CN101168049A - Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof - Google Patents
Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof Download PDFInfo
- Publication number
- CN101168049A CN101168049A CNA2007101762197A CN200710176219A CN101168049A CN 101168049 A CN101168049 A CN 101168049A CN A2007101762197 A CNA2007101762197 A CN A2007101762197A CN 200710176219 A CN200710176219 A CN 200710176219A CN 101168049 A CN101168049 A CN 101168049A
- Authority
- CN
- China
- Prior art keywords
- interleukin
- hil22
- total rna
- cultivate
- hepatopathy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses the usage of interleukin-22 during the preparative medicine for treating hepatic diseases, in particular to the application of medicine in preparing to treat alcoholic liver diseases and nonalcoholic fatty liver diseases. The range of application of the interleukin-22 is enlarged, bringing comfort to hepatopath. The invention also discloses a process for preparing the recombinant human interleukin-22, and the recombinant human interleukin-22 is produced by employing the method with high expression level and low costs, providing the foundation of mass production and application of the interleukin-22.
Description
Technical field
The present invention relates to the medical usage and the preparation method of interleukin-22, relate in particular to the purposes of interleukin-22 on preparation treatment liver disease drug, also relate to the preparation method of recombination human interleukin-22.
Background technology
(English name is Interleukin 22 to interleukin-22, is abbreviated as: IL22) be a kind of cytokine of finding in 2 years, by activated T cell and NK emiocytosis (Wolk K etc., J Immunol 2002; 168:5397～402), by the heteroreceptor complex (IL22R1, IL10R2) and performance biological effect (J Biol Chem 2000 such as XieMH; 275; 31335～9), IL10R2 distributes comparatively extensive, and IL22R1 expresses height-limited, mainly is expressed in pancreas, skin, liver, lung and kidney.Tranquillization or activatory immunocyte all do not have IL-22 R1 expression (Wolk K etc., Immunity 2004; 21:241-54).The medical usage of interleukin-22 mainly contains: (1) purposes (number of patent application: 200510023103.0) in treatment hyperlipemia, hypertriglyceridemia, obesity and/or diabetes, (2) purposes (U.S. Patent number: 7 in the treatment disturbances of pancreas, 226,591) the present document of not finding interleukin-22 treatment hepatopathy.
It is diseases related that alcoholic liver disease and non-alcohol fatty liver all belong to heredity-environment-metabolic stress.Alcoholic liver disease and non-alcohol fatty liver can merge with viral hepatitis and exist, non-alcohol fatty liver can cause relevant deformity of hepatopathy and the death except the same with alcoholic liver disease, also closely related with type 2 diabetes mellitus, metabolic syndrome and relevant cardiovascular and cerebrovascular vessel incident thereof (Brunt E:Nonalcoholicsteatohepatitis.Semin Liver Dis 2004,24:3-20).
Alcoholic liver disease (alcoholic liver diseases is called for short ALD) is meant a series of pathological changes such as liver injury that cause owing to long-term excessive consumption of alcohol, its pathology variation comprises alcoholic fatty liver, alcoholic hepatitis, alcoholic fibrosis, alcoholic cirrhosis, several pathological changes can take place separately and can exist simultaneously.Along with the continuous rising of people's living standard, the sickness rate of alcoholic liver disease presents the trend of obvious rising, has become the second largest hepatic disease that is only second to viral liver disease in China.
At present also not to the effective medicine of ALD, the current medicine of using clinically has glucocorticoid, PTX (pentoxifylline) and anti-TNF-α treatment, glucocorticoid is considered to improve the alcoholic hepatitis symptom of acute stage, improve the short-term survival rate, but can not be to prognosis, the improvement of liver complication and liver histological form produces favorable influence (Bergheim I etc., Dig Dis.2005; 23 (3-4): 275-84).PTX is because of its antiinflammatory action, can effectively prevent the generation of hepatorenal syndrome and safety preferably and is applied to the treatment of alcoholic hepatitis liver cirrhosis.
It is similar but do not have the clinical syndrome of excessive history of drinking history that non-alcohol fatty liver (NAFLD) is that a kind of liver histopathology changes with alcoholic liver disease.West Europe, the U.S., Japanese general population NAFLD prevalence are 10～24%, and NASH (non-alcoholic stellato-hepatitis) prevalence is 2%～5%, and the NAFLD prevalence is up to 57.5%～74% among the obese patient.Along with The development in society and economy, the NAFLD prevalence increases rapidly, has now become one of three big hepatopathys of harm humans health.
NAFLD is that heredity-environment-metabolic stress is diseases related, and is closely related with insulin resistant and relevant metabolic syndrome and genetic predisposition thereof.NAFLD not only can cause hepatopathy relevant disabled and dead, and occurred frequently closely related with atherosclerotic cardiovascular and cerebrovascular vessel incident.Also there is not effective medicine to treat for NAFLD.
The method for preparing at present IL22 mainly contains two kinds: (1) prokaryotic expression system (Ronaldo Alves PintoNagem etc., Crystal Structure of Recombinant Human Interleukin-22Structure, Vol.10,1051-1062, August, 2002), prokaryotic expression system is to utilize the pET serial carrier, its mode of inducing is chemical induction (an IPTG abduction delivering), and its shortcoming is the cost height; (2) eukaryotic expression system (Jing Li etc., International Immunopharmacology 4 (2004) 693-708), adopting eukaryotic expression system to express hIL22 is solubility, its shortcoming is that expression is little, can't satisfy zooperal demand; Therefore need to seek expression height, preparation method that cost is low.
