CN101134966A - Modified nucleic acid sequences and method to increasing mrna levels and protein expression in cell systems - Google Patents
Modified nucleic acid sequences and method to increasing mrna levels and protein expression in cell systems Download PDFInfo
- Publication number
- CN101134966A CN101134966A CNA2007101049335A CN200710104933A CN101134966A CN 101134966 A CN101134966 A CN 101134966A CN A2007101049335 A CNA2007101049335 A CN A2007101049335A CN 200710104933 A CN200710104933 A CN 200710104933A CN 101134966 A CN101134966 A CN 101134966A
- Authority
- CN
- China
- Prior art keywords
- codon
- nucleic acid
- modification
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred ''difficult'' protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.
Description
The application be that October 20, application number in 1998 are 98810400.8 the applying date, denomination of invention divides an application for the application for a patent for invention of " nucleotide sequence of modification and the method that increases mRNA level and protein expression in the cell system ".
Background of the present invention
Invention field
The present invention relates to allogeneic gene expression.More specifically, the present invention relates in more high eukaryotic cell system, express the gene of microorganism or Parasites.
Relevant prior art summary
The recombinant production of carrying out certain heterologous gene products in cell in vitro culture systems or body in the recombinant production system is difficulty normally.For example, many researchists find, the protein from bacterium, Parasites and virus beyond expression of words in the cell culture system, particularly mammalian cell culture system different with the cell of protein primary source.In the medical treatment that is difficult to produce by mammalian cell an example of key protein be plasmodium merozoite surface protein (malaria merozoite surface protein) (MSP-1).
Malaria is serious health problem in tropic countries.Resistance to existing medicine develops rapidly, thereby is badly in need of vaccine.In the multiple antigen of expressing in plasmodium falciparum (P.falciparum) growth cycle, MSP-1 is that to study the most deep and it seems be the most successful inoculation material standed for.The individuality that is exposed to plasmodium falciparum produces anti-MSP-1 antibody, and studies show that between the malaria morbidity rate of the acquiredim munity of MSP-1 being reacted and lowering has dependency.In a series of researchs, can be induced to the protection (Diggs etc., (1993) Parasitol Today9:300-302) of small part to this Parasites with natural MSP-1 or this proteic recombinant fragment immunity of purifying.Therefore MSP-1 is the important target of exploitation anti-plasmodium falciparum vaccine.
MSP-1 is the glycoprotein of a kind of 190-220kDA.The C-stub area has been the focus that can be used as the recombinant products of vaccine.Yet, exploitation MSP-1 is to be difficult to obtain to have the recombinant protein (Chang etc., (1992) Journal of Immunology (J.Immunol.) 148:548-555) of equal immunology ability and the recombinant protein that makes the feasible q.s of production of vaccine with the natural protein of affinity purification on bacterium or yeast expression system as a subject matter of vaccine.
Improved method is favourable, and it is difficult to the expression of recombinant expressed proteinic q.s from Parasites, bacterium and virus before can strengthening.Particularly, a kind of recombination system that can express q.s MSP-1 is particularly advantageous.
General introduction of the present invention
The invention provides the method for improved recombinant DNA composition and proteinic mRNA level of increase and protein expression, the protein here is from the allos cell, preferably such as unicellular lower eukaryotes such as bacterium, virus and Parasitess, and former protein beyond expression of words in cell culture system, mammalian cell culture system or transgenic animal.Being suitable for according to the optimization protein material standed for that expression system of the present invention is expressed is that those have relative recombinant expression system and the protein of the dna encoding sequence of total AT amount of Yan Hangao or rich AT zone and/or unstable motif of mRNA and/or rare codon.
First aspect, feature of the present invention is a kind of known nucleic acid of modification, the gene that preferably can in a kind of system, express from bacterium, virus or Parasites, modification wherein comprises that relative unmodified sequence has the AT content of reduction, and eliminate the unstable motif of mRNA at least a or that all exist optional further comprising in natural gene.In particular preferred embodiment, modify the one or more codons that further comprise with the preferred codon displacement natural gene of cell system.
Second aspect, the invention provides the method for nucleic acid of preparation modification of the present invention, comprise total AT content of the natural gene that reduces coded protein and/or eliminate in the unstable motif of mRNA at least one or all and/or use the preferred codon of the cell system of selecting replace one or more codons (all adopt the cell system of selecting clone identification, that be preferably selection preferably and the coding amino acid whose codon identical with institute metathetical codon replace one or more codons in the natural gene).Of the present invention this further comprises the nucleic acid of the modification for preparing according to the inventive method on the one hand.
The 3rd aspect, the present invention also provide contain nucleic acid of the present invention and in clone of selecting or organism the carrier of promoters active, and with nucleic acid transformed host cells of the present invention.
The 4th aspect the invention provides, the transgene expression vector that contains nucleic acid of the present invention that is used for production transgenosis lactation animal (lactat inganimal) with and plant the transgenic nonhuman lactation animal that nucleic acid of the present invention is contained in system.
The 5th aspect, the invention provides the transgene expression vector that is used to produce genetically modified lactation animal species, comprise nucleic acid of the present invention and operatively be coupled to and instruct mammary gland with the protein expression of this nucleic acid encoding promotor in the transgenic animal milk on this nucleic acid.
The 6th aspect the invention provides the dna vaccination that contains according to the nucleic acid of modification of the present invention.This preferred embodiment on the one hand of the present invention comprises the fragment according to the MSP-1 gene of modification of the present invention.
