CN101123983A

CN101123983A - Modulation of antibody specificity by tailoring the affinity to cognate antigens

Info

Publication number: CN101123983A
Application number: CNA2005800446280A
Authority: CN
Inventors: W·达拉夸; M·金奇; K·卡莱斯-克尼奇
Original assignee: MedImmune LLC
Current assignee: MedImmune LLC
Priority date: 2004-10-27
Filing date: 2005-10-27
Publication date: 2008-02-13

Abstract

The present invention relates to methods and compositions designed for the treatment, management, prevention and/o amelioration of various disorders associated with aberrant expression and/or activity of one or more Eph receptor tyrosine kinase family members and/or one or more Eph receptor ligands, particularly the Ephrins. In particular, the invention provides methods for the treatment, management , prevention and/or amelioration of a disorder associated with aberrant expression and/or activity(ies) of one or more Eph receptors and/or one or more Ephrins, the method comprising administering to a subject in need thereof an effective amount of one or more Eph/Ephrin Modulators. The present invention further relates to methods of modulating antibody specificity by tailoring the affinity to cognate antigens.

Description

The specificity of antibody is regulated in specific modification to the affinity of related antigen

The application requires the priority of U.S. Provisional Patent Application that number 60/622,711 and 2005 year JIUYUE of the U.S. Provisional Patent Application submitted on October 27th, 2004 submitted on the 16th number 60/717,209, and the two is all received in full and is reference.

1. invention field

The present invention relates to the affinity of related antigen be regulated the method for described antibody specificity by specific modification (tailoring) antibody.The invention still further relates to and be designed for treatment, control, prevention and/or alleviate the method and composition of joining proteic expression and/or active relevant unusually various diseases with one or more Eph receptor tyrosine kinase family members and/or one or more Eph receptors ligand, particularly liver.Specifically, the invention provides and be used for the treatment of, control, prevent and/or alleviate the method for joining proteic expression and/or active unusual relevant disease with one or more Eph receptors and/or one or more livers, described method comprises that one or more Eph/ livers of the object effective dose that needs join protein modulators.The present invention also provides the affinity of the related antigen antibody through specific modification.

2. background of invention

Receptor tyrosine kinase (RTK) is to have a tyrosine kinase activity, and the transmembrane protein that constitutes by the outer ligand binding domains of born of the same parents and born of the same parents' intracellular domain (Surawska etc., 2004, Cytokine Growth Factor Rev., 15:419-433).This protein families comprises the different members more than 50 kinds, and is different classes of at least 19 kinds according to its structural group composition, comprises that somatomedin (for example, EGF, PDGF, FGF) and the receptor (Grassot etc. of insulin, 2003, NuclAcids Res., 31 (1): 353-358; Surawska etc., 2004, Cytokine Growth Factor Rev., 15:419-433).I class RTK comprises, for example EGFR, ERBB2, ERBB3 and ERBB4; II class RTK comprises, for example INSR, IRR and IG1R; III class RTK comprises, for example PDGF α, PDGF β, Fms, Kit and Flt3; IV class RTK comprises, for example FGFR1, FGFR2, FGFR3, FGFR4 and BFR2; V class RTK comprises, for example Flt1, Flt2 and Flt4; VI class RTK comprises EphA1-EphA8 and EphB1-EphB6; VII class RTK comprises TrkA, TrkB and TrkC (Grassot etc., 2003, Nucl Acids Res., 31 (1): 353-358; Grassot etc., www.irisa.fr/jobim/papiers/O-p199_012.pdf).Tyrosine residue autophosphorylation in (kytoplasm) domain in the outer binding structural domain zygotic induction born of the same parents of part and born of the same parents, and then form the signal transduction complex and activate downstream signal transductory cascade reaction (Surawska etc., 2004, Cytokine Growth Factor Rev., 15:419-433).

The Eph receptor is the maximum subtribe of receptor tyrosine kinase (RTK), its part (liver is joined albumen) plays crucial effects in animal development and various activities biology of ripening period (its summary can be referring to Zhou etc., 1998, Pharmacol.Ther., 77:151-181; Himanen and Nikolov, 2003, Trends inNeurosci., 26:46-51; Murai and Pasquale, 2003, J Cell Sci., 116:2823-2832; Kullander and Klein, 2002, Nature Rev., 3:475-486).The Eph/ liver is joined protein mediated signal transduction at many important biological functions, comprise work in form generation, vascular development, cell migration, axon guidance and the synaptic plasticity (synaptic plasticity) (Kullander and Klein, 2002, Nature Rev., 3:475-486).In mammal, identify 15 kinds of Eph receptors (EphA1-A8 and EphA10 at present, and EphB1-B6) and 8 kinds of livers join protein ligands (liver join protein A 1-A5 regulating liver-QI join protein B 1-B3) (referring to, for example " Unified Nomenclature For Eph Family Receptors AndTheir Ligands; The Ephrins " (Eph receptor family and their part, liver is joined proteic unified term), Eph Nomenclature Committee (Eph NK), publish in Cell, 90:403-404,1997; Surawska etc., 2004, Cytokine Growth Factor Rev., 15:419-433; Siddiqui and Cramer, 2005, J Comp Neurol., 482 (4): 309-319; Aasheim etc., 2005, Biochim Biophys Acta, 1723 (1-3): 1-7; Zhou etc., 1998, Pharmacol.Ther., 77:151-181).According to the binding affinity of sequence conservation and they, the Eph regulating liver-QI join albumen all can be divided into A and B two subclass (Eph Nomenclature Committee (Eph NK), 1997, Cell, 90:403-404).Except EphA4 can be with A type and Type B part combine, the A type Eph receptor (EphA1-A8) of 8 kinds of evaluations can both be joined albumen (EFNA1-A5) by the bonded 5 kinds of A type livers of glycosyl-phosphatidyl inositol (GPI) anchorin and cell membrane usually and be intersected interaction (though affinity is different) (Kullander and Klein, 2002, Nature Rev., 3:475-486).Type B Eph receptor (EphB1-B6) show can by 3 kinds of Type B livers that hydrophobic transmembrane and short cytoplasmic structure territory link to each other with cell membrane join albumen (EFNB1-B3) interaction (Kullander and Klein, 2002, Nature Rev., 3:475-486).