Summary of the invention
One of purpose of the present invention provides a kind of purposes of interleukin-22.
Another purpose of the present invention provides the preparation method of recombination human interleukin-22.
The invention provides the application of interleukin-22 in preparation treatment liver disease drug.
Described interleukin-22 is meant human interleukin-2 2, recombination human interleukin-22, Mus interleukin-22 or reorganization Mus interleukin-22 etc.
Described hepatopathy is meant a kind of of hepatopathy such as depletion after alcoholic liver disease, non-alcohol fatty liver, viral hepatitis, acute hepatic failure, hepatic fibrosis, hepatic ischemia-reperfusion injury, the liver transplantation.
Above-mentioned hepatopathy is meant alcoholic liver disease or non-alcohol fatty liver.
The preparation method of recombination human interleukin of the present invention-22 comprises the steps:
(1) utilizes the fresh peripheral blood of people, cultivate human peripheral lymphocyte, extract total RNA;
(2) being template with total RNA, is that primer carries out the RT-PCR amplification with f1 and r1, gets the cDNA sequence of hIL22; The sequence of described primer f1 and r1 is as follows:
f1：5′GAGAATTCATATGGCACCCATCAGCTCCCA3′；
r1：5′ACGGATCCTCAAATGCAGGCATTTCT 3′
And then be template with the cDNA of gained, be that primer carries out pcr amplification with f1 and r1, the DNA sequence of hIL22;
(3) with EcoRI and BamHI respectively with DNA sequence and the plasmid pBV220 enzyme action of step (2) gained hIL22; Then both are mixed, both are connected, will connect the product electricity consumption then and transform or CaCl with the T4 ligase
2The conversion method transformed host cell, Screening and Identification gets recombiant plasmid pBV220/hIL22;
(4) electricity consumption transforms or CaCl
2Method is with recombiant plasmid pBV220/hIL22 transformed host cell; Be inoculated on the LB culture medium and cultivate, centrifugal then, resuspended precipitate utilizes the ultrasonic disruption thalline, then with the degeneration of gained inclusion body, dissolving, purification, renaturation, concentrated, promptly gets recombination human interleukin 22 albumen of the present invention.
The preparation method of above-mentioned recombination human interleukin-22, its detailed operating procedure is:
(1) with the fresh peripheral blood of people with 2 times of the PBS solution dilutions that contains 2mmol/L EDTA, be laid on then on the equal-volume lymphocyte separation medium, centrifugal under 700～1000rpm again, use the greyish white confluent monolayer cells of glass capillary sucking-off then, wash greyish white confluent monolayer cells 2～3 times with Hanks liquid, again greyish white confluent monolayer cells is suspended in 1640 and cultivates in the base, and at 37 ℃, 5%CO
2Cultivate 24h in the incubator, then add ConA (2mg/ml) and anti-CD
3(4mg/ml) be total to irritation cell, again at 37 ℃, 5%CO
2Continue in the incubator to cultivate 24h, extract total RNA with the total RNA extraction reagent box;
(2) being template with total RNA, is primer with f1 and r1
f1：5′GAGAATTCATATGGCACCCATCAGCTCCCA3′
r1：5′ACGGATCCTCAAATGCAGGCATTTCT3′
Carry out RT-PCR amplification and obtain the cDNA sequence of human interleukin-2 2;
The each several part ratio of described RT-PCR reaction system is: total RNA, 5ul; The RNase inhibitor; 0.5ul; Oligo (dT), 0.5ul; The DEPC treating water, 6.5ul; Amount to 12ul; 70 ℃ 5min to 4 ℃; RT: add in above-mentioned system: 5 * buffer 4ul, 2.5mMdNTP 2ul, AMV 1ul, RNase inhibitor 1ul, 42 ℃ of 1h, 85 ℃ 5min to 4 ℃;
The first chain cDNA that produces with reverse transcription is a template then, with f1, r1 is that primer carries out the PCR reaction, and the each several part ratio of described PCR reaction system is: 10PCR reaction * buffer 2.0ul, 2.0mmol/LdNTP 2.0ul, 5pmol/ul fl 2.0ul, 5pmol/ulrl2.0ul, reverse transcription product 4.0ul, TaqDNA polymerase 0.5ul, ddH2O 7.5ul, 20ul altogether; Described PCR reaction condition is 94 ℃ of pre-degeneration 3min, 94 ℃ of 30S, 50 ℃ of 30S, 72 ℃ of 30S, 30 circulations; 72 ℃ are extended 7min; Agarose gel with 1.2% separates the PCR product;
(3) add restricted enzyme EcoRI and BamHI to RT-PCR product and plasmid pBV220 respectively, enzyme action 3.5h in 37 ℃ of water-baths presses 10～4: 1 mixed with both then, adds the T4 ligase, carry out coupled reaction 12h, conversion of utilization electricity or CaCl in 16 ℃
2Method will connect the product transformed host cell, utilize amicillin resistance screening recombinant clone, and extract phase answers plasmid, enzyme action to identify, check order, and can get recombiant plasmid pBV220/hIL22;
(4) electricity consumption transforms or CaCl
2Method is transformed into recombiant plasmid pBV220/hIL22 in the host cell; Transform 30 ℃ of activation of spending the night of bacterium colony, next day, the ratio according to 1～2% percent by volume was inoculated in the LB culture medium, cultivated 2～3hr, placed on 42 ℃ of shaking baths then, cultivates 4～8hr under 180～220rpm condition for 30 ℃; Again at 4 ℃, 10,000～12, centrifugal 10～15min under the 000rpm condition, remove supernatant, ratio according to mass volume ratio 1: 8～10 is resuspended in precipitation in the PB solution, again with the ultrasonic disruption thalline, the inclusion body washing that obtains after with ultrasonic Treatment with 2mol/L carbamide 2～4 times, inclusion body is joined in the 8mol/L carbamide then, getting dissolved inclusion body solution, is column packing with Sephacryl-200 (S-200), and the dissolving supernatant is carried out gel permeation chromatography, again the gained purification of samples is placed 4 ℃ of renaturation buffers to carry out renaturation reaction 72hr, slowly concentrate with PEG 6000 at last and obtain human interleukin-2 2 albumen.