The description of the drawings
Fig. 1 described the cDNA sequence [sequence 1] of the MSP-142 that modifies according to the present invention, wherein replaced 306 Nucleotide to reduce AT content and to have eliminated the same protein aminoacid sequence that the unstable motif of mRNA keeps MSP-142 simultaneously.Capitalization is represented nucleotide subsitution.
Fig. 2 has described the nucleotide sequence [sequence 2] of coding " wild-type " or natural MSP-142 sequence.
Fig. 3 a is wild-type MSP-1
42(called after in table " MSP-1wt ") and the new MSP-1 that modifies
42The codon of gene (called after in table " editor's MSP ") and several milk protein gene (from the casein gene of goat and mouse) uses table.Numerical statement in each hurdle is shown in the actual frequency that specific cryptosystem occurs in each gene of listing.New MSP-1
42Synthetic gene is by at first selecting given amino acid whose rich GC codon to produce from the special codon usage of breast in conjunction with the amino acid that is chosen in the milk-protein the most normal use.
Fig. 3 b be more also each codon shown in Fig. 3 a at wild-type MSP-1
42(called after in table " MSP-1wt ") and the new MSP-1 that modifies
42The codon usage table of the occurrence number in the gene (called after in table " editor's MSP ").Table among Fig. 3 b also with each codon at wild-type MSP-1
42MSP-1 with new modification
42The frequency of occurrences in the gene and the frequency of occurrences of each codon in bacillus coli gene and people's gene compare.Thereby if expression system is a Bacillus coli cells, this table can be used for determining intestinal bacteria identification or preferred codon.
Fig. 4 a-c has described MSP-1 as be shown in the examples respectively
42Construct GTC479, GTC564 and GTC627.
Fig. 5 A hurdle is that Northern detects, and wherein construct GTC627 contains the new MSP-1 that modifies according to the present invention
42Gene, GTC479 are to contain natural MSP-1
42The construct of gene, and construct GTC469 is negative control DNA.
Fig. 5 B hurdle is that the Western of elution fraction behind the affinity purification detects.Numeral is the fraction of results.The result shows from the MSP-1 that modifies
42The fraction of synthetic gene construct GTC679 and MSP-1 polyclonal antibody reaction negative control GTC479 then do not react.
Fig. 6 has described the OT1[sequence 3 described in the embodiment], OT2[sequence 4], MSP-8[sequence 5], MSP2[sequence 6], MSP-1[sequence 7] nucleotide sequence.
Fig. 7 illustrates plasmid BC574.
Fig. 8 illustrates BC620.
Fig. 9 illustrates BC670.
Figure 10 illustrates the Westen trace of the MSP in the transgenosis milk.
Figure 11 illustrates the nucleotide sequence [sequence 8] of MSP42-2.
Figure 12 illustrates BC-718.
Figure 13 is shown in the Westen trace that BC718 expresses in the transgenosis milk.
Detailed description of the preferred embodiments
This patent and scientific literature cited herein have been set up the available knowledge of present technique field those of skill in the art.United States Patent (USP), the application of permission, disclosed foreign application and the document cited herein of promulgation are by the reference form and in the present invention.Any conflict that solves between these documents and the disclosure all is as the criterion with the present invention.
The invention provides the recombinant nucleic acid sequence (preferably DNA) of modification and the method that increases proteinic mRNA level and protein expression, the protein here is known or protein beyond expression of words in cell culture system, mammalian cell culture system or transgenic animal probably.Preferred " difficulty " protein material standed for that uses recombinant technology of the present invention to express is from preferably such as the cell-derived protein of allos of unicellular lower eukaryotes such as Parasites, bacterium and virus.The recombinant expression system that their dna encoding sequence is used relatively contains unstable motif of high total AT content or rich AT district and/or mRNA and/or rare codon.
First aspect, feature of the present invention is a kind of known nucleic acid of modification, the gene that preferably can in a kind of cell system, express from bacterium, virus or Parasites, modification wherein comprises that relative unmodified sequence has the AT content of reduction, and eliminate the unstable motif of mRNA at least a or that all exist optional further comprising in natural gene." cell system " comprises the tissue of cell culture system, tissue culture system, organ culture system and living animal.In specific preferred embodiment, modify the one or more codons that further comprise with the preferred codon displacement natural gene of cell system.In these features each all be by discernible with cell system and preferably its preference and with substituted one or more codons realizations in the natural gene by the codon of codon coding same amino acid in the metathetical natural gene.According to the present invention, this " silence " Nucleotide and codon displacement will be enough to reach reduction AT content and/or eliminate the unstable motif of mRNA and/or reduce the rare codon number and keep simultaneously and preferably improve cell system producing mRNA and the purpose of expressing the desirable proteins ability.
The present invention also comprise those under suitable stringent condition with modification of nucleic acids sequence-specific homologous sequence of the present invention, get rid of improved nucleic acid especially from its deutero-known nucleic acid.If homology is enough to make the accurate complementary sequence hybridization of a sequence and another sequence, then this sequence and another sequence " specificity " homology.If in vivo or under the condition of ionic strength near physiological condition, for example 140mM NaCl, 5mM MgCl
2Condition under can hybridize and form Waston-Crick or Hoogsteen base pair, then a sequence and another sequence " specific hybrid ".Preferably, under stringent condition, for example under 68 ℃ of 0.2X SSC conditions, keep this specific hybrid.