It is two-way that the Epb/ liver is joined protein mediated signal transduction, thus it be dynamic (referring to, for example Gauthier and Robbins, 2003, Life Sciences, 74:207-216; Murai and Pasquale, 2003, J.Cell Sci., 116:2823-2832; Kullander and Klein, 2002, Nature Rev., 3:475-486; Holder and Klein, 1999, Development, 126:2033-2044).The Eph receptor combines the conformational change that causes receptor with its part, and the Eph tyrosine kinase domain that activates high conservative subsequently is in the typical receptor forward signal of endocellular transduction (receptor forwardsignal) of expressing this receptor.Simultaneously, reverse signal is transduceed join proteic cell into the expression liver.The Eph/ liver is joined protein mediated signal transduction and can concentrate on and manyly join albumen and cellular signal transduction pathways near the fit interaction of molecules of other signal transduction of cell membrane by Eph and/or liver, comprises the Src kinases family that participates in mitogen-activated protein kinase (MAPK) approach signal transduction; Participate in the Grb2 of platelet derived growth factor (PDGF) and epidermal growth factor (PDGF) signal transduction; Phosphatidyl-inositol 3-kinase (PI3K); Participate in the Rho Mediated Signal Transduction Crk (referring to, for example Kullander and Klein, 2002, Nature Rev., 3:475-486); With low-molecular-weight phosphotyrosine phosphatase (LMW-PTP), it is raised and proves already and such as endothelium capillary tube sample assembling (endothelial capillary-like assembly) relevant (Stein etc. with the cell attachment functional response, 1998, Genes Dev., 12:667-678).

Yet, to them in disease, the evidence that the further investigation day by day that particularly acts in the cancer obtains supports the Eph/ liver to join protein mediated signal transduction in lysis, have during for example angiogenesis, tumor generate and shift effect (referring to, for example Sullivan and Bicknell, 2003, British J.Cancer, 89:228-231; Cheng etc., 2002, Cytokine ﹠amp; Growth Factor Rev., 13:75-85; Nakamoto and Bergemann, 2002, Microscopy Res.﹠amp; Technique, 59:58-67).Studied Eph receptor expression in all kinds cancer, described cancer includes but not limited to: breast carcinoma (Wu etc., 2004, Pathol.Oncol.Res., 10:26-33), colon cancer (Stephenson etc., 2001, BMC Mol.Biol., 2:15-23), osteosarcoma (Varelias etc., 2002, Cancer, 95:862-869) and esophageal carcinoma (Nemoto etc., 1997, Pathobiology, 65:195-203).In fact, first kind of Eph receptor of evaluation, EphA1 be from human liver cell (eph) cancerous cell line that produces erythropoietin separate (Hirai etc., 1987, Science, 238:1717-1720).

3. summary of the invention

The present invention partly be according to find specificity Eph receptor tyrosine kinase and/or their part (liver is joined albumen) with various diseases, include but not limited to abnormal expression in some relevant of cancer tissues and the cell type (that is, expression inadequately, overexpression or do not express) with inflammation.The present invention utilizes Eph receptor regulating liver-QI to join the interaction of multiple interaction between the albumen and they and the multiple signal transducers in downstream.Explore Eph receptor regulating liver-QI and joined the high conservative of protein structure domain and the high superposed of functional group, the invention provides and be designed for treatment, control, prevention and/or alleviate the method and composition of joining proteic expression and/or active relevant unusually various diseases with one or more Eph receptor tyrosine kinase family members and/or one or more Eph receptors ligand, particularly liver.Prevention of the present invention and Therapeutic Method comprise separately or unite other prevention or medicine and give the multiple Eph kinases of one or more preferential targeting of effective dose and/or liver and join proteic Eph/ liver and join protein modulators.In some embodiments, according to the disease of being treated, Eph/ liver of the present invention is joined protein modulators by regulating one or more Eph kinases and/or liver and join proteic expression and/or activity coming excitement and/or antagonism Eph receptor and/or liver to join protein active and/or stability.

In the specific embodiment of the present invention, be designed to join proteic unique zone with concrete Eph receptor and/or liver and combine and/or interact and regulate this Eph receptor and/or liver is joined proteic activity and/or expression thereby Eph/ liver of the present invention can be joined protein modulators.In another specific embodiment, be designed to join between the albumen common or homologous zone with concrete Eph receptor and/or liver and combine and/or interact and to regulate multiple Eph receptor simultaneously and/or liver is joined proteic activity and/or expression thereby can Eph/ liver of the present invention be joined protein modulators according to the inventive method.

The invention provides Eph receptor and/or liver and join proteic regulator (" the Eph/ liver is joined protein modulators ").The non-limitative example that the Eph/ liver is joined protein modulators is by (directly or indirectly): (i) for example transcribing, after transcribing, translation or translation back horizontal adjustment Eph receptor are (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or the endogenic ligand of Eph receptor (for example, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) expression; And/or regulate (ii) that Eph receptor and/or liver are joined proteic activity and the medicine of giving biological efficacy.

The example that the Eph/ liver is joined protein modulators includes but not limited to suppress or to reduce the endogenic ligand of Eph receptor and Eph receptor, and for example liver is joined interactional medicine between the albumen (hereinafter referred to as " the Eph/ liver is joined the protein-interacting inhibitor ").The non-limitative example that the Eph/ liver is joined the protein-interacting inhibitor comprises: (i) can with the Eph receptors bind, prevent or reduce Eph receptor regulating liver-QI and (for example join between the albumen medicine that interacts and induce the transduction of Eph receptor signal, liver join proteic soluble form (as, monomeric form or poly form)), with can with the Eph receptors bind, the antibody (that is Eph receptor agonism antibody (agonistic antibody)) of inducement signal transduction and Eph receptor phosphorylation; (ii) can with the Eph receptors bind, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction and prevent or induce very low medicine (for example, Eph receptor antagonism antibody regulating liver-QI is joined proteic dominant form (dominant negative form)) of transduceing to the Eph receptor signal that can ignore level; (iii) can join protein binding with liver, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction, and induce liver to join the medicine of protein signal transduction (for example, the soluble form of Eph receptor and can join protein binding with liver and induce liver to join the antibody of protein signal transduction); (iv) can join protein binding with liver, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction and prevent or induce very low medicine (for example, the dominant form of Eph receptor and resisting-liver is joined protein antibodies) to the Eph receptor signal transduction that can ignore level.