Host cell described in the said method can be E.coliDH5 α, HB101 or JM109 etc.
Hanks liquid described in the said method can directly be bought from the market, as buying from the kind company that reaches of sky profit.
Lymphocyte separation medium described in the said method can directly be bought from the market, as buying from the Shanghai smart biotech firm of China.
ConA described in the said method can directly buy on market, as buying from Xia Si biotech firm.
Anti-CD described in the said method
3Can on market, directly buy, as can my actor playing a martial role in Chinese operas's thing Science and Technology Ltd. buying from Shanghai.
Above-mentioned 1640 cultivate base for culture medium commonly used, can buy from the market, buy as purchasing from the kind reagent company that reaches of sky profit.
Above-mentioned total RNA extraction reagent box can be bought from the market, as buying from Promega company.
PB solution described in the said method is that final concentration is 100mmol/L Na
2HPO
4, 100mmol/LNaH
2PO
4Mixed liquor.See 1568 pages of " molecular cloning experiment guide " third editions.
Above-mentioned LB culture medium refers to used LB culture medium usually.
Utilize electricity to transform or CaCl in said method step (3) and the step (4)
2The method of method transformed host cell is seen " molecular cloning experiment guide " third edition 96～99.
Described gel permeation chromatography is to be column packing with Sephacryl-200 (S-200).
The constituent of described renaturation buffer and ratio thereof are: 100mmol/L Na
2HPO
4, 100mmol/LNaH
2PO
4, 0.1mmol/L GSSG, 1mmol/L GSH, 0.1%PEG.
The advantage that the present invention had: (1) the invention provides a kind of new purposes of interleukin-22, has enlarged the range of application of interleukin-22; (2) expression height of the present invention, and destination protein can account for 40% of tropina; (3) the inventive method is carrier with pBV220, adopts the thermoinducible mode of inducing, and production cost is low.
Description of drawings
Fig. 1 is the total RNA electrophoretogram of human peripheral
Fig. 2 is a RT-PCR product electrophoretogram
1.DL2000
2.hIL22cDNA
Fig. 3 is a pBV220-IL22 enzyme action product electrophoretogram
1.DL2000
2. use the electrophoretogram of EcoRI and BamHI enzyme action pBV220 product
3. use the electrophoretogram of EcoRI and BamHI enzyme action pBV220-hIL-22 product
Fig. 4 is the expression product electrophoretogram of hIL22 in various escherichia coli
1.Marker
2.pBV220/JM109
3.pBV220-IL22/JM109
Fig. 5 is the electrophoretogram of the purification of hIL22
Fig. 6 is the elution curve of hIL22
Fig. 7 is the short proliferation function curve chart of hIL22 to the LO2 cell
Fig. 8 is a LO2 cell c-myc expression electrophoretogram
1.DL2000
2.LO2 total RNA product of cell extraction
3. the hIL22 of variable concentrations (20,200,400,800ng/mL) is to the influence of c-myc expression
Fig. 9 LO2 cell bcl-2 expression electrophoretogram
1.DL2000 DNA marker；
2.LO2 cell total rna reverse transcription product
Bcl-2 expression in the LO2 cell of 3～6. different interleukin-22 concentration (20,200,400,800ng/mL)
The pathological section figure of Figure 10 hIL22 treatment non-alcohol fatty liver
A: normal group; B: model group; C:IL22 treatment group
The specific embodiment
The preparation of hIL22
(1) the hIL-22 gene angles the structure of getting with recombinant expression carrier
A. the extraction of total RNA is diluted 2 times with the PBS that contains 2mmol/L EDTA with the fresh peripheral blood of 1ml people, be laid on then on the equal-volume lymphocyte separation medium (purchasing) in the Shanghai smart biotech firm of China, centrifugally under 800r/min again make it layering, use the greyish white confluent monolayer cells of blood capillary sucking-off then; Wash greyish white confluent monolayer cells 3 times with Hanks liquid (purchasing the kind company that reaches of Yu Tianrun), cultivate base (purchasing the kind reagent company that reaches of Yu Tianrun) suspension cell with 1640 then, and at 37 ℃, 5%CO
2Cultivate 24h in the incubator, add ConA (2mg/ml purchases the biotech firm in Xia Si) and anti-CD more respectively
3(4mg/ml purchase in Shanghai I actor playing a martial role in Chinese operas's thing Science and Technology Ltd.) be irritation cell altogether, then at 37 ℃, and 5%CO
2Continue to cultivate 24h in the incubator, reuse total RNA extraction reagent box (Promega company) extracts total RNA (the operation by specification carries out), gets total RNA (see figure 1);
B. the structure of the separation of genes of interest and pBV-IL22 plasmid is got the total RNA of 5uL, is primer with f1 and r1, utilizes Oligo (dT) to carry out reverse transcription, the synthetic first chain cDNA; Used primer is:
EcoRI f1：5′GAGAATTCATATGGCACCCATCAGCTCCCA3′
BamHI r1：5′ACGGATCCTCAAATGCAGGCATTTCT3′