In preferred embodiments, nucleic acid of the present invention can (be identical cell type with natural gene in mammalian cell cultivation or transgenic animal under the same conditions, identical culture condition, identical expression vector) in cell in vitro culture systems or transgenic animal at least 25% of expression amount, preferably 50%, preferredly be at least 100% or higher horizontal expression protein.
The term of Shi Yonging " expression " is meant and causes the mRNA of protein expression to transcribe herein.Can express by a series of technical measurements known in the art, comprise the antibody that use is special to target protein." natural gene " or " nature gene " is meant gene order or its fragment (allelic variation that comprises natural appearance) in the nucleic acid source that encoding wild type is proteinic and conduct is modified." preference (preferably) codon " is meant the codon that the cell system of selection more generally uses.Be not that all codons described here change all be to become preference codon, only need a metathetical codon can be discerned by cell system at least.The term of Shi Yonging " the AT content of minimizing " is meant because the Nucleotide of the cell system identification of use selecting under the prerequisite of the aminoacid sequence that does not change target protein or codon displacement contain the nucleotide site of A or T or contain A and/or the codon of T and have the total percentage of the lower Nucleotide that contains A (VITAMIN B4) or T (thymus pyrimidine) base than natural gene herein." allogenic " of Shi Yonging is meant from the genetic material not of the same race with the kind of its importing herein, perhaps the protein that produces from this genetic material.
Particularly preferred cell system of the present invention comprises the mammal cell line system such as COS cell and Chinese hamster ovary celI, and the breast tissue of transgenic animal, particularly transgenic animal.Yet the present invention has also considered bacterium, yeast, intestinal bacteria and such as virus expression systems even the botanical system of baculovirus.
Second aspect, the invention provides the method for the nucleic acid that preparation modifies, comprise total AT content of the natural gene that reduces coded protein and/or eliminate at least one or all unstable motifs of mRNA and/or use the preference codon of the cell system of selecting to replace one or more codons (all adopting the same amino acid whose codon of that discern, that be preferably preference and the coding of the cell system of selecting and institute's metathetical codon to replace one or more codons in the natural gene).Describe the canonical reference school bag of the General Principle of recombinant DNA technology and draw together Watson, J.D. etc., the molecular biology of gene (Molecular Biology ofthe Gene) volume I and volume II, the Benjamin/Cummings Publishing Company, Inc.publisher, Menlo Park, CA (1987) Darnell, J.E. etc., molecular cytobiology (MolecularCell Biology), Scientific Ameri can Books, Inc., Publisher, NewYork, NY (1986); Old, R.W. etc., Principles of gene manipulation: genetically engineered cross the threshold (Principle of Gene Manipulation:An Introduc tion to Gen e ticEngineering), second edition, University of California Press, publisher, Berkeley CA (1981); Maniatis, T. etc., molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual), second edition, cold spring harbor laboratory (Cold Spring Harbor Laboratory), publisher, cold spring port (Cold SpringHarbor), NY (1989) and molecular biology generalized flowsheet (Curren tProtocols inMolecular Biology), Ausubel etc., Wiley Press, New York, NY (1992).Of the present invention this further comprises the nucleic acid of the modification for preparing according to the inventive method on the one hand.
Be not limited to any principle, one section conservative AU sequence (AUUUA) mediation selectivity mRNA degraded (Shaw, G. and Kamen, R. cell (Cell) 46:659-667) of the former 3 ' non-translational region that studies show that GM-CSF mRNA.The focus in past is the existence of these unstable motifs of gene non-translational region.The present invention is first benefit of recognizing the unstable sequence of eliminating gene coding region.
The 3rd aspect, the present invention also provide contain nucleic acid of the present invention and in clone of selecting or organism the carrier of promoters active, and with nucleic acid transformed host cells of the present invention.Preferred carrier contains a replication orgin, thereby reproducible in one or more cell types.Some preferred carrier is an expression vector, further has at least one promotor and passive terminator, thereby recombinant expressed element can be transcribed in bacterium, fungi, plant, insect or mammalian cell.
The 4th aspect, the invention provides the transgene expression vector that contains nucleic acid of the present invention that is used to produce transgenosis lactation animal with and plant the transgenic nonhuman lactation animal that nucleic acid of the present invention is contained in system.This transgene expression vector contains can make it come expression promoter as a host transgenic animal genome part.The General Principle of generation transgenic animal known in the art.Referring to for example Hogan et al., mice embryonic operation: laboratory manual (Manipulatingthe Mouse Embryo:A LaboratoryManual), cold spring harbor laboratory (Cold SpringHarbor Laboratory), (1986); Simons et al, Bio/Technology6:179-183, (1988); Wall et al., Biol.Reprod.32:645-651, (1985); Buhler et al., Bio/Technology8:140-143 (1990); Ebert et al., Bio/Technology9:835-838 (1991); Krimenfortetal., Bio/Technology9:844-847 (1991); Wall et al., cellular biochemistry magazine (J.Cell.Biochem.) 49:113-120 (1992).The technology that exogenous DNA array is imported Mammals and sexual cell thereof is developed in mouse at first.Referring to for example, Gordon et al., periodical (Proc.Natl.Acad.Sci.USA) 77:7380-7384 of institute of NAS, (1980); Gordon and Ruddle science (Science) 214:1244-1246 (1981); Palmiter and Brinster, cell (Cell) 41:343-345,1985; Brinster et al., periodical (Proc.Natl.Acad.Sci.USA) 82:4438-4442 (1985) the and Hogan et al. (source is as above) of institute of NAS.Subsequently these technological improvements are comprised ox and sheep for being used for macrofauna.As of late, the method that produces the widespread use of transgenic mice or domestic animal is a pronucleus that interested up to a hundred linear DNA molecules is expelled to zygote with the form of transgene expression construct.The tenuigenin that DNA is expelled to zygote also is widely used.Recently, the clone that can be expelled to the complete transgenic cell line of unfertilized egg succeed (KHS Campbell et al., the nature (Nature) 380 64-66, (1996)).