In other embodiments, the Eph/ liver is joined the medicine that protein modulators includes but not limited to regulate the Eph expression of receptor.This medicine can (for example reduce/reduce the Eph expression of receptor, Eph receptor antisense molecule, RNAi and ribozyme) or raising/rise Eph expression of receptor and make the Eph of cell surface surpassed by the scale of construction (for example to can be used for bonded endogenic ligand, liver is joined albumen) amount, therefore improve unconjugated Eph and be subjected to the scale of construction (for example, the nucleic acid of coding Eph receptor).

In other embodiments, the Eph/ liver to join protein modulators be to regulate the medicine that liver is joined protein expression.This medicine can reduce/reduce liver and join protein expression (for example, liver is joined the albumen antisense molecule, RNAi and ribozyme) or raising/rise liver and join protein expression (for example, the coding liver is joined proteic nucleic acid).

In also having other embodiment, Eph/ liver of the present invention joins that protein modulators includes but not limited to regulate the Eph receptor or liver is joined proteic protein stability or the cumulative medicine of protein.

In other embodiments, Eph/ liver of the present invention to join protein modulators be to promote the kinase activity medicine of (for example, the activity of Eph receptor, liver are joined proteic activity or known activity of joining the relevant heterologous protein of albumen with the Eph receptor or the liver of cell membrane).

In also having other embodiment, the Eph/ liver is joined protein modulators and includes but not limited to: can and prevent or reduce Eph receptor signal transduction with the Eph receptors bind, but do not suppress or reduce Eph receptor regulating liver-QI and join the medicine of albumen interphase interaction (for example, Eph receptor intracellular antibody); Can join protein binding with liver and prevent or reduce liver and join protein signal transduction, but not suppress or reduce the medicine (for example, B-type liver is joined the albumen intracellular antibody) that liver is joined albumen and Eph receptor interaction.

In a specific embodiment, it is not to suppress or to reduce Eph receptor and endogenic ligand that the Eph/ liver is joined protein modulators, and for example liver is joined the medicine of albumen interphase interaction.In another specific embodiment, it is not to regulate the medicine that (raise or reduce) Eph receptor and/or liver are joined protein expression that the Eph/ liver is joined protein modulators.In also having an embodiment, it is not can regulate the Eph receptor or liver is joined proteic protein stability or the cumulative medicine of protein that the Eph/ liver is joined protein modulators.Also have in another embodiment of the present invention, it is not to promote the kinase activity medicine of (for example, the activity of Eph receptor, liver are joined proteic activity or known activity of joining the relevant heterologous protein of albumen with the Eph receptor or the liver of cell membrane) that the Eph/ liver is joined protein modulators.In another specific embodiment, it is not and to prevent or reduce Eph receptor signal transduction with the Eph receptors bind that the Eph/ liver is joined protein modulators, but do not prevent Eph receptor regulating liver-QI join the albumen interphase interaction medicine; Or be not can join protein binding with liver and prevent or reduce liver and join protein signal transduction, but do not prevent liver join albumen and Eph receptor interaction medicine.In a specific embodiment, it is not EphA2 agonistic antibody or EphA2 antagonistic antibodies that the Eph/ liver is joined protein modulators.In another specific embodiment, it is not that Eph receptor antisense molecule or liver are joined the albumen antisense molecule that the Eph/ liver is joined protein modulators.In also having another embodiment, it (Eph-Fc) or not is that the liver of soluble form is joined albumen (for example, liver is joined albumen-Fc) for example, that the Eph/ liver is joined the Eph receptor that protein modulators is not a soluble form.

The present invention also part to receptor tyrosine kinase (RTK) family (for example exists according to finding, the Eph receptor family) the general specific antibody of member or classification receptor (pan-specific antibody), specificity that then can specific this antibody of modification is to change the specificity to those related antigens in same RTK family or the classification.In one embodiment, the invention provides specificity through specific modification and can with at least two bonded general specific antibodies of member's specificity of receptor tyrosine kinase family method, described method comprises each aminoacid randomization (randomize) of the CDR that makes described general specific antibody; Generation contains the library of described randomization CDR; Screen the clone who in the described library required receptor affinity is raise or reduces.

In another embodiment, the present invention also provide can with the bonded monoclonal antibody of at least one member's specificity of Eph receptor family, can the described monoclonal antibody of specific modification make it that at least one member of described Eph family is had required affinity.

3.1 Definition

Term used herein " unusually " refers to depart from standard, for example common health objects or cell and/or common health objects of a group or cell.Term used herein " unconventionality expression " refers to compare the gene outcome of certain cell or object (for example, RNA, protein, polypeptide or peptide) unconventionality expression with normal healthy cell or object and/or a group normal healthy cell or object.This unconventionality expression can be due to gene amplification or gene expression are suppressed.In a specific embodiment, Eph receptor or liver are joined albumen relevant " unconventionality expression " and refer to that one or more Eph receptors and/or liver join proteic expression rising, reduction or inappropriate.In concrete embodiment, term " active unusual " refers to that Eph receptor or liver join protein active and depart from normal activity at healthy cell or object and/or a group normal healthy cell or object.

Term used herein " medicine " refers to have the molecule of required biological efficacy.Medicine can be preventative or curative.Medicine comprises and being not limited to: protein molecular, include but not limited to peptide, and polypeptide, protein comprises protein, fusion rotein, antibody of post translational modification etc.; Micromolecule (less than 1000 dalton) comprises inorganic or organic compound; Nucleic acid molecules includes but not limited to two strands or single stranded DNA or two strands or single stranded RNA (as antisense (molecule), RNAi etc.), intron sequences, triple helical nucleic acid molecules and fit; Or vaccine (as, Li Site and Fei Lisite vaccine).Medicine can be available from any known biology (including but not limited to: animal, plant, antibacterial, fungus and protozoacide or virus) or synthetic molecules storehouse.Join the medicine of protein modulators as the Eph/ liver and can regulate (directly or indirectly): (i) Eph receptor, for example EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6; And/or the endogenic ligand of Eph receptor, for example liver is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and join protein B 2 or liver and join the expression of protein B 3 (for example, when transcribing, when transcribing back, translation or translation back level); And/or the (ii) endogenic ligand of Eph receptor and/or Eph receptor, for example liver is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and join the activity that protein B 2 or liver are joined protein B 3.

