MXPA00003839A - NOVEL MODIFIED NUCLEIC ACID SEQUENCES AND METHODS FOR INCREASING mRNA LEVELS AND PROTEIN EXPRESSION IN CELL SYSTEMS - Google Patents

Abstract

The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred"difficult"protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.

Description

NOVEDOSAS SEQUENCES OF NUCLEIC ACIDS, MODIFIED, AND METHODS TO INCREASE LEVELS OF mRNA AND EXPRESSION OF PROTEINS IN CELLULAR SYSTEMS Background of the Invention Field of the Invention The invention relates to the heterologous expression of genes. More particularly, the invention relates to the expression of genes from microbial organisms or parasites in higher eukaryote cell systems. Compendium of Related Art Frequently, the recombinant production of certain heterologous gene products is difficult in cell culture systems in vitro or in recombinant production systems in vivo. For example, many researchers have found it difficult to express proteins that are derived from bacteria, parasites and viruses in cell culture systems other than the cells from which the protein was originally derived, and particularly in cell culture systems. mammals An example of a therapeutically important protein, which has been difficult to produce by mammalian cells, is the surface protein of the malaria merozoite (MSP-1). Malaria is a major health problem in tropical countries. Resistance to existing drugs develops rapidly and a vaccine is urgently needed. Of the number of antigens that are expressed during the life cycle of P-falciparum, MSP-1 is the one that has been studied more extensively and promises to be the most successful candidate for vaccination. Individuals who are exposed to P. falciparum develop antibodies against MSP-1, and studies have shown that there is a correlation between an immune response that is acquired naturally to MSP-1 and reduced morbidity of malaria In a number of studies, immunization with purified native MSP-1 or recombinant fragments of the protein has at least induced partial parasite protection (Diggs et al. (1993), Parasi tol. Today 9: 300-302). In this way, MSP-1 is an important objective for the development of a vaccine against P. fal ciparum. MSP-1 is a glycoprotein of 190-220 kDa. The C-terminal region has been the focus of recombinant production to be used as a vaccine. However, a major problem in the development of MSP-1 as a vaccine is the difficulty in obtaining recombinant proteins in bacterial or yeast expression systems that are equivalent in immunological potency with the purified native affinity protein ( Chang et al., (1992) J. Immunol., 148: 548-555) and in sufficiently large quantities make vaccine production feasible. Improved methods to improve the expression of sufficient amounts of proteins that are derived from parasitic, bacterial and viral organisms, which had previously been difficult to produce recombinantly, would be advantageous. In particular, a recombinant system capable of expressing MSP-1 in sufficient amounts would be especially advantageous. SUMMARY OF THE INVENTION The present invention provides improved recombinant DNA compositions for increasing mRNA levels and the expression of proteins that are derived from heterologous cells, preferably those from lower organisms such as bacteria, viruses, and parasites, which they had been difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic mammals. Preferred protein candidates for expression in an expression system according to the invention are those proteins having DNA coding sequences comprising a high total AT content or rich regions of AT, and / or motifs of instability of MRNA, and / or rare codons in relation to recombinant expression systems. In a first aspect, the invention presents a modified known nucleic acid, preferably a gene from a bacterium, virus or parasite, which can be expressed in a system, wherein the modification comprises a reduced AT content, relative to the unmodified sequence , "and optionally further comprising the removal of at least one or all of the motifs of mRNA instability present in the native gene In certain preferred embodiments, the modification further comprises the replacement of one or m-rs-codons of the natural gene with the Preferred codons of the cellular system In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention comprising the steps of lowering the total AT content of the natural gene encoding the protein, and / or eliminating at least one or all of the motifs of mRNA instability, and / or replacing one or more codons with a preferred codon of the cell system that was selected, all by means of replacing one or more codons in the natural gene with codons recognizable for, and preferably with codons that prefer the cellular system of choice and which code for the same amino acids as the codon that was replaced. This aspect of the invention further includes modified nucleic acids which are prepared in accordance with the process of the invention. In a third aspect, the invention also provides vectors comprising the nucleic acids of the invention and active promoters in the cell line or organism of choice, and the host cells that were transformed with the nucleic acids of the invention. In a fourth aspect, the invention provides transgenic expression vectors for the production of transgenic lactating animals comprising the nucleic acids of the invention, as well as transgenic non-human lactating animals whose germ lines comprise a nucleic acid of the invention. In a fifth aspect, the invention provides a transgenic expression vector for the production of a species of transgenic lactating