelial cell wherein, described method comprises following steps: do not use the water power rotaring dyeing technology, the composition of RNAi inductor that will comprise the target virogene of significant quantity by injection is introduced in person under inspection's the vascular system.

The present invention provides the method for the genetic expression in the lung that suppresses the Mammals person under inspection in addition, and it comprises following steps: will comprise the RNAi inductor of target gene of significant quantity and the composition of delivery agents and directly introduce in person under inspection's the respiratory system.In a preferred embodiment, gene is respiratory tract disease virus gene, for example influenza virus gene.Preferably, significant quantity suppresses the generation of influenza virus in person under inspection's respiratory system.In method of the present invention or some embodiment aspect any other, virus is the Respirovirus beyond the RSV.

For example, composition can via nose or mouthful, usually then suck throw with.Composition can comprise the particle that mainly is retained in the upper respiratory tract such as nose, pharynx for example, as the particle in typical nose or oral spray.In other embodiments, particle is inhaled in the lower respiratory tract.Discuss hereinafter and can be used for composition directly is delivered to the prescription breathed in the respiratory system.In certain embodiments, directly be delivered to and cause systemic delivery in the respiratory system, for example, the RNAi inductor is from lung intravasation system and be transported to other local target organ or tissue in the body.

Be used for the method that RNAi inductor with significant quantity is delivered to Mammals person under inspection's respiratory system and serve many purposes, include, but is not limited to prevention or treatment respiratory virus infection.Also can use the inventive method throwing and the RNAi inductor of the suitable transcript of target to prevent and/or treat various other diseases and the symptom that influences respiratory system.Example for example comprise cancer such as lung cancer, cystic fibrosis (referring to, for example, U.S.S.N.10/200,607), asthma (referring to, for example, U.S.S.N.11/069,611), pulmonary hypertension, pulmonary fibrosis, pulmonary emphysema etc.The target gene that is fit to comprises the gene of (for example) oncogene, the short vasculogenesis molecule of coding and/or somatomedin (such as, vascular endothelial growth factor), short inflammatory molecule, etc.Certainly, when RNAi inductor during by systemic delivery, but the transcript that target works in the disease of any part of invasion and attack health.

In certain embodiments of the present invention, significant quantity is between every kilogram of person under inspection's body weight 0.1mg and 5mg.In other embodiments, significant quantity is between every kilogram of person under inspection's body weight 0.1mg and 10mg, or between every kilogram of person under inspection's body weight 0.5mg and the 20mg.

Comprise the composition that RNAi induces entity and may comprise or not comprise delivery agents.Be applicable to that delivery agents of the present invention is included in hereinafter and the application that coexists in U.S.S.N.10/674, the delivery agents of describing in 087.Delivery agents can array mode use.

B. cationic polymers and modified cationic polymers

The present inventor determines that any polymkeric substance in various cationic polymerss and the modified cationic polymers strengthens RNAi inductor sending by many different approaches.Therefore the present invention provides composition, its RNAi that comprises (i) target target transcript to induce entity and (ii) cationic polymers.The present invention provides the method that suppresses target genetic expression in addition, and it comprises to the Mammals person under inspection throws and the composition that comprises the RNAi inductor of target target transcript.Specifically, the invention provides the method that treats and/or prevents influenza infection, it comprises to Mammals person under inspection throwing and comprises the RNAi inductor of target influenza virus transcript and the composition of cationic polymers.

Usually, cationic polymers is a kind of under about physiological pH value, for example roughly 7.0 to 7.6, and the pH value in the scope of preferably approximately 7.2 to 7.6, more preferably about 7.4 pH value time, the polymkeric substance of positively charged.Described cationic polymers includes, but is not limited to: polylysine (PLL), poly arginine (PLA), polyhistidyl; Polymine (PEI) (37) comprises straight or branched PEI and lower molecular weight PEI described in (for example) (76); Polyvinylpyrrolidone (PVP) (38); Chitosan (39,40); Protamine; Poly-phosphate; Poly phosphate (such as the poly phosphate of describing in No. 20020045263 open case of the U.S.); Poly-(N-N-isopropylacrylamide), etc.Some described polymkeric substance comprises primary amine groups, imido grpup, guanidine radicals and/or imidazolyl.The preferred cationic polymkeric substance has low relatively toxicity.Reference 85-87; U.S.S.N.6,013,240; WO9602655; Provide about PEI and other with the 20040167087th and No. 20030157030 U.S. open case and to be applicable to other information of implementing polymkeric substance of the present invention.Can use and be called jetPEI ^TM(Qbiogene, Carlsbad, commercially available PEI reagent CA), it is a kind of PEI (U.S.S.N.6,013,240) of linear forms.

The cationic polymers that is fit to also comprise the polymkeric substance with different molecular weight adulterant, comprise the multipolymer of the subelement of any polymkeric substance in the above-mentioned polymkeric substance (or other polymkeric substance), Methionin-Histidine multipolymer etc. for example.The per-cent of various subelements in multipolymer needn't equate, is made the cytotoxicity minimum simultaneously but can select (for example) to optimize such as the character such as ability with nucleic acid formation mixture.In addition, subelement needn't replace with regular fashion.The suitable analysis that is used for assessing at desired character various polymkeric substance is described in the example.The preferred cationic polymkeric substance also comprises such as above-mentioned polymkeric substance, incorporates any modification in the various modifications in addition into.Suitable modification is modified (32) in hereinafter discussing and including, but is not limited to ethanoyl, succinyl, acyl group or imidazolyl.

Promote the DNA plasmid transfection though shown cationic polymers, if but on structure and size, there is gross differences between siRNA and shRNA molecule and the DNA plasmid, whether cationic polymers effectively is being very uncertain aspect the absorption that strengthens siRNA so.Yet, described in example 12, the present inventor is verified, when before or after influenza infection, throw with intravenous route and the time, the composition that comprises the siRNA of PEI, PLL or PLA and target Influenza Virus RNA significantly suppresses the generation of influenza virus in the mouse.When using the siRNA of the different Influenza Virus RNA of 2 kinds of targets, described inhibition be dose-dependently and represent additive effect.Therefore, when with such as the combination of the cationic polymers of PEI, PLL or PLA the time, siRNA can arrive lung, enters in the cell, and effectively suppresses the virus replication cycle.Though the existence of PEI strengthens significantly to the sending of lung, when not having PEI, (example 12 also takes place effectively to send; Figure 22 C), show that effective siRNA that use " naked " siRNA can reach to respiratory system sends.It is believed that described discovery is to use siRNA to suppress the report first time (for example, comparatively speaking, suppressing the generation of the virus transcription of virus replication in the cycle this or intermediate) of the effect that infectious virus produces in Mammals.Described in example 16, the lung of the mixture of siRNA and cationic polymers throws and the target transcript that suppresses effectively in the pneumonocyte.Example 23 and 24 and Figure 31 further provide naked siRNA in the respiratory system that is delivered to the Mammals person under inspection to suppress the evidence of the expression of target transcript wherein effectively.

Be used for by intravenous route with siRNA be delivered to intravital solid organ and the tissue other researchs (referring to, for example, McCaffrey 2002; McCaffrey 2003; Lewis, D.L., 2002) liquid that has adopted the technology that is called the water power transfection, this technology to relate to large volume is delivered in the tail vein of mouse fast, and be presented at solid organ, especially cause in the liver significant quantity plasmid DNA gather that (Liu 1999; Zhang 1999; Zhang 2000).Compare with the routine techniques that relates to the liquid of injecting about 200 μ l (Liu 1999), described technology relates to the liquid volume of sending the botal blood volume that almost is equivalent to animal, concerning the mouse of body weight 18-20 gram, be 1.6ml for example, be equivalent to about 8-12% of body weight.In addition, use being injected in the short time interval (for example, 5 seconds) of water power transfection method to take place, the described timed interval is the transgenosis necessary (Liu 1999) that effective expression is injected.Also siRNA is delivered in the subcutaneous implantation tumour cell in the nude mice (Filleur 2003) by intravenous route, if but system has distinguishing characteristics, so described discovery it be unclear that for the cognation that RNAi inductor intravenously is delivered in natural organ and the tissue.In addition, the present invention proves that for example under the dosage of 0.1-5mg, effective intravenously of RNAi inductor is sent at every kilogram of person under inspection's body weight 5mg or below the 5mg.

Still imperfectly understand though the water power transfection reaches the mechanism of genetically modified transfer and the high level expression injected in liver, think that this is back to (Zhang2000) in the liver owing to instantaneous cardiac congestion by hepatic vein owing to dna solution.The comparability method that is used for the human treatment seems may not be feasible.; the present inventor has used the liquid (for example 200 μ l) of conventional volume and verifiedly expection has been caused siRNA effectively is delivered in the lung under the situation that the transgenosis of being injected even the minimum in liver (liver is to use the easiest position that reaches expression of water power transfection) are expressed.

Therefore the present invention is provided in Mammals person under inspection's the cell and (for example suppresses transcript, virus transcription originally, such as the influenza virus transcript) the method for expression, it comprises the conventional injection technique of use, for example use the technology of conventional pressure and/or conventional liq volume, the composition such as the RNAi inductor of siRNA or shRNA that will comprise target target transcript is introduced the step in person under inspection's the vascular system.In a preferred embodiment of the invention, intravenously is thrown and produce the agent of treatment effective dose of medicine in the target organ of for example lung.In certain embodiments of the present invention, composition comprises cationic polymers.In a preferred embodiment of the invention, composition is to introduce less than 10% liquid volume of person under inspection's body weight being equivalent to.In certain embodiments of the present invention, liquid volume is equivalent to less than 5% of person under inspection's body weight, less than 2% of person under inspection's body weight, less than person under inspection's body weight 1% or less than 0.1% of person under inspection's body weight.In certain embodiments of the present invention, described method reach significant quantity the RNAi inductor beyond the liver of for example lung bodily tissue or the cell in the organ in send.In some preferred embodiment of the present invention, composition is that (for example) introduces in the vein by intravenous injection.Yet, composition also can throw with artery in, use such as conduit, keep somewhere device such as intravenously pipe and send.In some preferred embodiment of the present invention, the RNAi inductor suppresses virus (for example) generation in lung.

Described in example 15, the present inventor is also verified, and cationic polymers PLL and PLA and siRNA form mixture and promote the absorption of functional siRNA in institute's cultured cells.Carry out transfection with the mixture of the mixture of PLL and NP-1496 or PLA and NP-1496 siRNA and suppressed the generation of influenza virus in cell.These results and result in mouse discussed above have proved that the mixture that uses cationic polymers and siRNA is delivered to advantage in the intravital mammalian cell of person under inspection with siRNA.Method described in the example 15 can be used for testing other polymkeric substance, for example modifies to reduce cytotoxicity and to optimize the initial effectively polymkeric substance of polymkeric substance by adding group (for example acyl group, succinyl, ethanoyl or imidazolyl).Some is preferably modified the positive charge that causes cationic polymers and reduces.Some is preferably modified primary amine is changed into secondary amine.Being used for modifying cationic polymers is known with the method for incorporating described other group in affiliated field.(referring to, for example, reference 32).For example, the epsilon-amino of various residues can (for example) pass through after synthetic polymer, combines with desired modification group to replace.Usually, need to select replace per-cent, being enough to reaching Cytotoxic suitable reduction, and do not cause that the ability of sending that polymkeric substance strengthens the RNAi inductor too much reduces simultaneously with respect to substituted polymer not.Therefore, in certain embodiments of the present invention, between 5% in the polymkeric substance and 75%, for example about 50% residue replaces.Similar effect can reach by the multipolymer that initial formation has a monomer subelement (that is to say that the some of them subelement has been incorporated desired modification into) of suitable selection.Be used to promote that the cationic polymers of sending of RNAi inductor can be through modifying so that it incorporates the one or more residue that is different from the principal monomer subelement that constitutes polymkeric substance into.For example, one or more replacement residue can be added to the end of polymkeric substance, perhaps polymkeric substance can connect by the residue that is different from the principal monomer that constitutes polymkeric substance.

Also can use various other cationic polymerss.Example comprises poly-(beta-amino ester) (PAE) polymkeric substance (such as, U.S.S.N.09/969,431; 10/446,444; Polymkeric substance described in the open case 20020131951 of the U.S. and reference 34 and 93).Though more verified poly-(beta-amino ester) (PAE) polymkeric substance promotes the DNA plasmid transfection, if but on structure and size, there is gross differences between siRNA and shRNA molecule and the DNA plasmid, whether still can effectively to strengthen the absorption of siRNA be very uncertain to cationic polymers so.Yet described in example 12, the present inventor confirms, when together with poly-(β amino ester) through intravenous route throw and the time, the siRNA of target NP (NP-1496) suppresses the influenza virus generation in the mouse.In addition, when together with second kind poly-(β amino ester) through the intraperitoneal approach throw and the time, the influenza virus that described siRNA suppresses in the mouse produces.

Also can be used for strengthening the other cationic polymers that RNAi inductor of the present invention sends and comprise, polyamide-amide (PAMAM) branch-shape polymer, polymethyl acrylic acid (2-dimethylamino) ethyl ester (pDMAEMA) and its quaternary amine analogue polymethyl acrylic acid (2-trimethylammonium amino) ethyl ester (pTMAEMA), poly-[a-(the amino butyl of 4-)-L-oxyacetic acid (PAGA) and gather (4-hydroxyl-1-proline ester).Other are described referring to Han (2000).

Can use modified cationic polymers, for example poly-(L-Histidine)-grafting-poly-(L-Methionin) polymkeric substance (Benns2000), polyhistidyl-PEG (Putnam 2003), folic acid-PEG-grafting-polymine (Benns 2002), polymine-dextran sulfate (Tiyaboonchai 2003) etc.Polymkeric substance can be side chain or linear forms and can be grafted or grafted not.In certain embodiments, polymkeric substance and RNAi of the present invention induce entity to form mixture, then by among throwing and the person under inspection.Any polymkeric substance in the described polymkeric substance can be through modifying to incorporate PEG or other hydrophilic polymers into.Cationic polymers can pass through multiple modification.

Any delivery agents of modifying in the delivery agents described herein is contained in the present invention, strengthens medicament sending and/or strengthen the part that the selectivity of medicament in specific cells sent in cell to incorporate into.Can use any part in the various parts, for example (i) specific combination is by the antibody or the antibody fragment of the expressed molecule of the cell (for example, airway epithelial cell) of needs inhibition; (ii) specific combination is by the part of the expressed molecule of the cell of needs inhibition.Being used for antibody, part and/or delivery agents is known with the method that the various delivery agents of nucleic acid or description herein combine in affiliated field.Referring to, for example, " Cross-Linking ", Pierce Chemical Technical Library can be at network address URL Www.piercenet.comUpward obtain and be disclosed at first the reference that 1994-95 Pierce Catalog neutralization is wherein quoted, with Wong SS, Chemistry of Protein Conjugation and Crosslinking, CRC Press Publishers, Boca Raton, 1991; And G.T.Hermanson, Bioconjugate Techniques, Academic Press, Inc., 1995.

C. be used for inducing entity to be delivered to the other reagent of respiratory system RNAi

Composition is contained in the present invention, and its any reagent and RNAi that comprises in the various other reagent induces entity, and wherein said reagent strengthens RNAi and induces entity (for example) sending to airway epithelial cell.

In certain embodiments, the peptide molecule carrier is included in the composition, and described peptide molecule carrier is the peptide that can penetrate plasma membrane from cell surface.It is made up of the 11-34 amino-acid residue usually, highly enriched arginine, and often be known as and be rich in arginic peptide (ARP) or wear film peptide (penetratin) (referring to document 42-51,120,134-36).

In other embodiments, composition comprises the tensio-active agent that is suitable for being incorporated in the lung.Example comprise commercially available formula I nfasurf_ (ONY, Inc., Amherst, NY); Survanta_ (Ross Labs, Abbott Park, IL) and ExosurfNeonatal_ (GlaxoSmithKline, Research Triangle Park, NC).The 4th, 338, No. 301; The 4th, 397, No. 839; The 4th, 312, No. 860; The 4th, 826, No. 821; The 5th, 110, No. 806 United States Patent (USP)s, U.S.S.N.4,312,860; 4,826,821; With 5,110,806 have described other surfactant composition.Usually, any not causing contains all useful as surfactants of lipid matter to the material injury of lung.

Also can use washing composition and thixotropy solution throw with.Also can use perfluorochemicals liquid, for example (heptacosafluorotributylamine is Fluorinert) with relevant molecule for perfluorotributylamine.Other are discussed referring to (74,126,150) and United States Patent (USP) 6,638,767.In addition, the present invention is contained and is used and have protein/polyethyleneimine: amine compound that RNAi of the present invention induces entity with for delivery to (for example) respiratory system, for example in the lung.Spendable other delivery agents comprise mixtures natural and synthetic cyclodextrin and described cyclodextrin and other delivery agents.Other information are referring to Singh, and M waits the people, Biotechnol Adv.20 (5-6): 341-59,2002; Eastburn, SD and Tao, BY, Biotechnol Adv., 12 (2): 325-39,1994; With No. 20030157030 open case of the U.S..Can use various non-cationic polymkeric substance, such as, poly-(rac-Lactide) (PLA), poly-(glycollide) (PLG) and poly-(DL-rac-Lactide-copolymerization-glycollide) (PLGA) (Panyam 2002), polyvinyl alcohol, poly-(N-ethyl-4-vinyl bromination pyridine), general stream Buddhist nun gram (Pluronic), gather (ether-acid anhydride).Use the combination of cationic polymers and non-cationic polymkeric substance in certain embodiments, such as, poly-(lactic acid-copolymerization-oxyacetic acid) be poly-(L-Methionin) (Jeong 2002) of grafted (PLGA), with other combinations, comprise the cationic polymers of PLA, PLG or PLGA and all polymkeric substance as discussed above or any polymkeric substance in the modified cationic polymers.Also can use segmented copolymer, it can comprise positively charged ion and/or non-cationic monomer.Case description is in the 6th, 800, No. 663; The 6th, 692, No. 770; The 6th, 669, No. 959; The 6th, 616, No. 941; The 6th, 592, No. 899; With the 6th, 517, in No. 869 United States Patent (USP)s.

VII. be used for the composition that suction that RNAi induces entity is sent

The invention provides be used for by suck to throw and comprise the composition that RNAi induces entity.Preferably, to induce entity be that RNAi such as siRNA or shRNA induces entity to RNAi.As indicated above, the RNAi inductor can naked form or with delivery agents, by suction pass nose or mouthful directly throw with respiratory system in and enter in the lung.In certain embodiments, the RNAi inductor be the amount that produces the minimum systemic delivery of the RNAi inductor that enters the minimal absorption in the blood and cause thus with the symptom of effective treatment or prevention invasion and attack respiratory system (such as, respiratory virus infection), simultaneously throw with.In certain embodiments of the present invention, the degree in the blood of absorbing is so that when so that effectively dosage is thrown with the RNAi medicament in lung, do not observe the degree of clinical remarkable effect in the organ or tissue of respiratory system outside.

Specifically, the invention provides dry powder composite, it comprises RNAi and induces entity, is preferably the RNAi inductor.From pressurizing vessel or divider, or send by atomizer with the aerosol spray form for pharmacy optimization of the present invention, and described pressurizing vessel or divider contain suitable propelling agent, for example, and such as the gas of carbonic acid gas.In certain embodiments, delivery system is suitable for being delivered to composition in person under inspection's the main air flue (trachea and bronchus) and/or being deep in the lung (bronchiole and/or alveolar).In certain embodiments, comprising the composition that RNAi induces entity is to use nasal spray to send.Delivery agents can be included in the medical composition.Yet the present inventor has been found that also when being delivered in the respiratory system by respiratory tract, the RNAi inductor can suppress influenza virus (example 23) effectively when under the situation that does not have the particular delivery agent.In certain embodiments, the RNAi inductor is to be delivered in the lung with composition forms, described composition is basically by (for example being dried forms (for example dry powder) or the RNAi inductor in aqueous medium, naked siRNA or shRNA) form, described aqueous medium is made up of water basically, optionally also comprise salt (for example, NaCl, phosphoric acid salt), damping fluid and/or ethanol.

Can comprise liquid or drying particulate for delivery to the aerosol formulations in air flue and the lung with various size and character.Contain diameter and be called dry powder in this article again less than the drying particulate composition of the particle of about 1mm." drying " meaning is that composition has low relatively content liquid, forms aerosol or sprays so that particle can easily be dispersed in (for example) powder inhaler." powder " meaning is a composition main or that be made up of the solids of fine dispersion fully, described solids are free-pouring relatively and can easily be dispersed in the suction apparatus, and subsequently (for example by the person under inspection, the patient) sucks, (preferably) so that particle can arrive the alveolar of lung, that is to say, be suitable for pulmonary delivery.Powder composition can characterize according to the various parameters such as and the following: particulate mark (FPF), injection dosage, average particle density and mass median aerodynamic diameter (MMAD).The method that is fit in affiliated field, be known and see (for example) reference 31 and 58 and No. 20020146373, No. 20030012742 and No. 20040092470 open case of the U.S. in.In certain embodiments of the present invention, use to have between 1 μ m and 25 μ m, preferably the particle of the quality average gas kinetic diameter between 1 μ m and 10 μ m.In certain embodiments, use the average geometric diameter have between 3 and 15 μ m and 0.04 and 0.6g/cm ³Between the macropore particle (31,58) of tap density.

The method that is used for making drying particulate is known in affiliated field.Appropriate methodology comprises spraying drying, spraying-lyophilize, is separated, single or two emulsion solvent evaporations, solvent extraction and simple and complex coacervation.Microparticle compositions also can use granulation, extruding and/or spheronization to make.The method that is suitable for preparing dry powder oligonucleotide prescription is known in affiliated field.Referring to, for example, No. 20040092470 open case of the U.S..The preferred method of using can not reduce the ability of physical integrity and its inhibition target transcript of nucleic acid greatly.Need avoid having notified and cause the nucleic acid significantly temperature of degraded or the ultimate value of pH value.Should be appreciated that palliating degradation degree can change with the time that specified conditions and nucleic acid are exposed to described condition usually, therefore will minimize exposure duration and may be desired and may allow to use more ultimate value condition.Can test to determine whether method selected is suitable concerning keeping enough effects to composition.Preferably, in the composition that selected compound method produced, the part of forming by nucleic acid have input nucleic acid activity level at least 10%, preferably more than at least 20%, 50% or 50%.

The condition that is used to prepare particle can be through selecting the particle that has desired size or character (for example, hydrophobicity, wetting ability, formalness, " viscosity ", shape etc.) with generation.The method and the employed condition (for example, solvent, temperature, concentration, air velocity etc.) that prepare particle also can be depending on particular active agent and other components that are included in the composition.If have in institute's claimed range size range in addition by the prepared particle of any method in the aforesaid method, can (for example) use sieve so, wait to the particle classification by grinding.But the combination of using method.

Dry powder can be made up of one or more RNAi inductor basically.In certain embodiments, prescription comprises one or more other reagent, for example the reagent sent of the enhancing of stablizer, all reagent as indicated above, vehicle etc.Be meant the material that is different from the reagent that promoting agent or enhancing send that is present in the prescription of the present invention by term used herein " vehicle ".The vehicle that is applicable to pulmonary delivery is known in affiliated field.Any compound in a large amount of compounds that generally acknowledge in affiliated field can be included in the prescription of the present invention.Usually, can use the composition of the promoting agent (that is, RNAi inductor) of concentration between 0.1% and 100% by weight.

Be used for (for example) the reduction target transcript content of test particle and/or the method for the ability that the inhibition influenza virus produces and be described in example 10.Similar approach can be used for any prescription in the aerosol formulations of the present invention.The drying particulate composition dissolves in the suitable solvent and with the liquid aersol form or by other modes of sending that are fit to and sends.

Liquid particle also can (for example) be sent as aerosol formulations.Usually, the size range of described particle can be similar to the size range of above drying particulate being described.Although also can use littler or macroparticle more, in certain embodiments, liquid particle is approximately to send to be used for respiratory system between the 0.5-5 μ m.The aqueous vehicles that is fit to comprises water or salt solution, optionally comprises alcohol.At Bisgaard, H. waits the people to the other consideration of pulmonary delivery, and (volume), Drug Delivery to theLung, the 26th volume in " Lung Biology in Health and Disease ", Marcel Dekker, New York, 2002 are discussed.

If desired, the particle that comprises RNAi inductor of the present invention so also can by intravenous route throw with.Concerning intravenously was sent, approximately the size of 10nm-50 μ m was normally preferred.

VIII. treatment is used

Comprising composition that RNAi of the present invention induces entity can be used for suppressing or reduces respiratory virus infection or duplicate.

In described application, before being exposed to the virus of influenza virus for example, simultaneously or afterwards, the present composition of significant quantity is delivered in cell or the organism.Preferably, RNAi induces the amount of entity to be enough to reduce or delay one or more infection symptoms.For being described, siRNA of the present invention will often be mentioned in this part, but the similar application that target virus transcription other RNAi originally induce entity is contained in the present invention.Should be appreciated that also influenza virus is to use as an example in this article, but described method can be applicable to any virus in other Respiroviruses of broad range.

Composition of the present invention can comprise the single RNAi of kind inductor in single site in the single influenza transcript of target, perhaps can comprise a plurality of different species in the one or more site in one or more the influenza transcript of target.In some embodiments of the invention, the needs utilization is contained target various flows sensillary base because of the composition of set of different RNA i inductor (for example, multiple different siRNA).For example, may need to use various siRNA, in viral life cycle, at a plurality of somes place challenge virus at the different virus transcript.According to some embodiment of the present invention, composition contains each segmental siRNAi of target.

In certain embodiments, composition comprises 2,3,4,5,6,7,8,9 or 10 kind of different RNAi inductor species, for example, and 2,3,4,5,6,7,8,9 or 10 kind of different siRNA.In certain embodiments of the present invention, RNAi inductor target has the part of the influenza virus gene group of the sequence that is selected from the group that is made up of SEQ ID NO:272-380.In certain embodiments of the present invention, RNAi inductor target has the part of the influenza virus gene group of the sequence that is selected from the group that is made up of any selected subclass of SEQ ID NO:272-380.Be used for any herein and all purposes even statement ambiguously, all described subclass are also included within.

In certain embodiments of the present invention, composition comprises for example RNAi inductor of the another kind of influenza virus gene of NP, PB1 or PB2 of the RNAi inductor of at least a target PA and at least a target.In certain embodiments of the present invention, composition comprises for example RNAi inductor of the another kind of influenza virus gene of NP, PA or PB2 of the RNAi inductor of at least a target PB1 and at least a target.In certain embodiments of the present invention, composition comprises for example RNAi inductor of the another kind of influenza virus gene of NP, PB1 or PA of the RNAi inductor of at least a target PB2 and at least a target.In certain embodiments of the present invention, composition comprises for example RNAi inductor of the another kind of influenza virus gene of PA, PB1 or PB2 of the RNAi inductor of at least a target NP and at least a target.

According to some embodiment of the present invention, siRNA composition of the present invention can contain more than one the single virus transcription of target siRNA species originally.For example, may need to comprise the siRNA of coding region of at least a target target transcript and the siRNA of at least a target 3 ' UTR.Described strategy can additionally guarantee will can not produce by this coded product of associated retroviral because the transcript that at least a siRNA in the composition is used to target to degrade, and at least a other siRNA suppresses any translation of avoiding the transcript of degrading.

Therefore, the combination that RNAi of the present invention induces entity is contained in the present invention, include, but is not limited to throw and multiple RNAi inductor, the synthetic of siRNA that the method for for example multiple siRNA or shRNA and the guiding of single carrier suppress multiple influenza virus transcript maybe can pass through the synthetic method of processing with the RNA that produces a plurality of siRNA.Other details are referring to example 11.According to some embodiment of the present invention, composition comprises the RNAi inductor of at least a influenza virus A transcript of target and the RNAi inductor of at least a influenza virus B transcript of target.In certain embodiments, composition comprises target influenza A virus transcript and influenza B virus transcription RNAi inductor originally.According to some embodiment of the present invention, composition comprises the not homotactic multiple siRNA with the specific segmental same section of target.According to some embodiment of the present invention, composition comprises the multiple RNAi inductor that suppresses different strains of influenza viruses or hypotype.

Influenza virus experience antigenic shift and antigenic drift, and may produce the therapeutical agent resistance.Can expect, after composition of the present invention has used for some time, may undergo mutation and/or reprovision, thus the varient that may occur not being subjected to the specific RNAi inductor that provided to suppress.Therefore the present invention contains further (evolving) treatment plan.For example, under specific circumstances,, can select one or more new RNAi inductor in response to specific sudden change or reprovision.For example, the new RNAi inductor that the Chang Keneng design is identical with original medicament, the RNA fragment that is and has any sudden change that has taken place or target newly to obtain; In other cases, with the new sequence that needs in the identical transcript of target; In other cases, with the new transcript of the complete target of needs.

Regular meeting other antiviral agents combinations of RNAi inductor of the present invention and one or more need be thrown with to suppress, to reduce or prevent one or more infection symptoms or infection characteristic.In some preferred embodiment of the present invention, RNAi inductor of the present invention is to make up such as other antiviral agents such as NA inhibitor, M inhibitor with one or more.Example comprises Symmetrel (amantadine) or Rimantadine (rimantadine) and/or Zha Nami big (zanamivir), Ao Sita big (oseltamivir), Peramivir (peramivir) (BCX-1812, RWJ-270201) Ro64-0796 (GS 4104) or RWJ-270201.Yet, the throwing of RNAi inducer composition of the present invention with, also can comprise any medicament combination of (for example) various known flow influenza vaccines (for example, using the conventional vaccine and the dna vaccination of influenza virus or virus antigen) in interior various medicaments with one or more.Other information are referring to Palese, P. and Garcia-Sastre, 2002; Cheung and Lieberman, 2002, Leuscher-Mattli, 2000; And Stiver, 2003.

In different embodiments of the invention, the RNAi inductor is present in the identical mixture with other medicaments, perhaps is used for individual treatment plan and comprises RNAi inductor and other medicaments that needn't send or send simultaneously at equal mixture.Therefore, as used herein, term " combination " is not intended to represent that compound must be present in the single composition, or as single composition, for example as the part (for example, in identical aerosol formulations, particle composition, tablet, capsule, pill, solution etc.) of same dose unit throw with the person under inspection in (though also can so).But, in certain embodiments of the present invention, individually but side by side throw and described medicament.As used herein, two or more " throw altogether with " or " throw simultaneously with " of compound of term be not intended to represent compound must the accurately identical time thrown and.Usually, if compound is present in the body with the amount less than trace (de minimis) simultaneously, so compound is thrown altogether with or throw simultaneously with.Therefore, compound can (but needn't) as the part of single composition throw together with.In addition, compound can (but needn't) simultaneously (for example, in 5 minutes, or) less than in 1 minute throw with or throw at short notice relative to each other and (for example, be separated by, less than 30 minutes,, about 5 minutes) less than 10 minutes less than 1 hour.According to various embodiments of the present invention, in the described timed interval, throw and compound can be considered to throw in fact simultaneously and.The those skilled in the art can easily determine compound throw with between appropriate time at interval so that will be present in the body to surpass micro-content separately, or preferably, be present in the body with effective concentration.

RNAi inductor of the present invention and carrier provide vaccinated complementary strategy, and can by throw with or also not with various existing or research and develop in any vaccine of vaccine carry out vaccinated individuality (Palese, P. and Garcia-Sastre, A., J.Clin.Invest., 110 (1): 9-13, comment in 2,002 one literary compositions).The existing vaccine formulation of the U.S. contain inactivation of viruses and must by intramuscular injection throw with.Vaccine is divided into three parts, and except that influenza category-B type, also contains the representative virus strain from the two kinds of hypotypes (H3N2 and H1N1) of the influenza A in the present circulation.Every kind of specificity proposed standard identification in season is applicable to the specific bacterial strain of vaccine in this in season.Other vaccine methods comprise suitable cold influenza virus alives, can by nasal spray throw and; The influenza virus vaccine alive that in viral genome, contains deletion or other sudden changes through the genetically engineered operation; Lack replicating influenza virus, and dna vaccination, wherein with intramuscular or local approach throw with the coding virus protein in one or more virus protein plasmid DNA (referring to, for example, Macklin, M.D. waits the people, J Virol, 72 (2): 1491-6,1998; Ilium, L. waits the people, Adv Drug Deliv Rev, 51 (1-3): 81-96,2001; Ulmer, J., Vaccine, 20:S74-S76,2002).Immunocompromised patient and older individuals can obtain specific benefits from the therapeutical agent based on RNAi, reduce because they may experience the influenza virus vaccine effect.

In some embodiments of the invention, may need the throwing of composition of the present invention and target cell through influenza infection, or at least the target susceptible in the cell (for example, expressing the cell that contains sialic acceptor) of influenza infection.In other embodiments, will need effective maximum to send the selection width.

As mentioned above, treatment plan of the present invention is included in and is exposed to before the influenza virus, simultaneously or afterwards, throws RNAi inductor or carrier with significant quantity.For example, the individuality that does not infect can come " immunity " with composition of the present invention before being exposed to influenza; Be among the risk individuality (for example, the elderly, immunocompromised individuals, recently with under a cloud, probably or the people that contacts of the known personnel that are subjected to influenza infection, Deng) can be in fact exposing simultaneously, for example treat with interior back 2 hours of exposure or 2 hours.In other embodiments, the person under inspection is the time a little later after under a cloud or known exposure, for example, treats in 2-12,12-24,24-36 or 36-48 hour.The person under inspection has symptom or asymptomatic.In certain embodiments, the person under inspection is between exposing maximum 48 hours, maximum 24 hours, maximum 12 hours, maximum 3 hours etc., is protected by throwing with RNAi inductor or carrier.Certainly, under a cloud or known infected individuality can be accepted treatment of the present invention at any time.

Some preferred influenza virus inhibitor suppresses virus replication, so that the levels of replication in containing the cell of inhibitor is lower at least about 2 times than the levels of replication in the control cells that does not contain inhibitor, preferably at least about 4 times, more preferably at least about 8 times, 16 times, 64 times, 100 times, 200 times or reach even bigger degree.Some preferred influenza virus inhibitor the throwing of medicament with and/or infect after, prevention (for example, be reduced to immesurable level) or (for example significantly reduce virus replication, the level that takes place when not having the RNAi inductor is below 10% or 10%, below 25% or 25%, below 50% or 50%, below 75% or 75%) at least 24 hours, at least 36 hours, at least 48 hours or about 60 hours.

In certain embodiments of the present invention, use sustained release preparation to realize preventing purpose, for example, protect the person under inspection avoiding influenza infection through the promoting agent that discharges q.s one period, or alleviate the prescription of the symptom of described infection.For example, prescription can discharge the medicament of significant quantity in a couple of days, a week, 1-2 week or longer period.Can use the biodegradable polymerization delivery system that comprises RNAi inductor or carrier.

Therefore, RNAi of the present invention induce entity under at least 3 kinds of different situations in treatment effectively: (i) RNAi induces entity can throw with not under a cloud or do not know to be exposed to the person under inspection of influenza virus.Under described situation, RNAi induces entity preferably to prevent the development of clinical remarkable infection or alleviates its seriousness; (ii) RNAi induces entity (for example) to throw and the under a cloud or known person under inspection who has been exposed to influenza virus in the timed interval in advance in maximum weeks.RNAi induces entity preferably to prevent the development of clinical remarkable infection or alleviates its seriousness, and (iii) RNAi induces entity to throw and becomes clinical sick person under inspection.RNAi induces entity to suppress at least a symptom of influenza infection was duplicated and preferably alleviated to influenza virus seriousness and/or time length.Can treat have the upper respiratory tract, the person under inspection of lower respiratory tract or both infection.In certain embodiments of the present invention, the person under inspection has by the caused virus pneumonia of influenza infection.

In certain embodiments of the present invention, use gene therapy to come flu-prevention or the sick individuality of treatment.The gene therapy scheme can be included in before the influenza infection, in fact simultaneously or afterwards, throws gene therapy carrier with the expression that can guide inhibitory RNA i inductor of significant quantity to the person under inspection.

As mentioned above, except that the mankind, influenza virus also infects multiple species.The present invention includes composition of the present invention and be used for the treatment of the non-human species, especially such as the purposes of species such as chicken, pig and horse.

IX. medicine is filled a prescription

As discussed above, RNAi induces the suction of entity to send to be in certain embodiments of the present invention preferred, and intravenously to send be preferred in other embodiments of the invention.Suction is sent and may be more suitable for being in relatively the better patient of state of health, and intravenously is sent and may be more suitable for carrying out enough air-breathing and/or suffer to stop the symptom of effectively sending (for example, excessive mucus generation via respiratory pathways; A plurality of parts of lung are owing to infectation of bacteria becomes situation real or that stop up because of scar tissue, etc.) maybe need to keep the individuality of the relative constant density of medicament.

Yet composition of the present invention can be prepared being used in interior any effective way and sends by including, but is not limited to following various approach: (for example intravenously), intracutaneous outside the enteron aisle, subcutaneous, mouth, nose, segmental bronchus, eye, transdermal (part), saturating mucous membrane, rectum and vaginal approach.Preferred route of delivery comprises outer, the saturating mucous membrane of enteron aisle, nose, segmental bronchus and oral route.Medical composition of the present invention generally includes the RNAi inductor or will cause the carrier that the RNAi inductor produces after sending, and pharmaceutically acceptable supporting agent.As used herein, " pharmaceutically acceptable supporting agent " speech comprises and medicine throwing and compatible solvent, dispersion medium, coating, antibacterial agent and anti-mycotic agent, isotonic agent and absorption delayer etc.Also can incorporate in the composition replenishing active compound.

The preparation medical composition is to throw compatible with approach with expection.The solution or the suspension that are used for enteron aisle outer (for example intravenously), intramuscular, intracutaneous or subcutaneous application can comprise following component: sterile diluent, such as water for injection, salt brine solution, fixed oil, polyoxyethylene glycol, glycerine, propylene glycol or other synthetics; Antibacterial agent is such as benzylalcohol or para methyl paraben; Antioxidant is such as xitix or sodium bisulfite; Sequestrant is such as ethylenediamine tetraacetic acid (EDTA) (EDTA); Buffer reagent is such as acetate, Citrate trianion or phosphoric acid salt; With the reagent that is used to regulate osmotic pressure, such as sodium-chlor or glucose.PH value usable acid or alkali are regulated, all example hydrochloric acids or sodium hydroxide.The enteron aisle external preparation can pack ampoule, disposable syringe into or the multiple dose vials made by glass or plastics in.

The medical composition that is suitable for injecting purposes generally includes aseptic aqueous solution (if water miscible) or dispersion liquid and is used for preparing the sterilized powder of aseptic injectable solution or dispersion liquid temporarily.Concerning intravenously throw with, the supporting agent that is fit to comprises physiological saline, bacteriostatic water, Cremophor EL ^TM(BASF, Parsippany NJ) or phosphate buffered saline (PBS) (PBS).In all cases, composition should be aseptic, and should be the liquid that is easy injection degree.Preferred medicine prescription is stable under manufacturing and storage condition, and necessary prevention is such as microbiological contamination effects such as bacterium and fungies.Usually, relevant supporting agent can be solvent or the dispersion medium that contains (for example) water, ethanol, polyvalent alcohol (for example, glycerine, propylene glycol and liquid polyethylene glycol etc.) and its suitable mixture.Can (for example) by using coating, by under deployment conditions, keeping required granularity and by using tensio-active agent to keep suitable flowability such as Yelkin TTS.Prevention to microbial process can be passed through various antibacterial agents and anti-mycotic agent, and for example parabens, chlorobutanol, phenol, xitix, Thiomersalate (thimerosal) etc. reach.In many cases, will preferably comprise isotonic agent in composition, for example, sugar is such as the polyvalent alcohol of N.F,USP MANNITOL, Sorbitol Powder, sodium-chlor.By comprise for example reagent of the delayed absorption of aluminum monostearate and gelatin in composition, cocoa prolongs the absorption of injectable composition.