The reverse transcription system is as follows: total RNA 5uL, and RNase inhibitor 0.5uL, Oligo (dT) 0.5uL, DEPC treating water 6.5uL is total to 12uL, 70 ℃ 5min to 4 ℃;
RT: add in above-mentioned system: 5 * buffer 4uL, 2.5mMdNTP 2uL, AMV 1uL, RNase inhibitor 1uL, 42 ℃ of 1h, 85 ℃ 5min to 4 ℃;
The first chain cDNA that produces with reverse transcription is a template, carries out the PCR reaction, PCR reaction system: 10PC reaction * buffer 2.0uL, 2.0mmol/L dNTP 2.0uL, 5pmol/uL f1 2.0uL, 5pmol/uLr1 2.0uL, reverse transcription product 4.0uL, TaqDNA polymerase 0.5uL, ddH
2O 7.5uL, 20uL altogether;
The PCR reaction condition is 94 ℃ of pre-degeneration 3min; 94 ℃ of 30S, 50 ℃ of 30S, 72 ℃ of 30S, 30 circulations; 72 ℃ are extended 7min; Agarose gel with 1.2% separates the PCR product, reclaim the PCR product, use EcoRI and BamHI double digestion then, the reuse ligase be connected through the two pBV220 that cut of same enzyme, connect product Transformed E .coliDH5 α competent cell, to be accredited as male recombiant plasmid through double digestion and send the order-checking of BioaSia company, result's (seeing Fig. 2 and Fig. 3) must have the recombiant plasmid of genes of interest hIL22, and this plasmid is labeled as pBV-IL22.
(2) expression of pBV-IL22 in escherichia coli is with constructed plasmid pBV-IL22 transformed into escherichia coli competent cell JM109, from transforming the dull and stereotyped picking monoclonal colony inoculation of going up in 3ml amp
rIn the LB culture medium (the LB culture medium: fluid medium takes by weighing tryptone 10g, and yeast extract 5g is settled to 1L with distilled water), 30 ℃ of activation of spending the night.To activate bacterium with 3% ratio and be inoculated in the fresh amp of 3ml next day
rIn the LB culture medium, 30 ℃ shake to exponential phase to OD
600nmReach at 0.5 o'clock, directly change bacterium over to shaking bath 4h under 42 ℃, 200rpm condition, again at 4 ℃, 12, centrifugal 10min under the 000rpm condition receives bacterium, will precipitate with mass volume ratio to be resuspended in PB (100mmol/L Na at 1: 10
2HPO
4, 100mmol/L NaH
2PO
4) in, with the ultrasonic disruption thalline (6 times, each 30s; + 200W), collect supernatant and precipitation respectively, carry out 15%SDS-PAGE, (see figure 4) shows the expression of hIL22 in E.coli JM109 as a result.
(3) precipitation behind the purification bacterial cell disruption of rhIL-22 is washed with the 2mol/L carbamide of 10 times of volumes, the inclusion body that washing is good is dissolved in the 8mol/L carbamide, room temperature is placed 8h, constantly stir, wait inclusion body fully to dissolve, then centrifugal 30min under 4 ℃, 12000rpm condition, collect cleer and peaceful precipitation respectively, selecting Sephacryl-300 (S-300) for use is filler, and column volume is 3.6 * 100cm, and destination protein is carried out separation and purification.Pillar is with balance liquid (8mol/L carbamide, the 100mmol/L Na of 2 times of volumes before the last sample
2HPO
4, 100mmol/L NaH
2PO
4, 50mmol/LNaCl PH7.4,10mmo/L DTT) and balance, last sample volume is about 2% of column volume, with eluent (50mmol/L Na
2HPO
4, 50mmol/L NaH
2PO
4, 50mmol/LNaCl) with the flow velocity elution samples of 0.5mL/min; Adopt 15%SDS-PAGE to analyze the sample purity of each eluting peak correspondence, (see figure 5) has obtained the rhIL-22 albumen of purification as a result;
(4) the rhIL-22 albumen of the renaturation of rhIL-22 gained purification in (3) adds renaturation buffer (50mmol/L Na
2HPO
4, 50mmol/L NaH
2PO
4, 0.1mmol/L GSSG, 1mmol/LGSH, 0.1%PEG), the control protein concentration is at 0.15mg/ml, places 50 hours down and progressively reduces urea concentration in conjunction with dialysis for 4 ℃, slowly concentrates with PEG6000 at last and obtains rhIL-22 protein.
HIL22 is to the short proliferation activity test of LO2 cell
It is good to cell to growth conditions to cultivate the LO2 cell with the RPMI1640 culture fluid that contains 10% hyclone (purchasing the company in Gibco BRL), and collecting cell is with 1 * 10
5Individual cell/mL is inoculated in the 96 porocyte culture plates, 50 μ l/ holes; Add the hIL-22 albumen of 50 μ l then respectively by doubling dilution embodiment 1 gained in every hole, final concentration is respectively 0.1,1,2.5,10,50,100,1000,2000,4000 and 8000ng/ml, establish acellular blank simultaneously and cell is arranged but do not add the negative control of the factor, each concentration is done three repetitions; At 37 ℃, 5%CO
2After cultivating 72h in the incubator, every hole adds the MTT 20 μ l of 5mg/ml; Continue to cultivate 5h, every then hole adds 100 μ l 10%SDS (being dissolved among the 0.01N HCl), treat purple first the part between the ribs and the hips crystallization dissolving after, measure the light absorption value of 570nm.