animals comprising a nucleic acid of the invention, a promoter that is operably coupled to the nucleic acid, which directs the expression of the mammary gland of the protein that encoded the nucleic acid, inside the milk of the transgenic animal. In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene, according to the invention. Description of the Drawings Figure 1 describes the sequence of the cDNA of SP-142 that was modified according to the invention [SEQ ID NO 1], in which the positions of nucleotide 306 have been replaced to decrease the content of AT and eliminate motifs of mRNA instability, while maintaining the same protein amino acid sequence of MSP-142- Large letters indicate nucleotide substitutions. Figure 2 describes the coding sequence of the nucleotide sequence of the wild-type or native MSP-1 [SEQ ID NO 2]. Figure 3a is a codon usage table for the wild type MSP-142 (designated "MSP wt" in the table) and the new gene of the modified MSP-142 (referred to as "MSP edited" in the table). table) and different milk protein genes (casein genes that are derived from goats and mice). The numbers in each column indicate the number of actual times in which a specific codon appears in each of the listed genes. The new synthetic gene of the MSP-142 was derived from the use of the mammary specific codon by means of selecting codons rich in GC for a given amino acid, combined with the selection of amino acids that are used more frequently in milk proteins. . Figure 3b is a codon usage table that compares the number of times each codon appears on the MSP-142 of both the wild type (designated "MSP wt" in the table), as of the new gene of the modified MSP-142 (designated "MSP edited" in the table), as also shown in the table in Figure 3a. The table in Figure 3b also compares the frequency with which each codon appears in the wild type MSP-142 and the modified new gene of the MSP-142, with the frequency of appearance of each codon in both the genes of the .coli as in human genes. Thus, if the expression system were E. coli cells, this table can be used to determine which codons recognize, or prefer, E. coli Figures 4a-4c describe the GTC 479, GTC 564, and GTC 627 constructs of the MSP-142, respectively, as described in the examples. Panel A of Figure 5 is a Northern analysis where the GTC627 construct comprises the new MSP-142 gene modified according to the invention, the GTC479 is the construct comprising the native MSP-142 gene, and the GTC469 construct It is a negative control DNA. Panel B of Figure 5 is a Western analysis where levigated fractions are after affinity purifications. The numbers are the fractions that were collected. The results show that the fractions from the GTC679 and from the construction of the synthetic gene of the modified MSP-142 reacted with the polyclonal antibodies to the MSP-1 and the GTC479 of the negative control did not. Figure 6 depicts the nucleic acid sequences of [SEQ ID NO 3] of OT1, [SEQ ID NO 4] of OT2, [SEQ ID NO 5] of MSP-8, [SEQ ID NO 6] of MSP-2, and [SEQ ID NO 7] of MSP-1 that are described in the examples. Figure 7 is a schematic representation of plasmid BC754. Figure 8 is a schematic representation of BC620. Figure 9 is a schematic representation of BC670. Figure 10 is a representation of a Western blot of the MSP in transgenic milk.

Figure 11 is a schematic representation of the nucleotide sequence of [SEQ ID NO 8] of MSP42-2. Figure 12 is a schematic representation of BC718. Figure 13 is a representation of a Western blot of the expression of BC-718 in transgenic milk. Detailed Description of Preferred Embodiments The patent and scientific literature referred to herein establishes the knowledge that is available to those skilled in the art. United States patents issued, approved applications, published foreign applications, and references cited herein are incorporated by reference herein. Any conflicts between these references and the present description, should be resolved in favor of the present description. The invention provides recombinant nucleic acid sequences (preferably DNA) and methods to increase mRNA levels and the expression of proteins known to be, or are likely to be, difficult to express in human protein systems. cell culture, mammalian cell culture systems, or in transgenic animals. Preferred "difficult" protein candidates for expression using the recombinant techniques of the invention are those proteins that are derived from heterologous cells, preferably those from lower organisms such as parasites, bacteria, and viruses, which have coding sequences of DNA comprising a high total AT content or AT rich regions, and / or motifs of mRNA instability, and / or rare codons relative to the recombinant expression system to be used. In a first aspect, the invention presents a modified known nucleic acid, preferably a gene from a bacterium, virus or parasite, which can be expressed in a cellular system, wherein the modification comprises a reduced AT content, in relation to to the unmodified sequence, and optionally further comprising the removal of at least one or all of the motifs of mRNA instability present in the natural gene. A "cellular system" includes cell culture systems, tissue culture systems, organ and tissue culture systems of living animals. In certain preferred embodiments, the modification further comprises replacing one or more codons of the natural gene with the preferred codons of the cellular system. Each of these features is achieved by replacing one or more codons of the natural gene with codons recognizable for, and preferably preferred by the cellular