The 5th aspect, the invention provides and contain nucleic acid of the present invention and can operating and be coupled to and instruct the transgene expression vector of mammary gland on the nucleic acid, be used to produce transgenosis animal species lactation period the protein expression of the nucleic acid encoding promotor in the transgenic animal milk.The mammary gland expression system has high expression level, low cost, the correct advantage of processing and accessibility.Several researchists have produced known protein matter in the lactation transgenic animal, such as ox and human alpha-lactalbumin.(Wright et al., Bio/technology9:830; 834 (1991); Vilotte et al, european journal of biological chemistry (Eur.J.Biochem.), 186:43-48 (1989); Kochiet al., Mol Reprod.And Devel.33:160-164 (1992); Soulier et al., FEBS Letters297 (1,2): 13-18 (1992)), and this system's demonstration can produce high-caliber protein.
Preferred promotor is activated in breast tissue.Useful especially is in the gene found in such as breast tissue of gene at coding milk specific protein specific activity to be arranged, and promptly the activity in mammary tissue is better than promotor in other tissue under the physiological condition of synthesise lactic.Not only special but also promotor efficiently most preferably to breast tissue.Preferably casein, whey-protein, lactoglobulin (lactalglobulin) promotor in this class promotor, include but not limited to α-, β-and gamma-casein promotor and alpha-lactalbumin and beta-lactoglobulin promotor.Preferred promotor is from rodent, goat and ox.Other promotor comprises the promotor of adjusting whey acidic protein matter (WAP) gene etc.
A preferred embodiment of the present invention provides can be at cell culture system, mammalian cell culture system or the coding MSP-1 that expresses in transgenic animal milk or its segmental modification of nucleic acids.Modified the nucleotide sequence of the natural MSP-1 gene of encoding according to the present invention.At first by use the coding same amino acid but compare with natural MSP-1 gene or gene fragment the selection of AT content in the nucleic acid that is enough to reduce modification cell system identification and preferably the codon in the codon displacement natural gene of its preference reduce total AT content.Secondly by use the coding same amino acid but be enough to eliminate the unstable motif of mRNA selection cell system identification and preferably the codon in the codon displacement natural gene of its preference eliminated the unstable motif (AUUUA of mRNA in natural gene or the gene fragment, Shaw and Kamen, in front).Randomly, all preferred codon displacements of the expression system of available said selection of any other codon in the natural gene.
The 6th aspect the invention provides the dna vaccination that contains according to modification of nucleic acids of the present invention.In particular preferred embodiment, dna vaccination contains according to carrier of the present invention.Dna vaccination of the present invention may be according to modification of nucleic acids " naked " of the present invention or purifying, may or may not be operably connected with promotor.If nucleic acid and promotor ways of connecting are expressed nucleotide sequence, being nucleic acid and promotor can be operatively connected.This dna vaccination can not carry out encapsulated administration, or can be used as the part administration of liposome, or as virus genomic part administration.Usually enough to make expression of nucleic acid and to comprise that at the animal body of accepting dna vaccination the amount of human body induce antibody reaction uses this vaccine.But subsequently at least after the administration first time after the week rechallenge strengthen antibody response.Preferred route of administration comprises through mucous membrane and administered parenterally.
This preferred embodiment on the one hand of the present invention comprises the fragment according to the MSP-1 gene of modification of the present invention.This fragment preferably comprises about 5% to about 100% complete genome sequence and contains according to one or more modifications of the present invention.
Fig. 3 b illustrates the example of intestinal bacteria and people's codon use.Fig. 3 b has shown the codon usage frequency of gene and the comparing its codon usage frequency and intestinal bacteria and people's gene of MSP-l natural gene and foundation modification of the present invention.Present technique field those of skill in the art are easy to obtain and know codon usage frequency table such as multiple other expression systems such as yeast, baculovirus and mammlian systems.
The following examples have illustrated implements some optimal way of the present invention, but is not in order to limit the scope of the invention, because can use the alternate method to obtain similar result.
Embodiment
Make the MSP-142 gene of new modification
The nucleic acid of the new modification of coding MSP-1C-terminal fragment is provided in one embodiment.Fig. 1 has shown the coding MSP-1 that can express in mammalian cell of the present invention
42kD C-terminal portions (MSP-1
42) the nucleic acid of the new modification of the present invention.Natural MSP-1
42Gene (Fig. 2) can not be expressed in mammalian cell cultivation or transgenic mice.To natural MSP-1
42Its various features of the analysis revealed of gene and Mammals are had any different.At first, it has the total AT content up to 76%.Secondly, in the dna fragmentation (Fig. 2) of this 1100bp, the unstable motif AUUUA of mRNA occurs 10 times.For at these differences, designed new MSP-1
42Gene.To natural MSP-1
42306 sites of gene have been introduced reticent nucleotide subsitution total AT content have been reduced to 49.7%.The unstable motif of 10 AUUUA mRNA in the natural gene has been eliminated in the change of same codon usage.In order to change codon usage, use multiple mouse and goat breast specific protein to make breast tissue specificity codon and use chart 3a.This table is used to instruct the MSP-1 that modifies as mentioned above
42The codon usage of gene is selected.For example shown in the table among Fig. 3 a, in natural gene, 65% (25/38) leucine is encoded by TTA, and it is rare codon in mammary gland.The MSP-1 that is modifying
42In the gene, 100% leucine is encoded by CTG, and it is a leucic preferred codon in the mammary gland.