The hIL-22 concentration that adopts the Bradford method to record after renaturation also concentrates is 1mg/mL, uses the promotion that mtt assay detects the proliferation activity of recombiant protein confrontation LO2 cell.(see figure 7) is compared with negative control as a result, and behind the adding recombinant protein hIL-22, the propagation of LO2 cell has significant change; Along with the increase of recombinant protein concentration, the proliferation activity of the short LO2 cell of hIL-22 is obviously strengthened, when 1 μ g/mL, the proliferation activity of the short LO2 cell of recombinant protein hIL-22 is the highest, activity begins to descend afterwards, and to 4 μ g/mL, platform effect appears in the propagation of LO2 cell.Institute's measured value is carried out statistical test, and the result shows that the recombinant protein of experimental group variable concentrations stimulates that light absorption value and the negative control of 570nm has significant difference (P＜0.01) behind the LO2 cell, illustrates that hIL-22 has promoted the proliferation activity of LO2 cell.
HIL22 is to the influence test of LO2 cell c-myc expression
The LO2 cell is cultivated 2h in the 60mm culture dish, grouping adds prepared recombinant il-2 2 protein solutions of embodiment 1 of variable concentrations successively then, makes that various proteic final concentrations are respectively 20,200,400,800ng/mL, at 37 ℃, 5%CO
2Cultivate 2h, also quantitatively carry out RT-PCR behind the extraction RNA.(see figure 8) shows that c-myc expression of gene level raises gradually from 20～800ng/mL after external source hIL-22 stimulates as a result, is dependence with the concentration of hIL-22, illustrates that hIL22 can improve the expression of LO2 cell c-myc.
HIL-22 is to the influence test of LO2 cell bcl-2 expression
Behind the hIL-22 recombinant protein solution effects LO2 cell with embodiment 1 gained of variable concentrations, make various proteic final concentrations be respectively 20,200,400,800ng/mL, also quantitatively carry out reverse transcription after extracting RNA, carry out PCR with special bcl-2 primer, amplified production is identified through 1% agarose gel electrophoresis, as seen bcl-2 conforms to 445bp with the 435bp of expection respectively substantially with the special purpose band size of hGAPDH, after external source hIL-22 stimulates, the result shows that (see figure 9) bcl-2 expression of gene level raises gradually from 20～800ng/mL, be dependence with the concentration of hIL-22, illustrate that hIL-22 has promoted LO2 cell bcl-2 to express.
HIL22 is to the action effect test of alcoholic liver disease
(1) sets up 60 of the male Wistar rats (purchasing Experimental Animal Center) that the alcoholic liver disease model is chosen 200～250g in Military Medical Science Institute, 10 of normal group, 50 of model group, model group is fed with high lipid food, irritate simultaneously with 56 ° of Red Star strong, colourless liquor distilled from sorghum (purchasing in Hongxing Co., Ltd. Beijing), dosage is:
1～4 all 16ml/kg.d, every day, twice filling given
5～8 all 24ml/kg.d, every day, twice filling given
9～12 all 32ml/kg.d, every day, twice filling given
High lipid food consists of the normal feedstuff+big oil of 10% pig+5% Semen Maydis oil+1% cholesterol; Normal group is fed with the full nutrition pellet, irritate simultaneously with the isodose normal saline of model group;
Be experimental group with model components during (2) 12 weekends, the experiment contrast group, continue to feed with high fat diet, experimental group is by tail vein injection hIL22 recombiant protein, dosage is 0.25ug/g.d, continuous injection 14 days, the experiment contrast group is by the normal saline of tail vein injection same dose, 5% pentobarbital sodium solution anesthesia after 14 days, postcava blood extracting assay index of correlation is separated liver, weighs, calculate the variation of liver index (liver quality/body weight), get hepatic tissue, 10% formaldehyde fixed, paraffin section, HE dyeing, its pathology integration is estimated, and result's (seeing Table 1) shows the obviously rising of transaminase lowering of IL22, effectively the pathological change of alleviation of alcohol hepatopathy.
HIL22 is to the action effect test of non-alcohol fatty liver
(1) the SD rat that will just wean of the foundation of non-alcohol fatty liver model 30 (purchasing the Experimental Animal Center in Military Medical Science Institute) is divided into blank group, the experiment contrast group, experimental group, blank group is fed with the full nutrition pellet, experimental group and matched group are fed with high lipid food, the constituent of high lipid food is the 70% normal feedstuff+big oil of 20% pig+2% cholesterol+1% bile salts+7% yolk powder, and the modeling cycle was 12 weeks;
During (2) 12 weekends, experimental group and blank group thereof are fed with high lipid food, the reorganization of experimental group injection simultaneously hIL22 albumen (0.25ug/g.d), matched group is annotated the normal saline with same dose; Treatment cycle is 14 days, and the pentobarbital sodium solution with 5% after 4 days is anaesthetized postcava blood extracting assay index of correlation, separate liver, weigh, calculate the variation of liver index (liver quality/body weight), get hepatic tissue, 10% formaldehyde fixed, paraffin section, HE dyeing, its pathology integration is estimated, and the result (sees Table 2, shows that Figure 10) hIL22 can obviously reduce the rising of serum zymetology and blood fat, improve liver function, alleviate the pathology integration of non-alcohol fatty liver.