system encoding the same amino acid as the codon that was replaced in the natural gene. In accordance with the invention, these substitutions of the "silent" nucleotide and the codon should be sufficient to achieve the objective decrease of the AT content and / or the elimination of the motifs of mRNA instability, and / or the reduction of the number of rare codons. while maintaining, and preferably improving, the ability of the cellular system to produce mRNA and express the desired protein. Also included in the invention are those sequences that are specifically homologous to the modified nucleic acids of the invention, under the appropriate stringent conditions, specifically excluding the known nucleic acids from which the modified nucleic acids are derived. A sequence is "specifically homologous" with another sequence if it is sufficiently homologous to hybridize specifically with the exact complement of the sequence. A sequence is "specifically hybridized" with another sequence, if it hybridizes to form Watson-Crick or Hoogs-teen base pairs either in the body, or under conditions which approximate physiological conditions with respect to the ionic strength, for example, 140 mM NaCl, 4 mM MgCl2. Preferably, this specific hybridization is maintained under stringent conditions, for example, 0.2X SSC at 68 ° C. In preferred embodiments, the nucleic acid of the invention can express the protein in the culture of mammalian cells, or in a transgenic animal at an el level. which is at least 25 percent, and preferably 50 percent and even more preferred at least 100 percent or more of that expressed by the natural gene in an in vitro cell culture system or in a transgenic animal under identical conditions (ie, the same type of cell, same culture conditions, same expression vector). As used herein, the term "expression" means the transcription of the mRNA that results in the expression of the protein. Expression can be measured by a number of techniques known in the art that include the use of an antibody specific for the protein of interest. By "natural gene" or "native gene" is meant the sequence of genes, or fragments thereof (which includes the allelic variations that occur naturally), which encode the wild-type form of the protein and from which is derived the modified nucleic acid. A "preferred codon" means a codon that more predominantly uses the cellular system of choice. Not all of the codon changes described herein are changes to a preferred codon, as long as the codon replacement is a codon that recognizes at least the cellular system. The term "reduced At-content" as used herein, means having a lower total percentage of nucleotides having bases of A (adenine) or T (thymine) relative to the natural gene, due to the replacement of the A or the T containing the nucleotide positions or the codons containing A and / or T with nucleotides or codons that recognizes the cellular system of choice and which does not change the amino acid sequence of the target protein. "Heterologous" is used herein to denote the genetic material that originates from species other than those into which it has been introduced, or a protein produced from that genetic material. Cellular systems of the invention that are particularly preferred include mammalian cell culture systems, such as COS cells and CHO cells, as well as transgenic animals, in particle the mammary tissue of transgenic animals. However, the invention also contemplates bacterial, yeast, E. coli, and viral expression systems, such as baculoviruses and even plant systems. In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention, comprising the steps of decreasing the total AT content of the natural gene encoding the protein, and / or eliminating at least one or all of the motifs of mRNA instability, and / or replacing one or more codons with a preferred codon of the system cell that was selected, all by means of replacing one or more codons in the natural gene with codons recognizable for, and preferably with codons that prefer the cellular system of choice and which code for the same amino acids as the codon that was replaced. Standard reference works describing the general principles of recombinant DNA technology include Watson, J.D. and collaborators, Mol ecular Biology of the Gen, volumes I and II, the Benjamin / Cummings Publishing Company, Inc., Editor, Menlo Park, CA (1987); Darnell, J.E. and collaborators, Molecular Cell Biology, Scientific American Books, Inc., Editor, New York, NY (1986); Listen, R.W. and collaborators, Principles of Gene Manipulation: An Introduction to Genetic Engineering, 2nd edition, University of California Press, Editor, Berkeley, CA (1981); Maniatis, T. et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Editor, Cold Spring Harbor, NY (1989), and Current Protocols in Molecular Biology, Ausubel et al., Wiley Press, New York, NY (1992). This aspect of the invention further includes the modified nucleic acid that was prepared in accordance with the process of the invention. Without being bound by any theory, previous research has indicated that a conserved AU sequence (AUUUA) from the 3 'untranslated region of the GM-CSF mRNA intercedes in the selective degradation of the AR? M (Shaw, G. Kamen, R., Cell 46: 659-667). The focus in the past has been on the presence of these motives of instability in the untranslated region of a gene. The present invention is the first to recognize an advantage for removing sequences of instability in the coding region of a gene. In a third aspect, the invention also provides the vectors comprising the nucleic acids of