Term used herein " analog " at protein drug (for example, peptide, polypeptide, protein or antibody) context in refer to have with second protein drug (for example, Eph receptor polypeptides or liver are joined protein polypeptide) similar or identical functions, but not necessarily comprise the aminoacid sequence similar or identical or the protein drug of structure with this second protein drug.Protein drug with similar aminoacid sequence refers to satisfy at least the protein drug of one of following standard: the aminoacid sequence that (a) has has at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical protein drug with the aminoacid sequence of second protein drug; (b) by can be under rigorous condition and at least 20 amino acid residues of coding second protein drug, at least 30 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino acid residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, the nucleotide sequence coded protein drug of the nucleotide sequence hybridization of at least 125 amino acid residues or at least 150 amino acid residues; (c) by showing at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 5 5%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical nucleotide sequence coded protein drug with the nucleotides sequence of coding second protein drug.Have to the protein drug of the second protein drug analog structure refer to have the secondary similar to second protein drug, the protein drug of three grades or quarternary structure.Available method known to those skilled in the art (including but not limited to X-radiocrystallography, nuclear magnetic resonance, NMR and ultramicroscope crystal pattern (crystallographic electron microscopy)) is measured the structure of protein drug.Protein drug preferably has the Eph receptor or liver is joined protein active.

For measuring the homogeny percentage ratio of two aminoacid sequences or two nucleotide sequences, for the best comparison purpose is compared these sequences (for example, introduce the room and second aminoacid or nucleotide sequence in first aminoacid or nucleotide sequence and do best comparison).Then relatively or be in the amino acid residue or the nucleotide of corresponding amino acid position or nucleotide position.In the amino acid residue of certain position or nucleotide and second sequence during relevant position identical, two kinds of molecules are identical in this position in occupying first sequence.Homogeny percentage ratio between the two sequences is the function (that is lap position number/total number of positions * 100% that, homogeny %=is identical) of the common same position number of these sequences.In one embodiment, two sequences is isometric.

Also can adopt the homogeny percentage ratio between the mathematical algorithm mensuration two sequences.The preferred non-limitative example that is used for the mathematical algorithm of comparison two sequences is Karlin and Altschul algorithm (1990, Proc.Natl.Acad.Sci.U.S.A., 87:2264-2268), by Karlin and the improved algorithm (1993 of Altschul, Proc.Natl.Acad.Sci.U.S.A., 90:5873-5877).This algorithm is included in Altschul etc., and (1990, J.Mol.Biol. is in NBLAST 215:403) and the XBLAST program.Can utilize NBLAST nucleotide program parameter to set, for example scoring=100, word length=12 are carried out BLAST nucleotide and are retrieved and obtain and the homologous nucleotide sequence of nucleic acid molecules of the present invention.Can utilize the XBLAST program parameter to set, for example scoring-50, word length=3 are carried out BLAST protein and are retrieved and obtain and the homologous aminoacid sequence of protein molecule of the present invention.Can utilize Altschul etc. (1997, Nucleic AcidsRes., 25:3389-3402) described room BLAST obtains the relatively room comparison of purpose.Perhaps, can utilize PSI-BLAST to carry out the iterative searching (Id.) of distance relation between detection molecules.When utilizing BLAST, room BLAST and PSI-Blast program, can utilize separately program () default parameters (referring to, NCBI website for example) for example, XBLAST and NBLAST's.The algorithm that another the preferred non-limitative example that is used for the mathematical algorithm of comparative sequences is Myers and Miller (1988, CABIOS, 4:11-17).This algorithm is contained in ALIGN program (2.0 version), and this program is the part of GCG sequence alignment software kit.When utilizing ALIGN program comparing amino acid sequence, can utilize PAM120 weighted residual table, room length point penalty 12, a gap penalty 4.

Can adopt the homogeny percentage ratio that is similar between above-mentioned technology (allowing or do not allow to add the room) mensuration two sequences.Calculate homogeny percentage ratio and only count accurate coupling usually.Term used herein " analog " refers to have in the context of non-albumen analog and the similar or identical functions of the first organic or inorganic molecule, and on the structure with the similar second organic or inorganic molecule of this first organic or inorganic molecule.

Term used herein " with the bonded antibody of Eph receptor-specific " and similar term refer to and can combine with the fragments specific of Eph receptor (e.g., EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 and EphB6) polypeptide or Eph receptor polypeptides, but do not combine the antibody of (can not combine perhaps in some embodiments) with other Eph receptor-specific with non-Eph receptor polypeptides specificity.Can with Eph receptor polypeptides or the bonded antibody of its fragments specific not can with the antigen generation cross reaction beyond the Eph receptor family.Can pass through, for example immunoassay or other technical appraisement well known by persons skilled in the art can with Eph receptor polypeptides or the bonded antibody of its fragments specific.In one embodiment, the activity that can only regulate the Eph receptor with Eph receptor polypeptides or the bonded antibody of the present invention of its fragments specific, and not obvious other activity that influences.In a specific embodiment, antibody capable of the present invention combines with one or more member's specificitys in receptor tyrosine kinase family or the classification.In other specific embodiment, antibody capable of the present invention combines with all member's specificitys of Eph receptor family.In another specific embodiment, antibody capable of the present invention combines with all member's specificitys of EphA receptor family.In another specific embodiment, at least one of antibody capable of the present invention and Eph receptor family, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least ten one, at least ten two, at least ten three, at least ten four or at least ten five member's specificitys combine.

About binding specificity, one or more members' of antibody of the present invention and receptor tyrosine kinase family or classification (for example, Eph receptor family) specificity is in conjunction with not obscuring with term " cross reaction ".Term " cross reaction " is interpreted as representing bad non-specific binding.In some embodiments, antibody capable of the present invention combines with several different members specificitys in the Eph receptor family.In some embodiments, this characteristic is the required character of antibody of the present invention, within the scope of the present invention, can think that their combination (combining with the one or more members in the Eph family) is specific.In another specific embodiment, the Eph receptor antibody is not anti--EphA2 antibody or is not anti--EphA4 antibody.In also having another specific embodiment, the Eph receptor antibody is not D7, EA2, EA5, B233, B207 or B208.