Use the MSP-1 that modifies
42The gene constructed expression carrier, it is by being fused to 26 amino acid of front end of goat beta-casein the MSP-1 of modification
42The N-of gene will be terminal and that will carry fusion gene, and SalI-Xho I fragment subclone carries out to the XhoI site of expression vector pCDNA3.The His6 mark is fused to MSP-1
423 ' end of gene makes the gene product can affinity purification.Prepared plasmid GTC627 (Fig. 4 c) like this.
For more natural MSP-1
42The MSP-1 that gene construct and the present invention modify
42Nucleic acid has also made up natural MSP-1
42Expression carrier also is added to this gene mammalian cell cultures and is expelled to and forms transgenic mice in the mouse, and is as described below:
Make up natural MSP-1
42Expression vector
For white-1 (MSP-1) of plasmodium falciparum merozoite surface proteins 4 and 5 that secretes brachymemma, MSP-142kD C-terminal portions (MSP-1 will encode
42) wild type gene be fused in preceding 15 or preceding 25 the amino acid whose dna sequence dnas of coding goat beta-casein.This is by at first using primer MSP1 and MSP2 (Fig. 6) pcr amplification MSP-1 plasmid (from Dr.David Kaslow, NIH), then the PCR product cloning to be obtained to TA carrier (Invitrogen).The BglI I-XhoI fragment of PCR product is connected with OT2 (Fig. 6) with oligomer OT1 enters expression vector pCDNA3.Produced plasmid GTC564 (Fig. 4 b) like this, preceding 11 amino acid of its 15 amino acid whose beta-casein signal peptide of coding and ripe goat beta-casein are natural MSP-142 gene subsequently.Use oligomer MSP-8 and MSP-2 (Fig. 6) by pcr amplification MSP-1 plasmid, then product cloning is arrived the TA carrier.The XhoI site of downcutting the XhoI fragment and being cloned into expression vector pCDNA3 produces plasmid GTC479, and (Fig. 4 a), its coding is fused to wild-type MSP-1
4215 amino acid whose goat beta-casein signal peptides of gene.GTC and in 564GTC479MSP-1
42Gene 3 ' end has added Histidine 6 (His6) mark.
In the COS-7 cell, do not express natural MSP-1
42Gene
By the transient transfection detection assay natural MSP expression of gene in the COS-7 cell of cultivating.Use lipofection amine reagent (Gibco-BRL) that GTC479 and GTC564 plasmid DNA are imported the COS-7 cell according to manufacturer's handbook.Transfection is two days later from the total cell RNA of COS cellular segregation.Transfection is passed through two days later will
35The new synthetic protein of metabolic marker is 10 hours in the S methionine(Met) adding culture.
For the MSP mRNA that measures in the COS cell expresses, use from GTC479's
32The P labeled dna fragment is surveyed the Northern trace.In GTC479 or GTC564 transfection body, do not measure MSP RNA (unpublished data).The exposure that prolongs discloses the MSPmRNA of the degraded that residual level is arranged.With cleer and peaceful lysate on the culture of the polyclonal antibody of anti-MSP precipitation 35S mark.Do not express in the lysate of immunoprecipitation experiment demonstration GTC479 or GTC564 transfectional cell or the supernatant by (unpublished data).These results show that natural MSP-1 does not express in the COS cell.
In transgenic mouse milk, there is not natural MSP-1
42Expression of gene
15 the amino acid whose goat beta-casein signal peptides of will encoding, preceding 11 amino acid and the natural MSP-1 of goat beta-casein
42The beta-casein XhoI site that the GTC479SalI-XhoI fragment cloning of gene is expressed in the carrier B C350.Produce plasmid BC574 (Fig. 7) like this.The SalI-NotI fragment of BC574 is expelled to mice embryonic generation transgenic mice.Set up the transgenic mice of 15 strain systems.Collect the milk of the female person of foundation mouse and use anti-MSP polyclonal antibody to carry out the Western detection.All do not find to express MSP-1 in 7 mouse milk that detect
42Protein.In order further to determine whether MSP-1 is arranged at mammary gland
42MRNA express, extract total RNA and carry out the Northern trace and detect from the 11st day lactation transgenic mice.Any one BC574 strain system of detecting does not all measure MSP-1
42MRNA.Thereby, MSP-1
42Transgenosis is not expressed in the mammary gland of transgenic mice.Generally speaking, the MSP-1 of the natural Parasites of these experiment promptings
42Gene can not be expressed in mammalian cell, and its blocking-up is the level of mRNA abundance.