the invention and the active promoters in the cell line or organism of choice, and the lanfitrion cells which will be formed with the nucleic acids of the invention. . Preferred vectors include an origin of the replica and are therefore duplicatable in one or more cell types. Certain preferred vectors are expression vectors, and additionally comprise at least one promoter and one passive terminator, thereby allowing the transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell. In a fourth aspect, the invention provides transgenic expression vectors for the production of transgenic lactating animals comprising the nucleic acids of the invention, as well as transgenic non-human lactating animals whose germ lines comprise a nucleic acid of the invention. These transgenic expression vectors comprise a promoter that can be expressed as part of the genome of the host transgenic animal. General principles for producing transgenic animals are known in the art. See, for example, Hogan et al., Manipulate ting the Mouse Embryo: A Labora tory Manual, Cold Spring Harbor Laboratory, (1986); Simons et al., Bio / Technology 6: 179-18-3, (1988); Wall et al., Biol. Reprod. 32: 645-651, (1985); Buhler et al., Bio / Technology 8: 140-143 (1990); Ebert et al., Bio / Technology 9: 835-838, (1991); Krimenfort et al., Bio / Technology 9: 844-847, (1991); Wall et al., J. Cell. Biochem 49: 113-120 (19921) Techniques for introducing foreign DNA sequences into mammals and their germ cells were originally developed in the mouse See, for example, Gordon et al., Proc. Na ti. Acad. Sci USA 77: 7380-7384 (1980), Gordon and Ruddle, Science 214: 1244-1246 (1981), Palmiter and Brinster, Cell 41: 343-345, 1985, Brinster et al., Proc. Na ti. Acad. Sci. USA 82: 4438-4442 (1985) and Hogan et al. (Ibid.) These techniques were subsequently adapted for use with larger animals, including cows and goats, until very recently, the procedure that was used most widely for The generation of transgenic mice or cattle was that several hundred linear molecules of the DNA of interest were injected in the form of a transgenic expression construct, into the pro-nuclei of a fertilized egg.The injection of DNA into the cytoplasm of A zygote was also widely used. The most recent cloning of a complete transgenic cell line that can be injected into an unfertilized egg has now been achieved (KHS Campbell et al., Na ture 380: 64-66 (1996)). In a fifth aspect, the invention provides a transgenic expression vector for the production of a transgenic lactating animal species comprising a nucleic acid of the invention, a promoter that is operatively coupled with the nucleic acid, which directs the expression of the mammary gland of the protein that encoded the nucleic acid within the milk of the transgenic animal. The expression system of the mammary gland has the advantages of high expression levels, low cost, correct processing and accessibility.

Different researchers have produced known proteins, such as bovine and human alpha lactalbumin, in transgenic lactating animals. (Wright et al., Bio / Technology 9: 830-834 (1991); Vilotte et al., Eur. J. Biochem., 186: 43-48 (1989); Hochi et al., Mol. Reprod. And Devel. 16O-164 (1992), Soulier et al., FEBS Letters 297 (1,2): 13-18 (1992)) and it has been shown that the system produces high levels of protein. Preferred promoters are active in breast tissue. Promoters that are specifically active in genes encoding specific proteins in the milk, such as genes found in breast tissue, ie more active in breast tissue than in other tissues under physiological conditions, are particularly useful. where it is, synthesizes the milk. The promoters that are most preferred are both specific and efficient in breast tissue. Among these promoters, casein, lactalbumin and lactaglobulin promoters are preferred, including, but not limited to, the alpha, beta and gamma casein promoters and the lactalbumin alpha and beta lactam-globulin promoters. Those that are preferred among the promoters are those from rodents, goats and cows. Other promoters include those that regulate, a gene for the whey acidic protein (WAP, for its acronym in English). In a preferred embodiment of the invention, a nucleic acid encoding MSP-1 or fragments thereof is provided, which is expressed in a cell culture system, mammalian cell culture system or in the milk of a transgenic animal The nucleic acid sequences encoding the natural MSP-1 gene are modified according to the invention. First, the content of total AT is reduced by replacing the codons of the natural gene with codons recognizable for, and preferably with codons that prefer the cellular system of choice, which encode the nucleic acid in comparison with the gene or gene fragment. of the native MSP-1. Second, the motifs of mRNA instability (AUUUA, Shaw and Kamen, supra) are eliminated in the gene gene or gene fragment native to the gene coding sequence, by replacing the codons of the natural gene with codons recognizable for, and preferably prefer the cellular system of choice that encodes the same amino acid, but that are sufficient to eliminate the motive of mRNA instability. Optionally, any other codon of the native gene can be replaced with a preferred codon of the expression system of choice, as described. In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. In certain preferred embodiments, the DNA vaccine according to the invention may be in the form of a purified or "naked" modified nucleic acid according to the invention, which may or may not be operatively associated with a promoter. . A nucleic acid is operatively