Term used herein " join the bonded antibody of protein-specific " with liver and similarly term refer to that can join albumen (e.g., liver join protein A 1, liver join protein A 2, liver join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver is joined protein B 2 regulating liver-QI and joins protein B 3) polypeptide or liver with liver joins the fragments specific of protein polypeptide and combine, but can not join the antibody that the protein polypeptide specificity combines (perhaps preferably can not join protein binding with other liver) with non-liver.In one embodiment, can with liver join protein polypeptide or the bonded antibody of its fragments specific not can with other antigen generation cross reaction.Can pass through, for example immunoassay or other technical appraisement well known by persons skilled in the art can be joined protein polypeptide or the bonded antibody of its fragments specific with liver.In one embodiment, can join protein polypeptide or the bonded antibody of its fragments specific with liver and can only regulate liver and join proteic activity, and not obvious other activity that influences.

Antibody of the present invention includes but not limited to: the Fv (sdFv) that the antibody that synthetic antibody, monoclonal antibody, reorganization produce, multi-specificity antibody (comprising bi-specific antibody), people's antibody, humanized antibody, chimeric antibody, intracellular antibody, strand Fv (scFv) (for example, comprising monospecific and bispecific etc.), Fab fragment, F (ab ') fragment, disulfide bond are connected, antiidiotype (resist-Id) the epi-position binding fragment of antibody and above any antibody.Specifically, antibody of the present invention comprises the immunologic competence part of immunoglobulin molecules and immunoglobulin molecules, promptly contain and (for example to join the bonded antigen-binding site of proteantigen specificity with Eph receptor antigen or liver, anti--the Eph receptor antibody (as, anti--EphA1,-EphA2,-EphA3,-EphA4,-EphA5,-EphA6,-EphA7,-EphA8,-EphA10,-EphB1,-EphB2,-EphB3,-EphB4,-EphB5 or-EphB6 antibody) or anti-liver join protein antibodies (as, anti--liver is joined protein A 1,-liver is joined protein A 2,-liver is joined protein A 3,-liver is joined protein A 4,-liver is joined protein A 5,-liver is joined protein B 1,-liver join protein B 2 or-liver joins protein B 3 antibody) one or more complementary determining regions (CDR)) molecule.Antibody of the present invention can be any kind (for example, IgG, IgE, IgM, IgD, IgA and IgY), classification (for example, IgG ₁, IgG ₂, IgG ₃, IgG ₄, IgA ₁And IgA ₂) or the immunoglobulin molecules of subclass.

Term used herein " cancer " refers to that the cell of disease has the potential that is transferred to distal site and shows the phenotypic character that is different from non-cancerous cell, described phenotypic character for example refers to form colony in three-dimensional substrates thing (for example soft agar) or at three-dimensional substrates film (basement membrane) or extracellular matrix goods, for example MATRIGEL ^TMMiddle microtubule network or the pseudostructure of forming.Non-cancerous cell can not form colony in soft agar, can not form chondritic clearly in three-dimensional Ranvier's membrane or extracellular matrix goods.Cancerous cell obtains the series of features sexual function in its growth course, though be to pass through different mechanisms.This function comprise evade apoptosis, growth signals self-sufficient, antagonism-growth signals is insensitive, the tissue intrusion/transfer ability, infinite copy potential and persistent angiogenesis.Term " cancerous cell " refers to comprise precancer and pernicious cancerous cell.

Term used herein " stimulates cellular proliferation " finger protein molecule (including but not limited to protein, antibody of peptide, polypeptide, protein, post translational modification etc.), micromolecule (less than 1000 dalton), inorganic or organic compound, nucleic acid molecules (including but not limited to two strands or single stranded DNA or two strands or single stranded RNA (for example, antisense (nucleic acid), RNAi etc.) and triple helical nucleic acid molecules) can be in vivo or externally keep, improve, quicken or prolong cell proliferation, growth and/or survival.Can adopt any method that can detect cell proliferation, growth and/or survival, for example whether be the medicine that stimulate cellular proliferation in cell proliferation test or epithelium barrier integrity test (epithelialbarrier integrity assay) if measuring certain medicine.The medicine that stimulates cellular proliferation is added also can keep, regenerate in the colony of hyper-proliferative or damaged cell or rebuild epithelium.

Term used herein " derivant " refers to contain in the context of protein drug (for example, peptide, polypeptide, protein or antibody) because of introducing the protein drug that amino acid residue replaces, lacks and/or add the aminoacid sequence that changes.Term used herein " derivant " also refers to modified protein drug, promptly links to each other with this protein drug covalency by the molecule with certain type.For example (but being not limited to), thus by should known protection/blocking group, the proteolysis cutting, be connected with cell ligand or other protein etc. and the derive protein drug derivant of generation of glycosylation, acetylation, pegization, phosphorylation, amidatioon.Can adopt technology well known by persons skilled in the art to carry out the derivant that chemical modification produces protein drug, described technology includes but not limited to that the metabolism of specificity chemical cleavage, acetylation, formylated, tunicamycin is synthesized.In addition, the derivant of protein drug can contain one or more atypia aminoacid.The derivant of protein drug can have with its derived from the protein drug identical functions.In a specific embodiment, the derivant of protein drug is the derivant of following material: the Eph receptor polypeptides (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6 polypeptide), liver is joined protein polypeptide, and (for example, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3 polypeptide), Eph receptor polypeptides or liver are joined the fragment of protein polypeptide, can with the bonded antibody of Eph receptor polypeptides specificity or its fragment, or can join the bonded antibody of protein polypeptide specificity or its fragment with liver.In one embodiment, the derivant of following material has or identical functions similar to this material: Eph receptor polypeptides or liver are joined protein polypeptide, Eph receptor polypeptides or liver and join the fragment of protein polypeptide, can or can join the bonded antibody of protein polypeptide specificity or its fragment with liver with the bonded antibody of Eph receptor polypeptides specificity or its fragment.In another embodiment, compare with unaltered polypeptide, the derivatives active of following material changes: Eph receptor polypeptides, liver are joined protein polypeptide, Eph receptor polypeptides or liver and join the fragment of protein polypeptide, can or can join protein polypeptide or the bonded antibody of its fragments specific with liver with Eph receptor polypeptides or the bonded antibody of its fragments specific.Example, antibody derivatives or its fragment can combine or more anti-Proteolytic enzyme more firmly with its epi-position.