Aseptic injectable solution can carry out filtration sterilization and prepare by the active compound of aequum is incorporated in the appropriate solvent with one of the composition above enumerated or combination when then needing.Preferably, the solution that is used to inject does not contain intracellular toxin.Usually, dispersion liquid is to prepare by active compound being incorporated into contain in basic dispersion medium and the aseptic vehicle from required other compositions of above enumerating composition.Be used to prepare under the sterilized powder situation of aseptic injectable solution, the preferred preparation method is vacuum-drying and lyophilize, and described method produces from its previous sterile filtration solution has the powder that activeconstituents adds any desired composition in addition.

Oral compositions generally includes inert diluent or edible supporting agent.For carry out oral administration throw with, can be with active compound and vehicle merging, and with tablet, buccal tablet or for example the capsule form of gelatine capsule use.Oral compositions also can use liquid carrier to prepare to be used as gargarisma.Can comprise pharmaceutically compatible tackiness agent and/or auxiliary substance part as composition.Tablet, pill, capsule, buccal tablet etc. can contain any composition in the following composition, or the compound with similarity: tackiness agent, such as Microcrystalline Cellulose, Tragacanth or gelatin; Vehicle is such as starch or lactose; Disintegrating agent is such as alginic acid, Primogel or W-Gum; Lubricant is such as Magnesium Stearate or Sterote; Glidant is such as colloid silica; Sweeting agent is such as sucrose or asccharin; Or seasonings, such as peppermint, wintergreen oil or orange flavoring.The prescription that is used for oral delivery can advantageously be incorporated the reagent that is used to improve the stability in gi tract and/or strengthens absorption into.

RNAi of the present invention induces any RNAi in the entity to induce the general throwing of entity and also can be undertaken by saturating mucous membrane or transdermal means.Concerning saturating mucous membrane or transdermal throw with, the permeate agent that will be suitable for barrier to be infiltrated is used for prescription.Described permeate agent is known in affiliated field usually, and concerning saturating mucous membrane throw with, comprise (for example) washing composition, biliary salts and fusidic acid derivatives.Saturating mucous membrane is thrown and can be finished by using nasal spray or suppository.Concerning transdermal throw with, active compound is mixed with known ointment, salve, gel or emulsion in affiliated field usually.Compound also can be used for the suppository that rectum sends (for example, having conventional suppository bases, such as theobroma oil and other glyceryl ester) or the retention enema form prepares.

Except that delivery agents mentioned above, in certain embodiments of the present invention, active entity is to utilize the protection compound to prepare from the supporting agent that health is eliminated fast avoiding, and such as controlled release formulation, comprises implant system and microencapsulation delivery system.Can use biodegradable, can biocompatible polymkeric substance, such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen protein, poe and poly(lactic acid).Can a few hours, a couple of days, several weeks or even longer period in the slowly-releasing prescription of release bioactive agent may be specially adapted to prevent purpose.The method that is used to prepare described prescription is conspicuous to the those skilled in the art.Described material also can be from Alza Corporation and Nova Pharmaceuticals, and Inc buys.Liposome suspension (liposome that comprises the target infected cell with at virus antigen monoclonal antibody) also can be used as pharmaceutically acceptable supporting agent.Described suspension can prepare according to the known method of those skilled in the art, for example, as the 4th, 522, the method described in No. 811 United States Patent (USP)s.

For reaching throwing and simplicity and dose uniformity, advantageously, the oral or outer composition of enteron aisle with the dosage unit form preparation.Dosage unit form is meant the physically discrete unit that is suitable as the dosage unit that is used for person under inspection to be treated as used herein; Each unit contain with required medical supporting agent bonded through calculating active compound with the predetermined amount that produces desired therapeutic action.

The toxicity of described compound and therapeutic efficiency can by in cell culture or laboratory animal (for example) be used to measure LD ₅₀(50% colony's lethal dose) and ED ₅₀The standard pharmaceutical program of (50% mass treatment effective dose) is measured.The dosage rate of toxic action and therapeutic action is therapeutic index and can be expressed as ratio LD ₅₀/ ED ₅₀The compound that represents high therapeutic index is preferred.Though can use the compound that represents toxic side effects, the delivery system of answering careful design that described targeting compounds is attacked the position of tissue, so that will minimize to may damaging of non-infected cells, and and then reduction side effect.

The data that obtained from cell culture analysis and zooscopy can be used to formulate the dosage range that uses for human.The dosage of described compound preferably is in the scope of circulation composition, and described concentration comprises having very little toxicity or do not have toxic ED ₅₀Visual employed formulation of dosage and the throwing that utilized and approach and in described scope, change.Concerning any compound that is used for the inventive method, the treatment effective dose can be at first according to cell culture analysis estimate.Dosage can be prepared in animal model to reach the circulating plasma concentration range as being measured in cell culture, and described scope comprises IC ₅₀(that is, and when reaching half maximum inhibition of symptom, the concentration of test compounds).Described information can be used for the effective dose among definite more accurately mankind.Can (for example) measure content in the blood plasma by high performance liquid chromatography.

The treatment significant quantity of medical composition normally arrives the 30mg/kg body weight about 0.001, preferred about 0.01 to the 25mg/kg body weight, more preferably from about 0.1 to the 20mg/kg body weight, and even more preferably from about 1 arrive 10mg/kg, 2 to 9mg/kg, 3 to 8mg/kg, 4 arrive 7mg/kg, or 5 arrive in the scope of 6mg/kg body weight.Medical composition can be on demand with the various timed intervals with throw through different periods with, for example, repeatedly once a day, every other day once, last about 1 to 10 week once in a week, 2 to 8 weeks, about 3 to 7 weeks, about 4,5 or 6 weeks etc. every day.It will be understood by one of ordinary skill in the art that, some factor may influence effective treatment person under inspection required dosage and timing, described factor includes, but is not limited to the seriousness of disease or illness, previous treatment, person under inspection's comprehensive health situation and/or age and existing other diseases.Usually, induce entity treatment person under inspection, can comprise single therapy or in many cases can comprising a series of treatment with RNAi as described herein.

Exemplary dosage comprises the milligram or the micrograms (for example, every kilogram of about 1 μ g/kg is to every kilogram of about 500mg/kg, and about 100mg/kg arrives about 5mg/kg, or about 1mg/kg arrives about 50mg/kg) of nucleic acid of the present invention of for example siRNA of every kilogram of person under inspection or example weight.The part is thrown and (for example, in the nose), can use dosage much smaller than described dosage.

Should be appreciated that in addition the suitable dosage of RNAi inductor depends on the effectiveness of medicament, and optionally (for example) makes at special receptor up to the desired reaction that reaches preliminary election by throwing with ascending-dose to measure.Should be appreciated that, the given dose level that is used for any particular animals person under inspection can be depending on various factors, the activity that comprises employed specific compound, person under inspection's age, body weight, comprehensive health situation, sex and diet, throw and the time, throw and approach discharge rate, any drug regimen and expression or active degree to be regulated and control.

The composition that the present invention includes the nucleic acid of the present invention that contains siRNA for example or shRNA is used for the treatment of the non-human animal's who includes, but is not limited to horse, pig and birds purposes.Therefore, throw and dosage and method can select according to the known principle of veterinary pharmacology and medical science.Guidance is found in (for example) Adams, R. (ed.), Veterinary Pharmacology andTherapeutics, the 8th edition, Iowa State University Press; ISBN:0813817439; In 2001.

Medical composition of the present invention can together be used for throwing with specification sheets be included in container, packing or divider.

Illustration

Example 1: suppress the design of the siRNA of influenza A virus

To be compared with the normal chain form from the genome sequence of one group of strains of influenza viruses, and discerned the most conservative zone in each fragment.Described viral group comprises the virus that derives from bird, pig, horse and the mankind.For carrying out relatively, in the future comfortable different year is separated the sequence alignment of the individual sections of the sequence of individual sections of 12 to 15 kinds of bacterial strains of influenza A virus of different animals (non-human) species that obtain and 12 to 15 kinds of bacterial strains that next comfortable different year is separated the mankind that obtain.Select bacterial strain to contain multiple HA and NA hypotype.Be chosen in 0,1 or 2 zone that Nucleotide is different is arranged between the different strains.For example, use following bacterial strain to select the siRNA of target NP transcript, the accession number before the various strain name is meant the accession number of NP sequence, and numbers the length of representing institute's comparative sequences by Nucleotide.

Entry in the following inventory is in proper order: length, time, the hypotype of accession number, strain name, institute's comparative sequences.The accession number difference of other genomic fragments, but can in database mentioned above, easily find.The bacterial strain that is compared is:

NC_002019 A/ Puerto Rico/8,/34 1,565 1934 H1N1

M30746 A/ Weir is inferior-Smith (Wilson-Smith)/33 1,565 1933 H1N1

M81583 A/ Leningrad/134,/47,/57 1,566 1957 H2N2

AF348180 A/ Hong Kong/1,/68 1,520 1968 H3N2

L07345 A/ Memphis/101,/72 1,565 1972 H3N2

Grand (Udorn)/307,/72 1,565 1972 H3N2 of D00051 A/ crow

L07359 A/ Guangdong/38,/77 1,565 1977 H3N2

M59333 A/ Ohio/201,/83 1,565 1983 H1N1

L07364 A/ Memphis/14,/85 1,565 1985 H3N2

M76610 A/ Wisconsin (wisconsin)/3,623,/88 1,565 1988 H1N1

U71144 A/ autumn fields (Akita)/1,/94 1,497 1994 H3N2

AF084277 A/ Hong Kong/483,/97 1,497 1997 H5N1

AF036359 A/ Hong Kong/156,/97 1,565 1997 H5N1

AF250472 A/ aquatic bird/Hong Kong/M603/98 1,497 1998 H11N1

ISDN13443 A/ Sydney/27,4/2,000 1,503 2000 H3N2

M63773 A/ duck/Manitoba (Manitoba)/1,/53 1,565 1953 H10N7

M63775 A/ duck/Pennsylvania/1,/69 1,565 1969 H6N1

M30750 A/ horse/London/1,416,/73 1,565 1973 H7N7

M63777 A/ sea-gull/Maryland/5,/77 1,565 1977 H11N9

M30756 A/ sea-gull/Maryland/1,815,/79 1,565 1979 H13N6

A/ wild duck/Astrakhan (Astrakhan) is (in the Gu

M63785

1565 1982 H14N5

Prokofiev (Gurjev))/263/82

M27520 A/ whale/Maine (Maine)/328,/84 1,565 1984 H13N2

M63768 A/ pig/Iowa (Iowa)/17,672,/88 1,565 1988 H1N1

Z26857 A/ turkey/Germany/3,/91 1,554 1991 H1N1

U49094 A/ duck/Nanchang/1,749,/92 1,407 1992 H11N2

AF156402 A/ chicken/Hong Kong/G9/97 1,536 1997 H9N2

AF285888 A/ pig/ontario (Ontario)/01911-1/99 1,532 1999 H4N6

Fig. 9 shows some the regional example that is chosen in the PA transcript of high conservative between 6 kinds of influenza A varients (all having the human host source), if wherein differ 0,1 or 2 Nucleotide, thinks that so the zone is a high conservative.(notice that sequence is as DNA rather than RNA lists and therefore contain T rather than U.) sequence of strains A/Puerto Rico/8/34 (H1N1) is elected to be basic sequence, that is, other sequences are sequence by comparison.Other members of this group are A/WSN/33 (H1N1), A/ Leningrad/134/17/57 (H2N2), A/ Hong Kong/1/68 (H3N2), A/ Hong Kong/481/97 (H5N1) and A/ Hong Kong/1073/99 (H9N2).This figure presents the multisequencing comparison that produces by computer program CLUSTALW (1.4).The Nucleotide that is different from basic sequence has added shade.

Figure 10 shows and to be chosen between 5 kinds of influenza A varients (all having different animal host sources) and some regional example of the PA transcript of high conservative between 2 kinds of bacterial strains with human host source, if wherein differ 0,1 or 2 Nucleotide, think that so the zone is a high conservative.(notice that sequence is as DNA rather than RNA lists and therefore contain T rather than U.) sequence of strains A/Puerto Rico/8/34 (H1N1) is elected to be basic sequence, that is, other sequences are sequence by comparison.Other members of this group are A/WSN/33 (H1N1), A/ chicken/FPV/ Rostock (Rostock)/34 (H7N1), A/ turkey/California/189/66 (H9M2), A/ horse/London/1416/73 (H7N7), A/ sea-gull/Maryland/704/77 (H13N6) and A/ pig/Hong Kong/9/98 (H9N2).The Nucleotide that is different from basic sequence has added shade.

In the attention, the sequence in Fig. 9 and 10 relatively, can select many different high conservative region, because the major part of sequence satisfies the standard of high conservative.Yet the sequence with AA at 5 ' end place provides 19 Nucleotide core sequences and 2 Nucleotide, the 3 ' UU overhang in complementary (antisense) siRNA chain.Therefore, the conservative zone of scanning height to be discerning 21 nucleotide segments, and described 21 nucleotide segments have AA so that the complementary nucleotide that is present in the antisense strand of siRNA is UU at its 5 ' end place.For example, each sequence in the shade sequence has AA at its 5 ' end.Notice that the UU 3 ' overhang in the antisense strand of gained siRNA molecule can as shown in table 2ly be replaced by TT or dTdT.Yet the 2nt 3 ' overhang of antisense strand needs not to be UU.

For further specifying described method, Figure 12 be presented between the part in 3 ' zone of 12 kinds of influenza A virus hypotypes with the mankind or animal host source or the NP sequence in the strain isolated sequence relatively.The corresponding part of line sequence and the sequence below the line sequence is used to design siRNA NP-1496 (vide infra).These sequences are presented among Figure 12.Basic sequence is the sequence of strains A/Puerto Rico/8/34.Shaded letter represents to be different from the Nucleotide of basic sequence.

Table 1A is listed in 21 Nucleotide districts of high conservative between segmental each the segmental influenza virus sequence set of virogene.Except that using T to replace the U, according to being present in sequence in the virus mRNA, 5 ' on 3 ' direction, list the sequence among the table 1A.The position of sequence in the numbering expression viral genome.For example, PB2-117/137 is illustrated among the fragment PB2 from the position 117 sequences that extend to position 137.Many sequences satisfy other standard, and promptly described sequence has AA at its 5 ' end place, so that produce 3 ' UU overhang in complementary strand.Concerning the PA fragment, under the situation that has 1 or 2 nucleotide difference, the sequence of siRNA is based on A/PR8/34 (H1N1) bacterial strain, except sequence PA-2087/2107AAGCAATTGAGGAGTGCCTGA (SEQ ID NO:30) is based on A/WSN/33 (H1N1) bacterial strain.Notice that 20 places in the position have 5 kinds to contain G and basic sequence (accession number NC_002019) contains A in 6 kinds of sequences.Therefore, under described situation, the sequence of basic sequence is not used in the siRNA design.Term PA-2087 and PA-2087 (G) alternately use in this article.

For the sequence of listing among the 1A based on table designs siRNA, Nucleotide 3-21 is elected to be the core area of siRNA sense strand sequence, and 2nt 3 ' overhang of being made up of dTdT is added in each calling sequence.To be elected to be corresponding antisense strand with the Nucleotide 1-21 complementary sequence of each sequence.For example, be the sequence PA-44/64 based on high conservative, that is, AATGCTTCAATCCGATGATTG (SEQ ID NO:22) designs siRNA, selects to have the 19nt core area of sequence TGCTTCAATCCGATGATTG (SEQ ID NO:109).2nt 3 ' overhang that interpolation is made up of dTdT, (behind U replacement T) generation sequence 5 '-UGCUUCAAUCCGAUGAUUGdTdT-3 ' (SEQID NO:79), be the sequence of siRNA sense strand.The sequence and the SEQ ID NO:22 of corresponding antisense siRNA chain-ordering, that is, CAAUCAUCGGAUUGAAGCAdTdT (SEQ ID NO:80) complementation, wherein except that 2nt 3 ' overhang, T is replaced by U.

Table 1B lists the siRNA that designs based on the other high conservative region of influenza virus transcript.The sequence that first 19nt sequence that is expressed as the sequence of " sense strand " in table 1B is a high conservative region.Show that sense strand siRNA sequence has the dTdT overhang at 3 ' end, this does not correspond to the influenza virus sequence and is the optional feature of siRNA.The antisense strand that also shows correspondence is also incorporated the dTdT overhang into as optional feature at 3 ' end.The same among the 1B of title and table.For example, PB2-4/22 has justice expression sense strand to have the siRNA of sequence of the Nucleotide 4-22 of PB2 transcript.The PB2-4/22 antisense represents to have corresponding to PB2-4/22 the complementary antisense strand of justice.The siRNA in the site of the leap splice site in the target transcript, be presented at the not interior position of montage transcript.For example, M-44-52/741-750 shows in montage mRNA, corresponding to the Nucleotide of the 44-52 of genome sequence and 741-750 by target.

Some 21 Nucleotide districts of the standard of high conservative are represented to satisfy in shadow zone among Fig. 9 and 10.Based on these sequences siRNA that designs as indicated above.Listed the actual siRNA sequence of being tested in the table 2.

Table 1A. is used to design the conserved regions of the siRNA that disturbs the influenza A virus infection

Fragment 1:PB2

PB2-117/137 AATCAAGAAGTACACATCAGG (SEQ ID NO：1)

PB2-124/144 AAGTACACATCAGGAAGACAG (SEQ ID NO：2)

PB2-170/190 AATGGATGATGGCAATGAAAT (SEQ ID NO：3)

PB2-195/215 AATTACAGCAGACAAGAGGAT (SEQ ID NO：4)

PB2-1614/1634 AACTTACTCATCGTCAATGAT (SEQ ID NO：5)

PB2-1942/1962 AATGTGAGGGGATCAGGAATG (SEQ ID NO：6)

PB2-2151/2171 AAGCATCAATGAACTGAGCAA (SEQ ID NO：7)

PB2-2210/2230 AAGGAGACGTGGTGTTGGTAA (SEQ ID NO：8)

PB2-2240/2260 AACGGGACTCTAGCATACTTA (SEQ ID NO：9)

PB2-2283/2303 AAGAATTCGGATGGCCATCAA (SEQ ID NO：10)

Fragment 2:PB1

PB1-6/26 AAGCAGGCAAACCATTTGAAT (SEQ ID NO：11)

PB1-15/35 AACCATTTGAATGGATGTCAA (SEQ ID NO：12)

PB1-34/54 AATCCGACCTTACTTTTCTTA (SEQ ID NO：13)

PB1-56/76 AAGTGCCAGCACAAAATGCTA (SEQ ID NO：14)

PB1-129/149 AACAGGATACACCATGGATAC (SEQ ID NO：15)

PB1-1050/1070 AATGTTCTCAAACAAAATGGC (SEQ ID NO：16)

PB1-1242/1262 AATGATGATGGGCATGTTCAA (SEQ ID NO：17)

PB1-2257/2277 AAGATCTGTTCCACCATTGAA (SEQ ID NO：18)

Fragment 3:PA

PA-6/26 AAGCAGGTACTGATCCAAAAT (SEQ ID NO：19)

PA-24/44 AATGGAAGATTTTGTGCGACA (SEQ ID NO：20)

PA-35/55 TTGTGCGACAATGCTTCAATC (SEQ ID NO：21)

PA-44/64 AATGCTTCAATCCGATGATTG (SEQ ID NO：22)

PA-52/72 AATCCGATGATTGTCGAGCTT (SEQ ID NO：23)

PA-121/141 AACAAATTTGCAGCAATATGC (SEQ ID NO：24)

PA-617/637 AAGAGACAATTGAAGAAAGGT (SEQ ID NO：25)

PA-711/731 TAGAGCCTATGTGGATGGATT (SEQ ID NO：26)

PA-739/759 AACGGCTACATTGAGGGCAAG (SEQ ID NO：27)

PA-995/1015 AACCACACGAAAAGGGAATAA (SEQ ID NO：28)

PA-2054/2074 AACCTGGGACCTTTGATCTTG (SEQ ID NO：29)

PA-2087/2107 AAGCAATTGAGGAGTGCCTGA (SEQ ID NO：30)

PA-2110/2130 AATGATCCCTGGGTTTTGCTT (SEQ ID NO：31)

PA-2131/2151 AATGCTTCTTGGTTCAACTCC (SEQ ID NO：32)

Fragment 4:HA

HA-1119/1139 TTGGAGCCATTGCCGGTTTTA (SEQ ID NO：33)

HA-1121/1141 GGAGCCATTGCCGGTTTTATT (SEQ ID NO：34)

HA-1571/1591 AATGGGACTTATGATTATCCC (SEQ ID NO：35)

Fragment 5:NP

NP-19/39 AATCACTCACTGAGTGACATC (SEQ ID NO：36)

NP-42/62 AATCATGGCGTCCCAAGGCAC (SEQ ID NO：37)

NP-231/251 AATAGAGAGAATGGTGCTCTC (SEQ ID NO：38)

NP-390/410 AATAAGGCGAATCTGGCGCCA (SEQ ID NO：39)

NP-393/413 AAGGCGAATCTGGCGCCAAGC (SEQ ID NO：40)

NP-708/728 AATGTGCAACATTCTCAAAGG (SEQ ID NO：41)

NP-1492/1512 AATGAAGGATCTTATTTCTTC (SEQ ID NO：42)

NP-1496/1516 AAGGATCTTATTTCTTCGGAG (SEQ ID NO：43)

NP-1519/1539 AATGCAGAGGAGTACGACAAT (SEQ ID NO：44)

Fragment 6:NA

NA-20/40 AATGAATCCAAATCAGAAAAT (SEQ ID NO：45)

NA704/724 GAGGACACAAGAGTCTGAATG (SEQ ID NO：46)

NA-861/881 GAGGAATGTTCCTGTTACCCT (SEQ ID NO：47)

NA-901/921 GTGTGTGCAGAGACAATTGGC (SEQ ID NO：48)

Fragment 7:M

M-156/176 AATGGCTAAAGACAAGACCAA (SEQ ID NO：49)

M-175/195 AATCCTGTCACCTCTGACTAA (SEQ ID NO：50)

M-218/238 ACGCTCACCGTGCCCAGTGAG (SEQ ID NO：51)

M-244/264 ACTGCAGCGTAGACGCTTTGT (SEQ ID NO：52)

M-373/393 ACTCAGTTATTCTGCTGGTGC (SEQ ID NO：53)

M-377/397 AGTTATTCTGCTGGTGCACTT (SEQ ID NO：54)

M-480/500 AACAGATTGCTGACTCCCAGC (SEQ ID NO：55)

M-584/604 AAGGCTATGGAGCAAATGGCT (SEQ ID NO：56)

M-598/618 AATGGCTGGATCGAGTGAGCA (SEQ ID NO：57)

M-686/706 ACTCATCCTAGCTCCAGTGCT (SEQ ID NO：58)

M-731/751 AATTTGCAGGCCTATCAGAAA (SEQ ID NO：59)

M-816/836 ATTGTGGATTCTTGATCGTCT (SEQ ID NO：60)

M-934/954 AAGAATATCGAAAGGAACAGC (SEQ ID NO：61)

M-982/1002 ATTTTGTCAGCATAGAGCTGG (SEQ ID NO：62)

Fragment 8:NS

NS-101/121 AAGAACTAGGTGATGCCCCAT (SEQ ID NO：63)

NS-104/124 AACTAGGTGATGCCCCATTCC (SEQ ID NO：64)

NS-128/148 ATCGGCTTCGCCGAGATCAGA (SEQ ID NO：65)

NS-137/157 GCCGAGATCAGAAATCCCTAA (SEQ ID NO：66)

NS-562/582 GGAGTCCTCATCGGAGGACTT (SEQ ID NO：67)

NS-589/609 AATGATAACACAGTTCGAGTC (SEQ ID NO：68)

Table 1B. is used to design the conserved regions of the siRNA that disturbs the influenza A virus infection

Fragment 1:PB2

PB2-4/22 has adopted GAAAGCAGGUCAAUUAUAUdTdT SEQ ID NO:190)

PB2-4/22 antisense AUAUAAUUGACCUGCUUUCdTdT SEQ ID NO:191)

PB2-12/30 has adopted GUCAAUUAUAUUCAAUAUGdTdT SEQ ID NO:192)

PB2-12/30 antisense CAUAUUGAAUAUAAUUGACdTdT SEQ ID NO:193)

PB2-68/86 has adopted CUCGCACCCGCGAGAUACUdTdT SEQ ID NO:194)

PB2-68/86 antisense AGUAUCUCGCGGGUGCGAGdTdT SEQ ID NO:195)

PB2-115/133 has adopted AUAAUCAAGAAGUACACAUdTdT SEQ ID NO:196)

PB2-115/133 antisense AUGUGUACUUCUUGAUUAUdTdT SEQ ID NO:197)

PB2-167/185 has adopted UGAAAUGGAUGAUGGCAAUdTdT SEQ ID NO:198)

PB2-167/185 antisense AUUGCCAUCAUCCAUUUCAdTdT SEQ ID NO:199)

PB2-473/491 has adopted CUGGUCAUGCAGAUCUCAGdTdT SEQ ID NO:200)

PB2-473/491 antisense CUGAGAUCUGCAUGACCAGdTdT SEQ ID NO:201)

PB2-956/974 has adopted UAUGCAAGGCUGCAAUGGGdTdT SEQ ID NO:202)

PB2-956/974 antisense CCCAUUGCAGCCUUGCAUAdTdT SEQ ID NO:203)

PB2-1622/1640 has adopted CAUCGUCAAUGAUGUGGGAdTdT SEQ ID NO:204)

PB2-1622/1640 antisense UCCCACAUCAUUGACGAUGdTdT SEQ ID NO:205)

Fragment 2:PB1

PB1-1124/1142 has adopted AAAUACCUGCAGAAAUGCUdTdT SEQ ID NO:206)

PB1-1124/1142 antisense AGCAUUUCUGCAGGUAUUUdTdT SEQ ID NO:207)

PB1-1618/1636 has adopted AACAAUAUGAUAAACAAUGdTdT SEQ ID NO:208)

PB1-1618/1636 antisense CAUUGUUUAUCAUAUUGUUdTdT SEQ ID NO:209)

Fragment 3:PA

PA-3/21 has adopted CGAAAGCAGGUACUGAUCCdTdT SEQ ID NO:210)

PA-3/21 antisense GGAUCAGUACCUGCUUUCGdTdT SEQ ID NO:211)

PA-544/562 has adopted AGGCUAUUCACCAUAAGACdTdT SEQ ID NO:212)

PA-544/562 antisense GUCUUAUGGUGAAUAGCCUdTdT (SEQ ID NO:213)

PA-587/605 has adopted GGGAUUCCUUUCGUCAGUCdTdT (SEQ ID NO:214)

PA-587/605 antisense GACUGACGAAAGGAAUCCCdTdT (SEQ ID NO:215)

PA-1438/1466 has adopted GCAUCUUGUGCAGCAAUGGdTdT (SEQ ID NO:216)

PA-1438/1466 antisense CCAUUGCUGCACAAGAUGCdTdT (SEQ ID NO:217)

PA-2175/2193 has adopted GUUGUGGCAGUGCUACUAUdTdT (SEQ ID NO:218)

PA-2175/2193 antisense AUAGUAGCACUGCCACAACdTdT (SEQ ID NO:219)

PA-2188/2206 has adopted UACUAUUUGCUAUCCAUACdTdT (SEQ ID NO:220)

PA-2188/2206 antisense GUAUGGAUAGCAAAUAGUAdTdT (SEQ ID NO:221)

Fragment 5:NP

NP-14/32 has adopted UAGAUAAUCACUCACUGAGdTdT ' SEQ ID NO:222)

NP-14/32 antisense CUCAGUGAGUGAUUAUCUAdTdT SEQ ID NO:223)

NP-50/68 has adopted CGUCCCAAGGCACCAAACGdTdT SEQ ID NO:224)

NP-50/68 antisense CGUUUGGUGCCUUGGGACGdTdT SEQ ID NO:225)

NP-1505/1523 has adopted AUUUCUUCGGAGACAAUGCdTdT SEQ ID NO:226)

NP-1505/1523 antisense GCAUUGUCUCCGAAGAAAUdTdT SEQ ID NO:227)

NP-1521/1539 has adopted UGCAGAGGAGUACGACAAUdTdT SEQ ID NO:228)

NP-1521/1539 antisense AUUGUCGUACUCCUCUGCAdTdT SEQ ID NO:229)

NP-1488/1506 has adopted GAGTAATGAAGGATCTTATdTdT SEQ ID NO:230)

NP-1488/1506 antisense 231) ATAAGATCCTTCATTACTCdTdT SEQ ID NO:

Fragment 7:M

M-3/21 has adopted CGAAAGCAGGUAGAUAUUGdTdT SEQ ID NO:232)

M-3/21 antisense CAAUAUCUACCUGCUUUCGdTdT SEQ ID NO:233)

M-13/31 has adopted UAGAUAUUGAAAGAUGAGUdTdT SEQ ID NO:234)

M-13/31 antisense ACUCAUCUUUCAAUAUCUAdTdT SEQ ID NO:235)

M-150/158 has adopted UCAUGGAAUGGCUAAAGACdTdT SEQ ID NO:236)

M-150/158 antisense GUCUUUAGCCAUUCCAUGAdTdT SEQ ID NO:237)

M-172/190 has adopted ACCAAUCCUGUCACCUCUGdTdT SEQ ID NO:238)

M-172/190 antisense CAGAGGUGACAGGAUUGGUdTdT SEQ ID NO:239)

M-211/229 has adopted UGUGUUCACGCUCACCGUGdTdT SEQ ID NO:240)

M-211/229 antisense CACGGUGAGCGUGAACACAdTdT SEQ ID NO:241)

M-232/250 has adopted CAGUGAGCGAGGACUGCAGdTdT SEQ ID NO:242)

M-232/250 antisense CUGCAGUCCUCGCUCACUGdTdT SEQ ID NO:243)

M-255/273 has adopted GACGCUUUGUCCAAAAUGCdTdT SEQ ID NO:244)

M-255/273 antisense GCAUUUUGGACAAAGCGUCdTdT SEQ ID NO:245)

M-645/663 has adopted GUCAGGCUAGGCAAAUGGUdTdT SEQ ID NO:246)

M-645/663 antisense ACCAUUUGCCUAGCCUGACdTdT SEQ ID NO:247)

M-723/741 has adopted UUCUUGAAAAUUUGCAGGCdTdT SEQ ID NO:248)

M-723/741 antisense GCCUGCAAAUUUUCAAGAAdTdT SEQ ID NO:249)

M-808/826 has adopted UCAUUGGGAUCUUGCACUUdTdT SEQ ID NO:250)

M-808/826 antisense AAGUGCAAGAUCCCAAUGAdTdT SEQ ID NO:251)

M-832/850 has adopted UGUGGAUUCUUGAUCGUCUdTdT SEQ ID NO:252)

M-832/850 antisense AGACGAUCAAGAAUCCACAdTdT SEQ ID NO:253)

M-986/1004 has adopted UGUCAGCAUAGAGCUGGAGdTdT SEQ ID NO:254)

M-986/1004 antisense CUCCAGCUCUAUGCUGACAdTdT SEQ ID NO:255)

M-44-52/741-750 has adopted GTCGAAACGCCTATCAGAAdTdT SEQ ID NO:256)

M-44-52/741-750 antisense UUCUGAUAGGCGUUUCGACdTdT SEQ ID NO:257)

Fragment 8:NS

NS-5/23 has adopted AAAAGCAGGGUGACAAAGAdTdT SEQ ID NO:258)

NS-5/23 antisense UCUUUGUCACCCUGCUUUUdTdT SEQ ID NO:259)

NS-9/27 has adopted GCAGGGUGACAAAGACAUAdTdT SEQ ID NO:260)

NS-9/27 antisense UAUGUCUUUGUCACCCUGCdTdT SEQ ID NO:261)

NS-543/561 has adopted GGAUGUCAAAAAUGCAGUUdTdT SEQ ID NO:262)

NS-543/561 antisense AACUGCAUUUUUGACAUCCdTdT SEQ ID NO:263)

NS-623/641 has adopted AGAGAUUCGCUUGGAGAAGdTdT SEQ ID NO:264)

NS-623/641 antisense CUUCUCCAAGCGAAUCUCUdTdT SEQ ID NO:265)

NS-642/660 has adopted CAGUAAUGAGAAUGGGAGAdTdT SEQ ID NO:266)

NS-642/660 antisense UCUCCCAUUCUCAUUACUGdTdT SEQ ID NO:267)

NS-831/849 has adopted UUGUGGAUUCUUGAUCGUCdTdT SEQ ID NO:268)

NS-831/839 antisense GACGAUCAAGAAUCCACAAdTdT SEQ ID NO:269)

Example 2: the siRNA of target viral rna polymerase or nucleoprotein suppresses influenza A virus and produces

Material and method

Cell cultures. make Madin-Darby Madin-Darby canine kidney(cell line) (MDCK) (from NY, New York, Mount SinaiSchool of Medicine, the donation of Dr.Peter Palese), in the DMEM substratum that contains 10% hot deactivation FCS, 2mM L-glutaminate, 100 units/ml penicillin (penicillin) and 100 μ g/ml Streptomycin sulphates (streptomycin), grow.Cell is at 37 ℃, 5%CO ₂Following growth.Concerning electroporation, cell is remained in RPMI 1640 substratum that do not contain serum.Virus infection be infect substratum (DMEM, 0.3% bovine serum albumin (and BSA, Sigma, St.Louis, MO), 10mM Hepes, 100 units/ml penicillin and 100ug/ml Streptomycin sulphate) in carry out.

Virus. under 37 ℃, make influenza virus A/PR/8/34 (PR8) and A/WSN/33 (WSN), hypotype H1N1, (from Mount Sinai School of Medicine, the donation of Dr.Peter Palese), contain embryo ovum gallinaceum (Charles River laboratories, MA) middle growth 48h at 10 ages in days.Collect allantoic fluid and storage under-80 ℃ behind the virus inoculation 48h.In example as herein described, all use identical virus strain and method.

SiRNA. the siRNA that designs as indicated above.Except that meeting the choice criteria described in the example 1, usually according to technical bulletin #003-Revision B, " siRNA Oligonucleotides for RNAi Applications " (DharmaconResearch, Inc., Lafayette, CO 80026) principle in described designs siRNA.Contain and siRNA design variable, relevant various information such as synthetic from the technical bulletin #003 of Dharmacon and #004, and incorporate this paper by reference into.Listed in the table 2 tested justice and antisense sequences arranged.

Table 2.siRNA sequence

Title SiRNA sequence (5 '-3 ')

PB2-2210/2230 (justice is arranged) GGAGACGUGGUGUUGGUAAdTdT (SEQ ID NO:69)

PB2-2210/2230 (antisense) UUACCAACACCACGUCUCCdTdT (SEQ ID NO:70)

PB2-2240/2260 (justice is arranged) CGGGACUCUAGCAUACUUAdTdT (SEQ ID NO:71)

PB2-2240/2260 (antisense) UAAGUAUGCUAGAGUCCCGdTdT (SEQ ID NO:72)

PB1-6/26 (justice is arranged) GCAGGCAAACCAUUUGAAUdTdT (SEQ ID NO:73)

PB1-6/26 (antisense) AUUCAAAUGGUUUGCCUGCdTdT (SEQ ID NO:74)

PB1-129/149 (justice is arranged) CAGGAUACACCAUGGAUACdTdT (SEQ ID NO:75)

PB1-129/149 (antisense) GUAUCCAUGGUGUAUCCUGdTdT (SEQ ID NO:76)

PB1-2257/2277 (justice is arranged) GAUCUGUUCCACCAUUGAAdTdT (SEQ ID NO:77)

PB1-2257/2277 (antisense) UUCAAUGGUGGAACAGAUCdTdT (SEQ ID NO:78)

PA-44/64 (justice is arranged) UGCUUCAAUCCGAUGAUUGdTdT (SEQ ID NO:79)

PA-44/64 (antisense) CAAUCAUCGGAUUGAAGCAdTdT (SEQ ID NO:80)

PA-739/759 (justice is arranged) CGGCUACAUUGAGGGCAAGdTdT (SEQ ID NO:81)

PA-739/759 (antisense) CUUGCCCUCAAUGUAGCCGdTdT (SEQ ID NO:82)

PA-2087/2107 (G) (justice is arranged) GCAAUUGAGGAGUGCCUGAdTdT (SEQ ID NO:83)

PA-2087/2107 (G) (antisense) UCAGGCACUCCUCAAUUGCdTdT (SEQ ID NO:84)

PA-2110/2130 (justice is arranged) UGAUCCCUGGGUUUUGCUUdTdT (SEQ ID NO:85)

PA-2110/2130 (antisense) AAGCAAAACCCAGGGAUCAdTdT (SEQ ID NO:86)

PA-2131/2151 (justice is arranged) UGCUUCUUGGUUCAACUCCdTdT (SEQ ID NO:87)

PA-2131/2151 (antisense) GGAGUUGAACCAAGAAGCAdTdT (SEQ ID NO:88)

NP-231/251 (justice is arranged) UAGAGAGAAUGGUGCUCUCdTdT (SEQ ID NO:89)

NP-231/251 (antisense) GAGAGCACCAUUCUCUCUAdTdT (SEQ ID NO:90)

NP-390/410 (justice is arranged) UAAGGCGAAUCUGGCGCCAdTdT (SEQ ID NO:91)

NP-390/410 (antisense) UGGCGCCAGAUUCGCCUUAdTdT (SEQ ID NO:92)

NP-1496/1516 (justice is arranged) GGAUCUUAUUUCUUCGGAGdTdT (SEQ ID NO:93)

NP-1496/1516 (antisense) CUCCGAAGAAAUAAGAUCCdTdT (SEQ ID NO:94)

NP-1496/1516a (justice is arranged) GGAUCUUAUUUCUUCGGAGAdTdT (SEQ ID NO:188)

NP-1496/1516a (antisense) UCUCCGAAGAAAUAAGAUCCdTdT (SEQ ID NO:189)

M-37/57 (justice is arranged) CCGAGGUCGAAACGUACGUdTdT (SEQ ID NO:95)

M-37/57 (antisense) ACGUACGUUUCGACCUCGGdTdT (SEQ ID NO:96)

M-480/500 (justice is arranged) CAGAUUGCUGACUCCCAGCdTdT (SEQ ID NO:97)

M-480/500 (antisense) GCUGGGAGUCAGCAAUCUGdTdT (SEQ ID NO:98)

M-598/618 (justice is arranged) UGGCUGGAUCGAGUGAGCAdTdT (SEQ ID NO:99)

M-598/618 (antisense) UGCUCACUCGAUCCAGCCAdTdT (SEQ ID NO:100)

M-934/954 (justice is arranged) GAAUAUCGAAAGGAACAGCdTdT (SEQ ID NO:101)

M-934/954 (antisense) GCUGUUCCUUUCGAUAUUCdTdT (SEQ ID NO:102)

NS-128/148 (justice is arranged) CGGCUUCGCCGAGAUCAGAdAdT (SEQ ID NO:103)

NS-128/148 (antisense) UCUGAUCUCGGCGAAGCCGdAdT (SEQ ID NO:104

NS-562/582 (R) (justice is arranged) GUCCUCCGAUGAGGACUCCdTdT (SEQ ID NO:105)

NS-562/582 (R) (antisense) GGAGUCCUCAUCGGAGGACdTdT (SEQ ED NO:106)

NS-589/609 (justice is arranged) UGAUAACACAGUUCGAGUCdTdT (SEQ ID NO:107)

NS-589/609 (antisense) GACUCGAACUGUGUUAUCAdTdT (SEQ ID NO:108)

All siRNA are that (Lafayette CO) uses 2 ' ACE protection chemistry to come synthetic by Dharmacon Research.According to the specification sheets of manufacturers the siRNA chain is gone protection, waiting molar ratio to mix and to anneal by being heated to 95 ℃, and every 30s slowly reduces by 1 ℃ of temperature and slowly reduces by 1 ℃ up to 5 ℃ up to 35 ℃ and per minute.