associated with a promoter if it is associated with the promoter in a manner that allows the nucleic acid sequence to be expressed. These DNA vaccines can be delivered without encapsulation, or they can be delivered as part of a liposome, or as part of a viral genome. In general, these vaccines are supplied in an amount sufficient to allow expression of the nucleic acid and produce an antibody response in an animal, including a human being, which receives the DNA vaccine. Subsequent supplies, at least one week after the first supply, can be used to improve the antibody response. Preferred delivery routes include introduction by mucous membranes, as well as parenteral administration. - A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene according to the invention. This fragment preferably includes from about 5 percent to about 100 percent of the total gene sequence and comprises one or more modifications according to the invention. The examples of the use of the E. coli and human codon are shown in Figure 3b. Figure 3b shows the frequency of codon usage for the native MSP-1 gene, as well as the modified MSP-1 gene of the invention and also compares the frequency of codon usage with that of Xos genes of E. coli and humans. Codon usage frequency tables are readily available and are known to those skilled in the art for a number of other expression systems such as yeast, baculovirus, and mammalian systems. The following examples illustrate certain preferred modes of carrying out and practicing the present invention, but are not intended to limit the scope of the invention, since alternative methods can be used to obtain the same results. EXAMPLES Creation of the novel modified MSP-142 gene In one embodiment, a modified nucleic acid encoding the fragment of the C-terminal MSP-1 is provided. The novel modified nucleic acid of the invention encoding the 42 kD C-terminal part of the MSP-1 (MSP-142) which can be expressed in the mammalian cells of the invention is shown in Figure 1. The natural MSP-142 gene (Figure 2) could not be expressed in the culture of mammalian cells or in the transgenic mice. The analysis of the natural MSP-142 gene suggested different characteristics that distinguished it from mammalian genes. First, it has a very high total AT content of 76 percent. Second, the mRNA instability motive, AUUUA, occurred 10-fold in this 1100 bp DNA segment (Figure 2). To address these differences, a new MSP-142 gene was designed. The replacement of the silent nucleotide within the native MSP-142 gene at position 306 was introduced to reduce the total AT content to 49.7 percent. Each of the 10 AUUUA was removed from the motifs of mRNA instability in the natural gene, through changes in codon usage as well. To change the use of the codon, a specific breast tissue codon usage table, Figure 3, was created by using different mouse and goat mammary specific proteins. The table was used to guide the selection of codon usage for the modified MASP-142 gene, as described above. For example, as shown in the Table in Figure 3a, 65 percent of the natural gene was coded (25/38) of the Leu using the TTA, a rare codon in the mammary gland. In the modified MSP-142 gene, 100 percent of the Leu was coded by CTG, a codon that is preferred for Leu in the mammary gland. - An expression vector was created using the modified MSP-142 gene by fusing the first 26 amino acids of goat beta casein at the N-terminus of the modified MSP-142 gene and sub-cloning a fragment I of Sall- Xho which carries the fusion gene within the Xhol site of the pCADN3 of the vector d expression. An His6 tag was fused at the 3 'end of the MSP-142 gene to allow the gene product to be affinity purified. This resulted in a plasmid GTC627 (Figure 4 c). To compare the construction of the MSP-142 gene with the nucleic acid of MSP-142 of the invention, an expression vector for the natural MSP-142 gene was also created and the gene was added to the culture of mammalian cells and injected into mice to form transgenic mice as follows: Construction of Expression Vector of MSP-142 na tiva To secrete truncated merozoite surface protein-1 (MSP-1) from Plasmodium falciparum, the wild-type gene encoding the 42KD C-terminal part of the MSP-1 (MSP-142), either with any of the DNA sequences encoding the first 15 or the first 25 amino acids of goat beta casein. This is achieved by first PCR amplifying the MSP-1 plasmid (which was received from Dr. David Kaslow, NIH) with the MSP1 and MSP2 primers (Figure 6), then cloning the PCR product into the TA vector (Invitro). -gen). The bglII-XhoI fragments of the PCR product were ligated with oligos OT1 and OT2 (Figure 6) into the pCADN3 of the expression vector. This produced plasmid GTC564 (Figure 4b), which encodes the 15 amino acid beta casein signal peptide and the first 11 amino acids of mature goat beta casein, followed by the MSP-142 gene. The oligos MSP-8 and MSP-2 (Figure 6) were used to amplify the plasmid MSP-1 by PCR, then the product was cloned into a TA vector. The Xhol fragment was excised and cloned into the Xhol site of pCADN3 of the expression vector, to produce plasmid GTC479 (Figure 4a), which encoded the 15 amino acid goat casein beta signal peptide that was fused with the MSP-142 gene of the wild type. A His6 tag was added at the 3 'end of the MSP-142 gene in GTC564 and GTC479. The Gene of the MS0-142 Na tiva Is Not Expressed in the COS-7 Cells The expression of the native MSP gene in cultured COS-7 cells was assayed by transient transfection assays. The plasmid DNA GTC479 and GTC564 were introduced into COS-7 cells by lipofectamine (Gibco-BRL), in accordance with the manufacturer's protocols. Total cellular RNA was isolated from COS cells two days after transfection. The newly synthesized proteins were labeled metabolically for 10 hours by adding 35S methionine to the culture medium, two days after transfection. To determine the expression of MSP RNA in COS cells, a Northern blot was probed with a 32P labeled DNA fragment from GTC479. No MSP RNA was detected in either the GTC479 transfectant or the GTC564 (data not shown). Prolonged exposure revealed residual levels of degraded MSP mRNA. The supernatants of the 35S labeled culture and the lysates were immunoprecipitated with a polyclonal antibody raised against the MSP. The immunoprecipitation experiments showed no pare expression of any of the lysates or supernatants of the transfected cells of GTC479 or GTC564 (data not shown). These results showed that the native MSP-1 gene was not expressed in COS cells. The Gene of MSP-1 Na tiva Is Not Expressed in the Mammary Gland of Transgenic Rats The Sall-Xhol fragment of the GTC479 was cloned., which encoded the goat 15 amino acid beta casein signal peptide, the first 11 amino acids of goat beta casein, and the native MSP-142 gene, within the Xhol site of beta casein that was expressed in the vector BC350. This produced plasmid BC574 (Figure 7). A Sall-XhoI fragment of BC574 was injected into the mouse embryo to generate transgenic mice. Fifteen lines of transgenic mice were established. The milk of the founding mouse was harvested and subjected to Western analysis with polyclonal antibodies against MSP. None of the seven mice that were analyzed were found to express the MSP-142 protein in their milk. To further determine whether the MSP-142 mRNA was expressed in the mammary gland, the total RNA was extracted from 11 day old transgenic mice and analyzed by Northern blotting. No mRNA from MSP-142 was detected by any of the BC 574 lines that were analyzed. Therefore, the transgene of MSP-142 was not expressed in the mammary gland of the transgenic mice. Taken together, these experiments suggest that the parasite gene of the native MSP-142 could not be expressed in mammalian cells, and the blocking is like the level of mRNA abundance. Expression of MSP in Mammalian Cells The experiments of transient transfection were performed to evaluate the expression of the modified MSPO-l42 gene of the invention, in COS cells. The DNA of GTC627 and GTC479 was introduced into COS-7 cells. Total RNA was isolated 48 hours after transfection for Northern analysis. The immobilized RNA was probed with the Sall-Xhol fragment labeled 32P of GTC627. A dramatic difference was observed between GTC479 and GTC627. Although no MSP-142 mRNA was detected in the transfected cells of GTC479, as shown previously, abundant mRNA of MSP-142 was expressed by GTC627 (Figure 5, Panel A). GTC479 was used as a negative control and comprises the insertion of cloned GTC564 into the cloning vector PU19, a cloning vector that is commercially available. A metabolic labeling experiment with 35S methionine followed by immunoprecipitation with polyclonal antibody (provided by Dr Kaslow NIAID, NIH) against MSP, showed that the MSP-142 protein was synthesized by the transfected COS cells (Figure 5, Panel B). In addition, MSP-142 was detected in the supernatant of the transfected COSs, indicating that the MSP-142 protein had also been secreted. Additionally, using the Ni-NTA column, MSP-142 was affinity purified from the transfected COS supernatant of GTC627.

These results demonstrated that modification of the MSP-142 parasite gene led to the expression of MSP mRNA in COS cells. Accordingly, mammalian cells synthesized and secreted MSP-142. Polyclonal bodies that were used in this experiment can also be prepared by elements well known in the art (An tibodies: A Labora tory Manual, Ed Harlow and David Lane, eds Cold Spring Harbor L'aboratory, editors (1988)). In Chang et al., Infection and Immunity (1996) 64: 253-261 and Chang et al., (1992) Proc. Na ti. Acad. Sci. USA 86: 6343-6347, the production of MSP serum is also described. The results of these analyzes indicate that the modified MSP-142 nucleic acid of the invention is expressed at a very high level compared to that of the native protein, which was not expressed at all. These results represent the first experimental evidence that the reduction of the percentage of AT in a gene, leads to the expression of the MSP gene in the heterologous systems and is also the first evidence that the removal of the motifs - of mRNA instability, AUUUA, from the coding region of the MSP, leads to the expression of the MSP protein in COS cells. In this way, the data presented here suggest that certain heterologous proteins that may be difficult to express in cell culture or transgenic systems due to the high AT content, and / or the presence of instability motifs, and / or the use of rare codons which are not recognizable for the cell system of choice, can be redesigned to facilitate the expression of any given system with the help of the codon usage tables for that system. The present invention represents the first time that a DNA sequence has been modified with the goal of removing the suspicious sequences responsible for the degradation resulting in low levels of RNA or no RNAB at all. The results shown in Figure 5, Panel A Northern (ie, no RNA with the native gene and reasonable levels with a modified DNA sequence, according to the invention), possibly explains the increase in the production of the protein. The following examples describe the expression of MSPl-42 as a non-fusion (and non-glycosylated) native protein in the milk of transgenic mice. Construction of Transgene of MSP To merge the MspI-42 with the signal peptide of casein-ß 15mer, a pair of oligos, the MSP203 and MSP204 (: ggccgctcgacgccaccatgaaggtcctcataattgcc tgtctggtggctctggccattgcagccgtcactccctccgtcat MSP204. Cgatgacggag ggagtgacggctgcaatggccagagccaccagagccaccagacaggcaattatgaggaccttcat ggtggcgtcgagc MSP203) were ligated , which encode the casein signal of 15 amino acids and the first 5 amino acids of MSP1-42 that are encoded at the Cía I site, were ligated with a Cía-Xho I fragment of BC620 (Figure 8) which encodes the rest of the MSP1-42 gene, within the Xho I site of the expression vector pCADN3. An Xho I fragment of this plasmid (GTC669) was then cloned into the Xho I site of the milk specific expression vector BC350, to generate B670 (Figure 9). Expression of MSP1 -42 in the milk of transgenic rats A Sal I-fot I fragment was prepared from plasmid BC670 and microinjected into the mouse embryo to generate transgenic mice. Transgenic mice were identified by extracting mouse DNA from the tail biopsy, followed by PCR analysis using oligos GTC 17 and MSP 101 (sequences of the oligos: GTC17, GATTGACAAGT AATACGCTGTTTCCTC, Oligo MSP101, GGATTCAATAGATACGG) . Milk was harvested from the founder transgenic mice on day 7 and day 9 of lactation, and subjected to Western analysis to determine the expression level of MSP1-42, using a polyclonal anti-MSP antibody and a body 5.2 monoclonal anti-MSP (Dr. David Kaslow, NIH). The results indicated that the expression level of the MSPl-42 in the milk of the transgenic mice was 1-2 milligrams / milliliter (Figure 10). Construction of glycosylation sites of MSP1 minus 42 mutants Our analysis of MSP produced by milk revealed that the transgenic MSP protein was N-glycosylated. To eliminate the N-glycosylation sites in the MSP1-42 gene, the Asn (N) at positions 181 and 262 were replaced with Gln (Q). Substitutions were introduced by assigning the DNA oligos that are strengthened with the corresponding region of the MSP1 and that carry the AAC mutations to CAG. These oligos were then used as PCR primers to produce DNA fragments encoding the N-Q substitutions. To introduce the N262-Q mutation, a pair of oligos, MSPGYLYCO-3 (CAGGGAATGCTGCAGATCAGC) and MSP42-2 ( AATTCTCGA GTTAGTGGTGGTGGTGGTGGTGATCGCAGAAAATACCATG, Figure 11), to amplify by PCR the plasmid GTC627, which contains the synthetic MSP1-42 gene. The PCR product was cloned into the vector pCR2.1 (Invitrogen). This generated the plasmid GTC716. To introduce the N181-Q mutation, oligos MSPGLYCO-1 (CTCCTTGTTCAGGAACTTGTAGGG) and MSPGLCO-2 (GT CCTGCAGTACACATATGAG, Figure 4) were used to amplify plasmid GTC627. The PCR product was cloned into pCR2.1. This generated the plasmid GTC700. The double glycosylation mutant of the MSP was constructed by following three steps: first, an Xho I-Bsm fragment of the BC670 and the Bsm I-Xho "i" fragment of the GCT716"are ligated into the Xho I site of the vector pCR2.1 This resulted in a plasmid containing the MPS1-42 gene with the N262-Q mutation.The "EcoN I-Nde I fragment of this plasmid was then replaced by the EcoN I-Nde I fragment of the GTC716 plasmid. to introduce the second mutation, N181-Q. Finally, a fragment Xho I of this plasmid was cloned into the BC350, to generate the BC718 (Figure 12). Expression of the non-glycosylated MSP in transgenic animals BC718 has the following characteristics: it carries the MSP1-42 gene under the control of the casein-β promoter, so that it can be expressed in the mammary gland of the transgenic animal during lactation. In addition, it encodes a 15-amino acid casein-ß leader sequence that directly fuses with MSPl-42, so that MSP1-42, without any additional amino acid at its N-terminus, can be secreted into milk. Finally, due to the N-Q substitutions, the MSP that was produced in the milk of the transgenic animal through this construction will not be glycosylated. Taken together, the transgenic MSP that was produced in the milk by BC718 is the same as the parasitic MSP. A Sall / XhoI fragment was prepared from plasmid BC718 and microinjected into mouse embryos to generate transgenic mice. The transgenic animals were identified as described above. The milk from the founders was collected and analyzed by Western staining with the 5.2 antibody. The results, which are shown in Figure 13, indicate the expression of non-glycosylated MSP1 at a concentration of 0.5 to 1 milligram / milliliter. Equivalents Those skilled in the art will recognize, or may find out, using no more than routine experimentation, which is considered numerous equivalents as within the scope of this invention, and are covered by the following claims.

Claims (26)

1. CLAIMS 1. A known, modified nucleic acid of a parasite, which is capable of being expressed in a mammalian cell, wherein the modification comprises a reduction of the AT content of the gene by replacing one or more codons containing AT in the gene with a preferred codon encoding the same amino acid as the replaced codon.
2. 2. A known, modified nucleic acid of a parasite protein, which is capable of being expressed in a mammalian cell, wherein at least one motif of mRNA instability present in the gene coding sequence is eliminated by replacing said motif of instability of mRNA with a preferred codon encoding the same amino acid as the replaced codon.
3. 3. The modified nucleic acid of claim 1 or 2, wherein at least one or more codons of the known gene are replaced by a preferred codon of the milk protein, which encodes the same amino acid as the replaced codon.