The expression of MSP in the mammalian cell
Carried out the transient transfection experiment to estimate the MSP-1 that the present invention modifies
42The expression of gene in the COS cell.The DNA of GTC627 and GTC479 is imported the COS-7 cell.Separating total RNA after the transfection in 48 hours carries out Northern and detects.With
32The SalI-XhoI fragment of p mark GTC627 is surveyed immobilized RNA.Observe the remarkable different of GTC479 and GTC627.Show as the front, do not detect MSP-1 in the GTC479 transfectional cell
42MRNA, and in GTC627, expressed abundant MSP-1
42MRNA (Fig. 5, A hurdle).GTC469 is used as negative control and contains the insertion fragment of the GTC564 of being cloned into commercialization cloning vector PU19.The immunoprecipitation of the metabolic marker experiment of use 35S methionine(Met) and the polyclonal antibody (the D.Kas low NIAID by NIH provides) of the anti-MSP of use subsequently shows that the COS cell of transfection has synthesized MSP-1
42Protein (Fig. 5, B hurdle).And, in the COS of transfection cell conditioned medium, detect MSP-1
42, show MSP-1
42Protein is also secreted out.In addition, use the Ni-NTA post, from the COS supernatant of GTC627 transfection affinity purification MSP-1
42
These results prove parasitics MSP-1
42The modification of gene causes MSP mRNA to express in the COS cell.Subsequently, the synthetic and secretion MSP-1 of mammalian cell
42Product.
Also can use method well known in the art to prepare the polyclonal antibody (antibody: laboratory manual (Antibodies:ALaboratory Manual) that uses in this experiment, Ed Harlowand David Lane, eds. cold spring harbor laboratory (Cold Spring HarborLaboratory), publishers (1988)).The generation of MSP serum antibody also is described in Chang et al., infects and immunity (Infection and Immunity) (1996) 64:253-261and Chang et al. newspaper (ProcNatl.Acad.Sci.USA) 8 of institute of (1992) NAS
These detections show with the natural protein of not expressing compares the MSP-1 of modification of the present invention
42Nucleic acid can high level expression.These results have represented and reduced first experimental evidence that the AT% in the gene causes the MSP gene to be expressed in the allos systems, have represented first evidence that causes MSP protein to be expressed the COS cell from the unstable motif of MSP coding region elimination AUUUA mRNA simultaneously.
Like this, the data that herein provides points out some because its high A/T content and/or have unstable motif, and/or has used the rare codon of the cell system nonrecognition of selecting and the heterologous protein that is difficult to express in cell culture or transgenosis system can be undertaken by the codon usage table of this system engineered they being expressed in any given system.The present invention shows for the first time for the purpose of eliminating the suspection sequence that causes the degraded that causes low rna level or do not have RNA and carries out the modification of dna sequence dna.The result of Fig. 5 A hurdle Northern (be natural gene do not have RNA and the dna sequence dna of modification of the present invention has the RNA of reasonable levels) has explained the increase that protein produces probably.
The following examples have been described MSP1-42 as the expression of natural fusion (and not glycosylation) protein in transgenic mice milk.
The genetically modified structure of MSP
For the amino acid whose beta-casein signal peptides of MSP1-42 and 15 are merged, front 5 amino acid whose oligomers of 15 amino acid casein signals of coding and the MSP1-42 that is connected Cla I site are connected MSP203:ggccgctcgacgccaccatgaaggtcctcataattgcctgtctggtggc tctggccattgcagccgtcactccctccgtcat.MSP204:cgatgacggagggag tgacggctgcaatggccagagccaccagacaggcaattatgaggaccttcatggtg gcgtcgagc to MSP203 with MSP204) be connected the Xho I site that enters expression vector pCDNA3 with the CLA I-Xho I fragment (Fig. 8) of the BC620 of remaining MSP1-42 gene of encoding. Then the Xho I fragment cloning of this plasmid (GTC669) is produced B670 (Fig. 9) to the Xho I site of milk specific expression vector BC350.
The expression of MSP1-42 in transgenic mice milk
Prepare Sal I-Not I fragment and microinjection produces transgenic mice to mice embryonic from plasmid BC670.Use oligomer GTC17 and the MSP101 (sequence of oligomer: GTC17 subsequently by extracting mouse DNA from the tail examination of living tissue, GATTG ACAAG TAATA CGCTGTTTCC TC oligomer MSP101 GGATTCAATAGATACGG) carries out PCR and detects the affirmation transgenic mice.Collect the milk of the female person's of foundation transgenic mice lactation the 7th and 9 days, and use polyclone anti--(Dr.David Kaslow NIH) detects the expression level of determining MSP-1-42 by western for MSP antibody and monoclonal anti MSP antibody 5.2.The result shows that the expression level of MSP1-42 in the transgenic mice milk is 1-2 mg/ml (Figure 10).
Make up the negative mutant of MSP1-42 glycosylation site
The MSP that we produce milk detects and discloses transgenosis MSP protein is that N-is glycosylated.In order to eliminate the N-glycosylation site in the MSP1-42 gene, replaced the l-asparagine (N) in 181 and 262 sites with glutamine (Q).Carry AAC by design and MSP1 respective regions annealed and imported displacement to the DNA oligomer that CAG suddenlys change.Then these oligomers are produced coding N to Q metathetical dna fragmentation as the PCR primer.
In order to import the N262-Q sudden change, use a pair of oligomer MSPGYLYCO-3 (CAGGGAATGCTGCAGATC AGC) and MSP42-2 (AATTCTCGAGTTAGTGGTGGTGGTGGTGGTGATCGCAGAAAATAC CATG Figure 11) pcr amplification to contain the plasmid GTC627 of synthetic MSP1-42 gene.The PCR product cloning is arrived the pCR2.1 carrier.Produced plasmid GTC716 like this.
In order to import the N181-Q sudden change, use oligomer MSPGLYCO-1 (CTCCTTGTTCAGGAACTTGTAG GG) and MSPGLCO-2 (GTCCTGCAGTACACATATGAG Fig. 4) pcr amplification plasmid GTC627.The PCR product cloning is arrived pCR2.1 carrier (Invitrogen).Produced plasmid GTC700 like this.