Term used herein " effective dose " refers to that therapeutic agent (for example, preventative or curative drug) consumption is enough to alleviate and/or alleviate the order of severity and/or the persistent period of certain disease or its symptom, prevent described disease progression, cause described disease to disappear, prevent one or more symptomatic recurrence, development or outbreak with described disease association, or the prevention or the treatment that improve or improve another therapeutic agent (for example, preventative or curative drug) are renderd a service.The non-limitative example that the Eph/ liver is joined the effective dose of the protein modulators X chapter that sees below.

Term used herein " endogenic ligand " or " native ligand " refer to can with the normal bonded molecule of special receptor in the body.For example (be not limited to), any A type liver join protein ligands (as, liver is joined protein A 1, liver and joins that protein A 2, liver are joined protein A 3, liver is joined protein A 4 regulating liver-QI and joins protein A 5) can with any A type Eph receptor (as, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8 and EphA10) combination; Any B-type liver join protein ligands (as, liver is joined protein B 1, liver is joined protein B 2 regulating liver-QI and joins protein B 3) can with any B-type Eph receptor (as, EphB1, EphB2, EphB3, EphB4, EphB5 and EphB6).Such as but not limited to, EphA4 also can join protein ligands with A-type described herein and B-type liver, and the two combines.

Term used herein " Eph receptor " or " Eph receptor tyrosine kinase " have referred to or will be by EphNomenclature Committee (Eph NK) (Eph NKs, 1997, Cell, 90:403-404) any Eph receptor of identifying and approving.Eph receptor of the present invention includes but not limited to: EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 and EphB6.In a specific embodiment, the Eph receptor polypeptides is from any species.In another specific embodiment, Eph receptor polypeptides source is the people.Visible list of references of the nucleotide sequence of Eph receptor polypeptides and/or aminoacid sequence or common data base (for example, GenBank), perhaps can adopt clone well known by persons skilled in the art and sequencing technologies to measure its nucleotide sequence and/or aminoacid sequence.The nucleotide sequence of people Eph receptor and the GenBank accession number of aminoacid sequence are summarized in following table 1.The aminoacid sequence of the mammal Eph receptor of having identified at present also can be referring to Fig. 1.

Table 1

The Eph receptor	Nucleotide sequence	Aminoacid sequence
The Eph receptor	Nucleotide sequence	Aminoacid sequence	EphA1	NM_005232.2(SEQ ID NO：1)	NP_05223.2(SEQ ID NO：2)
EphA2	NM_004431.2(SEQ ID NO：3)	NP_004422.2(SEQ ID NO：4)	EphA1	NM_005232.2(SEQ ID NO：1)	NP_05223.2(SEQ ID NO：2)
EphA2	NM_004431.2(SEQ ID NO：3)	NP_004422.2(SEQ ID NO：4)	EphA3, variant 1	NM_005233.3(SEQ ID NO：5)	NP_005224.2(SEQ ID NO：6)
EphA3, variant 2	NM_182644.1(SEQ IDNO：7)	NP_872585.1(SEQ ID NO：8)	EphA3, variant 1	NM_005233.3(SEQ ID NO：5)	NP_005224.2(SEQ ID NO：6)
EphA3, variant 2	NM_182644.1(SEQ IDNO：7)	NP_872585.1(SEQ ID NO：8)	EphA4	NM_00443 8.3(SEQ ID NO：9)	NP_004429.1(SEQ ID NO：10)
EphA5, variant 1	NM_004439.3(SEQ ID NO：11)	NP_004430.2(SEQ ID NO：12)	EphA4	NM_00443 8.3(SEQ ID NO：9)	NP_004429.1(SEQ ID NO：10)
EphA5, variant 1	NM_004439.3(SEQ ID NO：11)	NP_004430.2(SEQ ID NO：12)	EphA5, variant 2	NM_182472.1(SEQ ID NO：13)	NP_872272.1(SEQ ID NO：14)
EphA6 (expectation)	XM_114973.4(SEQ ID NO：15)	XP_114973.4((SEQ IDNO：16)	EphA5, variant 2	NM_182472.1(SEQ ID NO：13)	NP_872272.1(SEQ ID NO：14)
EphA6 (expectation)	XM_114973.4(SEQ ID NO：15)	XP_114973.4((SEQ IDNO：16)	EphA7	NM_004440.2(SEQ ID NO：17)	NP_004431.1(SEQ ID NO：18)
EphA8	NM_020526.2(SEQ ID NO：19)	NP_0653 87.1(SEQ ID NO：20)	EphA7	NM_004440.2(SEQ ID NO：17)	NP_004431.1(SEQ ID NO：18)
EphA8	NM_020526.2(SEQ ID NO：19)	NP_0653 87.1(SEQ ID NO：20)	EphA10	AJ872185.1(SEQ ID NO：206)	CAI43321.1(SEQ ID NO：207)
EphB1	NM_004441.2 (SEQ ID NO：21)	NP_004432.1(SEQ ID NO：22)	EphA10	AJ872185.1(SEQ ID NO：206)	CAI43321.1(SEQ ID NO：207)

EphB2, variant 1	NM_017449.1(SEQ ID NO：23)	NP_059145.1(SEQ ID NO：24)
EphB2, variant 1	NM_017449.1(SEQ ID NO：23)	NP_059145.1(SEQ ID NO：24)	EphB2, variant 2	NM_004442.4(SEQ ID NO：25)	NP_004433.2(SEQ ID NO：26)
EphB3	NM_004443.3(SEQ ID NO：27)	NP_004434.2(SEQ ID NO：28)	EphB2, variant 2	NM_004442.4(SEQ ID NO：25)	NP_004433.2(SEQ ID NO：26)
EphB3	NM_004443.3(SEQ ID NO：27)	NP_004434.2(SEQ ID NO：28)	EphB4	NM_004444.3(SEQ ID NO：29)	NP_004435.3(SEQ ID NO：30)
EphB5 (chicken; Bao Dao human sequence not)	NM_001004387.1(SEQ ID NO：112)	NP_001004387.1 (SEQ IDNO：113)	EphB4	NM_004444.3(SEQ ID NO：29)	NP_004435.3(SEQ ID NO：30)
EphB5 (chicken; Bao Dao human sequence not)	NM_001004387.1(SEQ ID NO：112)	NP_001004387.1 (SEQ IDNO：113)	EphB6	NM_004445.1(SEQ ID NO：31)	NP_004436.1(SEQ ID NO：32)

Have referred to term used herein " liver is joined albumen " or " liver is joined protein ligands " or will be by EphNomenclature Committee (Eph NK) (Eph NK, 1997, Cell 90:403-404) identifies and any liver of approval is joined protein ligands.Liver of the present invention is joined albumen and includes but not limited to: liver is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver is joined protein B 2 regulating liver-QI and joins protein B 3.In a specific embodiment, liver is joined protein polypeptide from any species.In another specific embodiment, it is the people that liver is joined the protein polypeptide source.Liver is joined the nucleotide sequence of protein polypeptide and/or the visible list of references of aminoacid sequence or common data base and (for example, GenBank), perhaps can adopt clone well known by persons skilled in the art and sequencing technologies to measure its nucleotide sequence and/or aminoacid sequence.The GenBank accession number that the people liver is joined proteic nucleotide sequence and aminoacid sequence is summarized in following table 2.The mammal liver of having identified is at present joined proteic aminoacid sequence also can be referring to Fig. 2.