4. 4. A known, modified nucleic acid of a parasite, which is capable of being expressed in a mammalian cell, where the overall AT content of the known gene encoding is reduced by replacement with a specific codon of the milk protein , and where at least one motif of mRNA instability present in the gene is eliminated by replacement with a specific codon of the milk protein and at least one codon of the natural gene is replaced by a specific codon of the milk protein, favorite.
5. 5. The modified nucleic acid of claim 4, wherein said modified nucleic acid is capable of expressing said protein at a level that is at least 100% of that expressed by said natural gene in a mammalian cell system in vi tro or in vivo.
6. 6. A method for preparing a known, modified, parasite nucleic acid for expression in a mammalian cell, comprising reducing the AT content of the natural gene by replacing one or more codons containing AT of the natural gene with a specific codon mammary, preferred, which encodes the same amino acid as the replaced codon.
7. 7. A method for preparing a known, modified, nucleic acid of a parasite protein, for expression in a mammalian cell, comprising removing at least one mRNA instability motif present in the gene coding sequence by replacing one or more motifs of mRNA instability in the gene with a specific mammary codon encoding the same amino acid as the replaced codon.
8. 8. The method of claim 5 or 6, further comprising replacing one or more codons in the natural gene encoding said protein with a mammary specific codon, preferred, encoding the same amino acid as the replaced codon.
9. 9. A modified nucleic acid sequence, prepared by the method according to claim 5 or 6.
10. 10. A method for preparing a known, modified, parasite nucleic acid for expression in a mammalian cell, comprising the steps of a) eliminate at least one motif of mRNA instability present in the natural gene encoding said protein by replacing one or more mRNA instability motifs in the gene with a specific codon of the preferred milk protein encoding the same amino acid that the codon replaced; b) reducing the AT-rich content of the natural gene encoding said protein by replacing one or more codons containing AT of the gene with a specific codon of the milk protein encoding the same amino acid as the replaced codon; and c) replacing one or more codons in the natural gene encoding said protein with a preferred mammary specific codon encoding the same amino acid as the replaced codon.
11. 11. A modified nucleic acid, prepared by the method according to claim 10.
12. 12. A modified nucleic acid of claim 1, wherein said parasite is malaria and said nucleic acid is a fragment of SEQ ID NO 1 or SEQ ID NO 9 or a sequence specifically homologous to them.
13. 13. A modified nucleic acid of claim 1, wherein said parasite is malaria and said nucleic acid is SEQ ID NO 9 or a fragment thereof or a sequence specifically homologous to it.
14. 14. A modified nucleic acid that is a fragment of SEQ ID NO 1 or a sequence specifically homologous to it, capable of being expressed in a cellular system, where the AT content of the natural gene is reduced by replacement of one or more codons with codons recognizable by said cell culture system that encodes the same amino acid as the replaced codon but that effectively reduces the overall AT content of the natural gene.
15. 15. A modified nucleic acid that is a fragment of SEQ ID NO 1 or a sequence specifically homologous to it, capable of being expressed in a cellular system, wherein at least one motif of mRNA instability present in the coding sequence of the gene natural is eliminated by replacing one or more codons comprising said motive of instability with a codon recognizable by said cellular system that effectively eliminates said motive of instability and encodes the same amino acid as the replaced codon.
16. 16. The modified nucleic acid of claim 14 or 15, wherein at least one or all of the codons of the native gene are replaced with preferred codons of said cellular system.
17. 17. A vector comprising the modified nucleic acid of claim 12.
18. 18. A host cell- transfected or transformed with a vector of claim 17.
19. 19. A transgenic expression construct, comprising the modified nucleic acid of the claim 12.
20. 20. A non-human transgenic animal, whose germ line comprises the modified nucleic acid of claim 12.
21. 21. A transgenic expression vector for the production of a transgenic animal comprising a promoter, operatively associated with the modified nucleic acid. of claim 12, wherein said promoter orders the expression of the mammary gland protein encoded by said modified nucleic acid into the milk of the animal.
22. 22. A known, modified nucleic acid of a bacterium, a virus, or a parasite, which is capable of being expressed in a cellular system where the AT content of the gene is reduced by replacement of one or more codons with recognizable codons by said cellular system encoding the same amino acid as the replaced codon, but which effectively reduces the overall AT-rich content of the natural gene.
23. 23. A modified nucleic acid of a bacterium, a virus, or a parasite, which is capable of being expressed in a cellular system, where at least one motif of mRNA instability present in the gene coding sequence is eliminated by replacing one or more codons comprising said motive of instability with a codon recognizable by said cellular system that effectively eliminates said motive of instability and encodes the same amino acid as the replaced codon.
24. 24. A modified nucleic acid of claims 22 or 23, wherein at least one or all of the codons of the native gene are replaced with preferred codons of said cellular system.
25. 25. A DNA vaccine, comprising a modified nucleic acid according to claim 24.
26. 26. A DNA vaccine, comprising a vector according to claim 17.