The siRNA electroporation. with the logarithmic phase culture trypsinized of mdck cell, the washing and with every milliliter 2 * 10 ⁷Individual cell is suspended among the RPMI 1640 that does not contain serum again.The cell of 0.5ml is put into the 0.4cm cuvette, and use 400V, the electroporation apparatus of 975 μ F (Gene Pulser) (Bio-Rad) carries out electroporation with 2.5nmol siRNA.Electroporation efficiency is about 30-40% of viable cell.To assign in 3 holes of 6 orifice plates in the DMEM substratum that contains 10%FCS through the cell of electroporation, and at 37 ℃, 5%CO ₂The following cultivation.

Virus infection. 6 to 8h behind the electroporation, rinses out the substratum that contains serum and under suitable infection multiplicity, and in the hole, each hole contains about 10 with the PR8 of 100 μ l or WSN virus inoculation ⁶Individual cell.With 1,000PFU (virus of per 1,000 cell; MOI=0.001) or 10,000 PFU (virus of per 100 cells; MOI=0.01) virus is come cells infected.After at room temperature cultivating 1h, add in each hole having the tryptic 2ml infection of 4 μ g/ml substratum, and at 37 ℃, 5%CO ₂Following culturing cell.At the appointed time, from infected culture collection supernatant liquor and by chicken red blood corpuscle (50 μ l, 0.5%, Charles River laboratories, the titre of hamegglution mensuration virus MA).

The measurement of virus titer. after infecting 24,36,48 and 60 hours, collect supernatant liquor.Use as Knipe DM, Howley, PM, Fundamental Virology, the 4th edition, the standard homo agglutinin described in the 34-35 page or leaf is analyzed and is measured virus titer.In 96 orifice plates at the bottom of the V-arrangement, carry out the hamegglution analysis.On ice, the chicken red blood corpuscle suspension with isopyknic 0.5% (Charles River Laboratories) is cultivated with continuous 2 times of diluents of each sample.Containing erythrocytic hole adherent, uniform bed keeps the score to just.Concerning plaque is analyzed,, the 4th edition, described in the 32nd page,, measure the virus titer of continuous 10 times of diluents of each sample as known in the affiliated field as Fundamental Virology.

The result

Use siRNA for research and suppress the feasibility that influenza virus is duplicated, the various influenza virus A RNA of target.Specifically, utilize mdck cell system, this clone is easily infected and be widely used in studying flu virus.By electroporation each siRNA is individually introduced in the mdck cell colony.Target GFP (justice arranged: 5 '-GGCUACGUCCAGGAGCGCAUU-3 ' (SEQ ID NO:110); Antisense: 5 '-UGCGCUCCUGGACGUAGCCUU-3 ' (SEQ ID NO:111)) siRNA as contrast.Described siRNA is called GFP-949.In subsequent experimental (be described in hereinafter example in), the UU overhang at 3 ' end place of two chains is replaced with dTdT, to not influence of result.Also carry out the contrast electroporation in contrast.Behind the electroporation 8 hours, under 0.1 or 0.01 MOI,, and, use the standard hamegglution to analyze the virus of analysis of cells to produce at thereafter each time point (24,36,48,60 hours) with influenza A virus PR8 or WSN cells infected.By flow cytometry, use standard method to analyze GFP and express.

Figure 11 A and 11B have compared result of experiment, and wherein indivedual siRNA suppress the ability of duplicating (Figure 11 A) of influenza virus A strains A/Puerto Rico/8/34 (H1N1) or the ability of duplicating (Figure 11 B) of inhibition influenza virus A strains A/WSN/33 (H1N1) is to measure by measuring the HA titre.Therefore, high HA titre shows to lack and suppresses, and low HA titre shows effective inhibition.Under 0.01 MOI, infect mdck cell.Concerning described experiment, a kind of siRNA, a kind of siRNA of target PB2 fragment (PB2-2240/2260), a kind of siRNA and the three kind different siRNAs of target NP genome of target PA fragment (PA-2087/2107 (G)) of test target PB1 fragment (PB1-2257/2277) with transcript (NP-231/251, NP-390/410 and NP-1496/1516).Notice that the legend among Figure 11 A and the 11B has only been listed 5 ' Nucleotide of siRNA.

Nomenclature among Figure 11 A and the 11B is as follows: solid squares represents not accept the control cells of siRNA.Square hollow represents to accept the cell of GFP contrast siRNA.Filled circles represents to accept the cell of siRNAPB1-2257/2277.Open circles represents to accept the cell of siRNA PB2-2240/2260.Hollow triangle represents to accept the cell of siRNAPA-2087/2107 (G).Symbol X represents to accept the cell of siRNA NP-231/251.The cell of siRNANP-390/410 is accepted in symbol+expression.Black triangle represents to accept the cell of siRNANP-1496/1516.Notice that in chart, some symbol is overlapping sometimes.For example, in Figure 11 B, hollow overlapping with black triangle.For being illustrated, but the numerical value of each point has been listed in reference table 3 and 4.

As shown in Figure 11 A and 11B (table 3 and 4), when not having siRNA (blank TF) or have contrast (GFP) siRNA, virus titer increases in time, arrives peaking after infecting about 48-60 hour.By contrast, when having any siRNA, at 60 hours, virus titer was significantly lower.For example, in bacterial strain WSN, with comparing in the contrast, the HA titre in the presence of siRNA PB2-2240 or NP-231 (reflection viral level) is only about half of big.Particularly, in two kinds of bacterial strains, in the presence of siRNANP-1496, viral level be detection limit (10,000PFU/ml) below.This is illustrated in to reduce in the PR8 bacterial strain to surpass 60 times factor and reduce in the WSN bacterial strain and surpasses 120 times factor.In bacterial strain WSN, in the presence of siRNA PA-2087 (G), viral level also be detection limit (10,000PFU/ml) below, and be extremely low in bacterial strain PR8.Even from measured earliest time point, siRNA is tangible to the inhibition that virus produces.After infection, reach 72 hours time point, observed effective inhibition, comprise virus is produced the undetectable level (as measuring by the HA titre) that is suppressed to.

Table 5 has been summarized in mdck cell, and the result of the siRNA inhibition analysis in the time of 60 hours represents to suppress multiple.Therefore, low value shows and lacks inhibition, and high value shows effective inhibition.The position of siRNA in virogene is to be represented by the numbering after the gene title.With other place is the same herein, number table is shown in the nuclei originis thuja acid of siRNA in the gene.For example, NP-1496 represents NP is specific siRNA, and first Nucleotide originates in Nucleotide 1496 places of NP sequence.Shown numerical value (inhibition multiple) is to use the hemagglutination primitive unit cell from the contrast transfection to calculate divided by the hemagglutination primitive unit cell that comes the personal siRNA of appointment transfection; Numerical value 1 expression does not suppress.

In the mdck cell system, test 20 kinds of siRNA altogether, 6 fragments (PB2, PB1, PA, NP, M and NS) (table 5) of these siRNA target influenza virus gene groups.No matter using PR8 still is WSN virus, about 15% the siRNA that is tested (PB1-2257, PA-2087G and NP-1496) shows powerful effect, in most of the cases, suppressing virus under MOI=0.001 produces and surpasses 100 times and suppress virus produce 16 to 64 times under MOI=0.01.Particularly, when using siRNA NP-1496 or PA-2087, inhibition is very significant, so that does not have the homo agglutinin activity that can detect in the culture supernatants.3 kinds of different virogene fragments of described effective siRNA target: PB1 and PA, the two is contained in the RNA transcriptase mixture; And NP, be single stranded RNA syncaryon albumen.Consistent with the discovery in other system, by near the 3 ' end (Figure 13) of the whole relative positionings of the sequence of described siRNA target in the coding region.

About 40% siRNA significantly suppresses virus and produces, but the inhibition degree is looked some parameter and changed.No matter using PR8 still is WSN virus, about 15% siRNA effectively suppresses virus and produces.Yet under the situation of some siRNA, the inhibition degree is looked a little and used PR8 still is WSN and changing.Such as some siRNA such as PB2-2240, PB1-129, NP-231 and M-37, only time point (infection back 24 to 36 hours) or the only generation of inhibition virus significantly under low dosage infection (MOI=0.001) in early days.The virogene fragment that described siRNA target is different, and corresponding sequence is positioned the 3 ' end or near the 5 ' end (Figure 13) of coding region.Table 5A and 5B present analytical results.About 45% siRNA does not have cognizable effect to virus titer, shows that in their influenza virus generations in disturbing mdck cell be not effective.Particularly, the siRNA of 4 kinds of target NS gene fragments does not have any restraining effect of a kind of demonstration.

For estimating virus titer more accurately, from deriving from experience contrast transfection or with the culture supernatants of the cell that is infected by the virus of NP-1496 transfection, (in the time of 60 hours) carry out the plaque analysis of usefulness culture supernatants.In the contrast supernatant liquor, detect about 6 * 10 ⁵Pfu/ml, and in undiluted NP-1496 supernatant liquor, do not detect plaque (Figure 11 C).Because the detection limit of plaque analysis is about 20pfu (plaque forming unit)/ml, so NP-1496 is at least about 30,000 times to the inhibition that virus produces.Even under 0.1 MOI, NP-1496 suppresses virus and produces about 200 times.

Be to measure the effect of siRNA, the NP-1496 transfection of classification amount in mdck cell, is then used the PR8 virus infection.Measure virus titer in the culture supernatants by the homo agglutinin analysis.As shown in Figure 11 D, along with the reduction of siRNA amount, the virus titer in the culture supernatants increases.Yet, even when the siRNA that uses as few as 25pmol carries out transfection, compare with the contrast transfection, detect about 4 times virus and produce inhibition, show that NP-1496siRNA is suppressing the aborning effect of influenza virus.

Concerning therapy, need siRNA can effectively suppress existing virus infection.In typical influenza infection, the virus particle of beginning release new after infecting about 4 hours.For measuring the infection whether siRNA can reduce or eliminate new releasing virus in the face of existing infection, with PR8 virus mdck cell is infected and also then carried out transfection in 2 hours with NP-1496 siRNA.As shown in Figure 11 E, virus titer is stable in time increasing after the contrast transfection, and in the NP-1496 cells transfected, virus titer only increases slightly.Therefore, behind the virus infection throwing of siRNA be effective.

Comprehensive, described result shows that (i) some siRNA can effectively suppress the influenza virus generation; (ii) influenza virus produces and can suppress by different virus gene (comprising coding NP, PA and the proteinic gene of PB1) is had specific siRNA; With, (iii) except throw at siRNA and in or siRNA throw with infected cells afterwards, siRNA throw with before siRNA also to take place in the infected cells suppress.

The inhibition that table 3.siRNA produces virus strain A/ Puerto Rico/8/34 (H1N1)

siRNA
										Contrast	GFP	PB1-2257	PB2-2040	PA-2087(G)	NP-231	NP-390	NP-1496
24hr	8	8	1	4	1	1	4	1
									36hr	16	8	4	8	1	4	8	1
48hr	32	32	4	8	2	4	8	1
									60hr	64	64	8	8	4	8	32	1

The inhibition that table 4.siRNA produces virus strain A/WSN/33 (H1N1)

siRNA
										Contrast	GFP	PB1-2257	PB2-2040	PA-2087(G)	NP-231	NP-390	NP-1496
24hr	32	32	1	8	1	8	16	1

36hr	64	128	16	32	1	64	64	1
									48hr	128	128	16	64	1	64	64	1
60hr	128	128	32	64	1	64	128	1

The effect that table 5A.20 kind siRNA produces influenza virus in the mdck cell

siRNA		Infective virus (MOT)
							PR8 (0.001)	PR8 (0.01)	PR8 (0.1)	WSN (0.001)	WSN (0.01)
		Example 1	GFP-949 PB2-2210 PB2-2240 PB1-6 PB1-129 PB1-2257	2 16 128 4 128 256	1 8 16 4 16 64
Example 2	GFP-949 PA-44 PA-739 PA-2087 PA-2110 PA-2131						2 2 4 128 8 4	1 1 2 16 4 2
		Example 3	NP-231 NP-390 NP-1496 M-37	16 4 16 2	4 2 64 2							4 2 128 128
Example 4	M-37 M-480 M-598 M-934 NS-128 NS-562 NS-589 NP-1496							2 2 2 1 2 1 1 64	16	128 4 128 4 2 1 1 128
		Example 5	GFP-949 PB2-2240 PB1-2257 PA-2087 NP-1496 NP-231		1 8 8 16 64 8								1 2 4 128 128 2

The effect that table 5B.siRNA produces influenza virus in the mdck cell

10 ³Pfu/ hole (MOI 0.001) 10 ⁴Pfu/ hole (MOI

0.01)

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 1 24 HR HR HR 24 HR HR HR 48HR

HR

NT 2 5 4 32 NT 6 7 64 128

NP1496 0 0 1 1 NP1496 3 5 8 32

M3 1 5 2 32 M3 5 7 32 128

M150 1 3 2 8 M150 6 7 64 128

M172 0 2 1 4 M172 6 7 64 128

PB24 0 3 1 8 PB24 5 7 32 128

PB268 1 5 2 32 PB268 6 7 64 128

PB2115 2 5 4 32 PB2115 6 7 64 128

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 2 24 HR HR HR 24 HR HR HR 48 HR

HR

NT 1 4 2 16 NT 7 ＞8 128 ＞256

NP1496 0 1 1 2 NP1496 0 1 1 2

NS5 0 3 1 8 NS5 6 ＞8 64 ＞256

NS9 1 4 2 16 NS9 6 ＞8 64 ＞256

M211 1 4 2 16 M211 7 ＞8 128 ＞256

M232 0 2 1 4 M232 5 ＞8 32 ＞256

PB2167 0 2 1 4 PB2167 5 7 32 128

PB2473 1 4 2 16 PB2473 7 ＞8 128 ＞256

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 3 24 HR HR HR 24 HR HR HR 48 HR

HR

NT 1 5 2 32 NT 4 7 16 128

NP1496 0 1 1 2 NP1496 0 3 1 8

NS543 1 5 2 32 NS543 2 6 4 64

NS623 1 5 2 32 NS623 4 7 16 128

M723 1 5 2 32 M723 2 7 4 128

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 4 24 HR HR HR 24 HR HR HR 48HR

HR

NT 3 6 8 64 NT ＞8 9 ＞256 512

NP1496 0 1 1 2 NP1496 1 4 2 16

NP1501 0 4 1 16 NP1501 6 8 64 256

NS642 3 5 8 32 NS642 8 9 256 512

NS831 3 5 8 32 NS831 8 9 256 512

PB1 3 6 8 64 PB11618 7 9 128 512

1618

PB212 3 5 8 32 PB212 7 9 128 512

M232 2 5 4 32 M232 6 8 64 256

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 5 24 HR HR HR 24 HR HR HR 48HR

HR

NT 1 4 2 16 NT 5 7 32 128

NP1496 0 1 1 2 NP1496 0 1 1 2

NP14 1 4 2 16 NP14 5 7 32 128

NP1488 0 1 1 2 NP1488 0 3 1 8

PB2 0 2 1 4 PB22283 4 5 16 32

2283

PA2188 1 4 2 16 PA2188 4 6 16 64

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 6 24 HR HR HR 24 HR HR HR 48 HR

HR

NT 2 4 4 16 NT 7 8 128 256

NP1496 0 0 1 1 NP1496 1 1 2 2

PB2956 2 4 4 16 PB2956 7 8 128 256

M13 2 4 4 16 M13 7 8 128 256

M255 1 2 2 4 M255 5 6 32 64

M645 1 2 2 4 M645 5 6 32 64

M808 1 3 2 8 M808 6 7 64 128

M832 1 1 2 2 M832 5 6 32 64

M986 2 3 4 8 M986 7 7 128 128

NP1488 0 0 1 1 NP1488 1 4 2 16

Hole count HA unit of hole count HA unit

48 24 48 48 24

Example 7 24 HR HR HR 24 HR HR HR 48 HR

HR

NT 2 5 4 32 NT 6 8 64 256

NP1496 0 0 1 NP1496 2 3 4 8

NP1501 0 4 16 NP1501 4 6 16 64

PB24 0 2 4 PB24 5 6 32 64

PB2 0 3 8 PB22283 4 6 16 64

2283

M172 2 5 4 32 M172 5 7 32 128

M255 0 2 4 M255 4 6 16 64

M645 0 3 8 M645 4 6 16 64

M832 0 1 2 M832 4 6 16 64

Example 3: the influenza A virus that the siRNA of target viral rna polymerase or nucleoprotein suppresses in the chicken embryo produces.

Material and method

The SiRNA-oligofectamine mixture forms and egg inoculation. preparation siRNA as indicated above.Ovum gallinaceum is maintained under the standard conditions.The Oligofectamine of 30 μ l (production code member: 12252011, from Life Technologies, now Invitrogen) is mixed with the Opti-MEM I (Gibco) of 30 μ l and under RT, cultivate 5min.The siRNA of 2.5nmol (10 μ l) is mixed with the Opti-MEM I of 30 μ l and add among the diluted oligofectamine.Under RT, siRNA and oligofectamine are cultivated 30min.With PR8 virus (5000pfu/ml) the inoculation 10 age in days ovum gallinaceums of siRNA-oligofectamine mixture together with 100 μ l.Under 37 ℃, ovum cultivated the fixed time and collect allantoic fluid.As indicated above by the virus titer in the HA analytical test allantoic fluid.

The result

For confirming the result in mdck cell, also analyze siRNA and suppress the ability that influenza virus produces in the fertilization ovum gallinaceum.Because can not on ovum, use electroporation, so use Oligofectamine (having confirmed to promote the systemic medicament of cell of DNA oligonucleotide) and siRNA (25) in vitro based on lipid.In brief, PR8 virus independent (500pfu) or viral adding among siRNA-oligofectamine mixture such as Figure 14 A are schematically shown in the allantoic cavity that is expelled to 10 age in days ovum gallinaceums.Collect allantoic fluid after 17 hours to be used for by homo agglutinin analysis to measure virus titer.As shown in Figure 14 B, (in the presence of Oligofectamine) easily detects high virus titer when independent injecting virus.Common not remarkably influenced of the injection virus titer of GFP-949.(when omitting Oligofectamine, do not observe the remarkable reduction of virus titer.)

The injection that influenza virus is had specific siRNA shows and the corresponding to result of viewed result in mdck cell: the virus that the identical siRNA (NP-1496, PA2087 and PB1-2257) that the influenza virus in the inhibition mdck cell produces also suppresses in the ovum gallinaceum produces, and not too effective siRNA (NP-231, M-37 and PB 1-129) is invalid in the fertilization ovum gallinaceum in mdck cell.Therefore, the influenza virus of siRNA in disturbing the fertilization ovum gallinaceum also is effective in producing.

Example 4: siRNA suppresses the influenza virus generation under the mRNA level

Material and method

Execution SiRNA preparation as indicated above.

RNA extraction, reverse transcription and PCR in real time .1 * 10 ⁷Individual mdck cell comes electroporation or contrast electroporation (no siRNA) with the NP-1496 of 2.5nmol.After 8 hours, under MOI=0.1, with influenza A PR8 virus inoculation in cell.1,2 and 3 hour time point is removed supernatant liquor after infection, and with Trizol reagent (Gibco) dissolved cell.Specification sheets purifying RNA according to manufacturers.According to the specification sheets of manufacturers, under 37 ℃, use the total RNA of 200ng, Auele Specific Primer (vide infra) and the Omniscript reversed transcriptive enzyme test kit (Qiagen) that are in the 20 μ l reaction mixtures, carried out reverse transcription (RT) 1 hour.It is as follows that mRNA, NP vRNA, NP cRNA, NS vRNA or NS cRNA are had a specific primer:

mRNA，dT ₁₈＝5′-TTTTTTTTTTTTTTTTTT-3′(SEQ ID NO：112)

NP vRNA，NP-367：5′-CTCGTCGCTTATGACAAAGAAG-3′(SEQ ID NO：113)。

NP cRNA，NP-1565R：

5′-ATATCGTCTCGTATTAGTAGAAACAAGGGTATTTTT-3′(SEQ ID NO：114)。

NS vRNA，NS-527：5′-CAGGACATACTGATGAGGATG-3′(SEQ ID NO：115)。

NS cRNA，NS-890R：

5′-ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT-3′(SEQ ID NO：116)。

With the RT reaction mixture of 1 μ l (promptly, by carrying out the sample that reverse transcription obtains) and sequence specific primers be used for PCR in real time, described PCR use comprises the S YBR Green PCRmaster mix (AB Applied Biosystems) of S YBR Green I double-stranded DNA combination dye.In ABI PRISM 7000 sequence detection systems (AB appliedBiosystem), carry out PCR circulation and analyze with ABI PRISM 7000 SDS softwares (AB Applied Biosystems).Under 50 ℃, 2min, under 95 ℃, 10min, then under 95 ℃, under 15sec and 60 ℃, 1min carries out 50 circulations with the PCR reaction.Reading with 0.2 flat fluorescent comes the analysis cycle time.With respond and repeat.Give up between repeating, to change and surpass for 1.0 cycling time.Then the recirculation time is averaged and, obtain standard value from wherein deducting the cycling time of beta-actin.

The PCR primer is as follows.

Concerning NP RNA:

NP-367：5′-CTCGTCGCTTATGACAAAGAAG-3′(SEQ ID NO：117)。

NP-460R：5′-AGATCATCATGTGAGTCAGAC-3′(SEQ ID NO：118)。

Concerning NS RNA:

NS-527：5′-CAGGACATACTGATGAGGATG-3′(SEQ ID NO：119)。

NS-617R：5′-GTTTCAGAGACTCGAACTGTG-3′(SEQ ID NO：120)。

The result

As indicated above, between the influenza virus replicative phase, vRNA is transcribed to produce cRNA that is used as other vRNA synthetic template and the mRNA (1) that is used as the template of protein synthesis.Although known RNAi is with the degraded (16-18) of sequence specific mode target mRNA, vRNA and cRNA also might be the targets of siRNA, because the vRNA of influenza A virus is responsive (1) to nuclease.For the effect of research siRNA to the degraded of various RNA species, use sequence specific primers to carry out reverse transcription, then carry out PCR in real time, so that the content of quantitative vRNA, cRNA and mRNA.Figure 16 shows the relation between influenza virus vRNA, mRNA and the cRNA.As shown in Figure 16 A and 16B, cRNA is the definite complement of vRNA, but mRNA contains 10 to 13 other Nucleotide that cap structure adds host-derived cell mRNA at 5 ' end place, and mRNA contains the polyA sequence at 3 ' end place, this polyA sequence start from from vRNA segmental 5 ' 15-22 the nucleotide site complementary site in end downstream.Therefore, compare with vRNA and cRNA, mRNA lacks 15 to 22 Nucleotide at 3 ' end.For distinguishing 3 kinds of viral RNA species, will have specific primer to vRNA, cRNA and mRNA and be used for reverse transcription reaction (Figure 16 B) first.Concerning mRNA, poly-dT18 is as primer.Concerning cRNA, 3 of the RNA that lacks among use and the mRNA ' end complementary primer.Concerning vRNA, primer can along RNA almost Anywhere, as long as complementary and not too near 5 ' end with vRNA.Increase by PCR in real time and only to transcribe the cDNA that obtains from one of RNA.

Behind the influenza infection, by about 4 hours, neovirion began assembled and discharges.For measuring the effect that siRNA transcribes mRNA and the cRNA of the first round, isolation of RNA early after the infection.In brief, with the NP-1496 electroporation in mdck cell.Also carry out contrast electroporation (no siRNA).After 6 to 8 hours, under MOI=0.1, use the PR8 cells infected.After infection, 1,2 separated with cytolysis and with RNA then with 3 hours.Carry out reverse transcription by the primer that uses various RNA species, then carry out PCR in real time, analyze the content of mRNA, vRNA and cRNA.

Before Figure 17 is presented at and infects approximately 6-8 hour through the contrast transfection or in siRNA NP-1496 cells transfected, with each time point behind the virus infection, the amount of virus N P and NS RNA species.As shown in Figure 17, infect after 1 hour, between warp or the sample without NP siRNA transfection, there is not significant difference in NP mRNA amount.Early to 2 hours, in the contrast transfection group, NP mRNA increases by 38 times after infection, and in the siRNA cells transfected, the content of NP mRNA does not increase (or even reducing a little).Infected back 3 hours, in the contrast transfection, mRNA transcript content continues to increase, and in the cell of accepting the siRNA processing, observes the continuous reduction of NP mRNA amount.Except only in infection back 3 hours, beyond the amount of vRNA and cRNA increased significantly in the contrast transfection, NP vRNA and cRNA showed similar pattern.Though do not wish to be bound by any theory, its this may be life cycle owing to influenza virus, wherein first run mRNA transcribe occur in cRNA and further vRNA synthetic before.

Described result shows that with consistent by homo agglutinin analysis or plaque analysis to measure result complete, live virus, the amount of all NP RNA species is also by handling with NP siRNA and significantly reducing.Although known siRNA mainly mediates the degraded of mRNA, although the hint of result hereinafter described, reduction by the NP protein content due to the reduction of NP mRNA content causes that the stability of NP cRNA and/or vRNA reduces, but does not get rid of the possibility of the degraded of siRNA mediation NP cRNA and vRNA from the data of described experiment.

Example 5: identification RNA interferential target

Material and method

The siRNA preparation of execution unmodified siRNA as indicated above.Also by the synthetic modified RNA oligonucleotide of Dharmacon, wherein at each nucleotide residue place of sense strand or antisense strand or two chains, with 2 '-O-methyl substituted 2 '-hydroxyl.With modified oligonucleotides go the protection and as described in the unmodified oligonucleotide, being annealed into complementary strand.Analyze finishing that the duplex of siRNA duplex forms by gel electrophoresis.

Cell cultures, with the siRNA transfection with use virus infection. these programs of execution as indicated above basically.In brief, concerning the experiment that relates to modified NP-1496 siRNA, use NP-1496 siRNA (2.5nmol) transfection mdck cell earlier, and after 8 hours, under 0.1 MOI, use the PR8 virus infection from wild-type (wt) and modified (m) chain formation.Infect 24 hours virus titers in the post analysis culture supernatants.Concerning the experiment that relates to M-37 siRNA, with M-37 siRNA (2.5nmol) transfection mdck cell, under 0.01 MOI, use the PR8 virus infection, and after infection 1,2 was with 3 hours, collect and separate to be used for RNA.About M-37 justice and antisense sequences are arranged, referring to table 2.

RNA extraction, reverse transcription and PCR in real time are as indicated above basically to be carried out.It is as follows that mRNA, M specificity vRNA and M specificity cRNA are had a specific primer that is used for reverse transcription:

mRNA，dT ₁₈＝5′-TTTTTTTTTTTTTTTTTT-3′(SEQ ID NO：112)

M vRNA：5′-CGCTCAGACATGAGAACAGAATGG-3′(SEQ ID NO：161)

M cRNA：5′-ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT-3′(SEQ ID NO：162)。

The PCR primer of M RNA is as follows:

The M forward: 5 '-CGCTCAGACATGAGAACAGAATGG-3 ' (SEQ ID NO:163)

M is reverse: 5 '-TAACTAGCCTGACTAGCAACCTC-3 ' (SEQ ID NO:164)

The result

For research siRNA remove to disturb the possibility that also may disturb vRNA and/or cRNA the mRNA, the synthetic NP-1496 siRNA that justice (S or+) or antisense (AS or-) chain process modification is arranged.In each nucleotide residue with 2 '-O-methyl substituted 2 '-modification of hydroxyl does not influence and is used for the base pairing that duplex forms, but modified RNA chain no longer supports RNA to disturb.In other words, sense strand through modification but antisense strand is the siRNA of wild-type (mS:wtAS), with support to have with antisense strand complementary sequence rather than with the degraded of the RNA of sense strand complementary sequence.On the contrary, but sense strand is the wild-type antisense strand through modifying the siRNA of (wtS:mAS), with the degraded of supporting to have with the RNA of sense strand complementary sequence, and will not support to have degraded with the RNA of sense strand complementary sequence.

Mdck cell is contrasted transfection, or another chain is that the NP-1496 siRNA of wild-type carries out transfection through modifying with sense strand (mS:wtAS) or antisense strand (wtS:mAS).Also the NP-1496 siRNA that passes through modification (mS:mAS) with two chains comes transfectional cell.Use the PR8 virus infected cell then, and measure the virus titer in the supernatant liquor.Described in Figure 18 A, in standing to contrast the culture of transfection, detect high virus titer.As expected, in culture, detect extremely low virus titer, but in the culture of the siRNA transfection of all passing through modification (mS:mAS) with two chains, detect high virus titer with wild-type siRNA (wtS:wtAS) transfection.In with the culture of antisense strand through the siRNA transfection of modification (wtAS:mAS), virus titer is high, and in the culture with the only siRNA transfection of sense strand process modification (mS:wtAS), virus titer is low.Though do not wish to be bound by any theory, the present inventor thinks, to the demand hint of wild-type antisense (-) chain that suppresses the siRNA duplex that influenza virus produces, RNA interferential target is mRNA (+) or cRNA (+) or both.

For further distinguishing described possibility, research siRNA is to the effect of gathering of corresponding mRNA, vRNA and cRNA.For following the tracks of transcribing of one group of cell through infecting simultaneously, infect 1,2 with 3 hours after (in the release of neovirion with before infecting again) collection separate to be used for RNA through the mdck cell of siRNA transfection.At first by using Auele Specific Primer to carry out reverse transcription and virus mRNA, vRNA and cRNA are transformed into cDNA separately.Then, the content by the quantitative various cDNA of PCR in real time.As shown in Figure 18 B, when using M specific siRNA M-37, after infecting 1 or 2 hour, detect a small amount of M specific mrna.Infect after 3 hours, when not having M-37, easily detect the M specific mrna.In the M-37 cells transfected, the content of M specific mrna reduces about 50%.By contrast, the content of M specificity vRNA and cRNA is not suppressed because of the existence of M-37.Though do not wish to be bound by any theory, described result shows that virus mRNA may be the interferential target that siRNA mediates.

Example 6: the effect that some siRNA gathers viral RNA

Material and method

SiRNA prepares as indicated above the execution.

Carry out described in RNA extraction, reverse transcription and PCR in real time such as the example 3.MRNA, NP vRNA, NPcRNA, NS vRNA, NS cRNA, M vRNA or M cRNA are had described in specific primer such as example 4 and 5.It is as follows that PB1 vRNA, PB1 cRNA, PB2 vRNA, PB2 cRNA, PA vRNA or PA cRNA are had a specific primer that is used for reverse transcription:

PB1 vRNA：5′-GTGCAGAAATCAGCCCGAATGGTTC-3′(SEQ ID NO：165)

PB1 cRNA：5′-ATATCGTCTCGTATTAGTAGAAACAAGGCATTT-3′(SEQ ID NO：166)

PB2 vRNA：5′-GCGAAAGGAGAGAAGGCTAATGTG-3′(SEQ ID NO：167)

PB2 cRNA：5′-ATATGGTCTCGTATTAGTAGAAACAAGGTCGTTT-3′(SEQ ID NO：168)

PA vRNA：5′-GCTTCTTATCGTTCAGGCTCTTAGG-3′(SEQ ID NO：169)

PA cRNA：5′-ATATCGTCTCGTATTAGTAGAAACAAGGTACTT-3′(SEQ ID NO：170)

The PCR primer of PB1, PB2 and PA RNA is as follows:

The PB1 forward: 5 '-CGGATTGATGCACGGATTGATTTC-3 ' (SEQ ID NO:171)

PB1 is reverse: 5 '-GACGTCTGAGCTCTTCAATGGTGGAAC-3 ' (SEQ ID NO:172)

The PB2 forward: 5 '-GCGAAAGGAGAGAAGGCTAATGTG-3 ' (SEQ ID NO:173)

PB2 is reverse: 5 '-AATCGCTGTCTGGCTGTCAGTAAG-3 ' (SEQ ID NO:174)

The PA forward: 5 '-GCTTCTTATCGTTCAGGCTCTTAGG-3 ' (SEQ ID NO:175)

PA is reverse: 5 '-CCGAGAAGCATTAAGCAAAACCCAG-3 ' (SEQ ID NO:176)

The result

Specifically whether whether the content of the degraded of target NP gene fragment or the viral RNA beyond the NP is also influenced in order to measure NP-1496, to have specific primer to NS and be used for RT and PCR in real time, (example 4) as indicated above measures the amount of different N S RNA species (mRNA, vRNA, cRNA).As shown in Figure 19, the change of NS mRNA, vRNA and cRNA show with to the viewed identical pattern of NP RNA.In infection back 3 hours,, can see the remarkable increase of all NS RNA species, and in the cell of accepting NP-1496 siRNA, not see the remarkable change of NS rna content in the contrast cells transfected.This result shows that at least with respect to NP RNA, transcribing and duplicating of different virus RNA transferred altogether.The meaning of transferring is that a kind of content of transcript influences the content of another kind of transcript directly or indirectly altogether.Not implicit special mechanism.When the NP transcript was degraded by the siRNA processing, the content of other viral RNAs also reduced.

For further probing into the effect of NP siRNA, in the cell of handling, measure mRNA, the vRNA of all virogenes and gathering of cRNA with NP-1496 to other viral RNAs.As shown in Figure 19 A (top figure), after infecting 1 or 2 hour, the NP specific mrna is low.Infect after 3 hours, when not having NP-1496, easily detect NP mRNA, and in the presence of NP-1496, the content of NP mRNA remains on background content, show that siRNA suppresses gathering of specific mrna.As shown in Figure 19 A (middle and below figure), the content of NP specificity and NS specificity vRNA and cRNA is suppressed widely because of the existence of NP-1496.Described results verification the result described in the example 4.In addition, in the cell of handling through NP-1496, gathering also of mRNA, the vRNA of M, NS, PB1, PB2 and PA gene and cRNA is suppressed (Figure 19 B, 19C and 19H).In addition, concerning PA-2087, also observe extensive restraining effect.Above Figure 19 E, 19F and the 19G left side figure, middle graph with below show among the figure with Figure 19 A, 19B and 19C in the identical result that presented, shown that NP-1496 siRNA inhibition virus mRNA is transcribed with viral vRNA and cRNA to duplicate.Above Figure 19 E, 19F and 19G the right figure, middle graph and below be presented under the same concentrations result of the identical experiment of carrying out with PA-2087 siRNA among the figure.As Figure 19 E, respectively upper right side figure, middle graph and below shown in the figure, after infecting 3 hours, when not having PA-2087, easily detect PA, M and NS mRNA, and the existence of PA-2087 suppresses transcribing of PA, M and NS mRNA.As Figure 19 F, respectively upper right side figure, middle graph and below shown in the figure, infect after 3 hours, when not having PA-2087, easily detect PA, M and NS vRNA, and the existence of PA-2087 suppresses gathering of PA, M and NS vRNA.As Figure 19 G, respectively upper right side figure, middle graph and below shown in the figure, infected back 3 hours, when not having PA-2087, easily detect PA, M and NS cRNA, and the existence of PA-2087 suppresses gathering of PA, M and NS cRNA.In addition, Figure 19 H shows that the NP specific siRNA suppresses gathering of PB1 (top figure), PB2 (middle graph) and PA (below figure) specific mrna.

Though do not wish to be bound by any theory, the present inventor thinks that the extensive effect of NP siRNA may be the result of the importance of NP in combination and stable vRNA and cRNA, rather than because the non-degraded of targeted rna specifically of NP specific siRNA.NP gene fragment coding single stranded RNA syncaryon albumen in the influenza virus can be in conjunction with vRNA and cRNA (referring to Figure 15).During viral life cycle, at first NP mRNA is transcribed and translates.The proteinic major function of NP is to make the purpose of viral genome encapsidate to be used for rna transcription, to duplicate and to assemble.When not having NP protein, the total length of vRNA and cRNA is synthetic greatly to be weakened.When NP siRNA induced the degraded of NP RNA, the weakened and proteinic shortage of enough NP gained of NP protein synthesis influenced subsequently that other virogenes are segmental to be duplicated.In this way, NP siRNA may early the stage be suppressed the virus generation effectively at the utmost point.

Suppose the level (1) that the quantity of NP protein molecule in infected cell is duplicated with the synthetic relative geneome RNA (vRNA and cRNA) of regulation and control mRNA.Use the proteinic temperature sensitive mutation of NP, previous research is verified, and the synthetic rather than mRNA of cRNA is synthetic in vitro and in vivo to be temperature sensitive (70,71).Confirmed that NP protein is the prolongation and the anti-termination necessary (71,72) of nascent cRNA and vRNA transcript.The result who above presents shows that the NP specific siRNA suppresses all viral RNAs gathering in infected cell.Though do not wish to be bound by any theory, seem possible and be, in the presence of the NP specific siRNA, the NPmRNA that newly transcribes is degraded, and causes behind the virus infection inhibition to the NP protein synthesis.When not having new synthetic NP, further virus transcription and duplicate and the neovirion that brings thus produces and is suppressed.

Equally, in the presence of the PA specificity, the PA mRNA that newly transcribes is degraded, and causes the inhibition to the PA protein synthesis.Although there is 30-60 RNA transcriptase copy (1) in each influenza virus particles, when no new synthetic RNA transcriptase, further virus transcription with duplicate and may be suppressed.Use has specific siRNA to PB1 and obtains similar result.On the contrary, do not need the late period (1) of matrix (M) protein up to virus infection.Therefore, the M specific siRNA suppresses gathering of gathering of M specific mrna rather than vRNA, cRNA or other viral RNAs.In a word, described discovery proves, in Influenza Virus RNA is transcribed and duplicated, to the crucial requirement of new synthetic nucleoprotein and polymerase protein matter.MRNA specificity and virus-specific mechanism that NP specificity, PA specificity and PB1 specific siRNA disturb mRNA to gather and transcribe with other viral RNAs hint that described siRNA may be the especially effective inhibitors of influenza infection.

Example 7: the extensive inhibition that some siRNA gathers Influenza Virus RNA is not because the RNA degraded of ifn response or virus induction.

Material and method

Rna content is measured. under standard conditions, use PCR measure R NA content.Following PCR primer is used to measure γ-Actin muscle RNA.

γ-Actin muscle forward: 5 '-TCTGTCAGGGTTGGAAAGTC-3 ' (SEQ ID NO:177)

γ-Actin muscle is reverse: 5 '-AAATGCAAACCGCTTCCAAC-3 ' (SEQ ID NO:178)

The measurement of the cultivation of Vero cell and phosphorylation PKR is to carry out according to the standard technique described in the reference of hereinafter quoting.

The result

A kind of possible reason of the extensive inhibition that the viral RNA described in the example 6 gathers is in the presence of siRNA, the ifn response of infected cell (23,65,66).Therefore, in the Vero cell, repeat experiment above, wherein delete entire I FN locus, comprise all α, β and ω gene (67,68) (the undocumented data of Q.G. and J.C.).As in mdck cell, gathering all of NP specificity, M specificity and NS specific mrna suppressed (Figure 19 D) by NP-1496.In addition, use pcr analysis siRNA to comprising the effect of beta-actin, γ-Actin muscle and GAPDH from the content of the transcript of cytogene.When not existing or having siRNA, do not detect significant difference (Figure 18 C below figure of transcript content, show M-37 siRNA to not effect of γ-Actin muscle mRNA, and data not shown), show that the restraining effect of siRNA is to be specific to viral RNA.Described result's hint, the extensive inhibition that some siRNA gathers viral RNA is not the result of cell ifn response.