The two glycosylation mutants of MSP have been made up by following three steps: at first the Xho I-Bsm I fragment of BC670 and the BSm I-Xho I fragment of GTC716 are connected the Xho I site of leading the pCR2.1 carrier.Produced the plasmid of the MSP1-42 gene that contains tool N262-Q sudden change like this.Then the EcoNI-Nde I fragment of the EcoN I-Nde I fragment in this plasmid with the GTC716 plasmid replaced, introduce second sudden change N181-Q.Xho I fragment cloning with this plasmid produces BC718 (Figure 12) to BC350 at last.
The expression of non-glycosylated MSP1 in the transgenic animal
BC718 has following feature: it carries and is in the MSP1-42 gene under the beta-casein promotor control thereby can expresses in transgenic animal mammary gland lactation.In addition, 15 amino acid whose beta-casein leader sequences that its is encoded directly and MSP1-42 merges can be secreted in the milk without any unnecessary amino acid whose MSP1-42 at the N-end like this.At last, because the N-Q displacement, the MSP that this construct produces in the transgenic animal milk can be by glycosylation.Generally speaking, the transgenosis MSP that is produced by BC718 in milk is identical with Parasites MSP1.
Prepared the SalI/XhoI fragment and microinjection has produced transgenic mice to mice embryonic from plasmid BC718.Identify transgenic animal as previously described.Collect the female person's of foundation milk, and use antibody 5.2 to carry out the Western trace and detect.The results are shown in Figure 13, show that non-glycosylated MSP1 expresses with the concentration of 0.5 to 1 mg/ml.
Equivalent
The ripe art personnel in present technique field only use normal experiment will appreciate that can determine that maybe multiple Equivalent all is considered within the scope of the invention, and is covered by following claim.
Claims (26)
1. the known nucleic acid of the modification of the energy Parasites of in mammalian cell, expressing, modification wherein comprise by use with the preferred codon sub stituent of institute metathetical codon coding same amino acid because of in the codon of one or more AT of containing reduce AT content.
2. the known nucleic acid of the proteinic modification of Parasites expressed in mammalian cell of an energy is wherein eliminated the unstable motif of at least one mRNA that exists in the gene coded sequence by using with the unstable motif of preferred codon displacement mRNA of institute metathetical codon coding same amino acid.
3. the nucleic acid of claim 1 or 2 modification, wherein by with at least one or a plurality of codon of the preferred milk protein specificity codon displacement known of institute metathetical codon coding same amino acid.
4. the known nucleic acid of the modification of the energy Parasites of in mammalian cell, expressing, wherein reduced total AT content of known coded gene, and wherein eliminated the unstable motif of at least one mRNA that exists in the gene and replaced at least one codon in the natural gene with preferred milk protein specificity codon with the displacement of milk protein specificity codon by the displacement of milk protein specificity codon.
5. the nucleic acid of the modification of claim 4, the nucleic acid of wherein said modification can be with at least 100% the described protein of horizontal expression of natural gene expression level in the mammal cell line system in external or body.
6. preparation is used for the method for known nucleic acid of the modification of the Parasites of expressing at mammalian cell, comprises that the codon of the one or more AT of containing in the preferred specific breast codon displacement natural gene of using with institute's metathetical codon coding same amino acid reduces the AT content of natural gene.
7. preparation is used for the method for the known nucleic acid of the proteinic modification of Parasites expressed at mammalian cell, comprise use with the preferred specific breast codon sub stituent of institute metathetical codon coding same amino acid because of in the unstable motifs of one or more mRNA eliminate at least one mRNA instability motif in the gene.
8. claim 5 or 6 method further comprise the one or more codons in the described proteinic natural gene of using with institute's metathetical codon coding same amino acid of preferred specific breast codon permutation encoding.
9. with the nucleotide sequence of the modification of claim 5 or the preparation of 6 method.
10. preparation is used for the method for known nucleic acid of the modification of the Parasites of expressing at mammalian cell, comprises the following steps:
A) use with the preferred milk protein matter specificity codon sub stituent of institute metathetical codon coding same amino acid because of in the unstable motifs of one or more mRNA eliminate at least one mRNA instability motif in the natural gene of code for said proteins.
B) use with the milk protein matter specificity codon sub stituent of institute metathetical codon coding same amino acid because of in the one or more AT of containing codons AT of reducing the natural gene of code for said proteins enrich content and
C) use one or more codons in the described proteinic natural gene of preferred specific breast codon permutation encoding with institute metathetical codon coding same amino acid.
11. the nucleic acid of the modification of the method preparation of use claim 10.
12. the nucleic acid of the modification of claim 1, wherein said Parasites are plasmodium and described nucleic acid be sequence 1 or sequence 9 fragment or with its specificity homologous sequence.
13. the nucleic acid of the modification of claim 1, wherein said Parasites are plasmodium and described nucleic acid be sequence 9 or its fragment or with its specificity homologous sequence.
14. the nucleic acid of the modification that can in cell system, express, its be sequence 1 fragment or with its specificity homologous sequence, wherein use with institute metathetical codon coding same amino acid but the codon that can effectively reduce the described cell culture system identification of the total AT content of natural gene is replaced the AT content that one or more codons have reduced this natural gene.
15. the nucleic acid of the modification that can in cell system, express, its be sequence 1 fragment or with its specificity homologous sequence, wherein use can effectively eliminate unstable motif and contain one or more codons of unstable motif with the codon displacement of the described cell system identification of institute metathetical codon coding same amino acid, eliminated the unstable motif of at least one mRNA that exists in the natural gene encoding sequence.