Table 1:hIL22 is to the therapeutic effect of alcoholic liver disease
| The example number | Body weight (g) | The liver index | ALT(U/L) | AST(U/L) | r-GT(U/L) | TC(mg/g) | TG(mg/g) | |
| |
8 | 334.4±25.2 | 2.5±0.12 | 44.8±4.3 | 71.4±10.8 | 21.5±5.8 | 61.3±6.3 | 34.5±2.2 |
| |
8 | 263.8±67.4 | 4.4±0.7 | 93.9±6.9 | 79.1±6.5 | 81.4±11.3 | 77.5±5.7 | 93.9±6.9 |
| The |
8 | 288.1±39.7 | 3.8±0.2 | 72.3±7.7 | 69.0±6.1 | 63.4±8.7 | 68.7±6.3 | 72.3±7.7 |
Table 2:hIL22 is to the therapeutic effect of non-alcohol fatty liver
| The example number | Body weight (g) | The liver index | ALT(U/L) | AST(U/L) | MDA(ug/g) | TG(mg/g) | TC(mg/g) | |
| |
8 | 334.4±25.2 | 2.5±0.1 | 51.7±7.9 | 80.3±13.5 | 5.6±0.32 | 53.2±6.3 | 55.2±4.7 |
| |
8 | 560.8±20.7 | 5.4±0.3 | 132.8±22.5 | 156.7±22.5 | 8.9±0.31 | 163.2±33.4 | 89.4±6.3 |
| The |
8 | 5 10.2±25.3 | 5.0±0.5 | 98.7±15.6 | 124.3±15.2 | 6.7±0.24 | 115.9±18.4 | 68.7±6.3 |
Claims (9)
1. the application of interleukin-22 in preparation treatment liver disease drug;
2. according to the described application of claim 1, it is characterized in that described interleukin-22 is meant a kind of of human interleukin-2 2, recombination human interleukin-22, Mus interleukin-22 or reorganization Mus interleukin-22 etc.
3. according to claim 1 or 2 described application, it is characterized in that described hepatopathy is meant a kind of of hepatopathy such as depletion after alcoholic liver disease, non-alcohol fatty liver, viral hepatitis, acute hepatic failure, hepatic fibrosis, hepatic ischemia-reperfusion injury, the liver transplantation.
4. according to the described application of claim 3, it is characterized in that described hepatopathy is meant alcoholic liver disease or non-alcohol fatty liver.
5. according to the described application of claim 4, it is characterized in that described hepatopathy is meant alcoholic liver disease.
6. according to the described application of claim 5, it is characterized in that described hepatopathy is meant non-alcohol fatty liver.
7. the proteic preparation method of claim 2 described recombination human interleukin-22 comprises the steps:
(1) utilizes the fresh peripheral blood of people, cultivate human peripheral lymphocyte, extract total RNA;
(2) being template with total RNA, is that primer carries out the RT-PCR amplification with f1 and r1, gets the cDNA sequence of hIL22; The sequence of described primer f1 and r1 is as follows:
f1：5′GAGAATTCATATGGCACCCATCAGCTCCCA3′；
r1：5′ACGGATCCTCAAATGCAGGCATTTCT 3′
And then be template with the cDNA of gained, be that primer carries out pcr amplification with f1 and r1, the DNA sequence of hIL22;
(3) with EcoRI and BamHI respectively with DNA sequence and the plasmid pBV220 enzyme action of step (2) gained hIL22; Then both are mixed, both are connected, will connect the product electricity consumption then and transform or CaCl with the T4 ligase
2The conversion method transformed host cell, Screening and Identification gets recombiant plasmid pBV220/hIL22;
(4) electricity consumption transforms or CaCl
2Method is with recombiant plasmid pBV220/hIL22 transformed host cell; Be inoculated on the LB culture medium and cultivate, centrifugal then, resuspended precipitate utilizes the ultrasonic disruption thalline, then with the degeneration of gained inclusion body, dissolving, purification, renaturation, concentrated, promptly gets recombination human interleukin 22 albumen of the present invention.