Behind the influenza infection, the existence of dsRNA also activates targeted rna and the cell path (23) of degrading.For studying siRNA, analyze the content (23) of the component phosphorylated protein kinases R (PKR) of this path most critical to this path activated effect.When not having virus infection,, do not influence through activating the content (data not shown) of PKR with NP-1496 transfection mdck cell.Cause that with influenza infection phosphorylation PKR content increases consistent with previous research (65,66,69).Yet when existing or not having NP-1 496, increase is identical (data not shown).Therefore, the extensive inhibition that viral RNA gathers is not in the presence of siRNA, by the degraded enhanced results of virus induction.

Example 8: have separately or suppress the systematicness identification of the siRNA of the superior ability that influenza virus produces with array configuration

Carry out high flux screening (example 18) and discern siRNA with the superior ability that suppresses the influenza virus generation.In cell culture, individually test siRNA, and manyly further in mouse, test.Also test some combination and proof additive effect.The systematicness of carrying out other combination is tested and is discerned the combination with collaborative (that is, greater than addition) effect.Further at the other strains of influenza viruses that comprises grow up human and avian pathogens, test siRNA and other RNAi that comprise the same anti-sense chain induce entity.

Example 9: the assessment of the non-viral delivery agents that the cell of promotion siRNA absorbs.Test the ability of the cell absorption of various non-viral delivery agents enhancing siRNA.Subsequent instance provides, and is presented at the data of the achievement (for example, suppressing influenza virus produces) when utilizing many polymkeric substance in cell culture and the animal.Use the other delivery agents of similar approach test.

Example 10: the composition that contains the RNAi inductor in the mouse test

The drying particulate that comprises the RNAi inductor of target influenza virus transcript as preparation as described in (58).In described program, water soluble excipient (that is, lactose, albumin etc.) and therapeutical agent are dissolved in the distilled water.With solution feed to Niro atomizer portable spray moisture eliminator (Niro Atomizer Portable Spray Dryer) (Niro, Inc., Colombus, MD) in, produce the average geometric diameter have between 3 and 15 μ m and 0.04 and 0.6g/cm ³Between the dry powder of tap density.In throwing in suction or the tracheae and respiratory system with dry powder throwing and mouse.The suction of finishing dry powder aerosol by forced ventilation on anesthetized mice is sent.In tracheae, throw with, will contain the injection of solution (54) in the lung of anesthetized mice of therapeutical agent by pipe.In other experiments, concerning delivering liquid, liquid aerosol is produced in the sealed plastic cage of placing mouse (52) by atomizer.Can use such as can available from PermCentury ( URLwww.penncentury.com) insufflator (for example Model IA-IC) carry out the pulmonary delivery of dry powder to animalcule.

Example 11: the siRNA that the template that is provided by dna vector or slow virus is transcribed is to the inhibition of influenza infection

As the replacement method of method mentioned above, the purposes of described in example 13 and 14, probing into dna vector, effective siRNA be transcribed and be processed into to the siRNA precursor can by described dna vector.Figure 20 A-20C shows the carrier be used for previous research (27,59), the results are shown among Figure 20 D of described research, and be described in addition in the 10/674th, No. 159 United States Patent (USP).Figure 21 A-21C shows the other construct of the effect of the hair clip formula precursor that can be used for testing the precursor that comprises multiple different siRNA.

The inhibition that example 12:siRNA produces influenza virus in the mouse

This case description, show when before or after influenza infection, throw and the time, the experiment of the generation of influenza virus in the throwing of the siRNA of target influenza virus NP or PA transcript and the inhibition mouse.Described inhibition is a dose-dependently, and when 2 kinds separately target from the siRNA of the expressed transcript of the susceptible virus gene of various flows thrown together and the time, show additive effect.

Material and method

The SiRNA preparation. described preparation is as indicated above to be carried out.

SiRNA sends. at room temperature, and in 5% glucose, with the jetPEI of oligonucleotide cationic polymers transfection reagent ^TM, N/P is than=5 (Qbiogene, Inc., Carlsbad, CA; Catalog number (Cat.No.) GDSP20130; N/P is meant the nitrogen number of each nucleotide phosphodiesterase salt in the jetPEI/siRNA mixture) or with poly-L-Lysine (MW (vis) 52,000; MW (LALLS) 41,800, Sigma catalog number (Cat.No.) P2636), siRNA (GFP-949 of 30 or 60 μ g, NP-1496 or PA-2087) is cultivated 20min.With intravenous route mixture is expelled in the mouse, is expelled in the eye socket posterior vein, every mouse 200 μ l, every group of 4 mouse.The glucose injection of 200 μ l 5% is arrived in contrast (non-processor) mouse.Before siRNA injection or intranasal infection, (Avertin) makes mouse anesthesia with 2.5% avertin.

Virus infection. splash in the nose of mouse by the damping fluid that will contain virus with transfer pipet, infect B6 mouse (maintaining under the standard laboratory conditions) in mode in the nose with PR8 virus, every mouse 30 μ l (12,000pfu).

Virus titer is measured. and sacrifice mouse at metainfective each time point, and collect lung.Lung is homogenized, and homogenate is freezing and thaw and come releasing virus twice.Infect the titre that measurement is present in PR8 virus in the infected lung by mdck cell.With every hole 3 * 10 ⁴Individual mdck cell is inoculated flat 96 orifice plates, and after 24 hours, removes the substratum that contains serum.With undiluted or from 1 * 10 ^-1Be diluted to 1 * 10 ^-725 μ l lung homogenate be inoculated in three repeated holes.After 1h cultivates, 175 μ l are had the tryptic infection substratum of 4 μ g/ml add in each hole.Under 37 ℃, after 48h cultivates, by whether by the existence of measuring virus from the hamegglution of the chicken RBC of the supernatant liquor of infected cell.In 96 orifice plates at the bottom of the V-arrangement, carry out the hamegglution analysis.Continuous 2 times of diluents of supernatant liquor are mixed with the chicken red blood corpuscle suspension (Charles River Laboratories) of isopyknic 0.5% (volume/volume ratio), and cultivate 1h on ice.Containing erythrocytic hole adherent, uniform bed keeps the score to just.The interpolation technique of the dilution end point by infecting 50% hole is by the method (TCID of Reed and Muench ₅₀) measure virus titer, so TCID ₅₀Low more, the reflection virus titer is low more.Utilize student t test (Student t test) relatively from any 2 groups data, all use described test to assess significance in the described in this article experiment.

The result

Figure 22 A shows a result of experiment, prove before infecting, throw and the time, the influenza virus that the siRNA of target virus N P transcript suppresses in the mouse produces.As mentioned described in material and the method, cultivate GFP-949 or the NP-1496 siRNA of 30 or 60 μ g, and be expelled in the mouse with intravenous route with jetPEI.After 3 hours, use PR8 virus with mode infecting mouse in the nose, every mouse 12000pfu.Infect and collect lung after 24 hours.As shown in Figure 22 A, do not accept siRNA and handle (NT; Solid squares) or accept siRNA (the GFP 60 μ g of target GFP; The average log of mouse lung homogenate square hollow) ₁₀TCID ₅₀Be 4.2.Through the siRNA of 30 μ g target NP (NP 30 μ g; Open circles) and in the pretreated mouse of jetPEI, the average log of lung homogenate ₁₀TCID ₅₀Be 3.9.Through the siRNA of 60 μ g target NP (NP 60 μ g; Filled circles) and in the pretreated mouse of jetPEI, the average log of lung homogenate ₁₀TCID ₅₀Be 3.2.There is significant difference in the virus titer of not accepting lung homogenate between group of handling and the group of the accepting 60 μ gNP siRNA, P=0.0002.The data of indivedual mouse are presented among the table 6A (NT=non-processor).

Figure 22 B shows another result of experiment, proved before infecting, with the composition forms that contains cationic polymers PLL through intravenous route throw and the time, the influenza virus that the siRNA of target virus N P transcript suppresses in the mouse produces.As mentioned described in material and the method, cultivate GFP-949 or the NP-1496 siRNA of 30 or 60 μ g, and be expelled in the mouse with intravenous route with PLL.After 3 hours, use PR8 virus with mode infecting mouse in the nose, every mouse 12000pfu.Infect and collect lung after 24 hours.As shown in Figure 22 B, do not accept siRNA and handle (NT; Solid squares) or accept siRNA (the GFP 60 μ g of target GFP; The average log of mouse lung homogenate square hollow) ₁₀TCID ₅₀Be 4.1.Through the siRNA of 60 μ g target NP (NP 60 μ g; Filled circles) and in the pretreated mouse of PLL, the average log of lung homogenate ₁₀TCID ₅₀Be 3.0.There is significant difference in the virus titer of accepting the group of 60 μ gGFP and accepting lung homogenate between the group of 60 μ gNP siRNA, P=0.001.The data of indivedual mouse are presented among the table 6A (NT=non-processor).Described data show, when before virus infection, throw and the time, the siRNA of target influenza NP transcript reduces the virus titer in the lung.Also show, when throw by intravenous injection and the time, the mixture of siRNA and cationic polymers effectively suppresses the influenza virus in the lung, and need be such as the technology of water power transfection.

The inhibition that table 6A.siRNA and cationic polymers produce influenza virus in the mouse

Handle	Log 10TCID 50
					NT (jetPEI experiment) GFP (60 μ g)+jetPEI NP (30 μ g)+jetPEI NP (60 μ g)+jetPEI NT (PLL experiment) GFP (60 μ g)+PLL NP (60 μ g)+PLL	4.3 4.3 4.0 3.3 4.0 4.3 3.3	4.3 4.3 4.0 3.3 4.3 4.0 3.0	4.0 4.3 3.7 3.0 4.0 4.0 3.0	Not 4.0 4.0 3.7 3.0 4.0 (not carrying out) 2.7

Figure 22 C shows the 3rd result of experiment, prove before infecting, throw and the time, the influenza virus that the siRNA of target virus N P transcript suppresses in the mouse produces, and the existence of proof cationic polymers significantly increases the inhibition effect of siRNA.As mentioned described in material and the method, cultivate GFP-949 or the NP-1496 siRNA of 60 μ g, and be expelled in the mouse through intravenous route with phosphate buffered saline (PBS) (PBS) or jetPEI.After 3 hours, use PR8 virus with mode infecting mouse in the nose, every mouse 12000pfu.Infect and collect lung after 24 hours.As shown in Figure 22 C, do not accept siRNA and handle (NT; The average log of mouse lung homogenate square hollow) ₁₀TCID ₅₀Be 4.1, and be received in (the GFP PBS of the siRNA of the target GFP among the PBS; Hollow triangle) the average log of mouse lung homogenate ₁₀TCID ₅₀Be 4.4.At (NP PBS in the pretreated mouse of siRNA of 60 μ g target NP in PBS; Black triangle), the average log of lung homogenate ₁₀TCID ₅₀Be 4.2, with respect to being untreated or, only showing that the appropriateness of effect increases through the processing of the siRNA of target GFP.At (GFP PEI in the pretreated mouse of siRNA of 60 μ g target GFP in jetPEI; Open circles), the average log of lung homogenate ₁₀TCID ₅₀Be 4.2.Yet, accept (NP PEI in the mouse of 60 μ g siRNA of target NP in jetPEI; Filled circles), the average log of lung homogenate ₁₀TCID ₅₀Be 3.2.There is significant difference in the virus titer of accepting the group of the GFP siRNA among the PBS and accepting lung homogenate between the group of the NP siRNA among the PBS, P=0.04, and the virus titer of accepting the group of GFP siRNA and jetPEI and accepting lung homogenate between the group of NP siRNA and jetPEI exists the difference of highly significant, P=0.003.The data of indivedual mouse are presented among the table 6B (NT=non-processor).

Table 6B. in the presence of cationic polymers, shows influenza virus generation during siRNA that effect increases is to mouse but System

Handle	Log 10TCID 50
					NT	4.3	4.3	4.0	3.7

GFP(60μg)+PBS NP(60μg)+PBS GFP(60μg)+jetPEI NT(60μg)+jetPEI

4.3 3.7 4.3 3.3

4.3 4.3 4.3 3.0

4.7 4.0 4.0 3.7

4.3 4.0 3.0 3.0

Carry out that other experiment evaluated before or after infecting that each time point is thrown and the time, siRNA suppresses the ability that influenza virus produces in metainfective each time.

Except that throwing in 12 hours and 120 μ g siRNA before virus infection, throwing as indicated above and siRNA.Table 6C indicator gauge is shown log ₁₀TCID ₅₀The result.Through the group of NP processing and the P value of control group comparison is 0.049.

Table 6C

	Mouse 1	Mouse 2	Mouse 3	Mouse 4
					NT	4.3	4	4	4
GFP-949	4.3	4	4	4
					NP-1496	4	3.7	3.7	3.3

In another experiment, before infecting, threw and siRNA (60 μ g) in 3 hours.With the PR8 virus of approach throwing in the nose with 1500pfu.Collect infected lung after infecting 48h.Table 6D indicator gauge is shown log ₁₀TCID ₅₀The result.Through the group of NP processing and the P value of control group comparison is 0.03.

Table 6D

	Mouse 1	Mouse 2	Mouse 3	Mouse 4
					NT	4	4	4	4
GFP-949	4.3	4	4	3.7
					NP-1496	3	3.7	3.7	3.3

In another experiment, after infecting 24 hours, throws and siRNA (120 μ g) PR8 (1500pfu).Infect after 52 hours, collect lung and measure virus titer.Table 6D indicator gauge is shown log ₁₀TCID ₅₀The result.Through the group of NP processing and the P value of control group comparison is 0.03.

Table 6E

	Mouse 1	Mouse 2	Mouse 3	Mouse 4
					GFP-949	2.3	2.7	2	2.7
NP-1496	2	2	1.7	2

Show that also other polymkeric substance are effective siRNA delivery agents.Figure 22 D be show when together with poly-(β amino ester) (J28) through intravenous route throw and the time, the figure of the influenza virus generation in the siRNA inhibition mouse of target NP (NP-1496).Figure 22 E be show when together with poly-(β amino ester) (J28 or C32) through the intraperitoneal approach throw and the time, the siRNA of target NP (NP-1496) suppresses the influenza virus generation in the mouse, and contrasts the figure that RNA (GFP) does not have remarkable effect.The ratio that removes polymkeric substance and siRNA be w/w than outside (for example, 60: 1 w/w), as indicated abovely basically carry out experiment.With 12, before the PR8 of the 000pfu virus intranasal infection 3 hours, with polymkeric substance and siRNA mixes and through intravenously or intraperitoneal approach throw with mouse in.Collect lung after 24 hours and carry out the HA analysis.U.S.S.N.10/446 is described and be depicted in to amine and two (acrylate) monomers of being present among J28 and the C32, in 444.Polymkeric substance is the donation of Dr.Robert Langer.

Figure 23 shows a result of experiment, proves that the siRNA of the different influenza virus transcripts of target shows additive effect.As mentioned described in material and the method, cultivate NP-1496 siRNA, 60 μ g PA-2087 siRNA or the 60 μ gNP-1496 siRNA+60 μ gPA-2087siRNA of 60 μ g, and be expelled in the mouse through intravenous route with jetPEI.After 3 hours, use PR8 virus with mode infecting mouse in the nose, every mouse 12000 pfu.Infect and collect lung after 24 hours.As shown in Figure 23, do not accept siRNA and handle (NT; The average log of mouse lung homogenate solid squares) ₁₀TCID ₅₀Be 4.2.(NP 60 μ g in the mouse of the siRNA that accepts 60 μ g target NP; Open circles), the average log of lung homogenate ₁₀TCID ₅₀Be 3.2.(PA 60 μ g in the mouse of the siRNA that accepts 60 μ g target PA; Hollow triangle), the average log of lung homogenate ₁₀TCID ₅₀Be 3.4.(NP+PA in the mouse of the siRNA of the siRNA+60 μ g target PA that accepts 60 μ g target NP; Filled circles), the average log of lung homogenate ₁₀TCID ₅₀Be 2.4.There is significant difference in the virus titer of not accepting lung homogenate between group of handling and the group of the accepting 60 μ gNP siRNA, 60 μ gPA siRNA or 60 μ g NP siRNA+60 μ g PA siRNA, P difference=0.003,0.01 and 0.0001.There is significant difference in the virus titer of accepting the group of 60 μ gNP siRNA or 60 μ g NP siRNA and accepting lung homogenate between the group of 60 μ gNP siRNA+60 μ g PA siRNA, P=0.01.The data of indivedual mouse are presented in (NT=non-processor) in the table 7.Described data show, reduce with after the virus titer in the lung of the mouse of influenza infection with the siRNA pre-treatment of target influenza NP or PA transcript.Data show in addition, and the combination of the siRNA of target different virus transcript shows additive effect, and hint is with respect to the amount that reaches the single siRNA that equates that effect is required, can make the dosage reduction of various siRNA with the therapy of the combination of the siRNA of the different transcripts of target.

Table 7. in mouse siRNA at the additive effect of influenza virus

Handle	log 10TCID 50
					NT NP (60 μ g) PA (60 μ g) NP+PA (respectively being 60 μ g)	4.3 3.7 3.7 2.7	4.3 3.3 3.7 2.7	4.0 3.0 3.0 2.3	4.0 3.0 3.0 2.0

Figure 24 shows a result of experiment, prove when after infection, throw and the time, the influenza virus that the siRNA of target virus N P transcript suppresses in the mouse produces.With PR8 virus (500pfu) with mode infecting mouse in the nose.As mentioned described in material and the method, cultivate GFP-949 siRNA, 60 μ g PA-2087 siRNA, 60 μ gNP-1496 siRNA or the 60 μ gNP siRNA+60 μ gPA siRNA of 60 μ g with jetPEI, and 5 hours after intravenous route be expelled in the mouse.SiRNA throws and collects lung after 28 hours.As shown in Figure 24, do not accept siRNA and handle (NT; Solid squares) or accept GFP specific siRNA GFP-949 (GFP; The average log of mouse lung homogenate square hollow) ₁₀TCID ₅₀Be 3.0.(PA 60 μ g in the mouse of the siRNA that accepts 60 μ g target PA; Hollow triangle), the average log of lung homogenate ₁₀TCID ₅₀Be 2.2.(NP 60 μ g in the mouse of the siRNA that accepts 60 μ g target NP; Open circles), the average log of lung homogenate ₁₀TCID ₅₀Be 2.2.(PA+NP in the mouse of accepting 60 μ gNP siRNA+60 μ g PA siRNA; Filled circles), the average log of lung homogenate ₁₀TCID ₅₀Be 1.8.There is significant difference in the virus titer of not accepting lung homogenate between group of handling and the group of the accepting 60 μ gPA, NP siRNA or 60 μ g NP siRNA+60 μ gPA siRNA, P difference=0.09,0.02 and 0.003.The difference of accepting the group of NP siRNA and accepting the virus titer of lung homogenate between the group of PA+NP siRNA has 0.2 P value.The data of indivedual mouse are presented in (NT=non-processor) in the table 8.Described data show, when after virus infection, throw and the time, the siRNA of target influenza NP and/or PA transcript reduces the virus titer in the lung.

The inhibition that table 8. siRNA produces influenza virus in the infected mouse

Handle	log 10TCTD 50
					NT GFP (60 μ g) PA (60 μ g) NP (60 μ g) NP+PA (respectively being 60 μ g)	3.O 3.0 2.7 2.7 2.3	3.0 3.0 2.7 2.3 2.0	3.0 3.0 2.3 2.3 1.7	3.0 2.7 1.3 1.7 1.3

Example 13: produce by throwing with the influenza virus that usefulness-suppress in the cell in the slow virus of the template that produces shRNA is provided

Material and method

Cell increases foster. with each hole 4 * 10 in 1ml DMEM-10%FCS ⁵Individual cell with the Vero cell inoculation in 24 orifice plates, and at 37 ℃, 5%CO ₂The following cultivation.

Be provided for the generation of the slow virus of the template that shRNA produces. as shown in Figure 25 A, anticipate and describe, the clone is as the oligonucleotide (Rubinson of the template of synthetic NP-1496a shRNA (referring to Figure 25 A) between the U6 of lentiviral vectors pLL3.7 promotor and terminator sequence, D. wait the people, Nature Genetics, the 33rd volume, the 401-406 page or leaf, 2003).Insert oligonucleotide between Hpal in the multiple clone site of pLL3.7 and the Xhol restriction site.Described lentiviral vectors is also expressed EGFP with the convenient cell that monitors through transfection/infection.By will comprising the dna vector cotransfection of the template that is used to produce NP-1496a shRNA, and vehicle group installed in the 293T cell produce slow virus.Behind the 48h, collect the culture supernatants that contains slow virus, under 4 ℃, rotation 7min also then filters via 0.45 μ m strainer under 2000rpm.With every hole 1 * 10 ⁵With the Vero cell inoculation in 24 orifice plates.After the incubated overnight, the culture supernatants that will contain inset (0.25ml or 1.0ml) is added in the hole that has 8 μ g/ml polybrenes (polybrene).Then at room temperature, under 2500rpm with the centrifugal 1h of plate and return in the culture.After infecting 24h, the GFP together with parental generation (not infecting) Vero cell expresses by flow cytometry gained Vero clone (Vero-NP-0.25 and Vero-NP-1.0).Note, NP-1496a is different from NP-1496, difference is the non-extra Nucleotide (A) of having a mind to comprise in 3 ' end place of justice part and the non-complementary nucleotide of having a mind to comprise in 5 ' end place (U) of antisense part, thus formation 20 nt of length rather than with NP-1496 in the duplex part of the same 19 nt.(referring to table 2).According to other embodiments of the invention, use NP-1496 sequence rather than NP-1496a sequence.In addition, the loop section of NP-1496a shRNA is different from the loop section of the NP-1496 shRNA shown in Figure 21.

The mensuration of influenza infection and virus titer. under 0.04,0.2 and 1 MOI, with the Vero cell (Vero-NP-0.25 and Vero-NP-1.0) of PR8 virus infection contrast Vero cell and slow virus infection through containing inset.Described in example 12, after infecting 48 hours, by the influenza virus titre in the HA assay determination supernatant liquor.

The result

Test contains the slow virus that is useful on the template that produces NP-1496a shRNA and suppresses the ability that the influenza virus in the Vero cell produces.NP-1496a shRNA comprises 2 complementation districts that can form stem-ring structure, and described stem-ring structure contains the double-stranded part with sequence identical with NP-1496a siRNA mentioned above.As shown in Figure 25 B, will contain the supernatant liquor overnight incubation of slow virus with the Vero cell, cause the expression of EGFP, show that the Vero cell is subjected to slow virus infection.Average fluorescent strength in the shade curve representation control cells (not infecting).When using the supernatant liquor of 1ml, nearly all cell become the EGFP male and average fluorescent strength higher (1818) (Vero-NP-1.0).When using the supernatant liquor of 0.25ml, most cells (about 95%) be the EGFP positive and average fluorescent strength lower (503) (Vero-NP-0.25).

Then, under 0.04,0.2 and 0.1 MOI, with influenza infection parental generation Vero cell with through the Vero of slow virus infection cell, and at 48 hours post analysis virus titers of influenza infection.Along with MOI increases, the virus titer in the supernatant liquor of parental generation Vero cell culture increases (Figure 25 C).On the contrary, the virus titer in the supernatant liquor of Vero-NP-1.0 cell culture still is extremely low, shows that influenza virus is created in the described cell to be suppressed.Similarly, the influenza virus in the Vero-NP-0.25 cell culture produces and also is subjected to the part inhibition.Virus titer is presented in the table 9.Described result's hint, the NP-1496 shRNA that expresses from lentiviral vectors can be processed to siRNA to be suppressed at the influenza virus generation the Vero cell.The degree that suppresses seems and the virus infection degree of each cell proportional (being represented by EGFP content).

Table 9. is expressed in the inhibition that the siRNA in the cell in the tissue culture produces influenza virus

Clone	Virus titer
				Vero Vero-NP-0.25 Vero-NP-1.0	16 8 1	64 32 4	128 64 8

Example 14: throw with the influenza that suppresses mouse in the nose of the dna vector by being used for transcribing the siRNA precursor and produce

Material and method

Making up plasmid as the template of shRNA. the structure that is used for expressing the plasmid of NP-1496a shRNA is described in example 13.NP-1496a shRNA is illustrated to describe described in example 13 He among Figure 25 A, the clone is as the oligonucleotide of the template of synthetic PB1-2257 shRNA or RSV specificity shRNA between the U6 of lentiviral vectors pLL3.7 promotor and terminator sequence.The sequence of oligonucleotide is as follows:

NP-1496a has justice:

5′-TGGATCTTATTTCTTCGGAGATTCAAGAGATCTCCGAAGAAATAAGATCCTTTTTT

C-3′(SEQIDNO：179)

The NP-1496a antisense:

5′-TCGAGAAAAAAGGATCTTATTTCTTCGGAGATCTCTTGAATCTCCGAAGAAATAA GATCCA-3′(SEQ ID NO：180)

PB1-2257 has justice:

5′-TGATCTGTTCCACCATTGAATTCAAGAGATTCAATGGTGGAACAGATCTTTTTTC-3′(SEQ ID NO：181)

The PB1-2257 antisense:

5′-TCGAGAAAAAAGATCTGTTCCACCATTGAATCTCTTGAATTCAATGGTGGAACAGAT CA-3′(SEQIDNO：182)

RSV has justice:

5′-TGCGATAATATAACTGCAAGATTCAAGAGATCTTGCAGTTATATTATCGTTTTTTC-3′(SEQIDNO：183)

The RSV antisense:

5′-TCGAGAAAAAACGATAATATAACTGCAAGATCTCTTGAATCTTGCAGTTATATTA TCGCA-3′(SEQ ID NO：184)

To in vivo process from the RSV shRNA of the vector expression that comprises above-mentioned oligonucleotide with generation and comprise the sense strand with following sequence and the siRNA of antisense strand:

Justice is arranged: 5 '-CGATAATATAACTGCAAGA-3 ' (SEQ ID NO:185)

Antisense: 5 '-TCTTGCAGTTATATTATCG-3 ' (SEQ ID NO:186)

Can use following oligonucleotide to make up PA specificity hair clip similarly:

PA-2087 has justice:

5′-TGCAATTGAGGAGTGCCTGATTCAAGAGATCAGGCACTCCTCAATTGCTTTTTTC-3′(SEQ ID NO：187)

The PA-2087 antisense:

5′-TCGAGAAAAAAGCAATTGAGGAGTGCCTGATCTCTTGAATCAGGCACTCCTCAATTG CA-3′(SEQIDNO：270)

The mensuration of virus infection and titration of virus. carry out described in the mensuration of described virus infection and virus titer such as the example 12.

DNA sends. and as indicated above, can as the plasmid DNA (each 60 μ g) of the template of expressing NP-1496a shRNA, PB1-2257 shRNA or RSV specificity shRNA individually with 40 μ l Infasurf_ (ONY, Inc., Amherst NY) and 5% glucose of 20 μ l mix, and in the intranasal approach throw with mouse in groups in, every group of 4 mouse.With the mixture of 5% glucose of 40 μ l Infasurf and 20 μ l throw with non-processor (NT) group in mouse in.As indicated above, after 13 hours, use PR8 virus with mode infecting mouse in the nose, every mouse 12000pfu.Infect and collect lung after 24 hours and measure virus titer.

The result

The shRNA that test is expressed from dna vector suppresses the ability of influenza infection the mouse.Concerning described experiment, plasmid DNA is mixed with Infasurf, Infasurf is vectorial natural surface active agent extract (74) that is used for promoting the transgenosis of lung shown in previous from being similar to of calf lung.By using pipette that mixture is splashed in the nose, the DNA/Infasurf mixture is instilled in the mouse.After 13 hours, use the PR8 virus infected mice, every mouse 12000pfu.Behind the influenza infection 24 hours, collect lung and pass through MDCK/ homo agglutinin analysis to measure virus titer.

As shown in Figure 26, do not giving with any plasmid DNA or giving in the mouse with the dna vector of expressing respiratory syncytial virus (RSV) specificity shRNA, virus titer is higher.When giving when expressing the plasmid DNA of NP-1496a shRNA or PB1-2257 shRNA, observe lower virus titer with mouse.When giving with mouse influenza specific plasmids DNA (a kind of expression NP-1496a shRNA, and the another kind of PB1-2257 shRNA that expresses) together, virus titer further significantly reduces.Do not accept to handle (NT; Square hollow) or accept the plasmid (RSV of coding RSV specificity shRNA; The average log of mouse lung homogenate solid squares) ₁₀TCID ₅₀Be respectively 4.0 or 4.1.Accept can be with the mouse of the plasmid of the template that acts on NP-1496a shRNA in (NP; Open circles), the average log of lung homogenate ₁₀TCID ₅₀Be 3.4.Accept can be with the mouse of the plasmid of the template that acts on PB1-2257 shRNA in (PB; Hollow triangle), the average log of lung homogenate ₁₀TCID ₅₀Be 3.8.Accept can be with the mouse of the plasmid of the template that acts on NP and PB shRNA in (NP+PBl; Filled circles), the average log of lung homogenate ₁₀TCID ₅₀Be 3.2.Do not accept to handle or accept the group of RSV specificity shRNA plasmid and accept NP shRNA plasmid, PB1 shRNA plasmid or NP and the group of PB1 shRNA plasmid between, the difference of the virus titer of lung homogenate has 0.049,0.124 and 0.004 P value respectively.The data of indivedual mouse are presented in (NT=non-processor) in the table 10.Described result shows, the shRNA that expresses from dna vector can be processed to siRNA and produce with the influenza virus that suppresses the mouse, and proof, and Infasurf is the vehicle that is fit to send the plasmid that is used to express shRNA.Particularly, described data show, when after virus infection, throw and the time, the shRNA of target influenza NP and/or PB1 transcript reduces the virus titer in the lung.

The inhibition that the shRNA that table 10. is expressed in mouse produces influenza virus

Handle	log 10TCID 50
					NT RSV (60 μ g) NP (60 μ g) PB1 (60 μ g) NP+PB1 (respectively being 60 μ g)	4.3 4.3 4.0 4.0 3.7	4.0 4.0 3.7 4.0 3.3	4.0 4.0 3.0 3.7 3.0	4.3 4.0 3.0 3.3 3.0

Example 15: cationic polymers promotes the cell of siRNA to absorb

Material and method

Reagent. buy poly-L-Lysine [poly-L-Lysine (MW (vis) 52,000 with 2 kinds of different molecular-weight average from Sigma; MW (LALLS) 41,800, catalog number (Cat.No.) P2636), and poly-L-Lysine (MW (vis) 9,400; MW (LALLS) 8,400, catalog number (Cat.No.) P2636], poly--L-arginine (MW15,000-70,000, catalog number (Cat.No.) P7762) and bromination 3-(4,5-dimethylthiazole-2-yl)-2,5-phenylbenzene tetrazolium (MTT).For being described, the molecular weight with supposition uses the LALLS method to obtain still should be appreciated that molecular weight is proximate, because polymkeric substance represents some size ununiformity.

Gel retardation assay. by (10pmol is dissolved in the 10mM Hepes damping fluid, pH7.2) mixes with the polymers soln of the polymkeric substance that contains variable quantity of 10 μ l, forms the siRNA-polymer complex with the siRNA of 10 μ l.At room temperature carry out mixture and form 30min, afterwards 20 μ l are run glue on 4% sepharose.Observe band with ethidium bromide staining.

Cytotoxicity analysis. with the siRNA in 10mM Hepes damping fluid (pH7.2) of equal quantities (50pmol) and the polymers soln mixing 30min of the polymkeric substance that contains variable quantity, form the siRNA-polymer complex by at room temperature.By MTT analysis and evaluation cytotoxicity.In the DMEM that contains 10% foetal calf serum (FCS) of 0.2ml, with 30,000 cells in every hole with cell inoculation in 96 orifice plates.After 37 ℃ of following overnight incubation, remove substratum and replace with 0.18ml OPTI-MEM (GIBCO/BRL).SiRNA-polymer complex in the Hepes damping fluid of 20 μ l is added in the cell.37 ℃ down cultivate 6h after, remove the substratum that contains polymkeric substance and replace with DMEM-10%FCS.Behind the 24h,, use the metabolic activity of MTT analysis to measure cell according to the specification sheets of manufacturers.To test and carry out three times, and data will be averaged.

Cell cultures, transfection, siRNA-polymer complex form and virus titer is measured the Vero cell under 37 ℃, at 5%CO ₂Under/95% air atmosphere, in the DMEM that contains 10% hot deactivation FCS, 2mM L-glutaminate, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates, grow.Concerning transfection experiment, in the DMEM-10%FCS of 1ml, with every hole 4 * 10 ⁵Individual cell with logarithmic phase Vero cell inoculation in 24 orifice plates.After 37 ℃ of following overnight incubation, by (400pmol (about 700ng) is in 10mM Hepes damping fluid, and siRNA pH7.2) adds in the polymkeric substance eddy current of 50 μ l, forms the siRNA-polymer complex with 50 μ l.The polymkeric substance that uses different concns is to reach mixture formation completely between siRNA and the polymkeric substance.At room temperature culturing mixt 30min forms to finish mixture.Remove cell growth medium and just before adding mixture, replace with OPTI-MEM I (LifeTechnologies).

Under 37 ℃, at 5%CO ₂Down, with mixture with cell cultures 6h after, remove the substratum that contains mixture, and will be at MOI=0.04, the PR8 virus of 200 μ l in the infection substratum of being made up of DMEM, 0.3%BSA (Sigma), 10mM Hepes, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates is added in each hole.After at room temperature following constant wave and culture 1h, add in each hole containing the tryptic 0.8ml infection of 4 μ g/ml substratum, and at 37 ℃, culturing cell under 5%CO2.In metainfective different time points, from infected culture collection supernatant liquor and as indicated above, by hamegglution (HA) assay determination virus titer.

For attached cell system, according to the specification sheets of manufacturers,, carry out the siRNA transfection by Lipofectamine 2000 (Life Technology).In brief, in the DMEM-10%FCS of 1ml, with every hole 4 * 10 ⁵Individual cell with the Vero cell inoculation of logarithmic phase in 24 orifice plates, and under 37 ℃, at 5%CO ₂The following cultivation.Second day, with 50 μ l adding among the siRNA (400pmol is dissolved among the OPTI-MEM I) of 50 μ l to form mixture in OPTI-MEM I through dilution Lipofectamine 2000.Washed cell and with the culture medium culturing that does not contain serum.Mixture is applied to cell, and under 37 ℃ with cell cultures 6h, as indicated abovely afterwards wash and use influenza infection.In metainfective different time points, from infected culture collection supernatant liquor and as indicated above, by hamegglution (HA) assay determination virus titer.

The result

Test poly-L-Lysine (PLL) and poly--L-arginine (PLA) form mixture with siRNA and promote through the ability of culturing cell to the absorption of siRNA.Whether form mixture for measuring PLL and/or PLA, with the NP-1496 siRNA of fixed amount and the mixed with polymers of incremental change with siRNA.Then by in 4% sepharose, carrying out the formation that electrophoresis is observed polymkeric substance/siRNA mixture.Along with the increase of amount of polymers, the electrophoretic mobility of siRNA is subjected to retardance (Figure 27 A and 27B), shows the formation mixture.Figure 27 A and 27B represent that respectively the mixture between siRNA and PLL (41.8K) or the PLA forms.The amount of used polymkeric substance from left to right increases among each figure.Among each figure in Figure 27 A and 27B, but see band in the swimming lane of on the left, show do not have mixture to form and therefore siRNA enter in the gel and migration subsequently.When moving on to the right, band disappears, and shows that mixture forms and mixture can not enter in the gel and migration.

Be the cytotoxicity of research siRNA/ polymer complex, the mixture under different ratios adds in the Vero cell culture in 96 orifice plates with PLL or PLA with siRNA.Analyze the metabolic activity that (74) measure cell by MTT.To test and carry out three times, and data will be averaged.Cell survival rate increases and significantly reduces with the amount of PLL (the about 42K of MW), and PLL (about 8K) shows remarkable lower toxicity, o'clock shows minimum toxicity or does not show toxicity (Figure 28 A up to 4: 1 at the PLL/siRNA ratio; Circle=PLL (the about 8K of MW); Square=PLL (the about 42K of MW)).As shown in Figure 28 B, cell survival rate increases with the PLA/siRNA ratio and reduces, but at the PLA/siRNA ratio up to 4.5: 1 o'clock, survival rate still is in more than 80%.Polymkeric substance/siRNA ratiometer is shown on the X-axis among Figure 28 A and the 28B.The data that are drawn among Figure 28 A and the 28B are presented in table 11 and 12.In table 11, numeral is with respect to the survival rate per-cent of untreated cell, at the survival rate per-cent of handling the back cell with polymkeric substance/siRNA mixture.ND=does not carry out.In table 12, the as directed PLA/siRNA ratio of numeral, survival per-cent and standard deviation.

The cytotoxicity (survival per-cent) of table 11.PLL/siRNA mixture

Handle	Polymkeric substance/siRNA ratio
							The about 41.8K of the about 8.4K PLL of PLL	0.5 92.26 ND	1.0 83.57 100	2.0 84.39 100	4.0 41.42 100	8.0 32.51 82.55	16.0 ND 69.63

The cytotoxicity (survival per-cent) of table 12.PLA/siRNA mixture

	Polymkeric substance/siRNA ratio
						Survival Percentage Criterion deviation	0.17 94.61 .74	0.5 100 1.91	1.5 92.33 2.92	4.5 83 1.51	13.5 39.19 4.12

Whether promote the cell of siRNA to absorb for measuring PLL or PLA, mix with the polymkeric substance and the NP-1496 of polymkeric substance compound ratio various amounts with all siRNA.In all cases, use the siRNA of equal quantities.Polymkeric substance/siRNA the ratio of the PLL use of polymkeric substance/about 8K of siRNA ratio comparison that the PLL of about 42K is used is low, has more toxicity because the former is proved to be pair cell.Mixture is added in the Vero cell, and after 6 hours, with PR8 virus infection culture.In metainfective different time points, collect culture supernatants and analyze the virus of culture supernatants by HA.Figure 29 A is in the cell of accepting various transfections processing, virus titer figure (circle=non-processor in time; Square=Lipofectamine; Black triangle=PLL (about 42K, PLL/siRNA ratio=2); Hollow triangle=PLL (about 8K, PLL/siRNA ratio=8)).As shown in Figure 29 A, in non-transfection culture, virus titer increases in time.In the culture of NP-1496/Lipofectamine transfection, virus titer is significantly lower, and in the culture of handling with the PLL/NP-1496 mixture even lower.The data that are drawn among Figure 29 A are presented in (NT=non-processor among the table 13A; LF2K=Lipofectamine).The PLL:siRNA ratiometer is shown in the parenthesis.

Similarly at certain polymkeric substance/siRNA ratio ranges build-in test PLA.Figure 29 B is in the cell of accepting various transfections processing, virus titer figure (solid squares=contrast transfection in time; Filled circles=Lipofectamine; The PLA of square hollow=in PLA/siRNA ratio=1 o'clock; The PLA of open circles=in PLA/siRNA ratio=2 o'clock; The PLA of hollow triangle=in PLA/siRNA ratio=4 o'clock; The PLA of black triangle=in PLA/siRNA ratio=8 o'clock).As shown in Figure 29 B, in the culture that the PLA/siRNA when contrasting (contrast transfection) culture and being used in 1: 1 ratio handles, virus titer increases in time.In the culture of NP-1496/Lipofectamine transfection, virus titer is significantly lower, and in the culture that the PLA/siRNA mixture of the mixture when containing at 4: 1 or higher PLA/siRNA ratio is handled even lower.The increase of amount of polymers causes the reduction that virus titer is bigger.The data that are drawn among Figure 29 B are presented among the table 13B.