16. the nucleic acid of the modification of claim 14 or 15 has wherein been replaced in the natural gene at least one or all codons with the preferred codon of described cell system.
17. contain the carrier of nucleic acid of the modification of claim 12.
18. use the carrier transfection or the transformed host cells of claim 17.
19. contain the transgene expression construct of nucleic acid of the modification of claim 12.
20. the non-human transgenic animal, its kind is the nucleic acid that contains the modification of claim 12.
21. contain the transgene expression vector that is used to produce transgenic animal of the promotor that can operate to link to each other with the nucleic acid of the modification of claim 12, wherein said promotor instructs the protein of the nucleic acid encoding of described modification to express at mammary gland and enters in this animal milk.
22. the known nucleic acid of the modification of bacterium, virus or Parasites that an energy is expressed in cell system, wherein use with institute's metathetical codon coding same amino acid but can effectively reduce the codon that the total AT of natural gene enriches the described cell system identification of content and replace one or more codons, reduced the AT content of this gene.
23. the nucleic acid of the modification of bacterium, virus or Parasites that an energy is expressed in cell system, wherein use and effectively to eliminate unstable motif and to contain one or more codons of described unstable motif, eliminated the unstable motif of at least one mRNA that exists in the gene coded sequence with the codon displacement of the described cell system identification of institute metathetical codon coding same amino acid.
24. the nucleic acid of the modification of claim 22 or 23 has wherein been replaced in the natural gene at least one or all codons with the preferred codon of described cell system.
25. contain the dna vaccination of nucleic acid of the modification of claim 24.
26. contain the dna vaccination of claim 17 carrier.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US6259297P | 1997-10-20 | 1997-10-20 | |
US60/062,592 | 1997-10-20 | ||
US60/085,649 | 1998-05-15 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB988104008A Division CN1325646C (en) | 1997-10-20 | 1998-10-20 | Modified nucleic acid sequences and method for increasing mRNA levels and protein expression in cell systems |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101134966A true CN101134966A (en) | 2008-03-05 |
Family
ID=39159290
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2007101049335A Pending CN101134966A (en) | 1997-10-20 | 1998-10-20 | Modified nucleic acid sequences and method to increasing mrna levels and protein expression in cell systems |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101134966A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112735525A (en) * | 2021-01-18 | 2021-04-30 | 江苏普瑞康生物医药科技有限公司 | mRNA sequence optimization method and device based on divide-and-conquer method |
-
1998
- 1998-10-20 CN CNA2007101049335A patent/CN101134966A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112735525A (en) * | 2021-01-18 | 2021-04-30 | 江苏普瑞康生物医药科技有限公司 | mRNA sequence optimization method and device based on divide-and-conquer method |
CN112735525B (en) * | 2021-01-18 | 2023-12-26 | 苏州科锐迈德生物医药科技有限公司 | mRNA sequence optimization method and device based on divide-and-conquer method |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1325646C (en) | Modified nucleic acid sequences and method for increasing mRNA levels and protein expression in cell systems | |
CN108884473A (en) | RNA replicon for the expression of multi-functional and efficient gene | |
CN109328233A (en) | Trans- replicated rna | |
Mlambo et al. | Murine model for assessment of Plasmodium falciparum transmission-blocking vaccine using transgenic Plasmodium berghei parasites expressing the target antigen Pfs25 | |
Otsu et al. | Interruption of a Trypanosoma cruzi gene encoding a protein containing 14-amino acid repeats by targeted insertion of the neomycin phosphotransferase gene | |
CN101134966A (en) | Modified nucleic acid sequences and method to increasing mrna levels and protein expression in cell systems | |
JP2006262875A (en) | Gene construct for expressing protein in poultry fallopian tube, and method for producing protein using the gene construct | |
JP2007228814A (en) | Gene cassette for expressing foreign protein and method for producing foreign protein | |
Margos et al. | Transgenic expression of a mosquito-stage malarial protein, Pbs21, in blood stages of transformed Plasmodium berghei and induction of an immune response upon infection | |
CN1708587A (en) | Recombinant MVA strains as potential vaccines against p. falciparum malaria | |
AU2003200911B2 (en) | Novel modified MSP-1 nucleic acid sequences and methods for increasing mRNA levels and protein expression in cell systems | |
MXPA00003839A (en) | NOVEL MODIFIED NUCLEIC ACID SEQUENCES AND METHODS FOR INCREASING mRNA LEVELS AND PROTEIN EXPRESSION IN CELL SYSTEMS | |
AU2003200914B2 (en) | Novel modified nucleic acid sequences and methods for increasing mRNA levels and protein expression in cell systems | |
JP4273230B2 (en) | Gene replacement vectors targeting birds and uses thereof | |
CN101969991A (en) | Malaria vaccine compositions and constituents which elicit cell mediated immunity | |
MXPA00003840A (en) | NOVEL MODIFIED MSP-1 NUCLEIC ACID SEQUENCES AND METHODS FOR INCREASING mRNA LEVELS AND PROTEIN EXPRESSION IN CELL SYSTEMS | |
CN105274108B (en) | The fish promoter of immune response and its application | |
Donelson | The molecular basis of livestock disease as illustrated by African trypanosomiasis | |
Mosupiemang | Fine mapping of autoimmune diseases in chicken | |
WO1996015237A2 (en) | Delivery system | |
WO1996040879A1 (en) | Dna cassettes for expression of lytic peptides in mammalian cells and transgenic organisms containing same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080305 |