Table 2

Liver is joined albumen	Nucleotide sequence	Aminoacid sequence
Liver is joined albumen	Nucleotide sequence	Aminoacid sequence	EprinA1, variant 1	NM_004428.2(SEQ ID NO：33)	NP_004419.2(SEQ ID NO：34)
Liver is joined protein A 1, variant 2	NM_182685.1(SEQ ID NO：35)	NP_872626.1(SEQ ID NO：36)	EprinA1, variant 1	NM_004428.2(SEQ ID NO：33)	NP_004419.2(SEQ ID NO：34)
Liver is joined protein A 1, variant 2	NM_182685.1(SEQ ID NO：35)	NP_872626.1(SEQ ID NO：36)	Liver is joined protein A 2	NM_001405.2(SEQ ID NO：37)	NP_001396.2(SEQ ID NO：38)
Liver is joined protein A 3	NM_004952.3(SEQ ID NO：39)	NM_004952.3(SEQ IDNO：40)	Liver is joined protein A 2	NM_001405.2(SEQ ID NO：37)	NP_001396.2(SEQ ID NO：38)
Liver is joined protein A 3	NM_004952.3(SEQ ID NO：39)	NM_004952.3(SEQ IDNO：40)	Liver is joined protein A 4, variant 1	NM_005227.2(SEQ ID NO：41)	NP_005218.1(SEQ ID NO：42)
Liver is joined protein A 4, variant 2	NM_182689.1(SEQ ID NO：43)	NP_872631.1(SEQ ID NO：44)	Liver is joined protein A 4, variant 1	NM_005227.2(SEQ ID NO：41)	NP_005218.1(SEQ ID NO：42)
Liver is joined protein A 4, variant 2	NM_182689.1(SEQ ID NO：43)	NP_872631.1(SEQ ID NO：44)	Liver is joined protein A 4, variant 3	NM_182690.1(SEQ ID NO：45)	NP_872632.1(SEQ ID NO：46)
Liver is joined protein A 5	NM_001962.1(SEQ ID NO：47)	NP_001953.1(SEQ ID NO：48)	Liver is joined protein A 4, variant 3	NM_182690.1(SEQ ID NO：45)	NP_872632.1(SEQ ID NO：46)
Liver is joined protein A 5	NM_001962.1(SEQ ID NO：47)	NP_001953.1(SEQ ID NO：48)	Liver is joined protein B 1	NM_004429.3(SEQ ID	NP_004420.1(SEQ ID NO：50)

	NO：49)
	NO：49)		Liver is joined protein B 2	NM_004093.2(SEQ ID NO：51)	NP_004084.1(SEQ ID NO：52)
Liver is joined protein B 3	NM_001406.3(SEQ ID NO：53)	NP_001397.1(SEQ ID NO：54)	Liver is joined protein B 2	NM_004093.2(SEQ ID NO：51)	NP_004084.1(SEQ ID NO：52)

Term used herein " the Eph/ liver is joined protein modulators " refers to by (directly or indirectly): (i) for example transcribing, after transcribing, the horizontal adjusted Eph receptor of translation or translation back (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or the endogenic ligand of Eph receptor (for example, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) expression; And/or regulate (ii) that Eph receptor and/or liver are joined proteic activity and the medicine of giving biological efficacy.

The example that the Eph/ liver is joined protein modulators includes but not limited to suppress or to reduce the endogenic ligand of Eph receptor and Eph receptor, and for example liver is joined interactional medicine between the albumen (hereinafter referred to as " the Eph/ liver is joined the protein-interacting inhibitor ").The non-limitative example that the Eph/ liver is joined the protein-interacting inhibitor comprises: (i) can with the Eph receptors bind, prevent or reduce Eph receptor regulating liver-QI and (for example join between the albumen medicine that interacts and induce the transduction of Eph receptor signal, liver join proteic soluble form (as, monomeric form or poly form)), with can with the Eph receptors bind, the antibody (that is Eph receptor agonism antibody) of inducement signal transduction and Eph receptor phosphorylation; (ii) can with the Eph receptors bind, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction and prevent or induce very low medicine (for example, Eph receptor antagonism antibody regulating liver-QI is joined proteic dominant form) of transduceing to the Eph receptor signal that can ignore level; (iii) can join protein binding with liver, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction, and induce liver to join the medicine of protein signal transduction (for example, the soluble form of Eph receptor and can join protein binding with liver and induce liver to join the antibody of protein signal transduction); (iv) can join protein binding with liver, prevent or reduce Eph receptor regulating liver-QI and join the albumen interphase interaction and prevent or induce very low medicine (for example, the dominant form of Eph receptor and resisting-liver is joined protein antibodies) to the Eph receptor signal transduction that can ignore level.