The table 13A. inhibition that polymkeric substance/the siRNA mixture produces influenza virus

Handle	Time (hour)
						24	36	48	60
The contrast about 8K of the transfection about 42K of LF2K PLL (2: 1) PLL (8: 1)	16 4 1 1	64 8 4 2	64 16 8 4	64 16 8 8

The table 13B. inhibition that polymkeric substance/the siRNA mixture produces influenza virus

Handle	Time (hour)
						24	36	48	60
Contrast transfection LF2K PLA (1: 1) PLA (2: 1) PLA (4: 1) PLA (8: 1)	8 2 4 4 1 1	64 6 16 16 4 1	128 16 128 32 8 1	256 32 256 64 16 2

Therefore, cationic polymers promotes the cell absorption of siRNA and the influenza virus that suppresses in the clone to produce, and more effective than widely used transfection reagent Lipofectamine.Described result also hints, can discern other cationic polymers easily and absorb with the cell that stimulates siRNA, and describe its recognition methods.PLL and PLA can be used as described research over against photograph.

Example 16A: by siRNA being delivered to the uciferase activity that suppresses in vascular system or the respiratory tract in the lung

Material and method

Obtaining also as indicated above the going of siRNAs from Dharmacon protects and anneals.The siRNA sequence that is used for NP (NP-1496), PA (PA-2087), PB1 (PB1-2257) and GFP provides as mentioned.The Luc specific siRNA as (McCaffrey, people such as AP, Nature, 418:38-39) described in.

The DNA transfection that mediates by PEI in the mouse. at room temperature, (Qbiogene, Carlsbad CA) mix 20min to the nitrogen with 10/phosphorus molar ratio (N/P ratio) with PEI with pCMV-luc DNA (Promega).Concerning intravenously (i.v.) throw with, 200 μ l mixtures approach behind eye socket that will contain 60 μ gDNA is expelled in the big male C57BL/6 mouse of 8 weeks (Taconic Farms).In tracheae (i.t) throw with, use 50 μ l mixtures that Perm Century Model IA-IC insufflator will contain 30 μ g or 60 μ g DNA to throw in the lung with anesthetized mice.

SiRNA by the PEI mediation in the mouse sends. and by at room temperature, the N/P ratio with 5 forms the siRNA-PEI composition with luc specificity or the GFP specific siRNA and jetPEI mixing 20min of 60 μ g.Concerning intravenously throw with, the approach injection contains the 200 μ l mixtures of specified amount siRNA behind eye socket.Concerning lung throw with, approach is sent 50 μ l in tracheae.

Luc analyzes. pCMV-luc DNA throw with after each time point, collect lung, spleen, liver, heart and kidney and (Marker Gene Technologies, Eugene homogenize in OR) at cytolysis damping fluid (Cell Lysis Buffer).(Promega) analyze luminous and (MGM Instruments, Hamden CT) measure with the Optocomp_I photometer with luciferase analytical system (Luciferase Assay System).By the protein concn in BCA analysis (Pierce) the measurement homogenate.

The result

For measuring the tissue distribution of the delivery of nucleic acids that mediates by PEI in the mouse,, and after 24 hours, in each organ, measure the Luc activity through intravenous route injection pCMV-lucDNA-PEI mixture.Activity is the highest in lung, wherein detect Luc activity at least 4 days (Figure 30 A), and in heart, liver, spleen and kidney, level is hanged down 100-1,000 times and detect the short period after injection.When approach instillation DNA-PEI mixture in tracheae, also in lung, detect significant Luc activity, just level is thrown and back low (Figure 30 B) than intravenously.

For the throwing of test intravenously promotes the ability that the lung of siRNA absorbs with back PEI, earlier approach is given and mouse pCMV-luc DNA-PEI mixture in tracheae, then with intravenous route injection and PEI compound Luc specific siRNA, with 5% glucose of PEI compound contrast GFP specific siRNA or equal volume.After 24 hours, the Luc activity in the lung in the mouse of accepting Luc siRNA than in the mouse of giving with GFP siRNA or non-processor low 17 times (Figure 30 C).Because Luc siRNA can reach effective inhibition of target transcript so described result shows the intravenous injection of siRNA-PEI mixture only suppress the Luc expression in the same lung cell of dna vector transfection in lung.

For the throwing of test lung promotes the ability that the lung of siRNA absorbs with back PEI, give and mouse pCMVDNA-PEI mixture earlier through intravenous route, then immediately in tracheae approach throw with PEI blended Luc specific siRNA, with 5% glucose of PEI blended contrast GFP specific siRNA or equal volume.After 24 hours, analyze the uciferase activity in the lung homogenate.Uciferase activity in the mouse lung homogenate of the next self-sufficiency of Figure 30 D demonstration and luciferase specificity or GFP specific siRNA has been standardized into protein content.Uciferase activity ratio in the mouse of using luciferase siRNA to handle hangs down 6.8 times in the mouse of handling with GFP siRNA.Described result shows lung's throwing and the effective inhibition that reaches the target transcript in pneumonocyte of siRNA-PEI mixture.

Example 16B: by siRNA being delivered to the cyclophilin B that suppresses in the respiratory system in the lung

Cyclophilin B is the native gene that is expressed in widely in the Mammals.Suppress the ability that native gene is expressed for evaluating the siRNA that directly is delivered in the respiratory system, by isofluranum/oxygen anesthesia outbreeding system Blackswiss mouse (about 30g or bigger body weight), and siRNA (Dharmacon with target cyclophilin B, D-001136-01-20 siCONTROLCyclophilin B siRNA (mankind/mouse/rat)) or contrast GFP-949 siRNA (2mg/kg) with approach in the nose throw with mouse in, for every kind of siRNA, 2 mouse are one group.Throw and collect lung after 24 hours.Extract RNA and use random primer to carry out reverse transcription from lung.Use cyclophilin B and GAPDH Taqman gene expression analysis (Applied Biosystems) to carry out PCR in real time then.Result's (table 14) shows that the siRNA by target cyclophilin B reaches 70% inhibition of cyclophilin B.

Table 14: the inhibition of cyclophilin B in the lung

Mean value	On average
				Standard value	Normal value	Suppress per-cent
	PBS-1 PBS-2 GFP-1 GFP-2 cyclophilin-1 cyclophilin-2	5.395406 3.182562 2.547352 4.957539 1.173444 1.339901	4.288984 3.752446 1.256672				12.50968 70.7

Example 17: the selection of suitably conservative target part

Be the suitable conservative region (at described target partly come targeted rna i inductor to be suppressed at expression in multiple bacterial strain) of identification as the various influenza virus A transcripts of target part, to compare from the genomic fragment of one group of virus strain of separating to obtain from the mankind and (be its normal chain form, that is the sequence seen in the mRNA).The bacterial strain of listing in example 1, described bacterial strain also comprises many bacterial strains.Table 15A-15H lists Genbank accession number (left column), strain name (middle column) and the serotype (right being listed as) of the influenza A virus genomic fragment that is used to discern suitable conserved regions.With each segmental whole sequence comparison and relatively, except the intron.Comprise 5 ' and 3 ' non-translational region.Concerning different fragments, the bacterial strain group difference of being compared, but every group comprises at least 19 kinds at the isolated bacterial strain of crossing between 1934 and 2004 of each time.Bacterial strain comprise known in the mankind all HA of round-robin and NA type (H1, H2, H3, H5, H9, N1, N2).

Table 15A: influenza A virus NP fragment (separating the bacterial strain that obtains from the mankind)

AF389119 A/ Puerto Rico/8/34/ west is mountain (Mount Sinai) H1N1

M63752 A/ Singapore/1/57 H2N2

M23976 A/ Ann Arbor (ann arbor)/6/60 H2N2

AY210103 A/ Korea S/426/68 H2N2

M76606 A/ New Jersey/8/76 H1N1

L07351 A/ Memphis/18/78 H3N2

AJ628066 A/ Fiji/15899/83 H1N1

L07369 A/ Memphis/3/88 H3N2

M63755 A/ Wisconsin/3523/88 H1N1

L07373 A/ Guangdong/38/89 H3N2

L07357 A/ Shanghai/6/90 H3N2

L24394 A/MD/12/91 H1N1

AF038254 A/ Kitakyushu (Kitakyushu)/159/93 H3N2

AB019358 A/ Nagasaki/48/95 H3N2

AJ291400 A/ Hong Kong/156/97 H5N1

AF255749 A/ Hong Kong/498/97 H3N2

AF255752 A/ Hong Kong/542/97 H5N1

AF038259 A/ Shiga (Shiga)/25/97 H3N2

AF255753 A/ Hong Kong/97/98 H5N1

AF342819 A/ Wisconsin/10/98 H1N1

AJ289871 A/ Hong Kong/1073/99 H9N2

AJ458276 A/ Switzerland/9243/99 H3N2

ISDN13443 A/ Sydney/274/2000 H3N2

AB126624 A/ Yokohama/22/2002 H1N2

AY575905 A/ Hong Kong/212/03 H5N1

AY526749 A/ Vietnam/1196/04 H5N1

Table 15B: influenza A virus PA transcript (separating the bacterial strain that obtains from the mankind)

AF389117 A/ Puerto Rico/8/34/ west is mountain H1N1

M26078 A/ Singapore/1/57 H2N2

M23974 A/ Ann Arbor/6/60 H2N2

M26079 A/ Korea S/426/68 H2N2

AJ605762 A/ Fiji/15899/83 H1N1

AF037424 A/ Kitakyushu/159/93 H3N2

U71138 A/ Shiga/20/95 H3N2

AJ289874 A/ Hong Kong/156/97 H5N1

AF257198 A/ Hong Kong/498/97 H3N2

AF257201 A/ Hong Kong/542/97 H5N1

AF037429 A/ Shiga/25/97 H3N2

AF258519 A/ Hong Kong/427/98 H1N1

AF257202 A/ Hong Kong/97/98 H5N1

AY043028 A/ Guangzhou/333/99 H9N2

AF257191 A/ Hong Kong/1073/99 H9N2

AJ293922 A/ Hong Kong/1774/99 H3N2

AB126627 A/ Yokohama/22/2002 H1N2

AY576404 A/ Hong Kong/212/03 H5N1

AY526750 A/ Vietnam/1196/04 H5N1

Table 15C: influenza A virus PB1 transcript (separating the bacterial strain that obtains from the mankind)

AF389116 A/ Puerto Rico/8/34/ west is mountain H1N1

M25924 A/ Singapore/1/57 H2N2

M23972 A/ Ann Arbor/6/60 H2N2

M25935 A/ Korea S/426/68 H2N2

AJ564807 A/ Fiji/15899/83 H1N1

AF037418 A/ Kitakyushu/159/93 H3N2

U71130 A/ Shiga/20/95 H3N2

AJ404633 A/ Hong Kong/156/97 H5N1

AF258823 A/ Hong Kong/498/97 H3N2

AF258826 A/ Hong Kong/542/97 H5N1

AF037423 A/ Shiga/25/97 H3N2

AF258526 A/ Hong Kong/427/98 H1N1

AF258827 A/ Hong Kong/97/98 H5N1

AY043029 A/ Guangzhou/333/99 H9N2

AF258816 A/ Hong Kong/1073/99 H9N2

AJ293921 A/ Hong Kong/1774/99 H3N2

AJ489539 A/ Britain/627/01 H1N2

AB126625 A/ Yokohama/22/2002 H1N2

AY576392 A/ Hong Kong/212/03 H5N1

AY526751 A/ Vietnam/1196/04 H5N1

Table 15D: influenza A virus PB2 transcript (separating the bacterial strain that obtains from the mankind)

AF389115 A/ Puerto Rico/8/34/ west is mountain H1N1

M73521 A/ Singapore/1/57 H2N2

M23970 A/ Ann Arbor/6/60 H2N2

M73524 A/ Korea S/426/68 H2N2

Grand/307/72 H3N2 of M91712 A/ crow

AJ564805 A/ Fiji/15899/83 H1N1

AF037412 A/ Kitakyushu/159/93 H3N2

U53158 A/ Wisconsin/4754/94 H1N1

U71134 A/ Shiga/20/95 H3N2

AF036363 A/ Hong Kong/156/97 H5N1

AF258842 A/ Hong Kong/498/97 H3N2

AF258845 A/ Hong Kong/542/97 H5N1

AF037417 A/ Shiga/25/97 H3N2

AF258525 A/ Hong Kong/427/98 H1N1

AF258846 A/ Hong Kong/97/98 H5N1

AF342824 A/ Wisconsin/10/98 H1N1

AY043030 A/ Guangzhou/333/99 H9N2

AJ404630 A/ Hong Kong/1073/99 H9N2

AJ293920 A/ Hong Kong/1774/99 H3N2

AJ489485 A/ Britain/627/01 H1N2

AB126626 A/ Yokohama/22/2002 H1N2

AY576380 A/ Hong Kong/212/03 H5N1

AY526752 A/ Vietnam/1196/04 H5N1

Table 1E: influenza A virus M transcript (separating the bacterial strain that obtains from the mankind)

AF389121 A/ Puerto Rico/8/34/ west is mountain H1N1

X08093 A/ Singapore/1/57 H2N2

M23978 A/ Ann Arbor/6/60 H2N2

M63531 A/ Korea S/426/68 H2N2

Grand/72 H3N2 of J02167 A/ crow

AJ298947 A/ Fiji/15899/83 H1N1

U65562 A/ Kitakyushu/159/93 H3N2

U53168 A/ Wisconsin/4754/94 H1N1

U65573 A/ Shiga/20/95 H3N2

AJ458306 A/ South Africa/1147/96 H3N2

AF036358 A/ Hong Kong/156/97 H5N1

AF255370 A/ Hong Kong/498/97 H3N2

AF255373 A/ Hong Kong/542/97 H5N1

AF038274 A/ Shiga/25/97 H3N2

AF258523 A/ Hong Kong/427/98 H1N1

AF255374 A/ Hong Kong/97/98 H5N1

AF342818 A/ Wisconsin/10/98 H1N1

AY043025 A/ Guangzhou/333/99 H9N2

AF255363 A/ Hong Kong/1073/99 H9N2

AJ293925 A/ Hong Kong/1774/99 H3N2

AJ458304 A/ Saudi Arabia/7971/2000 H1N1

AJ489530 A/ Britain/627/01 H1N2

AB126629 A/ Yokohama/22/2002 H1N2

AY575893 A/ Hong Kong/212/03 H5N1

AY526748 A/ Vietnam/1196/04 H5N1

Table 15F: influenza A virus NS transcript (separating the bacterial strain that obtains from the mankind)

AF389122 A/ Puerto Rico/8/34/ west is mountain H1N1

AY210151 A/ Singapore/1/57 H2N2

AY210161 A/ Ann Arbor/6/60 H2N2

AY210191 A/ Korea S/426/68 H2N2

Grand/72 H3N2 of V01102 A/ crow

AJ298950 A/ Fiji/15899/83 H1N1

D30676 A/ Kitakyushu/159/93 H3N2

U53170 A/ Wisconsin/4754/94 H1N1

U65673 A/ Shiga/20/95 H3N2

AF036360 A/ Hong Kong/156/97 H5N1

AF256183 A/ Hong Kong/498/97 H3N2

AF256187 A/ Hong Kong/542/97 H5N1

AF038279 A/ Shiga/25/97 H3N2

AF258521 A/ Hong Kong/427/98 H1N1

AF256188 A/ Hong Kong/97/98 H5N1

AF342817 A/ Wisconsin/10/98 H1N1

AY043027 A/ Guangzhou/333/99 H9N2

AF256177 A/ Hong Kong/1074/99 H9N2

AJ293941 A/ Hong Kong/1774/99 H3N2

AJ519463 A/ Saudi Arabia/7971/2000 H1N1

AJ489552 A/ Britain/627/01 H1N2

AB126628 A/ Yokohama/22/2002 H1N2

AY576368 A/ Hong Kong/212/03 H5N1

AY526747 A/ Vietnam/1196/04 H5N1

Table 15G: influenza A virus NA transcript (separating the bacterial strain that obtains from the mankind)

AF389120 A/ Puerto Rico/8/34/ west is mountain H1N1

AY209895 A/ Singapore/1/57 H2N2

AY209903 A/ Ann Arbor/6/60 H2N2

AY209932 A/ Korea S/426/68 H2N2

M27970 A/ New Jersey/8/76 H1N1

K01017 A/ Memphis/10/78 H1N1

AJ006954 A/ Fiji/15899/83 H1N1

U42634 A/ Britain/427/88 H3N2

U47816 A/ Wisconsin/3523/88 H1N1

U42636 A/ Shanghai/24/90 H3N2

U42774 A/ California/271/92 H3N2

AF038260 A/ Kitakyushu/159/93 H3N2

AJ457945 A/ Nanchang/933/95 H3N2

AF036357 A/ Hong Kong/156/97 H5N1

AF102670 A/ Hong Kong/542/97 H5N1

AF038264 A/ Shiga/25/97 H3N2

AF102661 A/ Hong Kong/97/98 H5N1

AF533749 A/ Montevideo (Montevideo)/2728/98 H3N2

AY043022 A/ Shaoguan/408/98 H9N2

AF342820 A/ Wisconsin/10/98 H1N1

AJ404629 A/ Hong Kong/1073/99 H9N2

AJ293923 A/ Hong Kong/1774/99 H3N2

AJ307628 A/ Montreal (Montreal)/MTL516/00 H3N2

AF503466 A/ Singapore/63/2001 H1N2

AJ457947 A/ Ireland/1092/2002 H3N2

AB126623 A/ Yokohama/22/2002 H1N2

AY575881 A/ Hong Kong/212/03 H5N1

AY555151 A/ Thailand/1-KAN-1/2004 H5N1

AY526746 A/ Vietnam/1196/04 H5N1

Table 15H: influenza A virus HA transcript (separating the bacterial strain that obtains from the mankind)

AF389118 A/ Puerto Rico/8/34/ west is mountain H1N1

L20410 A/ Singapore/1/57 H2N2

AF270721 A/ Ann Arbor/6/60 H2N2

L11133 A/ Korea S/426/68 H2N2

AY661044 A/ Bill holds in the palm sweet smell (Bilthoven)/628/76 H3N2

AJ289702 A/ Fiji/15899/83 H1N1

AY661055 A/ Britain/427/88 H3N2

L33755 A/ Finland/75/88 H1N1

AY661074 A/ Shanghai/24/90 H3N2

AF008817 A/ California/271/92 H3N2

D30669 A/ Kitakyushu/159/93 H3N2

AF008725 A/ Nanchang/933/95 H3N2

AF036356 A/ Hong Kong/156/97 H5N1

AF102678 A/ Hong Kong/542/97 H5N1

AJ311466 A/ Sydney/5/97 H3N2

AF102676 A/ Hong Kong/97/98 H5N1

AY271794 A/ Memphis/31/98 H3N2

AY043017 A/ Shaoguan/408/98 H9N2

AF342821 A/ Wisconsin/10/98 H1N1

AJ404626 A/ Hong Kong/1073/99 H9N2

AJ293926 A/ Hong Kong/1774/99 H3N2

ISDNOS0022 A/ Olso (Oslo)/6391/2000 H3N2

AF503481 A/ Singapore/63/2001 H1N2

AY661030 A/ Holland/120/02 H3N2

AB126622 A/ Yokohama/22/2002 H1N2

AY575869 A/ Hong Kong/212/03 H5N1

AY555150 A/ Thailand/1-KAN-1/2004 H5N1

AY526745 A/ Vietnam/1196/04 H5N1

For one group of preferred target part of identification between a big group influenza A virus strain, the sequence of selecting the PR8 bacterial strain is as basic sequence.Use each segmental whole sequence, except the intron.Sequence is shown among Figure 32 A-32J (SEQ ID NO:383-392).These sequences are contacted, form the single long sequence that is following order: NP, PB2, PB1, PA, M1, M2, NS1, NS2, HA, NA.By beginning at 5 ' end, use 19 Nucleotide " window " and select first possible target part, and follow on 3 ' direction, window is moved 1 Nucleotide to select next possible target part at every turn, discern the part of sequence with 19 length of nucleotides.Continue this process up to reaching 3 of transcript ' end.Although recognize and also can select short or long target part, consider the possible target part of each 19 Nucleotide districts representative.Discharge outside in the zone of containing the part of 2 kinds of different transcripts.Can easily determine from 13,472 possible targets sequence partly that described process obtains by the SEQ ID NO:383-392 among reference Figure 32.For example, in each sequence, the position that target partly extends is 1-19,2-20,3-21,4-22,5-23,6-24 etc.In NP transcript (SEQ ID NO:383), target partly is 1-19,2-20,3-21,4-22...1547-1565.In PB2 (SEQ ID NO:384) transcript, target partly is 1-19,2-20,3-21,4-22...2323-2341.In PB1 transcript (SEQ ID NO:385), target partly is 1-19,2-20,3-21,4-22...2323-2341.In PA transcript (SEQ ID NO:386), target partly is 1-19,2-20,3-21,4-22...2215-2233.In M1 transcript (SEQ ID NO:387), target partly is 1-19,2-3-21,4-22...1009-1027.In M2 transcript (SEQ ID NO:388), target partly is 1-19,2-20,3-21,4-22...321-339.In NS1 transcript (SEQ ID NO:389), target partly is 1-19,2-20,3-21,4-22...872-890.In NS2 transcript (SEQ ID NO:390), target partly is 1-19,2-20,3-21,4-22...400-418.In HA transcript (SEQ ID NO:391), target partly is 1-19,2-20,3-21,4-22...1767-1775.In the NA transcript, target partly is 1-19,2-20,3-21,4-22...1395-1413 (SEQID NO:392).To reaching the illustrative purpose, preceding 6 target parts of NP transcript have been listed in the table 16.

Target part in the table 16:NP gene

The ID numbering	Sequence	Nucleotide position
				1	AGCAAAAGCAGGGTAGATA(SEQ ID NO：394)	1-19
2	GCAAAAGCAGGGTAGATAA(SEQ ID NO：395)	2-20
			3	CAAAAGCAGGGTAGATAAT(SEQ ID NO：396)	3-21
4	AAAAGCAGGGTAGATAATC(SEQ ID NO：397)	4-22
			5	AAAGCAGGGTAGATAATCA(SEQ ID NO：398)	5-23
6	AAGCAGGGTAGATAATCAC(SEQ ID NO：399)	6-24

Possible target partly stands to select step, has the target part that is used for by the preferred feature of RNAi inductor inhibition with identification.Be applied to select standard in the step to comprise based on the filtration of GC content with based on the existence whether filtration of continuous segment G or C Nucleotide.For example, G or the C Nucleotide less than 70% is preferably contained in preferred RNAi inductor inhibitory area, and does not preferably contain above 3G Nucleotide or surpass the continuous segment of 3C Nucleotide.Therefore, preferred target partly contains G or the C Nucleotide less than 70%, and does not preferably contain above 3G Nucleotide or surpass the continuous segment of 3C Nucleotide.Use the remaining target in filtration back and partly be called " function target part ".Table 17 has been listed 2,244 function target parts.

To compare from the corresponding target sequence partly of other bacterial strains of listing among the sequence of the function target of PR8 part and the table 15A-15H.Corresponding target part in other bacterial strains easily based on its in fragment the position and discerned based on its sequence, identical with target part among the PR8 in fact usually.

Recognize,, the GU base pairing can take place according to " swing rule (wobble rules) ".Recognize that also the importance of keeping the complementarity between antisense strand and the target is different at the different positions place.Therefore discerned when the part of the target among the PR8 partly compares (wherein all 5 ' compare) on 3 ' direction with corresponding target in the bacterial strain, satisfied the target part of following standard with at least 80% of the target part of PR8 bacterium strain relatively: (1) is that G or C are the difference of U in any position permission PR8 sequence with A between the corresponding sequence; (2) only to allow the PR8 sequence be the A difference that A or C are with G between the corresponding sequence to one or more positions in position 1,18 and 19; (3) between position 1 and 9, between PR8 sequence and corresponding sequence, there is 0,1,2 or 3 difference; (4) between PR8 sequence and corresponding sequence, exist and be no more than 2 continuous differences; With, there are maximum 1 difference in (5) between PR8 sequence and corresponding sequence between position 11 and 17.

The target that satisfies above-mentioned standard partly is appointed as " suitably conservative target part ".Listed in the table 18 in the sequence that derives from 220 suitably conservative between human influenza bacterial strain target parts.The target part is from transcript NP, PB2, PB1, PA, M, NS and HA.Described suitably conservative target partly is of the present inventionly to be used to suppress the derive preferred target of RNAi inductor of influenza A virus strain of the multiple different mankind, and complementary fully with the inhibitory area of some preferred antisense strand.

Selected suitably to guard after the target part, partly compare in the future, and partly compare with the target of discerning from human derivative strain since bird (comprising duck, chicken, sea-gull, teal, tern, quail, pheasant, turkey, goose, pigeon, falcon and various other birds) or from the corresponding target that environment (supposition has poultry derived) separates the influenza A virus strain that obtains.The bacterial strain of listing in example 1, described bacterial strain also comprises a large amount of bacterial strains.Table 19A-19F lists Genbank accession number (left column), strain name (middle column) and the serotype (right row) that is used to discern suitably conservative target influenza A virus genomic fragment (being its normal chain form) partly.Concerning different fragments, the bacterial strain group difference of being compared, but every group comprises at least 30 kinds at the isolated bacterial strain of each time of crossing over 1934-2004.Application is used to discern the identical choice criteria from the suitably conservative target part of human derivative strain.The result is created in 138 suitably conservative between human and avian derived bacterial strain target parts.The target part is from transcript NP, PB2, PB1, PA, M and NS.Table 20 has been listed these suitably conservative target parts.Described target partly is of the present inventionly to be used to suppress that the multiple different mankind derive and the preferred target of the RNAi inductor of avian derived influenza A virus strain, and complementary fully with the inhibitory area of some preferred antisense strand of RNAi inductor of the present invention.

Table 19A: influenza A virus PA transcript (separating the bacterial strain that obtains from bird)

M21850 A/ chicken/FPV/ Rostock/34 H7N1

M26088 A/ sea-gull/Maryland/704/77 H13N6

M26085 A/ pin tail/Alberta (Alberta)/119/79 H4N6

AY633193 A/ wild duck/Alberta/203/93 H6N5

AY633305 A/ wild duck/Albert/76/94 H6N8

AF098606 A/ chicken/Hong Kong/728/97 H5N1

AF156444 A/ chicken/Hong Kong/G9/97 H9N2

AY633393 A/ teal/Alberta/16/97 H2N9

AF536676 A/ chicken/Henan/98 H9N2

AJ291397 A/ chicken/Pakistan/2/99 H9N2

AF216731 A/ environment/Hong Kong/437-8/99 H5N1

AY633353 A/ pin tail/Alberta/207/99 H4N8

AY180690 A/ Bantam/Nanchang/9-366/2000 H3N3

AF508676 A/ chicken/Henan/62/00 H9N2

AY059530 A/ duck/Hong Kong/ww461/2000 H5N1

AY180683 A/ duck/Nanchang/4-191/2000 H4N6

AF523462 A/ duck/Shantou/2030/00 H9N1

AY180693 A/ quail/Nanchang/4-034/2000 H4N6

AY180696 A/ quail/Nanchang/4-040/2000 H9N2

AF457716 A/ chicken/California/1002a/00 H6N2

AY633153 A/ wild duck/Alberta/127/00 H3N8

AF509210 A/ chicken/Hong Kong/866.3/01 H5N1

AY180709 A/ quail/Nanchang/2-040/2001 H3N6

AF523454 A/ wild duck/Shantou/4808/01 H9N2

AF457683 A/ chicken/California/6643/01 H6N2

AY180678 A/ chicken/Nanchang/3-201/01 H3N6

AY422033 A/ duck/Hokkaido/86/01 H2N3

AY303660 A/ chicken/Chile/176822/02 H7N3

AY576411 A/ chicken/Hong Kong/61.9/02 H5N1

AY586433 A/ turkey/Italy/220158/2002 H7N3

AY342420 A/ chicken/Holland/1/03 H7N7

AY616764 A/ chicken/Britain Colombia/04 H7N3

AY609311 A/ chicken/Guangdong/174/04 H5N1

Table 19B: influenza A virus PB1 transcript (separating the bacterial strain that obtains from bird)

U48280 A/ duck/Hong Kong/62/76 H11N2

M25933 A/ sea-gull/Maryland/704/77 H13N6

M25925 A/ turkey/Minnesota (Minnesota)/833/80 H4N2

AY633210 A/ wild duck/Alberta/206/96 H6N8

AY633186 A/ wild duck/Alberta/202/96 H2N5

AF098592 A/ chicken/Hong Kong/728/97 H5N1

AF156416 A/ chicken/Hong Kong/G9/97 H9N2

AY633394 A/ teal/Alberta/16/97 H2N9

AF536666 A/ chicken/Henan/98 H9N2

AF508626 A/ chicken/Korea S/99029/99 H9N2

AF216732 A/ environment/Hong Kong/437-8/99 H5N1

AY633354 A/ pin tail/Alberta/207/99 H4N8

AY180888 A/ Bantam/Nanchang/9-366/2000 H3N3

AY180885 A/ duck/Nanchang/4-191/2000 H4N6

AF523445 A/ duck/Shantou/2030/00 H9N1

AY180891 A/ quail/Nanchang/4-034/2000 H4N6

AY180892 A/ quail/Nanchang/4-040/2000 H9N2

AF457698 A/ chicken/California/431/00 H6N2

AY633154 A/ wild duck/Alberta/127/00 H3N8

AF509184 A/ chicken/Hong Kong/866.3/01 H5N1

AY180893 A/ chicken/Nanchang/1-101/2001 H3N6

AY180864 A/ quail/Nanchang/2-040/2001 H3N6

AF523431 A/ wild duck/Shantou/4808/01 H9N2

AY180872 A/ chicken/Nanchang/3-201/01 H3N6

AY422037 A/ duck/Hokkaido/86/01 H2N3

AY303664 A/ chicken/Chile/4957/02 H7N3

AY576400 A/ chicken/Hong Kong/YU777/02 H5N1

AY586436 A/ turkey/Italy/220158/2002 H7N3

AY340085 A/ chicken/Holland/1/03 H7N7

AY616765 A/ chicken/Britain Colombia/04 H7N3

AY609310 A/ chicken/Guangdong/174/04 H5N1

AY590582 A/ chicken/Buddhist system (Nakorn-Pathom)/Thailand H5N1

/CU-K2/2004

Table 19C: influenza A virus PB2 transcript (separating the bacterial strain that obtains from bird)

M73514 A/ turkey/Minnesota/833/80 H4N2

M73516 A/ sea-gull/Astrakhan/227/84 H13N6

AF268115 A/ turnstone (Ruddy Turnstone)/Delaware H3N4

(Delaware)/168/94

AY63 3243 A/ wild duck/Alberta/232/94 H6N8

AF268119 A/ aquatic bird/Delaware/23/96 H10N9

AF508651 A/ chicken/Guangdong/11/97 H9N2

AF098579 A/ chicken/Hong Kong/728/97 H5N1

AF156430 A/ chicken/Hong Kong/G9/97 H9N2

AF536686 A/ chicken/Henan/98 H9N2

AJ410602 A/ duck/Hong Kong/323/98 H6N2

AF508642 A/ chicken/Pakistan/5/99 H9N2

AF216733 A/ environment/Hong Kong/437-8/99 H5N1

AY633355 A/ pin tail/Alberta/207/99 H4N8

AY180775 A/ Bantam/Nanchang/9-366/2000 H3N3

AY180770 A/ duck/Nanchang/4-191/2000 H4N6

AF523481 A/ duck/Shantou/2030/00 H9N1

AY180772 A/ quail/Nanchang/4-034/2000 H4N6

AY180773 A/ quail/Nanchang/4-040/2000 H9N2

AF457689 A/ chicken/California/465/00 H6N2

AY633155 A/ wild duck/Alberta/127/00 H3N8

AF509158 A/ chicken/Hong Kong/866.3/01 H5N1

AY180759 A/ quail/Nanchang/2-040/2001 H3N6

AF523464 A/ wild duck/Shantou/4808/01 H9N2

AF457681 A/ chicken/California/6643/01 H6N2

AY180763 A/ chicken/Nanchang/3-201/01 H3N6

AY422041 A/ duck/Hokkaido/86/01 H2N3

AY576388 A/ chicken/Hong Kong/YU777/02 H5N1

AJ627496 A/ turkey/Italy/220158/2002 H7N3

AY342413 A/ bird/Holland/219/03 H7N7

AY342414 A/ chicken/Holland/1/03 H7N7

AY616766 A/ chicken/Britain Colombia/04 H7N3

AY609309 A/ chicken/Guangdong/174/04 H5N1

AY590681 A/ chicken/Buddhist system/Thailand/CU-K2/2004 H5N1

Table 19D: influenza A virus M transcript (separating the bacterial strain that obtains from bird)

M23917 A/ chicken/FPV/ defends bridge (Weybridge) H7N7

M63538 A/ sea-gull/Massachusetts/26/80 H13N6

AJ427302 A/ bends mouth dunlin (curlew sandpiper)/Hong Kong H10N5

/208/89

U49117 A/ duck/Nanchang/1749/92 H11N2

AF073180 A/ chicken/New Jersey/15086-3/94 H7N3

AF098562 A/ chicken/Hong Kong/728/97 H5N1

AF156458 A/ chicken/Hong Kong/G9/97 H9N2

AF250487 A/ duck/Hong Kong/P169/97 H3N8

AF250489 A/ duck/Hong Kong/P54/97 H11N9

AF250490 A/ duck/Hong Kong/T25/97 H11N8

AF250492 A/ duck/Hong Kong/Y264/97 H4N8

AY633389 A/ teal/Alberta/16/07 H2N9

AF536726 A/ chicken/Henan/98 H9N2

AY241600 A/ chicken/NY/12273-11/99 H7N3

AF216727 A/ environment/Hong Kong/437-8/99 H5N1

AJ427299 A/ aquatic bird/Hong Kong/399/99 H3N8

AY633349 A/ pin tail/Alberta/207/99 H3N3

AY180518 A/ Bantam/Nanchang/9-366/2000 H3N3

AY180509 A/ duck/Nanchang/4191/2000 H4N6

AF523500 A/ duck/Shantou/2030/00 H9N1

AY180507 A/ quail/Nanchang/4-034/2000 H4N6

AY180504 A/ quail/Nanchang/4-040/2000 H9N2

AY300962 A/ bird/NY/53726/00 H5N2

AY633149 A/ wild duck/Alberta/127/00 H3N8

AF474055 A/ chicken/California/6643/2001 H6N2

AF509055 A/ chicken/Hong Kong/866.3/01 H5N1

AY180523 A/ quail/Nanchang/2-040/2001 H3N6

AF523484 A/ wild duck/Shantou/4804/01 H9N2

The blue wing teal of AY300975 A//TX/2/01 H7N3

AY180505 A/ chicken/Nanchang/3-201/01 H3N6

AY422020 A/ duck/Hokkaido/86/01 H2N3

AY241624 A/ turkey/VA/67/02 H7N2

AY300974 A/ duck/NY/191255-59/02 H5N8

AY300971 A/ turkey/CA/D0208651-C/02 H5N2

AJ627497 A/ turkey/Italy/220168/2002 H7N3

AY340091 A/ chicken/Holland/1/03 H7N7

AY611525 A/ chicken/Britain Colombia/04 H7N3

AY609315 A/ chicken/Guangdong/174/04 H5N1

AY590578 A/ chicken/Buddhist system/Thailand/CU-K2/2004 H5N1

Table 19E: influenza A virus NS transcript (separating the bacterial strain that obtains from fowl)

J02105 A/ duck/Alberta/60/76 H12N5

U96743 A/ sea-gull/Maryland/1824/78 H13N9

U96739 A/ chicken/Pennsylvania/1370/83 H13N6

AF007035 A/ duck/Ohio/421/87 H7N8

AF074267 A/ chicken/New Jersey/15086-3/94 H7N3

AF156472 A/ chicken/Hong Kong/G9/97 H9N2

AF319651 A/ chicken/Italy/9097/97 H5N9

AF250495 A/ duck/Hong Kong/P169/97 H3N8

AF250498 A/ duck/Hong Kong/P54/97 H11N9

AF250499 A/ duck/Hong Kong/T25/97 H11N8

AF250501 A/ duck/Hong Kong/Y264/97 H4N8

AY633392 A/ teal/Alberta/16/97 H2N9

AF536736 A/ chicken/Henan/98 H9N2

AJ410587 A/ duck/Hong Kong/324/98 H6N2

AY241629 A/ chicken/NY/12273-11/99 H7N3

AF216726 A/ environment/Hong Kong/437-8/99 H5N1

AJ427300 A/ aquatic bird/Hong Kong/399/99 H3N8

AY633352 A/ pin tail/Alberta/207/99 H4N8

AY180647 A/ Bantam/Nanchang/9-366/2000 H3N3

AY180606 A/ duck/Nanchang/4-191/2000 H4N6

AF523502 A/ duck/Shantou/2030/00 H9N1

AY180614 A/ quail/Nanchang/4-034/2000 H4N6

AY180617 A/ quail/Nanchang/4-040/2000 H9N2

AY300986 A/ bird/NY/53726/00 H5N2

AY180620 A/ wild duck/Alberta/127/00 H3N8

The blue wing teal of AY300999 A//TX/2/01 H7N3

AF457675 A/ chicken/California/905/01 H6N2

AY259220 A/ chicken/Hebei/1/01 H9N2

AY180600 A/ chicken/Nanchang/3-201/01 H3N6

AY422029 A/ duck/Hokkaido/86/01 H2N3

AY241662 A/ turkey/VA/67/02 H7N2

AY300998 A/ duck/NY/191255-59/02 H5N8

AY300995 A/ turkey/CA/D0208651-C/02 H5N2

AY303645 A/ chicken/Chile/4322/03 H7N3

AY342424 A/ chicken/Holland/1/03 H7N7

AY611528 A/ chicken/Britain Colombia/04 H7N3

AY609316 A/ chicken/Guangdong/174/04 H5N1

AY590580 A/ chicken/Buddhist system/Thailand/CU-K2/2004 H5N1

Table 19F: influenza A virus NP transcript (separating the bacterial strain that obtains from bird)