8. in accordance with the method for claim 7, it is characterized in that its detailed operating procedure is:
(1) with the fresh peripheral blood of people with 2 times of the PBS solution dilutions that contains 2mmol/L EDTA, be laid on then on the equal-volume lymphocyte separation medium; Centrifugal under 700～1000rpm again, use the greyish white confluent monolayer cells of glass capillary sucking-off then, wash greyish white confluent monolayer cells 2～3 times with Hanks liquid, more greyish white confluent monolayer cells is suspended in 1640 and cultivates in the base, and at 37 ℃, 5%CO
2Cultivate 24hr in the incubator, then add ConA and anti-CD
3Be total to irritation cell, again at 37 ℃, 5%CO
2Continue in the incubator to cultivate 24h, extract total RNA with the total RNA extraction reagent box;
(2) being template with total RNA, is primer with f1 and r1
f1：5′GAGAATTCATATGGCACCCATCAGCTCCCA3′
r1：5′ACGGATCCTCAAATGCAGGCATTTCT 3′
Carry out RT-PCR amplification and obtain the cDNA sequence of human interleukin-2 2;
The each several part ratio of described RT-PCR reaction system is: total RNA, 5ul; The RNase inhibitor; 0.5ul; Oligo (dT), 0.5ul; The DEPC treating water, 6.5ul; Amount to 1 2ul; 70 ℃ 5min to 4 ℃; RT: add in above-mentioned system: 5 * buffer 4ul, 2.5mMdNTP 2ul, AMV 1ul, RNase inhibitor 1ul, 42 ℃ of 1h, 85 ℃ 5min to 4 ℃;
The first chain cDNA that produces with reverse transcription is a template then, with f1, r1 is that primer carries out the PCR reaction, the each several part ratio of described PCR reaction system is: 10PCR reaction * buffer 2.0ul, 2.0mmol/LdNTP 2.0ul, 5pmol/ul f1 2.0ul, 5pmol/ul r1 2.0ul, reverse transcription product 4.0ul, TaqDNA polymerase 0.5ul, ddH
2O 7.5ul, 20ul altogether; Described PCR reaction condition is 94 ℃ of pre-degeneration 3min, 94 ℃ of 30S, 50 ℃ of 30S, 72 ℃ of 30S, 30 circulations; 72 ℃ are extended 7min; Agarose gel with 1.2% separates the PCR product;
(3) add restricted enzyme EcoRI and BamHI to RT-PCR product and plasmid pBV220 respectively, enzyme action 3.5h in 37 ℃ of water-baths presses 10～4: 1 mixed with both then, adds the T4 ligase, carry out coupled reaction 12h, conversion of utilization electricity or CaCl in 16 ℃
2Method will connect the product transformed host cell, utilize amicillin resistance screening recombinant clone, and extract phase answers plasmid, enzyme action to identify, check order, and gets recombiant plasmid pBV220/hIL22;
(4) electricity consumption transforms or CaCl
2Method is transformed into recombiant plasmid pBV220/hIL22 in the host cell; Transform bacterium colony and spend the night for 30 ℃, be inoculated in LB culture medium according to 1～2% percent by volume next day, cultivates 2～3hr at 30 ℃, places then under 42 ℃ of shaking baths, the 180～220rpm condition and cultivate 4～8hr; Again at 4 ℃, 10,000～12, centrifugal 10～15min under the 000rpm condition, remove supernatant, ratio according to mass volume ratio 1: 8～10 is resuspended in precipitation in the PB solution, again with the ultrasonic disruption thalline, the inclusion body washing that obtains after with ultrasonic Treatment with 2mol/L carbamide 2～4 times, inclusion body is joined in the 8mol/L carbamide then, getting dissolved inclusion body solution, is column packing with Sephacryl-200 (S-200), and the dissolving supernatant is carried out gel permeation chromatography, again the gained purification of samples is placed 4 ℃ of renaturation buffers to carry out renaturation reaction 72hr, slowly concentrate with PEG 6000 at last and obtain human interleukin-2 2 albumen.
9. according to claim 7 or 8 described methods, it is characterized in that described host cell is E.coliDH5 α, HB101 or JM109.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101762197A CN101168049A (en) | 2007-10-23 | 2007-10-23 | Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101762197A CN101168049A (en) | 2007-10-23 | 2007-10-23 | Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101168049A true CN101168049A (en) | 2008-04-30 |
Family
ID=39388901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101762197A Pending CN101168049A (en) | 2007-10-23 | 2007-10-23 | Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101168049A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101318013A (en) * | 2008-07-17 | 2008-12-10 | 四川大学 | Uses of IL-4 in preparing medicament composition for treating chronic hepatic fibrosis |
| EP2185202A1 (en) * | 2007-08-06 | 2010-05-19 | Generon (Shanghai) Corp. | Use of interleukin-22 in the treatment of fatty liver disease |
| CN102348463A (en) * | 2009-01-12 | 2012-02-08 | 健能隆医药技术（上海）有限公司 | Prevention and/or treatment of multiple organ dysfunction syndrome with interleukin-22 |
| WO2012028089A1 (en) * | 2010-08-31 | 2012-03-08 | 健能隆医药技术（上海）有限公司 | Use of interleukin-22 in treating viral hepatitis |
| US9352024B2 (en) | 2011-12-27 | 2016-05-31 | Generon (Shanghai) Corporation Ltd. | Uses of interleukin-22(IL-22) in treating and preventing nerve damage diseases or neurodegenerative diseases |
| WO2019046697A1 (en) * | 2017-08-31 | 2019-03-07 | The Regents Of The University Of California | Compositions and methods for treating alcoholic liver disease, alcohol-induced brain injury and reducing alcohol addiction |
| US10543169B2 (en) | 2013-11-07 | 2020-01-28 | Generon (Shanghai) Corporation Ltd. | Use of IL-22 dimer in manufacture of a medicament for intravenous administration |
| US11510966B2 (en) | 2016-04-15 | 2022-11-29 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 in treating necrotizing enterocolitis |
-
2007
- 2007-10-23 CN CNA2007101762197A patent/CN101168049A/en active Pending
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2185202A1 (en) * | 2007-08-06 | 2010-05-19 | Generon (Shanghai) Corp. | Use of interleukin-22 in the treatment of fatty liver disease |