M63779 A/FPV/ all cloth gloomy (Dobson)/' Holland '/27 H7N7

AJ243993 A/FPV/ Rostock/34 H7N1

M22576 A/FPV/ Rostock/34 H7N1

M21937 A/FPV/ Rostock/34 H7N1

M24660 A/FPV/ Rostock/34 (mutant strain ts19) H7N1

M24556 A/FPV/ Rostock/34 (reverse mutation strain 19R) H7N1

M24557 A/FPV/ Rostock/34 (reverse mutation strain 81R) H7N1

M24453 A/ chicken/Germany/N/49 H10N7

M63773 A/ duck/Manitoba/1/53 H10N7

M63780 A/ duck/Britain/1/56 H11N6

M30762 A/ duck/Czechoslovakia/56 H4N6

M30763 A/ duck/Ukraine/2/60 H11N8

M30767 A/ tern/South Africa/61 H5N3

M63781 A/ duck/Britain/1/62 H4N6

AF156415 A/ turkey/California/189/66 H9N2

M63774 A/ turkey/ontario/7732/66 H5N9

M63775 A/ duck/Pennsylvania/1/69 H6N1

M27298 A/ shearwater (shearwater)/Australia/72 H6N5

M27519 A/ tern/Turkmenistan (Turkmenia)/18/72 H3N3

M22344 A/ parrot/Ulster (Ulster)/73 H7N1

M63776 A/ duck/Memphis/928/74 H3N8

M22573 A/ duck/Hong Kong/7/75 H3N2

M36812 A/ pin tail/ratio rubs and controls (Primorje)/695/76 H2N3

AF523423 A/ duck/Hong Kong/86/76 H9N2

U49093 A/ goose/Hong Kong/8/76 H1N1

M30760 A/ duck/New Zealand/31/76 H4N6

U49097 A/ duck/Hong Kong/193/77 H1N2

M63777 A/ sea-gull/Maryland/5/77 H11N9

M30765 A/ budgerigar/Hokkaido/1/77 H4N6

M22574 A/ duck/Bavaria/2/77 H1N1

M27521 A/ sea-gull/Maryland/704/77 H13N6

M76603 A/ turkey/Britain/647/77 H1N1

M63782 A/ duck/Beijing/1/78 H3N6

AF523421 A/ duck/Hong Kong/289/78 H9N2

AF523424 A/ duck/Hong Kong/366/78 H9N2

D00050 A/ wild duck/New York/6750/78 H2N2

M30755 A/ sea-gull/Maryland/1824/78 H13N9

AF523422 A/ duck/Hong Kong/552/79 H9N2

U49095 A/ duck/Hong Kong/717/79 H1N3

M30761 A/ ash teal/Australia/2/79 H4N4

M30756 A/ sea-gull/Maryland/1815/79 H13N6

M63783 A/ duck/Australia/749/80 H1N1

AF079571 A/ duck/Hokkaido/8/80 H3N8

M30752 A/ sea-gull/Massachusetts/26/80 H13N6

M30757 A/ sea-gull/Minnesota/945/80 H13N6

M63784 A/ teal/Iceland/29/80 H7N7

M30769 A/ turkey/Minnesota/833/80 H4N2

M63778 A/ turkey/Minnesota/I661/81 H1N1

M63785 A/ wild duck/Astrakhan (Prokofiev in the Gu)/263/82H14N5

M30764 A/ wild duck/Astrakhan/244/82 H14

M30768 A/ chicken/Pennsylvania/1/83 H5N2

AY633119 A/ wild duck/Alberta/743/83 H9N1

M30753 A/ sea-gull/Astrakhan/227/84 H13N6

AY633311 A/ wild duck/Alberta/98/85 H6N2

AY633319 A/ pin tail/Alberta/113/85 H6N2

M30766 A/ turnstone/New Jersey/47/85 H4N6

Z26855 A/ oyster catcher/Germany/87 H1N1

AY633279 A/ wild duck/Alberta/321/88 H9N2

M76609 A/ turkey/North Carolina (North Carolina) H1N1

/1790/88

AJ427301 A/ bends mouth dunlin/Hong Kong/208/89 H10N5

AY633295 A/ wild duck/Alberta/11/91 H9N2

AY633167 A/ wild duck/Alberta/17/91 H9N2

Z26857 A/ turkey/Germany/3/91 H1N1

U49094 A/ duck/Nanchang/1749/92 H11N2

AF156410 A/ quail/Hong Kong/AF157/92 H9N2

AY633191 A/ wild duck/Alberta/203/92 H6N5

AF156414 A/ quail/Arkansas State/29209-1/93 H9N2

AY633335 A/ pin tail/Alberta/179/93 H6N1

AF156409 A/ chicken/Beijing/1/94 H9N2

AY497120 A/ chicken/Hidalgo (Hidalgo)/232/94 H5N2

AF098624 A/ chicken/Hidalgo/26654-1368/94 H5N2

AF156408 A/ chicken/Hong Kong/739/94 H9N2

AF098625 A/ chicken/Mexico/26654-1374/94 H5N2

AY497113 A/ chicken/Mexico/31381-7/94 H5N2

AF098627 A/ chicken/Pueblo (Puebla)/14585-622/94 H5N2

AY497114 A/ chicken/Pueblo/8623-607/94 H5N2

AF098626 A/ chicken/Pueblo/8623-607/94 H5N2

Pochard/Alberta, AY633383 A/ America/291/94 H6N8

AY633239 A/ wild duck/Alberta/232/94 H6N8

AY633303 A/ wild duck/Alberta/76/94 H6N8

AY633327 A/ pin tail/Alberta/155/94 H6N8

AF536699 A/ chicken/Beijing/1/95 H9N2

AF213906 A/ chicken/Italy/24/95 H1N1

AY497117 A/ chicken/Pueblo/28159-474/95 H5N2

AF098628 A/ chicken/Kui Leitaluo (Queretaro)/14588-19/95 H5N2

AF508600 A/ duck/Germany/113/95 H9N2

AF213905 A/ wild duck/Italy/24/95 H1N1

AF508596 A/ ostrich/South Africa/9508103/95 H9N2

AB020778 A/ chicken/Beijing/1/96 H9N2

AF536703 A/ chicken/Hebei/1/96 H9N2

AF156412 A/ chicken/Korea S/25232-96006/96 H9N2

AF156411 A/ chicken/Korea S/38349-p96323/96 H9N2

AF203787 A/ chicken/Korea S/MS96/96 H9N2

AF508613 A/ chicken/Shandong/6/96 H9N2

AF144303 A/ goose/Guangdong/1/96 H5N1

AY633207 A/ wild duck/Alberta/206/96 H6N8

AF508617 A/ quail/Shanghai/8/96 H9N2

AF156413 A/ aquatic bird/Delaware/9/96 H9N2

AY633183 A/ wild duck/Alberta/202/96 H2N5

AF536700 A/ chicken/Beijing/2/97 H9N2

AF508607 A/ chicken/Guangdong/11/97 H9N2

AF536702 A/ chicken/Guangdong/97 H9N2

AF508609 A/ chicken/Heilungkiang/10/97 H9N2

AF046084 A/ chicken/Hong Kong/220/97 H5N1

AF098618 A/ chicken/Hong Kong/728/97 H5N1

AF098619 A/ chicken/Hong Kong/786/97 H5N1

AF098620 A/ chicken/Hong Kong/915/97 H5N1

AF156403 A/ chicken/Hong Kong/G23/97 H9N2

AF156402 A/ chicken/Hong Kong/G9/97 H9N2

AF098617 A/ chicken/Hong Kong/y388/97 H5N1

AF319644 A/ chicken/Italy/312/97 H5N2

AF319645 A/ chicken/Italy/330/97 H5N2

AF319646 A/ chicken/Italy/367/97 H5N2

AF319647 A/ chicken/Italy/9097/97 H5N9

AF508615 A/ chicken/Shenzhen/9/97 H9N2

AF508612 A/ chicken/Sichuan/5/97 H9N2

AF250473 A/ duck/Hong Kong/P185/97 H3N8

AF250474 A/ duck/Hong Kong/P54/97 H11N9

AF250470 A/ duck/Hong Kong/T25/97 H11N8

AF250471 A/ duck/Hong Kong/T37/97 H11N8

AF156405 A/ duck/Hong Kong/Y280/97 H9N2

AF156406 A/ duck/Hong Kong/Y439/97 H9N2

AF098621 A/ duck/Hong Kong/p46/97 H5N1

AF098622 A/ duck/Hong Kong/y283/97 H5N1

AF508616 A/ duck/Nanjing/1/97 H9N2

ISDN22474 A/ duck/Singapore/645/97 H5N3

AF370122 A/ goose/Guangdong/3/97 H5N1

AF250475 A/ goose/Hong Kong/W217/97 H6N9

AF098623 A/ goose/Hong Kong/w355/97 H5N1

AF508603 A/ pheasant/Ireland/PV18/97 H9N2

AF156404 A/ pigeon/Hong Kong/Y233/97 H9N2

AF156407 A/ quail/Hong Kong/G1/97 H9N2

AF250480 A/ teal/Hong Kong/W312/97 H6N1

AF057293 A/ chicken/Hong Kong/258/97 H5N1

AY633135 A/ wild duck/Alberta/117/97 H3N8

AB049161 A/ parakeet (parakeet)/Chiba (Chiba) H9N2

/1/97

AY633343 A/ pin tail/Alberta/156/97 H3N8

AY633367 A/ pin tail/Alberta/22/97 H2N9

AY633391 A/ teal/Alberta/16/97 H2N9

AF250472 A/ aquatic bird/Hong Kong/M603/98 H11N1

AF508605 A/ chicken/Beijing/8/98 H9N2

AF508599 A/ chicken/Germany/R45/98 H9N2

AF536704 A/ chicken/Hebei/2/98 H9N2

AF536705 A/ chicken/Hebei/3/98 H9N2

AF508608 A/ chicken/Hebei/4/98 H9N2

AF536706 A/ chicken/Henan/98 H9N2

AY497116 A/ chicken/Pueblo/231-5284/98 H5N2

AF536708 A/ chicken/Shandong/98 H9N2

AY253753 A/ chicken/Shanghai/F/98 H9N2

AY497115 A/ chicken/Ah melon links spy (Aguascalientes) H5N2

/124-3705/98

AY633199 A/ wild duck/Alberta/205/98 H2N3

AY633215 A/ wild duck/Alberta/211/98 H1N1

AY633231 A/ wild duck/Alberta/226/98 H2N3

AY633247 A/ wild duck/Alberta/242/98 H3N8

AY633255 A/ wild duck/Alberta/279/98 H3N8

AY633263 A/ wild duck/Alberta/295/98 H4N6

AY633271 A/ wild duck/Alberta/30/98 H4N6

AY633287 A/ wild duck/Alberta/47/98 H4N1

AB049162 A/ parakeet/one-tenth field (Narita)/92A/98 H9N2

AF536701 A/ chicken/Beijing/3/99 H9N2

AF222619 A/ chicken/Hong Kong/FY20/99 H9N2

AF222620 A/ chicken/Hong Kong/KC12/99 H9N2

AF222616 A/ chicken/Hong Kong/NT16/99 H9N2

AF186272 A/ chicken/Hong Kong/SF2/99 H9N2

AF508601 A/ chicken/Iran/11T/99 H9N2

AF508604 A/ chicken/Korea S/99029/99 H9N2

AF536707 A/ chicken/Liaoning/99 H9N2

AF508611 A/ chicken/Ningxia/5/99 H9N2

AJ291394 A/ chicken/Pakistan/2/99 H9N2

AF508597 A/ chicken/Pakistan/4/99 H9N2

AF508598 A/ chicken/Pakistan/5/99 H9N2

AF508602 A/ chicken/Saudi Arabia/532/99 H9N2

AF508614 A/ chicken/Shijiazhuang/2/99 H9N2

AF216736 A/ environment/Hong Kong/437-10/99 H5N1

AF216712 A/ environment/Hong Kong/437-4/99 H5N1

AF216720 A/ environment/Hong Kong/437-6/99 H5N1

AF216728 A/ environment/Hong Kong/437-8/99 H5N1

AF222618 A/ pheasant/Hong Kong/SSP11/99 H9N2

AF222615 A/ pigeon/Hong Kong/FY6/99 H9N2

AF222614 A/ quail/Hong Kong/A17/99 H9N2

AF186270 A/ quail/Hong Kong/NT28/99 H9N2

AF222617 A/ quail/Hong Kong/SSP10/99 H9N2

AF186271 A/ silk plumage Gallus Domesticus (Silky Chicken)/Hong Kong H9N2

/SF43/99

AF222621 A/ silk plumage Gallus Domesticus/Hong Kong/SF44/99 H9N2

AY038019 A/ turkey/MO/24093/99 H1N2

AJ427298 A/ aquatic bird/Hong Kong/399/99 H3N8

AF261750 A/ chicken/Taiwan/7-5/99 H6N1

AY585429 A/ duck/Guangxi/07/1999 H5N1

AJ410555 A/ duck/Hong Kong/3096/99 H6N2

AJ410556 A/ duck/Hong Kong/3461/99 H6N1

AY633127 A/ wild duck/Alberta/111/99 H4N6

AY633175 A/ wild duck/Alberta/199/99 H3N6

AY633223 A/ wild duck/Alberta/215/99 H6N8

AJ410548 A/ pheasant/Hong Kong/SH39/99 H6N1

AY633351 A/ pin tail/Alberta/207/99 H4N8

AY633359 A/ pin tail/Alberta/210/99 H4N6

AY633375 A/ pin tail/Alberta/37/99 H3N8

AJ410549 A/ quail/Hong Kong/1721-20/99 H6N1

AJ410550 A/ quail/Hong Kong/1721-30/99 H6N1

AJ627488 A/ turkey/Italy/4603/1999 H7N1

AY180580 A/ Bantam/Nanchang/9-366/2000 H3N3

AF474069 A/ chicken/California/650/00 H6N2

AF508606 A/ chicken/Guangdong/10/00 H9N2

AF508610 A/ chicken/Henan/62/00 H9N2

AY180581 A/ chicken/Nanchang/1-0016/2000 H9N2

AY180545 A/ chicken/Nanchang/12-220/2000 H3N6

AY180527 A/ chicken/Nanchang/12-301/2000 H3N6

AY180554 A/ chicken/Nanchang/2-0527/2000 H4N6

AY180539 A/ chicken/Nanchang/3-0128/2000 H4N6

AY180531 A/ chicken/Nanchang/4-008/2000 H4N6

AY180562 A/ chicken/Nanchang/4-010/2000 H9N2

AY180529 A/ chicken/Nanchang/7-010/2000 H3N6

AY180535 A/ chicken/Nanchang/9-220/2000 H3N6

AY059497 A/ duck/Hong Kong/2986.1/2000 H5N1

AY059494 A/ duck/Hong Kong/ww381/2000 H5N1

AY059495 A/ duck/Hong Kong/ww461/2000 H5N1

AY180584 A/ duck/Nanchang/1-0070/2000 H9N2

AY180549 A/ duck/Nanchang/10-096/2000 H3N6

AY180553 A/ duck/Nanchang/10-383/2000 H3N6

AY180583 A/ duck/Nanchang/10-389/2000 H9N2

AY180542 A/ duck/Nanchang/11-197/2000 H9N2

AY180544 A/ duck/Nanchang/11-290/2000 H9N2

AY180537 A/ duck/Nanchang/11-392/2000 H9N2

AY180586 A/ duck/Nanchang/12-280/2000 H3N6

AY180524 A/ duck/Nanchang/2-0147/2000 H4N6

AY180557 A/ duck/Nanchang/2-0485/2000 H2N9

AY180558 A/ duck/Nanchang/2-0486/2000 H2N9

AY180573 A/ duck/Nanchang/2-0492/2000 H2N9

AY180574 A/ duck/Nanchang/3-090/2000 H2N9

AY180572 A/ duck/Nanchang/4-165/2000 H4N6

AY180559 A/ duck/Nanchang/4-173/2000 H4N6

AY180568 A/ duck/Nanchang/4-184/2000 H2N9

AY180571 A/ duck/Nanchang/4-190/2000 H2N9

AY180570 A/ duck/Nanchang/4-191/2000 H4N6

AY180534 A/ duck/Nanchang/7-092/2000 H9N2

AY180547 A/ duck/Nanchang/8-174/2000 H3N6

AY180546 A/ duck/Nanchang/8-197/2000 H3N6

AY180532 A/ duck/Nanchang/8-198/2000 H3N6

AY180526 A/ duck/Nanchang/9-091/2000 H3N6

AY180579 A/ duck/Nanchang/9-385/2000 H3N6

AF523413 A/ duck/Shantou/1042/00 H9N2

AF523410 A/ duck/Shantou/1043/00 H9N2

AF523425 A/ duck/Shantou/1588/00 H9N1

AF523420 A/ duck/Shantou/1881/00 H9N2

AF523426 A/ duck/Shantou/2030/00 H9N1

AF523415 A/ duck/Shantou/2102/00 H9N2

AF523411 A/ duck/Shantou/2134/00 H9N2

AF523419 A/ duck/Shantou/2143/00 H9N2

AF523417 A/ duck/Shantou/2144/00 H9N2

AF523416 A/ duck/Shantou/830/00 H9N2

AY059498 A/ goose/Hong Kong/3014.8/2000 H5N1

AF398419 A/ goose/Hong Kong/385.3/2000 H5N1

AF398420 A/ goose/Hong Kong/385.5/2000 H5N1

AY059492 A/ goose/Hong Kong/ww26/2000 H5N1

AY059493 A/ goose/Hong Kong/ww28/2000 H5N1

AY059496 A/ goose/Hong Kong/ww491/2000 H5N1

AY180530 A/ pigeon/Nanchang/11-045/2000 H3N6

AY180538 A/ pigeon/Nanchang/11-145/2000 H9N2

AY180525 A/ pigeon/Nanchang/2-0461/2000 H9N2

AY180560 A/ pigeon/Nanchang/7-058/2000 H9N2

AY180536 A/ pigeon/Nanchang/8-142/2000 H3N6

AY180582 A/ pigeon/Nanchang/9-058/2000 H3N3

AY180550 A/ quail/Nanchang/10-028/2000 H3N6

AY180543 A/ quail/Nanchang/12-340/2000 H1N1

AY180575 A/ quail/Nanchang/2-0460/2000 H9N2

AY180576 A/ quail/Nanchang/2-0579/2000 H4N6

AY180540 A/ quail/Nanchang/4-026/2000 H4N6

AY180541 A/ quail/Nanchang/4-034/2000 H4N6

AY180563 A/ quail/Nanchang/4-040/2000 H9N2

AY180548 A/ quail/Nanchang/7-026/2000 H3N6

AY180564 A/ wild duck/Nanchang/2-0480/2000 H9N2

AF457701 A/ chicken/California/431/00 H6N2

AF457693 A/ chicken/California/465/00 H6N2

AY496851 A/ chicken/Mudanjiang/0823/2000 H9N2

AJ410554 A/ Ou Shi bird (chukka)/Hong Kong/FY295/00H6N1

AJ410553 A/ Ou Shi bird/Hong Kong/NT261/00 H6N1

AY585423 A/ duck/Fujian/19/2000 H5N1

AY585425 A/ duck/Guangdong/07/2000 H5N1

AY585426 A/ duck/Guangdong/12/2000 H5N1

AY585428 A/ duck/Guangdong/40/2000 H5N1

AY585439 A/ duck/Zhejiang/11/2000 H5N1

AY585440 A/ duck/Zhejiang/52/2000 H5N1

AY633143 A/ wild duck/Alberta/119/00 H4N6

AY633151 A/ wild duck/Alberta/127/00 H3N8

AY633159 A/ wild duck/Alberta/136/00 H4N6

AJ421064 A/ pheasant/Hong Kong/FY294/00 H6N1

AJ427309 A/ pheasant/Hong Kong/FY294/00 H6N1

AJ427864 A/ quail/Hong Kong/FY298/00 H6N1

AJ410551 A/ quail/Hong Kong/SF550/00 H6N1

AJ410552 A/ quail/Hong Kong/SF595/00 H6N1

AF474070 A/ chicken/California/139/01 H6N2

AY497118 A/ chicken/El Salvador/102711-1/01 H5N2

AF509126 A/ chicken/Hong Kong/715.5/01 H5N1

AF509127 A/ chicken/Hong Kong/751.1/01 H5N1

AF509128 A/ chicken/Hong Kong/822.1/01 H5N1

AF509129 A/ chicken/Hong Kong/829.2/01 H5N1

AF509130 A/ chicken/Hong Kong/830.2/01 H5N1

AF509131 A/ chicken/Hong Kong/858.3/01 H5N1

AF509132 A/ chicken/Hong Kong/866.3/01 H5N1

AF509133 A/ chicken/Hong Kong/867.1/01 H5N1

AF509135 A/ chicken/Hong Kong/873.3/01 H5N1

AF509136 A/ chicken/Hong Kong/876.1/01 H5N1

AF509134 A/ chicken/Hong Kong/879.1/01 H5N1

AF509137 A/ chicken/Hong Kong/891.1/01 H5N1

AF509138 A/ chicken/Hong Kong/893.2/01 H5N1

AF509120 A/ chicken/Hong Kong/FY150/01 H5N1

AY221551 A/ chicken/Hong Kong/FY150/01 H5N1

AY221550 A/ chicken/Hong Kong/FY150/01-H5N1

AF509117 A/ chicken/Hong Kong/FY77/01 H5N1

AY221549 A/ chicken/Hong Kong/NT873.3/01 H5N1

AY221548 A/ chicken/Hong Kong/NT873.3/01-H5N1

AF509125 A/ chicken/Hong Kong/SF219/01 H5N1

AY221556 A/ chicken/Hong Kong/YU562/01 H5N1

AF509118 A/ chicken/Hong Kong/YU562/01 H5N1

AF509119 A/ chicken/Hong Kong/YU563/01 H5N1

AY221555 A/ chicken/Hong Kong/YU822.2/01 H5N1

AY221554 A/ chicken/Hong Kong/YU822.2/01-H5N1

AY180585 A/ chicken/Nanchang/1-020/2001 H3N6

AY180565 A/ chicken/Nanchang/1-101/2001 H3N6

AY180533 A/ chicken/Nanchang/2-120/2001 H3N6

AY180566 A/ chicken/Nanchang/2-220/2001 H3N6

AY180555 A/ chicken/Nanchang/3-120/2001 H3N2

AY180578 A/ chicken/Nanchang/4-301/2001 H9N2

AY180551 A/ chicken/Nanchang/4-361/2001 H9N2

AF468842 A/ duck/Anyang/AVL-1/2001 H5N1

AF509141 A/ duck/Hong Kong/573.4/01 H5N1

AF509142 A/ duck/Hong Kong/646.3/01 H5N1

AY233394 A/ duck/NC/91347/01 H1N2

AY180577 A/ duck/Nanchang/1-100/2001 H3N6

AY180528 A/ duck/Nanchang/1-161/2001 H3N6

AY180552 A/ duck/Nanchang/1-181/2001 H3N6

AY180556 A/ duck/Nanchang/2-182/2001 H3N6

AF523414 A/ duck/Shantou/1605/01 H9N2

AF523418 A/ duck/Shantou/2088/01 H9N2

AF509139 A/ goose/Hong Kong/76.1/01 H5N1

AF509140 A/ goose/Hong Kong/ww100/01 H5N1

AF509121 A/ pheasant/Hong Kong/FY155/01 H5N1

AY221553 A/ pheasant/Hong Kong/FY155/01 H5N1

AY221552 A/ pheasant/Hong Kong/FY155/01-H5N1

AF509124 A/ pigeon/Hong Kong/SF215/01 H5N1

AF509123 A/ quail/Hong Kong/SF203/01 H5N1

AY180569 A/ quail/Nanchang/2-040/2001 H3N6

AY180567 A/ quail/Nanchang/3-140/2001 H3N6

AF509122 A/ silk plumage Gallus Domesticus/Hong Kong/SF189/01 H5N1

AF523412 A/ wild duck/Shantou/4808/01 H9N2

AF457709 A/ chicken/California/139/01 H6N2

AF457685 A/ chicken/California/6643/01 H6N2

AF457676 A/ chicken/California/905/01 H6N2

AY180561 A/ chicken/Nanchang/3-201/01 H3N6

AY268949 A/ chicken/Wang Cheng (Wangcheng)/4/2001 H9N2

AY585422 A/ duck/Fujian/17/2001 H5N1

AY585424 A/ duck/Guangdong/01/2001 H5N1

AY585430 A/ duck/Guangxi/22/2001 H5N1

AY585431 A/ duck/Guangxi/35/2001 H5N1

AY585432 A/ duck/Guangxi/50/2001 H5N1

AY422023 A/ duck/Hokkaido/107/01 H2N3

AY422024 A/ duck/Hokkaido/17/01 H2N3

AY422025 A/ duck/Hokkaido/86/01 H2N3

AY422026 A/ duck/Hokkaido/95/01 H2N2

AY585434 A/ duck/Shanghai/08/2001 H5N1

AY585435 A/ duck/Shanghai/13/2001 H5N1

AY585438 A/ duck/Shanghai/38/2001 H5N1

AY586423 A/ wild duck/Italy/33/01 H7N3

AY586424 A/ wild duck/Italy/43/01 H7N3

AY497119 A/ chicken/Guatemala/194573/02 H5N2

AY651511 A/Ck/HK/31.2/2002 H5N1

AY651522 A/Ck/HK/3169.1/2002 H5N1

AY651521 A/Ck/HK/3176.3/2002 H5N1

AY651512 A/Ck/HK/37.4/2002 H5N1

AY651514 A/Ck/HK/YU22/2002 H5N1

AY575908 A/Eg/ Hong Kong/757.3/02 H5N1

AY575909 A/G.H/ Hong Kong/793.1/02 H5N1

AY651510 A/Gf/HK/38/2002 H5N1

AY651513 A/SCk/HK/YU100/2002 H5N1

AY303658 A/ chicken/Chile/176822/02 H7N3

AY303659 A/ chicken/Chile/4957/02 H7N3

AY575911 A/ chicken/Hong Kong/31.4/02 H5N1

AY575915 A/ chicken/Hong Kong/409.1/02 H5N1

AY575912 A/ chicken/Hong Kong/61.9/02 H5N1

AY575914 A/ chicken/Hong Kong/96.1/02 H5N1

AY575913 A/ chicken/Hong Kong/YU777/02 H5N1

AY585420 A/ duck/Fujian/01/2002 H5N1

AY585421 A/ duck/Fujian/13/2002 H5N1

AY585427 A/ duck/Guangdong/22/2002 H5N1

AY585433 A/ duck/Guangxi/53/2002 H5N1

AY575910 A/ duck/Hong Kong/821/02 H5N1

AY585436 A/ duck/Shanghai/35/2002 H5N1

AY585437 A/ duck/Shanghai/37/2002 H5N1

AY651524 A/ rock dove/HK/862.7/2002 H5N1

AY575907 A/ goose/Hong Kong/739.2/02 H5N1

AY651526 A/ ash heron/HK/861.1/2002 H5N1

AY575916 A/ pheasant/Hong Kong/sv674.15/02 H5N1

AY651527 A/ teal/China/2978.1/2002 H5N1

AY651525 A/ sets sparrow/HK/864/2002 H5N1

AY586426 A/ turkey/Italy/214845/02 H7N3

AJ627486 A/ turkey/Italy/214845/2002 H7N3

AJ627495 A/ turkey/Italy/220158/2002 H7N3

AY586425 A/ turkey/Italy/220158/2002 H7N3

AY651515 A/Ck/HK/2133.1/2003 H5N1

AY651519 A/Ck/HK/FY157/2003 H5N1

AY651516 A/Ck/HK/NT93/2003 H5N1

AY651517 A/Ck/HK/SSP141/2003 H5N1

AY651518 A/Ck/HK/WF157/2003 H5N1

AY651520 A/Ck/HK/YU324/2003 H5N1

AY651490 A/Ck/ Indonesia/2A/2003 H5N1

AY651485 A/Ck/ Indonesia/BL/2003 H5N1

AY651487 A/Ck/ Indonesia/PA/2003 H5N1

AY651532 A/Ck/ST/4231/2003 H5N1

AY651529 A/Dk/HN/5806/2003 H5N1

AY651534 A/Dk/ST/4003/2003 H5N1

AY651535 A/Dk/YN/6255/2003 H5N1

AY651536 A/Dk/YN/6445/2003 H5N1

AY342426 A/ bird/Holland/033/03 H7N7

AY342425 A/ bird/Holland/219/03 H7N7

AY651523 A/ blackhead sea-gull/HK/12.1/2003 H5N1

AJ620352 A/ chicken/Germany/R28/03 H7N7

AY342427 A/ chicken/Holland/1/03 H7N7

AY518364 A/ duck/China/E319-2/03 H5N1

AY576929 A/ chicken/Vietnam/CM/2004 H5N1

AY651488 A/Ck/ Indonesia/4/2004 H5N1

AY651489 A/Ck/ Indonesia/5/2004 H5N1

AY651491 A/Ck/ Thailand/1/2004 H5N1

AY651492 A/Ck/ Thailand/73/2004 H5N1

AY651493 A/Ck/ Thailand/9.1/2004 H5N1

AY651502 A/Ck/ Vietnam/33/2004 H5N1

AY651503 A/Ck/ Vietnam/35/2004 H5N1

AY651504 A/Ck/ Vietnam/36/2004 H5N1

AY651505 A/Ck/ Vietnam/37/2004 H5N1

AY651506 A/Ck/ Vietnam/38/2004 H5N1

AY651507 A/Ck/ Vietnam/39/2004 H5N1

AY651508 A/Ck/ Vietnam/C57/2004 H5N1

AY651538 A/Ck/YN/115/2004 H5N1

AY651537 A/Ck/YN/374/2004 H5N1

AY651531 A/Dk/HN/101/2004 H5N1

AY651530 A/Dk/HN/303/2004 H5N1

AY651486 A/Dk/ Indonesia/MS/2004 H5N1

AY651496 A/Dk/ Thailand/71.1/2004 H5N1

AY651509 A/Dk/ Vietnam/11/2004 H5N1

AY650273 A/GSC chicken/Britain Colombia/04 H7N3

AY648290 A/GSC chicken B/ Britain Colombia/04 H7N3

AY651497 A/Gs/ Thailand/79/2004 H5N1

AY651533 A/Ph/ST/44/2004 H5N1

AY651494 A/Qa/ Thailand/57/2004 H5N1

AY651495 A/ bird/Thailand/3.1/2004 H5N1

AY611527 A/ chicken/Britain Colombia/04 H7N3

The human B/04 H7N3 of AY646081 A/ chicken/Britain Colombia/GSC

AY609313 A/ chicken/Guangdong/174/04 H5N1

AY684707 A/ chicken/Hubei/327/2004 H5N1

AY653196 A/ chicken/Jilin/9/2004 H5N1

AY590579 A/ chicken/Buddhist system/Thailand/CU-K2/2004 H5N1

AY574189 A/ chicken/Vietnam/HD1/2004 H5N1

AY574192 A/ chicken/Vietnam/HD2/2004 H5N1

AY576931 A/ muscovy duck/Vietnam/MdGL/2004 H5N1

AY651528 A/ falcon (peregrine falcon) H5N1

/HK/D0028/2004

Example 18: by the highly effective siRNA of high flux screening identification

Cell cultures. human pulmonary epithelial cells A-549 (ATCC) is grown in the DMEM substratum that contains 10% heat-inactivated fetal bovine serum (FCS), 2mM L-glutaminate, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates.Also can use other clones that derive from air flue, such as Calu-3 or HBE cell (ATCC), or other clones.Make cell under 37 ℃, have 5%CO ₂Humidified incubator in grow.

SiRNA. design and synthesize various siRNA, each siRNA contain have with table 16 in the high conservative target part listed fully complementary 19 Nucleotide inhibitory areas antisense strand and with antisense strand complementary sense strand.SiRNA contains 3 ' dTdT overhang on two chains.All siRNA are that (Lafayette CO), uses 2 ' ACE protection chemosynthesis to obtain by Dharmacon Research.By manufacturers siRNA is gone protection, desalination and annealing.

By two luciferase analyses identification highly effectively siRNA. according to the specification sheets of manufacturers (referring to No. 329 Promega Technical Bulletin, can Www.promega.com/tbs/tb329/tb329.pdfOn obtain), with corresponding to relevant influenza virus transcript, promptly from the full length cDNA clone of NP, PA, PB1, PB2, M, NS, NA or the HA gene of PR8 virus to psiCHECK ^TMIn-2 carriers (catalog number (Cat.No.) C8021, Promega, Madison, WI).CDNA is inserted through optimizing among synthetic renilla luciferase gene (Renillaluciferase gene) 3 ' UTR (hLuc) with the expression that is used for mammalian cell.According to the specification sheets of manufacturers, (or non-specific sicontrol, Dharmacon) cotransfection is in the A-549 cell with the DNA of target cDNA inset and siRNA to use Lipofectamine 2000 (Invitrogen).After the transfection, transcribe the syzygy of sea pansy gene and influenza virus gene.Transfection after 24 hours the function as the amount of each siRNA measure uciferase activity.In this analyzes, merge sea pansy by causing with the target part that merges transcript (that is, the influenza specificity part of the fusion transcript) siRNA of hybridization or the RNAi of shRNA mediation: the degraded of influenza virus gene transcript, thus reduce the luciferase signal.Described in Promega TechnicalBulletin 329, the fluorescence Luci of expressing from same vehicle contrasts as transfection contrast and specificity.Specifically, transfection was added solute and substrate buffer solution (Dual-Glo luciferase analytical system) in the cell to, and is read uciferase activity after 24 hours.Behind the 10min, interpolation is used for the Stop and Glo of sea pansy and reads the renilla luciferase activity.Each sample carries out three times.Be used as the transfection contrast of sea pansy in the same holes from the fluorescence luciferin enzymic activity in each hole.Sea pansy/active ratio of fluorescence Luci is used as the final value from the uciferase activity in each hole.Will be relatively from the mean value of the mean value of the ratio of three parts of influenza siRNA and three parts of sicontrol.To suppress percentage calculation is 100 * (1-influenza siRNA/sicontrol).

Table 26 presents the data of the effective siRNA of many height that discerns in the screening.This tabular has gone out the target gene (NP, PA, PB1, PB2), siRNA concentration of siRNA and ID number.SiRNA ID has listed on one hurdle the average inhibition per-cent under each concentration of being tested.Blank space is represented not experimentize.The result shows, many siRNA even inhibition transcript expression at least 80% when hanging down the concentration that reaches 0.6nM.

Table 26

Target gene: NP

Mean value suppresses (%)	Concentration (nM)	siRNAID
								154	758	1121	1313	NP-1496	1499
			0.0048 0.024 0.12 0.6 3 15 75	9.32 48.2 65.71 84.37 90.09 90.46 90.03	0 10.56 35.25 66.76 71.96 74.21 69.94	10.88 34.72 66.54 84.75 89.08 89.13 86.96	11.72 46.93 75.28 87.43 91.05 91.67 89.82							29.23 68.62 84.74 90.41 90.96	12.08 66.13 78.99 84.71 85.97

Target gene: PA

Mean value suppresses (%)	Concentration (nM)	7736	7803	8282	8286
							0.0048 0.024	11.4 29.3	27.27 44.88	11.94 18.78	11.62 37.57

0.12 0.6 3 15 75

60.14 78.25 85.76 85.74 85.42

77.37 85.13 86.78 87.82 86

40.34 85.95 92.18 93.34

69.03 83.23 89 89.8 90.64

Target gene: PB1

Mean value suppresses (%)	Concentration (nM)	PB1-
								4276	5018	5457	5773	6124	2257
			0.0048 0.024 0.12 0.6 3 15 75	4.61 60.81 87.98 92.17 92.07	0 22.98 72.99 85.83 89.12 89.07 93.4	9.11 23.92 60.67 82.63 87.63 89.81 88.57	0 22.21 53.46 75.09 84.76 84.94 87.56							8.4 27.03 57.67 76.65 80.84 83.93	13.7 34.2 66.32 81.29 84.88 86.05 82.29

Target gene: PB2

Mean value suppresses (%)	Concentration (nM)	PB2-
							2327	3276	3807	3817	2240
			0.0048 0.024 0.12 0.6 3 15 75	7.79 51.49 81.92 88.79 90.84 90.82 90.95	0 30.49 66.53 82.09 87.19 87.04 88.39	0 17.15 42.36 70.44 79.65 85.08 83.26						14.51 45.26 73.04 80.35 83.76 83.53 82.06	5.76 35.44 55.83 77.48 80.66 82.65 85.19

As described in other place herein, in the tissue culture and/or animal model described in example 19, use above-mentioned screening to be identified as highly effectively some siRNA and/or shRNA in addition at the influenza virus test.

Example 19: the effective siRNA of height that suppresses virus replication by screening identification

Cell cultures. Vero cell (ATCC) is grown in the DMEM substratum that contains 10% heat-inactivated fetal bovine serum (FCS), 2mM L-glutaminate, 100 units/ml penicillin and 100ug/ml Streptomycin sulphate.Make cell under 37 ℃, have 5%CO ₂Humidified incubator in grow.Virus infection be contain 0.3% bovine serum albumin (BSA, Sigma, St.Louis, MO), carry out among the DMEM of 10mM Hepes, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates.

SiRNA. design and synthesize siRNA, its contain have with table 18 in the high conservative target part listed the complete complementary of each part 19 Nucleotide inhibitory areas antisense strand and with antisense strand complementary sense strand.SiRNA contains 3 ' dTdT overhang on two chains.All siRNA are that (Lafayette CO), uses 2 ' ACE protection chemosynthesis to obtain by Dharmacon Research.By manufacturers siRNA is gone protection, desalination and annealing.

The siRNA transfection. with the logarithmic phase culture trypsinized of Vero cell, washing and with 20,000 cell inoculations in every hole in 96 orifice plates, and under 37 ℃, have 5%CO ₂Humidified incubator in overnight incubation.For screening for the first time, the siRNA (the double-stranded tagma of 19bp with dTdT3 ' overhang) of 10pmol is added among the Opti-MEM I (Invitrogen) of 25 μ l.Lipofectamine 2000 (Invitrogen) and the 0.19 μ lSuperRNAsin (Ambion) of 0.75 μ l are diluted among the Opti-MEMI of 25 μ l, and mix gently.With diluted lipid and diluted siRNA combination (cumulative volume is 50 μ l), and at room temperature mixture is cultivated 20min to form siRNA-Lipofectamine 2000 mixtures.When cultivate finishing, with pipette 50 μ l transfection composites are drawn to and contain in each hole of DMEM substratum that cell and 50 μ l contain 10%FCS.The ultimate density of each siRNA is 100nM.With each siRNA test three times, and with results averaged.NP-1496 (100nM) and sicontrol (Dharmacon) are used separately as over against shining and negative contrast.Except that the siRNA of working concentration 1nM, carry out the programmed screening of siRNA transfection in the same manner.

Virus infection. under 37 ℃, have 5%CO ₂Humidified incubator in cultivate after 6 hours, remove supernatant liquor and contain among the PBS of 0.3%BSA with the cell in each hole of PR8 virus infection at 25 μ l.Under 0.1 MOI, carry out to infect and be used for for the first time and programmed screening.Swing plate 1 h gently at room temperature, the DMEM that afterwards 175 μ l is contained 0.3%BSA, 4 μ g trypsinase, 10mM HEPES adds in each hole.Under 37 ℃, has 5%CO then ₂Humidified incubator in cultivate described plate.

The measurement of virus titer. infect and collect supernatant liquor after 24 hours.Measurement virus titer as indicated above.

The result

SiRNA for identification from the selected siRNA of one group of genomic high conservative target part of 215 kinds of target influenzas has greater activity has carried out a series of high flux screenings (HTS).Directly do not test siRNA and whether can suppress its special target expression of gene, but decision concentrates on the ability that siRNA suppresses influenza virus generation in the cell of assessing.Therefore, still may have the ability of degraded target mRNA and therefore be applicable to some purposes, still use virus titer as sense data though recognize some siRNA that can significantly not reduce virus titer.

In 215 kinds of siRNA that test among the HTS first time, with respect to non-processor (NT) or sicontrol, 90 kinds show that the PR8 virus titer reduces by 4 times at least.When the vero cell is during through the sicontrol of 100nM transfection, do not see non-specific inhibition.Transfection efficiency is about 80%.The result is summarized in the table 21, and suppresses to represent with regard to the multiple of virus titer.Actual inhibition degree may be bigger than what presented in the table.

Table 21: the result of high flux screening #1

Virus titer suppresses	siRNAID
		(multiple)
＞8	752、754、758、1121、1122、1223、1225、1254、1313、1316、 1381、1383、1488、1499、1527、NP1496
		≥4	109、119、154、222、224、301、302、359、375、688、692、1490、 1568、1714、1720、1728、2054、2283、2327、3225、3231、3276、 3277、3693、3700、3880、3882、3887、4120、4163、4276、4283、 4913、4915、4980、5018、5359、5360、5457、5460、5574、5578、 5580、5584、5680、5773、5791、5793、5795、5902、5942、5945、 5947、5997、6081、6087、6089、6351、6436、6559、6696、6732、 6744、7202、7424、75177580、7581、7648、7736、7803、7807、 8172、8271、8282、8285、8286、8289、8299、8300、8709、9331

Use the siRNA (1nM) of low concentration to carry out high flux screening for the second time, so as from the siRNA of at least 4 times of reductions showing virus titer in the first time the HTS the highly effective siRNA of identification more accurately.When described low concentration is tested, 30 kinds of siRNA show that the PR8 virus titer in the Vero cell culture reduces about 3 to 4 times.The result of HTS is presented in the table 22 for the second time.

Table 22: the result of high flux screening #2

siRNAID	Mean value	siRNAID	Mean value	siRNAID	Mean value
							109 119 154 222 224 301 302 359 375 688 692 752 754 758 1121 sicontrol 5359 5360 5457 5460 5574 5578 5580 5584 5680	2 1.67 1 2 1.67 1.67 1.67 2 1.67 1.67 2.67 2 1.67 1.33 1 4 1.67 1.67 1.33 1.33 1.67 1.67 1.67 1 3.33	1122 1223 1225 1254 1313 1316 1381 1383 1488 1499 1527 1590 1714 2283 2327 NT 5947 5997 6081 6087 6089 6351 6436 6559 6696	1 1.67 1.33 1.33 1 1 2 1.67 1.67 1.67 1.67 2 1.67 1.67 1.33 4 1.67 1.67 1.33 1.33 1.33 1.67 2 2 1.67	3276 3277 3693 3700 3880 3882 3887 4120 4163 4276 4283 4913 4915 4980 5018 7648 7736 7803 7807 8172 8271 8282 8285 8286	1.33 1.67 4 3.33 4 2 2 2 2 1 1.33 2 1.33 2 1.33 1 1.67 1 1.67 1.33 3.33 1 4 1

5773 5791 5793 5795 5902 5942 5945

1 2 1.67 2.67 2 2.67 2

6732 6744 7202 7424 7517 7580 7581

1.67 1.67 1.67 4 1.67 1.33 1.33

8289 8299 8300 9331 sicontrol NT

1 4 1.67 4 4 4

Example 20: confirm the siRNA screening

Material and method

Test is selected from 30 kinds of siRNA of HTS for the second time and from some siRNA of the HTS first time, to confirm described result in mdck cell.1,000 ten thousand mdck cells that do not contain in RPMI 1640 substratum of serum are mixed with the siRNA of ultimate density 100nM, and under 400V and 975 μ F, use electroporation apparatus (Bio-Rad) to carry out electroporation.To assign in 3 holes of 6 orifice plates through the cell of electroporation, and in the DMEM that contains 10% foetal calf serum, cultivate 6 hours.Remove substratum then, and the PR8 virus in the infection substratum of being made up of DMEM, 0.3%BSA, 10mM Hepes, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates of 100 microlitres is added in each hole.Each hole in 3 holes, under 0.2,0.02 and 0.002 MOI, carry out respectively and infect.After at room temperature cultivating 1h, add in each hole containing the tryptic 2ml infection of 4 μ g/ml substratum, and under 37 ℃, at 5%CO ₂Following culturing cell.At metainfective each time point, from infected culture collection supernatant liquor and by hemagglutination assay determination virus titer.

The result

In order to confirm that the effective siRNA of the height of being discerned suppresses the ability that influenza virus produces, and carries out screening for the third time in mdck cell in the first time and programmed screening.Compare with the Vero cell, mdck cell in addition more in a small amount caused the infections sensitivity of the experimental strain by influenza virus.Virus particle is more a lot of than duplicating in the Vero cell at mdck cell.The efficient of siRNA in virus suppresses is compared in described screening for the third time in mdck cell in addition, and confirms preceding twice results of screening, and accuracy is about 85-90%.

When MOI=0.2,3 kinds of NP siRNA make virus titer reduce at least 16 times after infecting 24 hours.4 kinds of NP siRNA (comprising above-mentioned 3 kinds of NP siRNA), 2 kinds of PB2,3 kinds of PB1 and 4 kinds of PA siRNA make virus titer reduce at least 8 times.Following siRNA is the 13 kinds of the most effective siRNA:154,758,1121,1313,2327,3276,4276,5018,5457,7736,7803,8282 and 8286 that tested.When MOI=0.02,8 kinds of NP, 2 kinds of PB2,3 kinds of PB1 and 8 kinds of PA siRNA (effective siRNA when being included in MOI=0.2) make virus titer reduce at least 8 times after infecting 24 hours.When MOI=0.002,10 kinds of NP, 8 kinds of PB2,11 kinds of PB1,10 kinds of PA siRNA (effectively effective siRNA when being included in MOI=0.02) make virus titer reduce at least 4 times after infecting 24 hours.Not observing virus for sicontrol siRNA suppresses.

Results of screening is presented in the table 23.Each row is presented at respectively under the MOI=0.2/0.02/0.002, metainfective time 24,36,48 and the HA unit 60 hours time the in some cases.With formal testing in groups, and sicontrol is contrast siRNA of each group test with plate.The NT=non-processor.The most effective siRNA shows with black matrix.

Table 23: the result of high flux screening #3

SiRNA	24h	36h	48h	60h
					sicontrol 1313 1488 2283 2327 3276 3277 siRNA sicontrol 154 1121 1122 1316 1499 1590 1714 3693 3700 8289 siRNA sicontrol 758 5018 6732 7580 7581 7648 7736 7803 8282 8286 7807 siRNA NT sicontrol 4276 4283 4915 5457 5460 5584 5773 6081	512/256/8 32/4/1 128/32/1 128/64/2 64/32/2 64/32/1 128/64/2 24h 1024/256/16 32/4/1 64/4/1 256/16/1 256/32/2 256/32/1 512/256/4 512/128/2 512/256/2 512/256/2 512/128/2 24h 1024/256/4 128/16/1 128/16/1 256/32/1 256/16/1 256/32/1 256/32/1 128/32/1 64/16/1 128/16/1 128/32/1 256/64/1 24h 1024/256/16 1024/256/16 128/32/1 512/64/2 512/128/4 128/32/1 512/64/4 512/128/2 256/32/1 512/128/2	1024/512/32 128/16/1 256/64/2 256/128/2 256/64/2 128/64/2 256/128/4 36h 2148/1024/32 128/8/1 128/16/1 512/64/1 1024/128/16 1024/128/4 1024/256/16 1024/256/8 1024/512/8 1024/512/16 1024/128/16 36h 2148/512/16 512/64/1 512/64/1 512/64/4 512/64/4 512/64/4 512/64/4 256/64/4 256/64/1 512/32/2 256/128/8 512/128/8 36h 1024/512/32 1024/512/32 256/64/8 512/128/16 512/128/16 256/64/4 512/128/16 512/128/16 256/64/4 512/128/16	1024/512/32 256/64/2 512/256/8 256/256/4 256/128/4 256/128/8 256/128/16 48h 2148/1024/64 128/16/1 256/32/2 1024/64/4 1024/128/32 2148/128/8 2148/256/32 1024/256/8 1024/512/16 1024/512/16 1024/256/32 48h 2148/1024/32 512/64/4 512/64/4 1024/512/8 1024/512/8 1024/512/16 1024/512/32 1024/512/16 1024/512/8 1024/512/8 1024/512/16 1024/512/32 48h 1024/512/64 1024/512/64 256/64/8 512/128/16 512/128/16 256/64/8 512/128/16 512/128/16 256/64/4 512/128/16	1024/512/64 512/64/4 1024/256/16 256/256/8 512/256/8 256/128/16 512/128/16

6087 6089 8172 1225 1254

512/64/2 512/128/4 512/128/8 512/64/4 256/64/4

512/128/16 512/256/32 512/256/16 512/64/16 256/128/32

512/128/16 512/256/32 512/256/32 512/64/32 512/128/32

The test of example 21:siRNA dose response

Material and method

Test is selected from 13 kinds of siRNA of HTS for the third time and from the dose response of some siRNA of the HTS second time in mdck cell.1,000 ten thousand mdck cells that will be in RPMI 1640 substratum that do not contain serum mix with the siRNA that is in the various siRNA concentration of 0.8nM in the scope of 100nM.Under 400V and 975 μ F, by use electroporation apparatus (Bio-Rad) with the siRNA electroporation in cell.To assign in 3 holes of 6 orifice plates through the cell of electroporation, and in the DMEM that contains 10% foetal calf serum, cultivate 6 hours.Remove substratum then, and the PR8 virus in the infection substratum of being made up of DMEM0.3%BSA, 10mM Hepes, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates of 100 microlitres is added in each hole, to obtain concerning each hole in 3 holes 0.2,0.02 and 0.002 MOI.After at room temperature cultivating 1h, 2ml is contained the tryptic infection substratum of 4 μ g/ml add in each hole, and under 37 ℃, at 5%CO ₂Following culturing cell.At metainfective different time, from infected culture collection supernatant liquor and by hemagglutination assay determination virus titer as indicated above.

The result: when MOI=0.2 and MOI=0.02, suppressing virus after infecting 24 hours, to produce 2 times the Cmin of siRNA as follows, and wherein asterisk is represented as described in the example 1 and the siRNA of identification.

NP gene fragment as target:

154 0.8nM

758 1nM

1121 1nM

1313 0.8nM

1499 5nM

NP1496 ^* 4nM

PB2 gene fragment as target:

2327 1nM

3276 1nM

PB1 gene fragment as target:

4276 1nM

5018 5nM

5457 5nM

5773 5nM

PB1-2257 ^* 5nM

PA gene fragment as target:

7736 5nM

7803 1nM

8282 5nM

8286 5nM

The result is according to for various siRNA concentration, under the MOI of 0.2/0.02/0.002, infects the HA unit after 24,36 or 48 hours and is shown in the table 24.

Table 24: dose response The selection result

siRNA	24h	36h	48h
				NT Sicontrol 100nM NP1496 0.8nM NP1496 4nM NP1496 20nM 1313 0.8nM 1313 4nM 1313 20nM 1313 25nM 154 0.8nM 154 4nM 154 20nM 154 25nM 8172 100nM 8289 100nM siRNA NT Sicontrol 100nM 7803 1nM 7803 5nM 7803 25nM 8282 1nM 8282 5nM 8282 25nM 6696 100nM siRNA NT Sicontro1 25nM 2327 1nM 2327 5nM 2327 25nM 3276 1nM 3276 5nM 3276 25nM	1024/128/2 1024/128/2 1024/128/2 512/64/1 512/64/1 512/64/1 512/64/1 256/32/1 128/8/1 512/64/1 512/64/1 256/32/1 128/8/1 512/128/1 256/32/1 24h 1024/128/2 1024/128/2 512/64/1 512/32/1 256/32/1 1024/64/2 512/64/1 512/64/1 512/32/1 24h 1024/128/2 1024/128/2 512/64/1 512/64/1 512/32/1 1024/64/2 512/64/1 512/64/1	2048/256/4 2048/256/4 1024/256/4 1024/256/4 1024/256/4 1024/256/2 1024/128/2 512/64/1 256/32/1 1024/256/2 1024/128/2 512/64/1 256/32/1 1024/256/4 512/128/2 36h 2048/256/4 2048/256/4 1024/64/2 1024/64/2 512/64/2 1024/128/4 1024/128/4 1024/128/4 1024/128/4 36h 2048/256/4 2048/256/4 1024/128/2 1024/128/2 1024/64/2 1024/128/4 1024/128/2 1024/64/2	2048/256/8 2048/256/8 2048/256/8 2048/256/4 2048/256/4 2048/256/4 2048/256/4 1024/128/2 512/64/1 2048/256/4 2048/128/2 1024/128/2 512/64/1 2048/256/8 2048/256/4 48h 2048/256/8 2048/256/8 2048/128/4 1024/128/4 1024/128/4 2048/256/8 2048/256/8 1024/128/4 2048/256/8 48h 2048/256/8 2048/256/8 2048/128/8 2048/128/8 1024/64/8 2048/128/8 2048/128/8 2048/64/4

758 1nm 758 5nM 758 25nM siRNA NT Sicontrol 25nM 4276 1nM 4276 5nM 4276 25nM 5018 1nM 5018 5nM 5018 25nM 5457 1nM 5457 5nM 5457 25nM 7736 1nM 7736 5nM 7736 25nM siRNA NT Sicontrol 25 nM 1121 1nM 1121 5nM 1121 25nM 5773 1nM 5773 5nM 5773 25nM PB1-2257 1nM PB1-2257 5nM PB1-2257 25nM SiRNA NT sicontrol 25nM 1499 1nM 1499 5nM 1499 25nM 8286 1nM 8286 5nM 8286 25nM 1499+8286 2.5+2.5

512/64/1 512/64/1 256/32/1 24h 1024/128/2 1024/128/2 512/64/1 512/32/1 256/16/1 1024/64/2 512/32/1 256/16/1 1024/128/2 512/32/1 512/32/1 1024/64/2 512/64/1 512/64/1 24h 512/128/4 512/128/4 256/128/4 256/64/1 128/32/1 256/64/2 256/64/1 128/32/1 512/64/1 256/64/1 256/64/1 24h 1024/256/4 1024/256/4 1024/256/4 512/64/2 512/32/1 1024/128/2 512/64/2 512/64/2 1024/256/2

1024/128/2 1024/128/2 1024/64/2 36h 2048/256/4 2048/256/4 1024/128/2 1024/64/2 512/32/1 2048/128/2 1024/64/2 512/32/1 2048/256/4 1024/64/2 1024/64/2 1024/128/4 1024/128/2 512/64/1 36h 1024/256/8 1024/256/8 512/256/8 512/128/4 256/64/1 512/256/8 512/128/2 256/64/1 1024/128/4 512/128/4 512/128/4 36h 2048/512/16 2048/512/16 2048/256/8 2048/128/4 2048/64/2 2048/256/4 2048/128/4 2048/128/4 2048/256/4

1024/128/4 2048/128/8 2048/64/8 48h 2048/512/8 2048/512/8 1024/128/4 1024/128/4 512/64/2 2048/256/4 1024/128/2 1024/64/1 2048/512/8 1024/128/4 1024/128/4 2048/256/8 2048/256/4 2048/256/4 48h 1024/256/32 1024/256/32 512/256/32 512/128/8 512/64/4 512/256/8 512/128/4 256/64/4 1024/128/8 512/128/8 512/128/8 48h 2048/1024/32 2048/1024/32 2048/512/16 2048/256/8 2048/64/4 2048/256/8 2048/256/8 2048/256/8 2048/256/8

Example 22: use the effective inhibition of siRNA combination to influenza virus

Test is selected from some siRNA of HTS for the third time and from the anti influenza effect of array configuration of some siRNA of the HTS second time.Described in example 21, carry out transfection, infection and virus titer test.1499 with 4276 together under the 12.5nM with various siRNA transfections with under 25nM, independent 1499 or 4276 compare, a little more effectively suppress virus and produce.

Table 25: the effect of the siRNA of array configuration

siRNA	24h	36h	48h
				NT sicontrol 50nM 1499+8282 12.5+12.5 1499+4276 12.5+12.5 8282+4276 12.5+12.5 1499+8282 25+25 1499+4276 25+25 8282+4276 25+25 1499 25nM 1499 50nM 8282 25nM 8282 50nM 4276 25nM 4276 50nM	1024/128/4 1024/128/4 512/32/1 256/16/1 512/32/1 512/32/1 256/16/1 256/32/1 512/32/1 512/16/1 512/64/1 512/32/1 256/32/1 256/16/1	2048/256/8 2048/256/8 1024/64/2 512/32/1 1024/64/2 1024/64/2 512/32/1 1024/64/2 1024/64/2 1024/64/2 1024/128/4 1024/64/2 512/64/2 512/32/1	2048/512/16 2048/512/16 1024/128/8 512/64/4 1024/128/8 1024/128/8 512/64/2 1024/128/4 1024/128/8 1024/128/8 1024/128/8 1024/128/8 1024/128/8 512/64/2

Example 23: suppress influenza virus in the respiratory system by naked siRNA directly is delivered to

Material and method

Carrying out siRNA preparation, virus infection, lung collection and influenza virus titre described in example 12 analyzes.Use isofluranum (by suck throw with) anesthetized mice.Sending by drop in the nose is the siRNA of 50 μ l volumes.Use student T test to calculate the p value.

The result

Will the siRNA (NP-1496) in the phosphate buffered saline (PBS) (PBS) throw with mouse (every group of 5 mouse) in groups in.After throwing with 3 hours, siRNA uses influenza virus (2000PFU) infecting mouse.Infect and collected lung in back 24 hours and measure virus titer.In preliminary experiment, with the avertin anesthesia mouse and by the siRNA of drop throwing in the nose with 2mg/kg.Observe with respect to control group, virus titer reduces, but does not reach statistical significance (data not shown).

In experiment for the second time, use isofluranum/O ₂Anesthesia black Switzerland mouse.In approach throwing and mouse in the siRNA intranasal in PBS of various amounts, every mouse 50 μ l.3 not on the same group (every group of 5 mouse) accept the siRNA in PBS of 2mg/kg, 4mg/kg or 10mg/kg dosage by drop in the nose.The 4th group that only accepts PBS with comparing.After 3 hours, reuse isofluranum/O ₂Anesthetized mice is in approach throwing and mouse in PR8 virus (2000 pfu=4 * lethal dose) intranasal of 30 μ l.After infecting 24h, collect mouse lung, homogenize and the estimation TCID that passes through as indicated above ₅₀Measure virus titer.Lung homogenate is carried out continuous 5 times of dilutions rather than 10 times of dilutions.

Between each treatment group of 3 treatment group and mice in control group, see virus titer significantly and dose-dependently difference.In the group of accepting 2mg/kg, 4mg/kg and 10mg/kg dosage respectively, virus titer reduces by 3.45 times (p=0.0125), 4.16 times (p=0.0063) and 4.62 times (p=0.0057) with respect to control group.Data (the TCID of indivedual mouse ₅₀) be presented in the table 27 and be shown among Figure 31 A.

In a word, these results prove, in not having the aqueous culture medium that strengthens the particular agent of sending, and the effect of the siRNA in the respiratory system that is delivered to.

Table 27: the intranasal delivery of naked siRNA suppresses influenza virus and produces

Handle	log 10TCID 50					Mean value	The P value
								PBS	26718.37	45687.78	45687.78	15625	26718.37	32087.46
NP(2mg/kg)	15625	15625	3125	3125	9137.56	9327.51	0.008
								NP(4mg/kg)	9137.56	9137.56	5343.68	9137.56	5343.68	7620	0.004
NP(10mg/kg)	9137.56	9137.56	9137.56	3125	3125	6732.53	0.003

Example 24: produce by naked siRNA directly being delivered to the influenza virus that suppresses in the respiratory system in the mouse

This example is confirmed the result and the proof of example 23, by in not having the aqueous culture medium that strengthens the reagent of sending, with the siRNA of target NP throw with respiratory system in suppressed the influenza virus in the lung and produced.Remove after siRNA sends 2 hours, with PR8 virus with mode infecting mouse in the nose, outside every mouse 1000pfu, basically press described in the example 23, approach is instilled in the mouse in the NP-1496 siRNA of 6 μ g, 15 μ g, 30 μ g and 60 μ g that will be in PBS or the GFP-949siRNA intranasal of 60 μ g.Infect and collect lung after 24 hours.As shown in table 28 and Figure 31 B, in by nose instillation in the aqueous culture medium that does not have delivery agents, throw and the time, the NP specific siRNA effectively suppresses influenza virus.Between each treatment group of 3 treatment group and the mouse in the control group, see virus titer significantly and dose-dependently difference.

Table 28: the influenza virus of using naked siRNA to suppress in the lung produces

Handle	TCID 50					Mean value	The P value
								PBS
	125	365.5	213.7	365.5	125	239.95
								GFP(60μg)	125	213.7	213.7	213.7	365.5	226.32
NP(6μg)	213.7	213.7	125	213.7	42.7	161.8	0.263
								NP(15μg)	125	125	42.7	25	73.1	78.17	0.024
NP(30μg)	8.5	125	42.7	125	14.6	63.18	0.019
								NP(60μg)	73.1	14.6	25	25	25	32.54	0.006

Example 25: the siRNA of target influenza virus transcript allows the mispairing in the target district

This example proves, antisense strand (for example, with target transcript complementary 19 base pair districts in) in the inhibitory area effectively suppresses less than 100% complementary siRNA mediation with the target transcript.The result proves that the RNAi medicament of Miao Shuing will effectively suppress the influenza bacterial strain of sequence broad range different with the sequence of PR8 in the target part herein.

Material and method

Use the two luciferase analyses as example 18 described in, assess siRNA and be suppressed in the 19 Nucleotide inhibitory areas and the siRNA antisense strand ability of 100% complementary influenza genetic expression not.Use rite-directed mutagenesis test kit (Stratagene), to introduce in the dna vector (psiCHECK) by the resulting mispairing of comparison of human and avian influenza strain (using PR8) as standard, that is to say, influenza target site is modified comprising 1 or 2 difference with respect to the PR8 sequence, and particular differences is corresponding to the difference seen in one or more bacterial strains of the mankind that list in the table 15 or bird flu bacterial strain.

Table 29 shows result of experiment, proves that the variation of virus N P target (target of NP-1496) does not reduce the RNAi activity in fact.(shown in data be three times mean value).Tested near 5 of antisense strand ' or 3 ' end or near the mispairing of position in the middle.

Table 29: the mispairing between antisense strand and the target district is to the inhibiting influence of NP-1496

	Original	A3 is to G3	T9 is to C9	C12 is to T12	C15 is to T15	A18 is to G18
							Renilla luciferase suppresses (%)	85.6	81.8	58.3	67.8	72.9	54.7
Suppress (%) with the residue of original comparison	100	91.3	65.1	75.7	81.4	61.1

Table 30 shows result of experiment, proves that the variation of viral PA target (target of PA-2087 or PA-8242) does not reduce the RNAi activity in fact.(shown in data be three times mean value).Yet the G18 seen in 7 kinds of 157 kinds of people's parainfluenza bacterial strains has influenced the RNA interferon activity in fact to the A18 sudden change.(shown in data be three times mean value).Tested near 5 of antisense strand ' or 3 ' end or near the mispairing of position in the middle.The existence of 2 mispairing makes restraining effect reduce about 70-75% between antisense strand inhibitory area and the target, but still observes the inhibition of degree of functioning.

Table 30: the mispairing between antisense strand and the target district is to PA-2087 or the inhibiting influence of PA-8242

	Original	A4 is to G4	T6 is to A6	T6 is to C6	C15 is to T15	G18 is to A18	A19 is to G19	T6 to C6 and C15 to T15
									Renilla luciferase suppresses (%)	91.7	80.8	75.9	88.8	87.5	7.0	89.3	26.8
Suppress (%) with the residue of original comparison	100	88.1	82.8	96.9	95.5	7.6	97.4	29.3

Table 31 shows result of experiment, proves that the variation of viral PB2 target (target of PB2-3817) does not reduce the RNAi activity in fact.(shown in data be three times mean value).

Table 31: the mispairing between antisense strand and the target district is to the inhibiting influence of PB2-3817

	Original	A17 is to G17	A18 is to T18
				Renilla luciferase suppresses (%)	86.7	73.4	75.8

Suppress (%) with the residue of original comparison

100

100

87.4

Table 32A shows result of experiment, proves that the variation of viral PB1 target (target of PB1-6124) does not reduce the RNAi activity in fact.(shown in data be three times mean value).Tested near 5 of antisense strand ' or 3 ' end or near the mispairing of position in the middle.The existence of 2 mispairing makes restraining effect reduce about 70-75% between antisense strand inhibitory area and the target, but still observes the inhibition of degree of functioning.

Table 32A: the mispairing between antisense strand and the target district is to the inhibiting influence of PB1-6124

	Original	A1 is to T1	A5 is to G5	T8 is to C8	T12 is to C12	T8 to C8 and C15 to T15
							Renilla luciferase suppresses (%)	82.2	83.9	77.8	63.3	83.2	26.5
Suppress (%) with the residue of original comparison	100	100	94.7	77	100	32.2

Table 32B shows another result of experiment, proves that the variation of viral PB1 target (target of PB1-6124) does not reduce the RNAi activity in fact.(shown in data be three times mean value).Tested mispairing near the position of 5 of antisense strand ' or 3 ' end.The existence of 2 mispairing does not reduce the RNAi activity in fact between antisense strand inhibitory area and the target.

Table 32B: the mispairing between antisense strand and the target district is to the inhibiting influence of PB1-6124

PB1 (laboratory ID# /6124 siRNA)	Original	CI5 is to T15	A1 is to G1	T2 is to C2	G3 is to A3	A1 to T1 and G3 to A3
							The residue that renilla luciferase suppresses (%) and original comparison suppresses (%)	84.1 100	71.8 85.4	82.8 98.5	84.5 100	74.9 89.1	73.9 87.9

Table 32C shows another result of experiment, proves that the variation of viral PB1 target (target of PB1-6129) does not reduce the RNAi activity in fact.(shown in data be three times mean value).Tested near 5 of antisense strand ' or 3 ' end or near the mispairing of position in the middle.The mispairing at 10 places in the position (G:U swing) only has relatively little influence to suppressing, and proves that in this article the described mispairing at 10 places in the position does not reduce the RNAi activity in fact.The existence of 2 mispairing moderately reduces inhibition between antisense strand inhibitory area and the target, but still observes original inhibiting about 60-70%.

Table 32C: the mispairing between antisense strand and the target district is to the inhibiting influence of PB1-6129

PB1 (original 6129 siRNA of laboratory ID#)

T3 is to C3

T7 is to C7

T2 is to C2

C10 is to T10

T3 to C3 and C10 to T10

The residue 100 that renilla luciferase suppresses 86.4 (%) and original comparison suppresses (%)

87.3 100

84.4 97.8

84.5 100

81.3 94.2

59.0 68.3

Example 26: modified SiRNA mediation effectively suppresses

For probing into the inhibition potentiality of the siRNA that contains modified Nucleotide, the synthetic alternately ribonucleotide place of containing in each bar chain has 2 '-sense strand that the O-methyl is modified and the NP-1496 siRNA of antisense strand, and with unmodified NP-1496siRNA compare test.Through 2 '-NP1496 siRNA sequence that the O-methyl is modified is as follows: (2 '-O-methyl be shown as " m " of modified Nucleotide front):

Justice is arranged: 5 '-GmGA mUCmU UmAU mUUmC UmUC mGGmA G dTdT-3 ' (SEQ ID NO:381)

Antisense: 5 '-mCUmC CmGA mAGmA AmAU mAAmG AmUC mC dTdT-3 ' (SEQ ID NO:382)

According to the specification sheets of manufacturers, use lipofectamine 2000 (Invitrogen) will be through 2 '-the NP1496 siRNA that the O-methyl is modified and the NP1496 siRNA transfection of the unmodified Vero cell in 24 orifice plates in.After the transfection 6 hours, the sucking-off substratum.Under 0.1 MOI, with the PR8 inoculating cell of 200 μ l.After infecting 24,36 and 48 hours, collect culture supernatants.By mensuration virus titer mentioned above.Through 2 '-NP1496 that the O-methyl is modified shows that the viral growth bigger a little than the NP1496 of unmodified suppresses.The result is presented in the table 33.

Table 33: use modified siRNA effectively to suppress the influenza virus generation

HA unit	24h	36h	48h
				No siRNA contrast	4	8	16
Unmodified NP1496 (400 μ M)	1	2	8
				Modified NP1496 (100 μ M)	1	2	8
Modified NP1496 (200 μ M)	1	2	4
				Modified NP1496 (400 μ M)	1	1	4

Example 27: be used to discern highly effectively screening and the test of siRNA and sum up

Collect and make up the screening mentioned above and the result of test in vitro and in vivo, be produced as high conservative and be the general list of the influenza virus sequence of the target of highly effective siRNA.The inventory of target part is presented in the table 34.These sequences also are some highly effective complements of the antisense strand inhibitory area of RNAi inductor of siRNA for example.

Table 34: the high conservative influenza virus sequence of inducing the target of entity for highly effective RNAi

Sequence	SEO ID NO：	The target gene	Laboratory ID NO:
				GCCACTGAAATCAGAGCAT	272	NP	109
TCAGAGCATCCGTCGGAAA	273	NP	119
				GGACGATTCTACATCCAAA	274	NP	154
CAGCTTAACAATAGAGAGA	275	NP	222
				GCTTAACAATAGAGAGAAT	276	NP	224
AATAGAGAGAATGGTGCTC	277	NP	231
				GGGAAAGATCCTAAGAAAA	278	NP	301
GGAAAGATCCTAAGAAAAC	279	NP	302
				TGAGAGAACTCATCCTTTA	280	NP	359
TTATGACAAAGAAGAAATA	281	NP	375
				ACAAGAATTGCTTATGAAA	282	NP	688
GAATTGCTTATGAAAGAAT	283	NP	692
				AAGCAATGATGGATCAAGT	284	NP	752
GCAATGATGGATCAAGTGA	285	NP	754
				TGATGGATCAAGTGAGAGA	286	NP	758
CCACTAGAGGAGTTCAAAT	287	NP	1121
				CACTAGAGGAGTTCAAATT	288	NP	1122
GAGGAAACACCAATCAACA	289	NP	1223
				GGAAACACCAATCAACAGA	290	NP	1225
GGGCCAAATCAGCATACAA	291	NP	1254
				CAACCATTATGGCAGCATT	292	NP	1313
CCATTATGGCAGCATTCAA	293	NP	1316
				AGGATGATGGAAAGTGCAA	294	NP	1381
GATGATGGAAAGTGCAAGA	295	NP	1383
				GAGTAATGAAGGATCTTAT	296	NP	1488
GGATCTTATTTCTTCGGAG	297	NP	1498
				GATCTTATTTCTTCGGAGA	298	NP	1499
TCTTATTTCTTCGGAGACA	299	NP	1501
				GGAGTACGACAATTAAAGA	300	NP	1527
GAACTAAGAAATCTAATGT	301	PB2	1590
				TGAAATGGATGATGGCAAT	302	PB2	1714
GGAACATGCTGGGAACAGA	303	PB2	2283
				GAATGATGATGTTGATCAA	304	PB2	2327
AATGGAATTTGAACCATTT	305	PB2	3276
				ATGGAATTTGAACCATTTC	306	PB2	3277
GCACTAAGCATCAATGAAC	307	PB2	3693
				GCATCAATGAACTGAGCAA	308	PB2	3700
GGAGACGTGGTGTTGGTAA	379	PB2	3759
				CGGGACTCTAGCATACTTA	309	PB2	3789
ACTGACAGCCAGACAGCGA	310	PB2	3807
				AGACAGCGACCAAAAGAAT	311	PB2	3817
GAATTCGGATGGCCATCAA	312	PB2	3832
				GCAGGCAAACCATTTGAAT	313	PB1	3878
AGGCAAACCATTTGAATGG	314	PB1	3880
				GCAAACCATTTGAATGGAT	315	PB1	3882
CCATTTGAATGGATGTCAA	316	PB1	3887
				CAGGATACACCATGGATAC	380	PB1	4001
GACAATGAACCAAGTGGTT	317	PB1	4120

AAGCAATGGCTTTCCTTGA	318	PB1	4163
				ACCTATGACTGGACTCTAA	319	PB1	4276
ACTGGACTCTAAATAGAAA	320	PB1	4283
				CTCCAATAATGTTCTCAAA	321	PB1	4913
CCAATAATGTTCTCAAACA	322	PB1	4915
				GAAACTTAGAACTCAAATA	323	PB1	4980
GCATCGATTTGAAATATTT	324	PB1	5018
				ACATTTGAATTCACAAGTT	325	PB1	5359
CATTTGAATTCACAAGTTT	326	PB1	5360
				GGACATGAGTATTGGAGTT	327	PB1	5457
CATGAGTATTGGAGTTACT	328	PB1	5460
				ATGCCATAGAGGTGACACA	329	PB1	5574
CATAGAGGTGACACACAAA	330	PB1	5578
				TAGAGGTGACACACAAATA	331	PB1	5580
GGTGACACACAAATACAAA	332	PB1	5584
				CCAAATTTATACAACATTA	333	PB1	5680
CCACTGAACCCATTTGTCA	334	PB1	5773
				AGCCATAAAGAAATTGAAT	335	PB1	5791
CCATAAAGAAATTGAATCA	336	PB1	5793
				ATAAAGAAATTGAATCAAT	337	PB1	5795
AGAAATCGATCCATCTTGA	338	PB1	5902
				TTGAAGATGAACAAATGTA	339	PB1	5942
AAGATGAACAAATGTACCA	340	PB1	5945
				GATGAACAAATGTACCAAA	341	PB1	5947
CAGCAGTTCATACAGAAGA	342	PB1	5997
				TTTCGAATCTGGAAGGATA	343	PB1	6081
ATCTGGAAGGATAAAGAAA	344	PB1	6087
				CTGGAAGGATAAAGAAAGA	345	PB1	6089
ATGAAGATCTGTTCCACCA	346	PB1	6124
				GATCTGTTCCACCATTGAA	347	PB1	6129
ACCTGAAAATCGAAACAAA	348	PA	6351
				GCACAGATTTGAAATAATC	349	PA	6436
GAATAGATTCATCGAAATT	350	PA	6559
				ACTACACTCTCGATGAAGA	351	PA	6696
AAACCAGACTATTCACCAT	352	PA	6732
				TCACCATAAGACAAGAAAT	353	PA	6744
GGAATAAATCCAAATTATC	354	PA	7202
				CTAGCAAGTTGGATTCAGA	355	PA	7424
CCAATTGAACACATTGCAA	356	PA	7517
				GCCACAGAATACATAATGA	357	PA	7580
CCACAGAATACATA ATGAA	358	PA	7581
				GGATGATTTCCAATTAATT	359	PA	7648
GGAAGATCCCACTTAAGGA	360	PA	7736
				ACCCAAGACTTGAACCACA	361	PA	7803
AAGACTTGAACCACATAAA	362	PA	7807
				CTCCACAACTAGAAGGATT	362	PA	8172
GGCTATATGAAGCAATTGA	363	PA	8271
				GCAATTGAGGAGTGCCTGA	364	PA	8282
ATTGAGGAGTGCCTGATTA	365	PA	8285

TTGAGGAGTGCCTGATTAA	366	PA	8286
				AGGAGTGCCTGATTAATGA	367	PA	8289
GATTAATGATCCCTGGGTT	368	PA	8299
				ATTAATGATCCCTGGGTTT	369	PA	8300
TGATCCCTGGGTTTTGCTT	370	PA	8305
				CCGAGGTCGAAACGTACGT	371	M	8447
ACCAATCCTGTCACCTCTG	372	M	8580
				CAGTGAGCGAGGACTGCAG	373	M	8640
GACGCTTTGTCCAAAATGC	374	M	8663
				TGGCTGGATCGAGTGAGCA	375	M	9008
TGTGGATTCTTGATCGTCT	376	M	9240
				GTCTATGAGGGAAGAATAT	377	M	9331
GTCAGGCTAGGCAAATGGT	378	M	M645

Impartial opinion

Those skilled in the art will realize that or can only use the normal experiment method to determine many equivalent situation of the specific embodiment of the invention as herein described.Scope of the present invention is not limited to above-mentioned specification sheets, but is limited by subsidiary claims.

Reference

1.Lamb, R.A. and R.M.Krug.2001.Orthomyxoviridae:the viruese and theirreplication.Fundamental Virology Ed.D.M.Knipe ﹠amp; P.M.Hpwley:725-770.

2.Simonsen, L., K.Fukuda, L.B.Schomberger and N.J.Cox.2000.The impact ofinfluenza epidemics on hospitalizations.J.Infect.Dis, 181:831-837.

3.Webster, R.G., W.J.Bean, O.T.Gorman, T.M.Chambers and Y.Kawaoka.1992.Evolution and ecology of influenza A viruses.Microbiol.Rev. 56:152-179.

4.Parvin, J.D., A.Moscona, W.T.Pan, J.M.Leider and P, Palese.1986.Measurementof the mutation rates of animal viruses:influenza A virus and poliovirus type 1, J.Virol.59:377-383.

5.Smith, F.L. with P.Palese.1989.Variation in influenza virus genes:epidemiology, pathogenic and evolutionary consequences.The influenza viruses Krug, R.M. compiles: NewYork:Plenum.

6.Webster, R.G., W.G.Laver, G.M.air and S.G.C.1982.Molecular mechanisms ofvariation in influenza viruses.Nature 296:115-121.

7.Webby, R.J. and R.G.Webster.2001.Emergence of influenza A viruses.Phil.Trans.R.Soc.Lond.356:1817-1828.

8.Patterson, K.D. and G.F.Pyle.1991.The geography and mortality of the 1918influenza pandemic.Bull.Hist.Med.65:4-21.

9.Taubenberger, J.K., A.H.Reid, T.A.Janczewski and T.G.GFanning.2001.Integrating historical, clinical and molecular genetic data in order to explain the origin andvirulence ofthe 1918 Spanish influenza virus.Phil.Trans.R.Soc.Lond.356:1829-1839.

10.Claas, E.G., A.D.Osterhaus, R.van Beek, J.C.De Jong, G.F.Rimmelzwaan, D.A.Senne, S.Krauss, K.F.Shortridge and R.G.Webster.1998.Human influenza A H5N1 virusrelated to a highly pathogenic avian influenza virus.Lancet 351:472-477.

11.Yuen, K.Y., P.K.Chan, M.Peiris, D.N.Tsang, T.L.Que, K.F.Shortridge, P.T.Cheung, W.K.To, E.T.Ho, R.Sung and A.F.Cheng.1998.Clinical features and rapid viraldiagnosis of human disease associated with avian influenza A H5N1 virus. Lancet351:467-471.

12.Fukuda, F., C.B.Bridges and T.L.e.a.Brammer.1999.Prevention and control ofinfluenza:recommendations of the advisory committee on immunization practices (ACJJP) .MMWRMorb.Mortal.Wkly Rep.48:1-28.

13.Castle，S.C.2000.Clinical relevane of age-related immune dysfunction.Clin，Infect.Dis.31：578-585。

14.Luscher-Mattli，M.2000.Influenza chemotherapy；a review of the present stateof art and of new drugs in development.Arch.Virol.145：2233-2248。

15.Cox, N.J. and K.Subbarao.1999.Influenza.Lancet 354:1277-1282.

16.Vaucheret, H., C.Beclin and M.Fagard.2001.Post-transcriptional gene silencingin plants.J.CellSci.114:3083-3091.

17.Sharp，P.A.2001.RNA interference-2001.Genes Dev.15：485-490。

18.Brantl，S.2002.Antisense-RNA regulation and RNA interference.Biochem.Biophy.Acta 1575：15-25。

19.Baulcombe，D.2002.RNA silencing.Curr. Biol.12：R82-R84。

20.Fire, A., S.Xu, M.K.Montgomery, S.A.Kostas, S.E.Driver and M.C.C.1998.Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391:806-811.

21.Elbashir, S., J.Harborth, W.Lendeckel, A.Yalcin, K.Weber and T.Tuschl.2001.Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.Nature 411:494-498.

22.McManus, M.T. and P.A.Sharp.2002.Gene silencing in mammals by shortinterfering RNAs.Nature Rev. Gene.3:737-747.

23.Kumar, M. and G.G.Carmichael.1998.Antisense RNA:function and fate ofduplex RNA in cells ofhigher eukaryotes.Microbiol.Mol.Biol Rev.62:1415-1434.

24.Gitlin, L., S.Karelsky and R.Andino.2002.Short interfering RNA confersintracellular antiviral immunity in human cells.Nature 418:430-434.

25.Pderoso de Lima, M.C., S.Simoes, P.Pires, H.Faneca and N.Duzgunes.2001.Cationic lipid-DNA complexes in gene delivery:from biophysics to biological applications.Adv.DrugDeliv. Rev.47:277-294.

26.Holen, T., M.Amarzguioui, M.T.Wiiger, E.Babaie and H.Prydz.2002.Positionaleffects of short interfering RNAs targeting the human coagulation trigger tissue factor.Nucleic Acids Res.30:1757-1766.

27.McManus, M.T., Haines, B.B., Dillon, C.P., Whitehurst, C.E., van Parijs, L., Chen, J. and Sharp, P.A. (2002) .Small interfering RNA-mediated gene silencing in Tlymphocytes.J Immunol 169,5754-5760.

28.Elbashir, S.M., J.Martinez, A.Patkaniowska, W.Lendeckel and T.Tuschl.2001.Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogasterembryo lysate.EMBOJ.20:6877-6888.

29.Yang, D., H.Lu and J.W.Erickson.2000.Evidence that processed small dsRNAsmay mediate sequence-specific mRNA degradation during RNAi in Drosophila embryos.Curr.Biol.10:1191-1200.