| US10786551B2 (en) * | 2007-08-06 | 2020-09-29 | Generon (Shanghai) Corporation Ltd. | Use of interleukin-22 in the treatment of fatty liver disease |
| US20180028614A1 (en) * | 2007-08-06 | 2018-02-01 | Generon (Shanghai) Corporation Ltd. | Use of interleukin-22 in the treatment of fatty liver disease |
| EP2185202A4 (en) * | 2007-08-06 | 2013-11-06 | Generon Shanghai Corp | Use of interleukin-22 in the treatment of fatty liver disease |
| CN101318013A (en) * | 2008-07-17 | 2008-12-10 | 四川大学 | Uses of IL-4 in preparing medicament composition for treating chronic hepatic fibrosis |
| CN101318013B (en) * | 2008-07-17 | 2013-04-10 | 四川大学 | Uses of IL-4 in preparing medicament composition for treating chronic hepatic fibrosis |
| CN102348463A (en) * | 2009-01-12 | 2012-02-08 | 健能隆医药技术（上海）有限公司 | Prevention and/or treatment of multiple organ dysfunction syndrome with interleukin-22 |
| AU2011298556B2 (en) * | 2010-08-31 | 2015-04-16 | Evive Biotechnology (Shanghai) Ltd | Use of interleukin-22 in treating viral hepatitis |
| WO2012028089A1 (en) * | 2010-08-31 | 2012-03-08 | 健能隆医药技术（上海）有限公司 | Use of interleukin-22 in treating viral hepatitis |
| CN104479026A (en) * | 2010-08-31 | 2015-04-01 | 健能隆医药技术（上海）有限公司 | Application of interleukin-22 to treat viral hepatitis |
| CN103118699B (en) * | 2010-08-31 | 2014-11-19 | 健能隆医药技术（上海）有限公司 | Use of interleukin-22 in treating viral hepatitis |
| US8945528B2 (en) | 2010-08-31 | 2015-02-03 | Generon (Shanghai) Corporation Ltd. | Use of interleukin-22 in treating viral hepatitis |
| US9629898B2 (en) | 2010-08-31 | 2017-04-25 | Generon (Shanghai) Corporation, Ltd. | Use of interleukin-22 in treating viral hepatitis |
| CN103118699A (en) * | 2010-08-31 | 2013-05-22 | 健能隆医药技术（上海）有限公司 | Use of interleukin-22 in treating viral hepatitis |
| EP3332798A1 (en) * | 2010-08-31 | 2018-06-13 | Generon (Shanghai) Corporation Ltd. | Use of interleukin-22 in treating viral hepatitis |
| CN104479026B (en) * | 2010-08-31 | 2019-02-12 | 健能隆医药技术（上海）有限公司 | Application of the interleukin-22 in treatment virus hepatitis |
| US9352024B2 (en) | 2011-12-27 | 2016-05-31 | Generon (Shanghai) Corporation Ltd. | Uses of interleukin-22(IL-22) in treating and preventing nerve damage diseases or neurodegenerative diseases |
| US10543169B2 (en) | 2013-11-07 | 2020-01-28 | Generon (Shanghai) Corporation Ltd. | Use of IL-22 dimer in manufacture of a medicament for intravenous administration |
| US11654104B2 (en) | 2013-11-07 | 2023-05-23 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 dimer in manufacture of a medicament for intravenous administration |
| US11510966B2 (en) | 2016-04-15 | 2022-11-29 | Evive Biotechnology (Shanghai) Ltd | Use of IL-22 in treating necrotizing enterocolitis |
| WO2019046697A1 (en) * | 2017-08-31 | 2019-03-07 | The Regents Of The University Of California | Compositions and methods for treating alcoholic liver disease, alcohol-induced brain injury and reducing alcohol addiction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101168049A (en) | Application of interleukin-22 in preparing medicine for treating hepatopathy and preparation method thereof | |
| CN103288973B (en) | Banlangen Polysaccharide, Preparation Method And The Use | |
| CN102212539A (en) | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof | |
| CN101036784B (en) | Toxicity T cell position vaccine of the cell for treating Hepatitis B and the preparing method | |
| CN102286490A (en) | Preparation and renaturation method of chicken interferon gamma | |
| CN103232545B (en) | A kind of Recombinant Swine Interferon α1-Fc fusion rotein and encoding gene thereof and expression method | |
| CN104352539B (en) | The extracting method of achyranthes aspera extract | |
| CN101797381B (en) | Compound of hepatitis B virus antigen and lewis oligosaccharide and preparation method and application thereof | |
| CN101280001A (en) | Preparation of human SDF-1 alpha, human SDF-1 alpha obtained therefrom and use thereof | |
| CN103830722A (en) | Clostridium perfringens beta toxin genetic engineering vaccine and application thereof | |
| CN102716481A (en) | Immunoadjuvant of oral vaccine for tilapia and use thereof | |
| CN100408686C (en) | Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium | |
| CN103861094A (en) | Clostridium perfringen alpha toxin genetic engineering vaccine and application thereof | |
| CN110028570A (en) | A kind of expression of muscle element and its application in metabolic disease | |
| CN102199217B (en) | Hepatitis B virus multi-epitope fusion protein and preparation method and application thereof | |
| CN103830747A (en) | Genetically engineered vaccine of epsilon toxin of clostridium perfringens and application thereof | |
| CN104593401B (en) | A kind of method of the albumen of application pCold vector expressions solubility angiostrongylus cantonensis galectin 1 | |
| CN103509815A (en) | Preparation method of recombinant panda IL-2 immune adjuvant | |
| CN105194668A (en) | Method for preparing conjugate of gp96 protein and PD1 antibody, and application of conjugate | |
| CN101884793A (en) | Immune enhanced gene vaccine of hepatitis B virus core antigen and preparation method thereof | |
| CN102199608B (en) | Efficient expression of pinellia ternate agglutinin (PTA) in bombyx mori reactor | |
| CN112426523A (en) | Pig vaccine containing antiviral composition and application | |
| CN104561022B (en) | Construction of domestic porcine tumor necrosis factor mutant and protein expression purification method | |
| CN104372025A (en) | Preparation method and application of human heat shock protein gp96 | |
| CN104098666B (en) | A kind of antibacterial peptide and its application in anti-infectives, antitumor drug, immunopotentiating agent and feed additive is prepared |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20080430 |