30.Caplen, N.J., J.Fleenor, A.Fire and R.A.Morgan.2000.dsRNA-mediated genesilencing in cultured Drosophila cells:a tissue culture model for the analysis of RANinterference.Gene 252:95-105.

31.Edwards, D.A., J.Hanes, G.Caponetti, J.Hrkach, A.Ben-Jebria, M.L.Eskew, J.Mintzes, D.Deaver, N.Lotan and R.Langer.1997.Large porous particles for pulmonary drugdelivery.Science 276:1868-1871.

32.Putnam, D., C.A.Gentry, D.W.Pack and R.Langer.2001.Polymer-based genedelivery with low cytotoxicity by a unique balance of side-chain termini.Proc, Natl.Acad, Sci.USA 98:1200-1205.

33.Lynn, D.M. and R.Langer.2000.Degradable Poly (amino esters): Synthesis, Characterization and Self-Assembly with Plasmid DNA. J. Am. Chem. Soc.122:10761-10768.

34.Lynn, D.M., D.G.Anderson, D.Putnam and R.Langer.2001.Accelerateddiscovery of synthetic transfection vectors:parallel synthesis and screening of a degrablepolymer library.J.Am.Chem.Soc.123:8155-8156.

35.Han, S.-O., R.I.Mahato, Y.K.Sung and S.W.Kim.2000.Development ofBiomaterials for gene therapy.Mol.Therapy 2:302-317.

36.Soane, R.J., M.Frier, A.C.Perkins, N.S.Jones, S.S.Davis and L.Ilium.1999.Evaluation of the clearance characteristics of bioadhesive systems in humans.Int.J.Pharm.178:55-65.

37.Boussif, O., F.Lezoualc ' h, M.A.Zanta, M.D.Mergny, D.Scherman, B.Demeneix and J.P.Behr.1995.A versatile vector for gene and oligonucleotide transfer intocells in culture and in vivo:polyethylenimine.Proc.Natl.Acad. Sci.USA 92:7297-7301.

38.Astafieva, I., I.Maksimova, E.Lukanidin, V.Alakhov and A.Kabanov.1996.Enhancement of the polycation-mediated DNA uptake and cell transfection with PluronicP85 block copolymer.FESB Lett.389:278-280.

39.Davis，S.S.1999.Delivery of peptide and non-peptide drugs through therespiratory tract.Pharm.Sci.Technol.Today 2：450-457。

40.Roy, K., H.-Q.Mao, S.-K.Huang and K.W.Leong.1999.Oral delivery withchitosan/DNA nanoparticles generates immunologic protection in murine model of peanutallergy.Nat.Med.5:387-391.

41.Hansen, M.B., S.E.Nielsen and K.Berg.1989.Re-examination and furtherdevelopment of a precise and rapid dye method for measuring cell growth/cell kill.J.Immunol.Methods 119:203-210.

42.Green, M. and P.M.Loewenstein.1988.Autonomous functional domains ofchemically synthesized human immunodeficiency virus tat trans-activator protein.Cell55:1179-1188.

43.Frankel, A.D. and CO.Pabo.1988.Cellular uptake of the tat protein from humanimmunodeficiency virus.Cell 55:1189-1193.

44.Elliott, G. and P.O ' Hare.1997.Intercellular trafficking and protein delivery by aherpesvirus structural protein.Cell 88:223-233.

45.Joliot, A., C.Pernelle, H.Deagostini-Bazin and A.Prochiantz.1991.Antennapediahomeobox peptide regulates neural morphogenesis. Proc. Natl. Acad. Sci.USA88:1864-1868.

46.Fawell, S., J.Seeiy, Y.Dailch, C.Moore, L.L.Chen, B.Pepinslcy and J.Barsoum.1994.Tat-mediated delivery of heterologous proteins into cells.Proc.Natl.Acad.Sci.USA91:664-668.

47.Schwarze, S.R., A.Ho, A.Vocero-Akbani and S.F.Dowdy.1999.In vivo proteintransductiomdelivery of a biologically active protein.Science 285:1569-1572.

48.Derossi, D., G.Chassaing and A.Prochiantz.1998.Trojan peptides:the penetratinsystem forintracellular delivery.Trends Cell Biol.8:84-87.

49.Troy, CM., D.Derossi, A.Prochiantz, L.A.Greene and M.L.Shelanski.1996.Downregulation of Cu/Zn superoxide dismutase leads to cell death via the nitricoxide-peroxynitrite pathway.J.Neurosci.16:253-261.

50.Allinquant, B.; P.Hantraye, P.Mailleux, K.Moya, C.Bouillot and A.Prochiantz.1995.Downregulation of amyloid precursor protein inhibits neurite outgrowth in vitro.J.Cell Biol.128:919-927.

51.Futaki, S., T.Suzuki, W.Ohashi, T.Yagami, S.Tanaka, K.Ueda and Y.Sugiura.2001.Arginine-rich peptides.An abundant source of membrane-permeable peptides havingpotential as carriers for intracellular protein delivery.J.Biol.Chem.276:5836-5840.

52.Densmore, C.L., F.M.Orson, B.Xu, B.M.Kinsey, J.C.Waldrep, P.Hua, B.Bhogal and V.Knight.1999.Aerosol delivery of robust polyethyleneimine-DNA complexes forgene therapy and genetic immunization.Mol.Therapy 1:180-188.

53.Arppe, J., M.Widgred and J.C.Waldrep.1998.Pulmonary pharmacokinetics ofcyclosporin A liposomes.Intl.J.Pharm.161:205-214.

54.Griesenbach, U., A.chonn, R.Cassady, V.Hannam, C.Ackerley, M.Post, A.K.Transwell, K.Oleic, H.O ' Brodovich and L.-C.Tsui.1998.Comparison between intratrachealand intravenous administration of liposome-DNA complexes for cystic fibrosis lung genetherapy.Gene Ther.5:181-188.

55.Orson, F.M., L.Song, A.Gautam, C.L.DEnsmore, B.Bhogal and B.M.Kinsey.2002.Gene delivery to the lung using protein/polyethyleneimine/plasmid complexes.GeneTherapy 9:463-471.

56.Gautam, A., C.L.Densmore, E.Golunski, B.Xu and J.C.Waldrep.2001.Transgene expression in mouse airway epithelium by aerosol gene therapy with PEI-DNAcomplexes.Mol.Therapy 3:551-556.

57.Tabata, Y. and Y.Ikada.1988, Effect of size and surface charge of polymermicrospheres on their phagocytosis by macrophage.J.Biomed, Mater.Res.22:837-842.

58.Vanbever, R., J.D.Mintzes, J.Wang, J.Nice, D.chen, R.Batycky, L.R. and D.A.Edwards.1999.Formulation and physical characterization of large porous particles forinhalation.Pharmaceutical Res.16:1735-1742.

59.McManus, M.T., C.P.Peterson, B.B.Haines, J.Chen and P.A.Sharp.2002.Genesilencing using micro-RNA designed hairpins.RNA 8:842-850.

60.Myslinski, E., J.C.Ame, A.Krol and P.Carbon.2001.An unusually compactexternal promoter for RNA polymerase III transcription of the human HI RNA gene.NucleicAcids Res.29:2502-2509.

61.Brummelkamp, T.R., R.Bernards and R.Agami.2002.A system for stableexpression of short interfering RNAs in mammalian cells.Science 296:550-553.

62.Paddison, P.J., A.A.Caudy, E.Bernstein, G.J.Hannon and D.S.Conklin.2002.Short hairpin RNAs (shRNAs) induce sequence-sepcific silencing in mammalian cells.GenesDev.16:948-958.

63.Gil, J. and M.Esteban.2000.Induction of apoptosis by the dsRNA-dependentprotein kinase (PKR): mechanism of action.Apoptosis 5:107-114.

64.Bitko, V. and S.Barik.2001.Phenotypic silencing of cytoplasmic genes usingsequence-specific double-stranded short interfering RNA and its application in the reversegenetic of wild type negative-strand RNA viruses.BMC Microbiol.1:34-43.

65.Garcia-Sastre，A.(2002)Microbes & Inf.4，647-655。

66.Katze，M.G.，He，Y.& Gale Jr.，M.(2002)Nature Rev.Immunol.2，675-687。

67.Diaz，M.O.，Ziemin，S.，Le Beau，M.M.，Pitha，P.，Smith，S.D.，Chilcote，R.R.& Rowley，J.D.(1988)Proc.Natl.Acad.Sci.USA 85，5259-5263。

68.Diaz，M.O.，Pomykala，H.M.，Bohlander，S.K.，Maltepe，E.，Malik，K.，Brownstein，B.& Olopade，O.I.(1994)Genomics 22，540-552。

69.Kim，M.-J.，Latham，A.G.& Krug，R.M.(2002)Proc.Natl.Acad.Sci.USA99，10096-10101。

70.Medcalf，L.，Poole，E.，Elton，D. & Digard，P.(1999)J.Virol.73，7349-7356。

71.Shapiro，G.I. & Krug，R.M.(1988)J.Vorol.62，2285-2290。

72.Beaton，A.R.&Krug，R.M.(1986)Proc.Natl.Acad.Sci.USA 83，6282-6286。

73.Lois, C, E.J.Hong, S.Pease, E.J.Brown and D.Baltimore. (2002) Science295:868-872.

74.Weiss, D.J., G.M.Mutlu, L.Bonneau, M.Mendez, Y.Wang, V.Dumasius and P.Factor. (2002) Mol.Ther.6:43-49.

75.Hansen, M.B., S.E.Nielsen and K.Berg. (1989) J.Immunol.Methods119:203-210.

76.Kunath，K，von Harpe A，Fischer D，Petersen H，Bickel U，Voigt K，Kissel T.(2003)J Control Release 89(1)：113-25。

77.Jobe A.Surfactant treatment for respiratory distress syndrome.Respir Care1986；31(6)：467-476。

78.Berry D.Neonatology in the 1990′s：surfactant replacement therapy becomes areality.ClinPediatr 1991；30(3)：167-170。

79.Avery ME，Mead J.Surface properties in relation to atelectasis and hyalinemembrane disease.Am J Dis Child 1959；97：517-523。

80.von Neergard K.Neue Auffassungen iiber einen Grundbegriff der Atemmechanik：die Retraktionskraft der Lunge，abhangig von der Oberflachenspannung in den Alveolen.ZGes Exp Med 1929；66：373。

81.Hallman M，Teramo K，Ylikorkala O，Merritt TA.Natural surfactant substitutionin respiratory distress syndrome.J Perinat Med 1987；15：463-468。

82.Bloom BT, Kattwinkel J, people .Comparison of Infasurf (calf lungsurfactant extract) to Survanta (beractant) in the treatment and prevention of respiratorydistress syndrome.Pediatrics.1997 such as Hall RT; 100:31-38.

83.Mizuno K, Ikegami M, people .Surfactant protein-B supplementationimproves in vivo function ofa modified natural surfactant.Pediatr Res.1995 such as Chen C-M; 37:271-276.

84.Hall SB, Venkitaraman AR, people .Importance of hydrophobicapoproteins as constituents of clinical exogenous surfactants.Am Rev Respir Dis.1992 such as Whitsett JA; 145:24-30.

85.C.H.Ahn，S.Y.Chae，Y.H.Bae and S.W.Kim，Biodegradablepoly(ethylenimine)for plasmid DNA delivery.J Control Release 80，273-82，2002。

86.Kichler, A., Leborgne C, Coeytaux E, Danos O.Polyethylenimine-mediated genedelivery:a mechanistic study.J Gene Med.2001 March-April; 3 (2): 135-44.

87.Brissault B, Kichler A, Guis C, Leborgne C, Danos O, Cheradame H.Synthesisof linear polyethylenimine derivatives for DNA transfectionBioconjug Chem.2003 May-June; 14 (3): 581-7.

88.Kichler A, Leborgne C, Marz J, Danos O, Bechinger B.Histidine-richamphipathic peptide antibiotics promote efficient delivery of DNA into mammalian cellsProc Natl Acad Sci USA.2003 February 18; 100 (4): 1564-8.

89.Brantl，S.(2002).Antisense-RNA regulation and RNA interference.BiochimBiophys Acta 1575，15-25。

90.Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D.N. and Fesik, S.W. (2003) .Specificity of short interfering RNA determined through gene expression signatures.Proc Natl Acad Sci U S A 100,6347-6352.

91.Chi, J.T, Chang, H.Y., Wang, N.N., Chang, D.S., Dunphy, N. and Brown, P.O. (2003) .Genomewide view of gene silencing by small interfering RNAs.Proc Natl Acad SciUS A 700,6343-6346.

92.Bitko, V. and Barik, S. (2001) .Phenotypic silencing of cytoplasmic genes usingsequence-specific double-stranded short interfering RNA and its application in the reversegenetics of wild type negative-strand RNA viruses. BMC Microbiol 1,34.

93.Anderson, D.G., Lynn, D.M. and Langer, R. (2003) .Semi-Automated Synthesisand Screening of a Large Library of Degradable Cationic Polymers for Gene Delivery.Angew Chem Int Ed Engl 42,3153-3158.

94.Ge, Q., McManus, M., Nguyen, T., Shen, C.-H., Sharp, P.A., Eisen, H.N. and Chen, J. (2003) .RNA interference of influenza virus production by directly targeting mRNAfor degradation and indirectly inhibiting all viral RNA transcription.Proc Natl Acad Sci USA100.2718-2723.

95.Kumar, M. and Carmichael, G.G. (1998) .Antisense RNA:function and fate ofduplex RNA in cells of higher eukaryotes.Microbiol Mol Biol Rev 62,1415-1434.

96.Leuscher-Mattli，M.(2000).Influenza chemotherapy：a review of the presentstate of art and of new drugs in development.Arch Virol 145，2233-2248。

97.McCaffrey, A.P., Meuse, L., Pham, T.T., Conklin, D.S., Hannon, G.J. and Kay, M.A. (2002) .RNA interference in adult mice.Nature 418,38-39.

98.McCaffrey, A.P., Nakai, H., Pandey, K., Huang, Z, Salazar, F.H., Xu, H., Wieland, S.F., Marion, P.L. and Kay, M.A. (2003) .Inhibition of hepatitis B virus in mice byRNA interference.Nat Biotechnol 21,639-644.

99.Rubinson, D.A., Dillon, C.P., Kwiatkowski, A.V., Sievers, C, Yang, L., Kopinja, J., Rooney, D.L., Ihrig, M.M., McManus, M.T., Gertler, F.B. wait the people. (2003) .Alentivirus-based system to functionally silence genes in primary mammalian cells, stem cellsand transgenic mice by RNA interference.Nat Genet 33,401-406.

100.Shapiro, G.I. and Krug, R.M. (1988) .Influenza virus RNA replication in vitro:synthesis of viral template RNAs and virion RNAs in the absence of an added primer.J Virol62.2285-2290.

101.Shen, C, Buck, A.K., Liu, X., Winkler, M. and Reske, S.N. (2003) .Gene silencingby adenovirus-delivered siRNA.FEBS lett 539,111-114.

102.Simeoni, F., Morris, M.C, Heitz, F. and Divita, G. (2003) .Insight into themechanism of the peptide-based gene delivery system MPG:implications for delivery ofsiRNA into mammalian cells.Nucleic Acids Res 31,2717-2724.

103.Soane, R.J., Frier, M., Perkins, A.C, Jones, N.S., Davis, S.S. and Ilium, L. (1999) .Evaluation of the clearance characteristics of bioadhesive systems in humans.Int JPharm 775,55-65.

104.Stiver，G.(2003).The treatment of influenza with antiviral drugs.CMAJ 168，49-56。

105.Tachibana, R., Harashima, H., Ide, N., Ukitsu, S., Ohta, Y., Suzuki, N., Kikuchi, H., Shinohara, Y. and Kiwada, H. (2002) .Quantitative analysis of correlation between numberof nuclear plasmids and gene expression activity after transfection with cationic liposomes, Pharm Res19,377-381.

106.Thomas, C.E., Ehrhardt, A. and Kay, M.A. (2003) .Progress and problems withthe use of viral vectors for gene therapy.Nat Rev Genet 4,346-358.

107.Xia, H., Mao, Q., Paulson, H.L. and Davidson, B.L. (2002) .siRNA-mediatedgene silencing in vitro and in vivo.Nat Biotechnol 20,1006-1010.

108.Zhang, G., Song, Y.K. and Liu, D. (2000) .Long-term expression of humanalphal-antitrypsin gene in mouseliver achieved by intravenous administration of plasmidDNA using a hydrodynamics-based procedure.Gene Ther 7,1344-1349.

109.Cheung, M. and Lieberman, J.M. (2002) .Influenza:update on strategies formanagment.Contemporay Pediatrics 19,82-114.

110.Yang, P., Althage, A., Chung, J. and Chisari, F. (2000) Hydrodynamic injection ofviral DNA:A mouse model of acute hepatitis B virus infection, Proc.Natl.Acad.Sci., 99 (21): 13825-13830.

111.Zhang，G.，Budker，V.，Wolff，JA(1999)High levels of foreign gene expressionin hepatocytes after tail vein injections of naked plasmid DNA，Hum Gene Ther，10：1735-1737。

112.Liu，F.，Song，Y.K.，Liu，D.(1999)Hydrodynamics-based transfection in animalsby systemic administration of plasmid DNA.Gene Therapy；6：1258-1266。

113.Naldini，L.Lentiviruses as gene transfer agents for delivery to non-dividing cells.Curr Opin Biotechnol 9，457-63(1998)。

114.Naldini, people .In vivo gene delivery and stable transduction of nondividingcells by a lentiviral vector.Science 272 such as L., 263-7 (1996).

115.Mivoshi，H.，Blomer，U.，Takahashi，M.，Gage，F.H.& Verma，I.M.Development of a self-inactivating lentivirus vector.J Virol 72，8150-7(1998)。

116.Pfeifer，A.，Ikawa，M.，Dayn，Y.& Verma，I.M.Transgenesis by lentiviralvectors：lack of gene silencing in mammalian embryonic stem cells and preimplantationembryos.Proc Natl Acad Sci USA99，2140-5(2002)。

117.Lois，C，Hong，E.J.，Pease，S.，Brown，E.J.& Baltimore，D.Germlinetransmission and tissue-specific expression of transgenes delivered by lentiviral vectors.Science 295，868-72(2002)。

118.Anderson DG, Lynn DM, Langer R., the Semi-Automated Synthesis and Screeningof a Large Library of Degradable Cationic Polymers for Gene Delivery.Angew Chem Int EdEngl.20037 month 14; 42 (27): 3153-3158.

119.McCown, M., Diamond, M.S. and Pekosz, A., Virology, 313:514-524 (2003).

120.Gratton, J.P., Yu, J., Griffith, J.W., Babbitt, R.W., Scotland, R.S., Hicke y, R., Giordano, F.J. and Sessa, W.C., Cell-permeable peptides improve cellular uptake andtherapeutic gene delivery of replication-deficient viruses in cells and in vivo.Nat.Med., 9 (3): 357-362 (2003).

121.McKenzie, D.L., Kwok, K.Y. and Rice, K.G., A Potent New Class of ReductivelyActivated Peptide Gene Delivery Agents.J.Biol.Chem., 275 (14): 9970-9977 (2000).

122.Park, Y., Kwok, K.Y., Boukarim, C and Rice, K.G., Synthesis of SulfhydrylCross-Linking Poly (Ethylene Glycol Peptides and Glycopeptides as Carriers for GeneDelivery.Bioconjugate Chem., 13:232-239 (2002).

123.Zhang, X., Sawyer, G., J., Dong, X,, Qiu, Y., Collins, L. and Fabre, J.W.The invivo use of chloroquine to promote non-viral gene delivery to the liver via the portal vein andbile duct.J.Gene Med., 5:209-218,2003.

124.Thomas, N. and Klibanov, A.M.Non-viral gene therapy:polycation-mediated DNAdelivery.Appl Microbiol, Biotechnol62:27-34 (2003).

125.S.-O.Han，R.I.Mahato，Y.K.Sung，S.W.Kim，″Development of biomaterialsfor gene therapy″，Molecular Therapy 2：302317，2000。

126.Weiss，D.，Delivery of Gene Transfer Vectors to the Lung：Obstacles and theRole of Adjunct Techniques for Airway Administration.Mol.Therapy 6(2)(2002)。

127.Ferrari S，Geddes DM，Alton EW.Barriers to and new approaches for genetherapy and gene delivery in cystic fibrosis.Adv DrugDeliv Rev，54(11)：1373-93(2002)。

128.Orson FM，Song L，Gautam A，Densmore CL，Bhogal BS，Kinsey BM.Genedelivery to the lung using protein/polyethylenimine/plasmid complexes.Gene Ther.2002Apr；9(7)：463-71。

129.Tiyaboonchai, W., Woiszwillo, J. and Middauth, C.R.Formulation andcharacterization of DNA-polyethylenemimine-dextran sulfate nanoparticles.Eur, J, Pharm.Sci.19:191-202 (2003).

130.Benns, J., Mahato, R. and Kim, S.W., Optimization of factors influencing thetransfection efficiency of folate-PEG-folate-graft polyethyleneimine, J.Cont. Release79:255-269 (2002).

131.Putnam, D., Zelikin, A.N., Izumrudov, V.A. and Langer, R., Polyhistidine-PEG:DNA nanocomposites for gene delivery, Biomaterials 24:4425-4433 (2003).

132.Benns, J., Choi, J-S., Mahato, R.I., Park, J-H. and Kim, S.W., pH-SensitiveCationic Polymer Gene Delivery Vehicle:N-Ac-poly (L-histidine)-graft-poly (L-lysine) CombShaped Polymer, Bioconj.Chem.11:637-645 (2000).

133.Panyam, J., Zhou, W-Z., Prabha, S., Sahoo, S.K. and Labhasetwar, V., Rapidendo-lysosomal escape of poly (DL-lactide-co-glycolide) nanoparticles:implications for drugand gene delivery, FASEB J., 16:1217-1226 (2002).

134.Lindgren, M., Hallbrink, M., Prochiantz, A. and Langel, U.Cell-penetratingpeptides.Trends Pharmacol.Sci.21:99-103 (2000).

135.Morris, M.C., Depollier, J., Mery, J., Heitz, F. and Divita, G., A peptide carrier forthe biologically active proteins into mammalian cells.Nat.Biotechnol 19:1174-1176 (2001).

136.Schwarze, S.R. and Dowdy, S.F.In vivo protein transduction:intracellular deliveryof biologically active proteins, compounds, and DNA.Trends Pharmacol.Sci.21:99-103 (2000).

137.Amarzguioui, A., Holen, T., Babaie, E. and Prydz, H.Tolerance for mutations andchemical modifications in a siRNA.Nuc.Acids.Res.31 (2): 589-595 (2003).

138.Braasch, D.A., Jensen, S., Liu, Y., Kaur, K., Arar, K., White, M.A. and Corey, D.R＞RNA Interference in Mammalian Cells by Chemically Modified RNA.Biochemistry 42:7967-7975 (2003).

139.Chiu，y-L. and Rana，T.M.siRNA function in RNAi：A chemical modificationanalysis.RNA 9(9)：1034-1048(2003)。

140.Satishchandran C.Characterization of a new class of DNA delivery complexeformed by the local anesthetic bupivacaine.Biochimica et Biophysica Acta 1468：20-30(2000)。

141.Jeong JH，Park TG.，Poly(L-lysine)-g-poly(D，L-lactic-co-glycolic acid)micellesfor low cytotoxic biodegradable gene delivery carriers.J Control Release，82(1)：159-66(2002)。

142.Loakes, D. and Brown, D.M., Nucl.Acids Res.22:4039-4043 (1994).

143.Ohtsuka, people such as E., J.Biol.Chem.260 (5): 2605-2608 (1985).

144.Lin, P.K.T. and Brown, D.M., Nucleic Acids Res.20 (19): 5149-5152 (1992).

145.Nichols, people such as R., Nature 369 (6480): 492-493 (1994).

146.Rahmon, M.S. and Humayun, N.Z., Mutation Research 377 (2): 263-8 (1997).

147.Amosova, people such as O.., Nucleic Acids Res.25 (10): 1930-1934 (1997).

148.Loakes D. & Brown，D.M.，Nucleic Acids Res.22(20)：4039-4043(1994)。

149.Loakes，D.，Nucleic Acids Res.29(12)：2437-47(2001)。

150.Das，A.and Niven，R.J.Pharm.Sci.，90(9)，1366(2001)。

151.Okuda, people such as K, Vaccine 19:3681-3691, (2001).

152.Han, people such as S.-O, Molecular Therapy 2:302317, (2000).

153.Lewis, people such as DL., Nat Genet.32 (1): 107-8 (2002).

Claims (105)

1. the RNAi inductor of a target influenza virus transcript, wherein said RNAi inductor comprises: nucleic acid moiety, its sequence comprise sequence, its complement or the arbitrary fragment with at least 15 length of nucleotides that is selected from the group that is made up of SEQ ID NO:272-380.

2. RNAi inductor according to claim 1, wherein said sequence is selected from the group that is made up of following sequence: SEQ ID NO:274,286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361,364 and 366, its complement or arbitrary fragment with at least 15 length of nucleotides.

3. RNAi inductor according to claim 1, wherein said sequence is selected from the group that is made up of following sequence: SEQ ID NO:297,309,310,311,346,347,364 and 366, its complement or arbitrary fragment with at least 15 length of nucleotides.

4. RNAi inductor according to claim 1, it is the siRNA that comprises indivedual nucleic acid chains, one of described nucleic acid chains or two chains comprise and are positioned at its 3 ' strand overhang of locating.

5. RNAi inductor according to claim 1, it is the shRNA that comprises first and second nucleic acid moieties of the single nucleic acid that forms duplex, wherein said first and second nucleic acid moieties partly link together by single-chain nucleic acid, and wherein said duplex comprises the strand overhang in addition.

6. RNAi inductor, its except that the sequence of nucleic acid moiety for the nucleic acid moiety of RNAi inductor according to claim 1 difference on 1 or 2 position, identical with described RNAi inductor.

7. carrier, it comprises the template that is used to transcribe RNAi inductor according to claim 1, and wherein said template can be operatively connected to promotor.

8. the treatment or the method for flu-prevention virus infection, it comprises to the person under inspection that needs are arranged throws and RNAi inductor according to claim 7.

9. composition, it comprises RNAi inductor according to claim 1 and delivery agents.

10. composition according to claim 9, wherein said delivery agents is a cationic polymers.

11. composition according to claim 10, wherein said cationic polymers are selected from the group that is made up of following polymkeric substance: PEI, PLL, PLA and poly-(β) amino ester.

12. the treatment or the method for flu-prevention virus infection, it comprises to the person under inspection that needs are arranged throws and RNAi inductor according to claim 1.

13. a method of diagnosing influenza, it comprises following steps:

Determine whether the person under inspection is subjected to the influenza infection to the restraining effect sensitivity of RNAi inductor according to claim 1.

14. method according to claim 13, it comprises in addition to the step of described person under inspection's throwing with described RNAi inductor.

15. a RNAi inductor, its target is selected from the influenza virus gene by the group of following genomic constitution: polymerase protein matter PB1 gene, polymerase protein matter PB2 gene, polymerase protein matter PA gene and NP gene.

16. RNAi inductor according to claim 15, wherein said gene is PB1.

17. RNAi inductor according to claim 15, wherein said gene is PB2.

18. RNAi inductor according to claim 15, wherein said gene is PA.

19. RNAi inductor according to claim 15, wherein said gene is NP.

20. RNAi inductor according to claim 15, the target part of the gene of the preferred target part of the function that wherein said medicament target is RNAi.

21. RNAi inductor according to claim 15, the suitably conservative target part of the described gene of wherein said medicament target.

22. RNAi inductor according to claim 15, the high conservative target part of the described gene of wherein said medicament target.

23. RNAi inductor according to claim 15, wherein said RNAi inductor comprises:

With target part 100% complementary nucleic acid moiety at least 15 continuous nucleotides of described influenza virus gene, wherein said target partly is the preferred target of the function of RNA.

24. a RNAi inductor, its except that nucleic acid moiety with respect to the nucleic acid moiety of RNAi inductor according to claim 23 difference on 1 or 2 position, identical with described RNAi inductor.

25. a carrier, it comprises the template that is used to transcribe RNAi inductor according to claim 15.

26. an isolating nucleic acid or its complement, its sequence comprises the sequence that is selected from the group that is made up of SEQ ID NO:272-380, or comprising the fragment that the sequence that is selected from the group that is made up of SEQ ID NO:272-380 has at least 16 length of nucleotides, wherein said nucleic acid has the length of 100 Nucleotide or 100 following Nucleotide.

27. nucleic acid according to claim 26, wherein said sequence comprises and is selected from the NO:274 by SEQ ID, 286,287,292,297,298,304,305,309,310,311,319,324,327,334,346,347,360,361, the sequence of 364 and 366 groups that form, or comprise and be selected from NO:274 by SEQ ID, 286,287,292,297,298,304,305,310,311,319,324,327,334,346,347,360,361, the sequence of 364 and 366 groups that form has the fragment of at least 16 length of nucleotides, and wherein said nucleic acid has the length of 100 Nucleotide or 100 following Nucleotide.

28. nucleic acid according to claim 26, wherein said sequence comprises the sequence that is selected from by SEQ ID NO:297,309,310,311,346,347,364 and 366 groups that form, or comprise the sequence that is selected from by SEQ ID NO:297,310,311,346,347,364 and 366 groups that form and have the fragment of at least 16 length of nucleotides, wherein said nucleic acid has the length of 100 Nucleotide or 100 following Nucleotide.

29. nucleic acid according to claim 26, wherein said sequence comprise the sequence that is selected from the group that is made up of SEQ ID NO:272-380.

30. isolating nucleic acid according to claim 26, but it comprises the test section that is connected to described nucleic acid in addition.

31. a RNAi inductor, it comprises nucleic acid according to claim 26.

32. a carrier, it comprises the template that is used to transcribe RNAi inductor according to claim 26.

33. one kind has sequence

The isolating nucleic acid of n1-n2-n3-n4-n5-n6-n7-n8-n9-n10-n11-n12-n13-n14-n15-n16-n 17-n18-n19 (N19), described sequence is identical with a part that is selected from by the influenza virus gene of the group of following genomic constitution: polymerase protein matter PB1 gene, polymerase protein matter PB2 gene, polymerase protein matter PA gene and NP gene, or difference is:

Allowing A in any position is that G or C are the difference of U;

Only position n1, n1 8 allow G to be or C to the difference that is, and/or between N19 and described influenza virus, have difference between 0,1,2 or 3,

Be no more than 2 continuous differences; And

Between N19 and described influenza virus, there is 1 difference at most.

34. a RNAi inductor, its target nucleic acid according to claim 33.

35. a RNAi inductor, it comprises nucleic acid according to claim 33.

36. a carrier, it comprises the template that is used to transcribe RNAi inductor according to claim 33.

37. a method of diagnosing person under inspection's influenza, it comprises following steps:

Determine whether described person under inspection is subjected to induce the strains of influenza viruses of the restraining effect sensitivity of entity to infect to RNAi.

38. according to the described method of claim 37, it comprises following steps in addition:

Induce entity to described person under inspection's throwing with described RNAi.

39. according to the described method of claim 37, wherein said determining step comprises the diagnositc analysis of enforcement based on nucleic acid.

40. a diagnostic kit, it comprises:

Primer or probe, its detect influenza virus gene the target part to small part, described target partly be RNAi suitably guard the target part.

41. according to the described diagnostic kit of claim 40, wherein said suitably conservative target partly comprises the sequence that is selected from the group that is made up of SEQID NO:272-380.

42. the method for genetic expression in tissue that suppresses the Mammals person under inspection or the organ, it comprises following steps:

Do not use the water power rotaring dyeing technology, the composition of RNAi inductor that will comprise the described gene of target of significant quantity is directly introduced in described person under inspection's the vascular system.

43. according to the described method of claim 42, wherein said organ is a lung.

44. according to the described method of claim 42, wherein said composition comprises cationic polymers.

45. according to the described method of claim 42, wherein said gene is the gene that infects the virus of airway epithelial cell.

46. according to the described method of claim 45, wherein said virus is influenza virus.

47. according to the described method of claim 42, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

48. according to the described method of claim 42, wherein said significant quantity makes described expression of gene reduce at least 2 times.

49. the method that virus produces in the respiratory system that suppresses the Mammals person under inspection, wherein said virus infection airway epithelial cell, described method comprises following steps:

Do not use the water power rotaring dyeing technology, the composition of RNAi inductor that will comprise the described virogene of target of significant quantity by injection is introduced in described person under inspection's the vascular system.

50. according to the described method of claim 49, wherein said composition comprises cationic polymers.

51. according to the described method of claim 49, wherein said virus is influenza virus.

52. according to the described method of claim 49, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

53. according to the described method of claim 49, wherein before the person under inspection who is not subjected to described virus infection infects, described composition is thrown and described person under inspection, and wherein when described person under inspection was infected subsequently, described composition effectively suppressed the generation of described virus.

54. the method for genetic expression in the lung that suppresses the Mammals person under inspection, it comprises following steps:

To comprise the RNAi inductor of the described gene of target of significant quantity and the composition of delivery agents directly introduces in described person under inspection's the respiratory system.

55. according to the described method of claim 54, wherein said composition be throw in the intranasal with.

56. according to the described method of claim 54, wherein said composition by suck to throw with.

57. according to the described method of claim 54, wherein said composition comprises cationic polymers.

58. according to the described method of claim 54, wherein said gene is the gene that infects the virus of airway epithelial cell.

59. according to the described method of claim 58, wherein said virus is influenza virus.

60. according to the described method of claim 54, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

61. according to the described method of claim 54, wherein said significant quantity makes described expression of gene reduce at least 2 times.

62. according to the described method of claim 54, wherein said composition is substantially free of and strengthens polymkeric substance and the lipid of sending.

63. the method that virus produces in the respiratory system that suppresses the Mammals person under inspection, wherein said virus infection airway epithelial cell, described method comprises following steps:

The composition of RNAi inductor that will comprise the described virogene of target of significant quantity is directly introduced in described person under inspection's the respiratory system.

64. according to the described method of claim 63, wherein said virus is influenza virus.

65. according to the described method of claim 63, wherein said composition be throw in the intranasal with.

66. according to the described method of claim 63, wherein said composition be by suck to throw with.

67. according to the described method of claim 63, wherein said composition comprises cationic polymers.

68. according to the described method of claim 63, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

69. according to the described method of claim 63, wherein said significant quantity makes the generation of described virus reduce at least 25%.

70. according to the described method of claim 63, wherein said composition is substantially free of and strengthens polymkeric substance and the lipid of sending.

71. according to the described method of claim 63, wherein before the person under inspection who is not subjected to described virus infection infects, described composition is thrown and described person under inspection, and wherein when described person under inspection was infected subsequently, described composition effectively suppressed the generation of described virus.

72. a transgenic nonhuman animal, it expresses the RNAi inductor of target influenza virus transcript.

73. according to the described transgenic nonhuman animal of claim 72, wherein said animal is a bird.

74. the purposes of a RNAi inductor, it is used to make the medicament of treatment or flu-prevention virus infection, it comprises to the person under inspection that needs are arranged throws and described RNAi inductor, wherein said RNAi inductor comprises: nucleic acid moiety, its sequence comprises sequence, its complement or the arbitrary fragment with at least 15 length of nucleotides that is selected from the group that is made up of SEQ ID NO:272-380, and wherein said template can be operatively connected to promotor.

75. the purposes of a RNAi inductor, it is used to make the medicament of treatment or flu-prevention virus infection, it comprises to the person under inspection that needs are arranged throws and described RNAi inductor, wherein said RNAi inductor comprises: nucleic acid moiety, its sequence comprise sequence, its complement or the arbitrary fragment with at least 15 length of nucleotides that is selected from the group that is made up of SEQ ID NO:272-380.

76. the purposes of a RNAi inductor, it is used for making inhibition Mammals person under inspection's the tissue or the medicament of organ genetic expression, and its composition that comprises the RNAi inductor of the described gene of target that does not use the water power rotaring dyeing technology will comprise significant quantity is directly introduced the step in described person under inspection's vascular system.

77. according to the purposes of the described RNAi inductor of claim 76, wherein said organ is a lung.

78. according to the purposes of the described RNAi inductor of claim 76, wherein said composition comprises cationic polymers.

79. according to the purposes of the described RNAi inductor of claim 76, wherein said gene is the virogene that infects airway epithelial cell.

80. according to the purposes of the described RNAi inductor of claim 76, wherein said virus is influenza virus.

81. according to the purposes of the described RNAi inductor of claim 76, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

82. according to the purposes of the described RNAi inductor of claim 76, wherein said significant quantity makes described expression of gene reduce at least 2 times.

83. the purposes of a RNAi inductor, it is used for making the medicament of the respiratory system virus generation that suppresses the Mammals person under inspection, wherein said virus infection airway epithelial cell, described purposes comprise the composition of RNAi inductor that does not use the water power rotaring dyeing technology will comprise the described virogene of target of significant quantity by injection and introduce step in described person under inspection's the vascular system.

84. the purposes of 3 described RNAi inductors according to Claim 8, wherein said composition comprises cationic polymers.

85. the purposes of 3 described RNAi inductors according to Claim 8, wherein said virus is influenza virus.

86. the purposes of 3 described RNAi inductors according to Claim 8, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

87. the purposes of 3 described RNAi inductors according to Claim 8, wherein before the person under inspection who is not subjected to described virus infection infects, described composition is thrown and described person under inspection, and wherein when described person under inspection was infected subsequently, described composition effectively suppressed the generation of described virus.

88. the purposes of a RNAi inductor, it is used for making the medicament that suppresses the genetic expression of Mammals person under inspection lung, and it comprises directly introduces step in described person under inspection's the respiratory system with the composition that comprises the RNAi inductor of the described gene of target of significant quantity and delivery agents.

89. the purposes of 8 described RNAi inductors according to Claim 8, wherein said composition be throw in the intranasal with.

90. the purposes of 8 described RNAi inductors according to Claim 8, wherein said composition be by suck throw with.

91. the purposes of 8 described RNAi inductors according to Claim 8, wherein said composition comprises cationic polymers.

92. the purposes of 8 described RNAi inductors according to Claim 8, wherein said gene are to infect the gene of the virus of airway epithelial cell.

93. according to the purposes of the described RNAi inductor of claim 92, wherein said virus is influenza virus.

94. the purposes of 8 described RNAi inductors according to Claim 8, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

95. the purposes of 8 described RNAi inductors according to Claim 8, wherein said significant quantity make described expression of gene reduce at least 2 times.

96. being substantially free of, the purposes of 8 described RNAi inductors according to Claim 8, wherein said composition strengthen polymkeric substance and the lipid of sending.

97. the purposes of a RNAi inductor, it is used for making the medicament of the respiratory system virus generation that suppresses the Mammals person under inspection, wherein said virus infection airway epithelial cell, described purposes comprise directly introduces step in described person under inspection's the respiratory system with the composition of RNAi inductor that comprises the described virogene of target of significant quantity.

98. according to the purposes of the described RNAi inductor of claim 97, wherein said virus is influenza virus.

99. according to the purposes of the described RNAi inductor of claim 97, wherein said composition be throw in the intranasal with.

100. according to the purposes of the described RNAi inductor of claim 97, wherein said composition be by suck to throw with.

101. according to the described purposes of claim 97, wherein said composition comprises cationic polymers.

102. according to the described purposes of claim 97, wherein said significant quantity is between every kilogram of about 0.1mg of person under inspection's body weight and 5mg.

103. according to the described purposes of claim 97, wherein said significant quantity makes the generation of described virus reduce at least 25%.

104. according to the described purposes of claim 97, wherein said composition is substantially free of and strengthens polymkeric substance and the lipid of sending.

105. according to the described purposes of claim 97, wherein before the person under inspection who is not subjected to described virus infection infects, described composition is thrown and described person under inspection, and wherein when described person under inspection was infected subsequently, described composition effectively suppressed the generation of described virus.

Images