In a specific embodiment, it is not to suppress or to reduce Eph receptor and endogenic ligand that the Eph/ liver is joined protein modulators, and for example liver is joined the medicine of albumen interphase interaction.In another specific embodiment, it is not to regulate the medicine that (raise or reduce) Eph receptor and/or liver are joined protein expression that the Eph/ liver is joined protein modulators.In also having an embodiment, it is not can regulate the Eph receptor or liver is joined proteic protein stability or the cumulative medicine of protein that the Eph/ liver is joined protein modulators.Also have in another embodiment of the present invention, it is not to promote the kinase activity medicine of (for example, the activity of Eph receptor, liver are joined proteic activity or known activity of joining the relevant heterologous protein of albumen with the Eph receptor or the liver of cell membrane) that the Epb/ liver is joined protein modulators.In another specific embodiment, it is not and to prevent or reduce Eph receptor signal transduction with the Eph receptors bind that the Eph/ liver is joined protein modulators, but do not prevent Eph receptor regulating liver-QI join the albumen interphase interaction medicine; Or be not can join protein binding with liver and prevent or reduce liver and join protein signal transduction, but do not prevent liver join albumen and Eph receptor interaction medicine.In a specific embodiment, it is not EphA2 agonistic antibody or EphA2 antagonistic antibodies that the Eph/ liver is joined protein modulators.In another specific embodiment, it is not anti-EphA4 antibody that the Eph/ liver is joined protein modulators.In another embodiment, the Eph/ liver to join protein modulators be not that Eph receptor antisense molecule or liver are joined the albumen antisense molecule.In also having another embodiment, it (Eph-Fc) or not is that the liver of soluble form is joined albumen (for example, liver is joined albumen-Fc) for example, that the Eph/ liver is joined the Eph receptor that protein modulators is not a soluble form.

Term used herein " epi-position " refers to animal, preferred mammal, and most preferably philtrum has antigenicity or the active Eph receptor of immunogenicity or liver and joins a proteic part.Having the active epi-position of immunogenicity is to cause the Eph receptor of antibody or the part that liver is joined protein polypeptide in animal body.Having the active epi-position of antigenicity and be can be by any method known in the art, for example the part that can join protein polypeptide with bonded Eph receptor of antibody specificity or liver that detects of immunoassay.Antigenic epitopes not necessarily has immunogenicity.In a specific embodiment, epi-position is not EphA2 ₅₈(IMNDMPIYM; SEQ ID NO:55) or be not EphA2 ₅₅₀(VLAGVGFFI; SEQ ID NO:56).In another specific embodiment, epi-position is not (TLADFDPRV; SEQ ID NO:57), (VLLLVLAGV; SEQ ID NO:58), (VLAGVGFFI; SEQ ID NO:59), (IMNDMPIYM; SEQ ID NO:60), (SLLGLKDQV; SEQ ID NO:61), (WLVPIGQCL; SEQ ID NO:62), (LLWGCALAA; SEQ ID NO:63), GLTRTSVTV; SEQ ID NO:64), (NLYYAESDL; SEQ ID NO:65) or (KLNVEERSV; SEQ ID NO:66).In also having another embodiment, epi-position is not (IMGQFSHHN; SEQ ID NO:67), (YSVCNVMSG; SEQ ID NO:68), (MQNIMNDMP; SEQ ID NO:69), (EAGIMGQFSHHNIIR; SEQ ID NO:70), (PIYMYSVCNVMSG; SEQ ID NO:71) or (DLMQNIMNDMPIYMYS; SEQ ID NO:72).

The peptide of term used herein " fragment " indication in the context of protein drug or polypeptide contains the Eph receptor polypeptides or liver is joined protein polypeptide, Eph receptor polypeptides or liver are joined the fragment of protein polypeptide, can join the bonded antibody of protein polypeptide specificity with Eph receptor polypeptides or liver, or can with replace because of introducing amino acid residue, disappearance and/or add and at least 5 contiguous amino acid residues in the aminoacid sequence that the Eph receptor polypeptides that changes or liver are joined the bonded antibody fragment of protein polypeptide specificity, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, the aminoacid sequence of at least 200 contiguous amino acid residues or at least 250 contiguous amino acid residues.For example, antibody fragment is the epi-position binding fragment.

Term used herein " fusion rotein " refers to contain the aminoacid sequence of first polypeptide or protein or its fragment, analog or derivant and heterologous polypeptide or protein (promptly, second polypeptide or protein or its fragment, analog or the derivant that are different from first polypeptide or protein or its fragment, analog or derivant are not the parts of first polypeptide or protein or its fragment, analog or derivant usually perhaps) the polypeptide or the protein of aminoacid sequence.In one embodiment, fusion rotein comprises the preventative or curative drug that merges with heterologous protein, polypeptide or peptide.According to this embodiment, described heterologous protein, polypeptide or peptide can the dissimilar preventative or curative drugs of yes or no.For example, two kinds of different proteins, polypeptide or peptides with immunoregulatory activity can be fused to and form fusion rotein together.In one embodiment, compare with initial polypeptide or activity of proteins before heterologous protein, polypeptide or protein merge, fusion rotein keeps or has improved activity.

Term used herein " humanized antibody " refers to the antibody of inhuman (for example, mice) form, mosaic type antibody for example, and this antibody contains the sequence that is derived from non-human immunoglobulin on a small quantity.The major part of humanized antibody is human normal immunoglobulin's (receptor's antibody), wherein receptor's's (antibody) hypervariable region or the inhuman species of complementary determining region (CDR) residue, the hypervariable region residue or the CDR residue that for example have required specificity, affinity and binding ability in the antibody of mice, rat, rabbit or non-human primates (donor antibody) replace.In some instances, passable according to structural model with one or more framework regions (FR) residue that corresponding inhuman residue or other residue replace the human normal immunoglobulin, for example improve the affinity of humanized antibody.In addition, humanized antibody can contain the residue that does not have in receptor's antibody or donor antibody.Carry out these modifications and can further optimize the antibody performance.Humanized antibody can contain at least one usually, all (residue) basically of common two variable regions, and wherein all or all basically hypervariable region are corresponding to non-human immunoglobulin, and all or all basically FR are human normal immunoglobulin's sequences.Also optional constant region for immunoglobulin (Fc), the normally at least a portion of human normal immunoglobulin's constant region of containing of humanized antibody.More details are seen Jones etc., 1986, and Nature, 321:522-525; Reichmann etc., 1988, Nature, 332:323-329; Presta, 1992, Curr.Op.Struct.Biol., 2:593-596; Queen etc., U.S. Patent number 5,585,089.

Term used herein " hypervariable region " refers to be responsible for and the bonded amino acid residue of antigen in the antibody.Hypervariable region comprises amino acid residue (that is, the residue 24-34 (L1) of variable region of light chain, 50-56 (L2) and 89-97 (L3), the residue 31-35 (H1) of variable region of heavy chain, 50-65 (H2) and the 95-102 (H3) of " complementary determining region " or " CDR "; Kabat etc., Sequences of Proteins of ImmunologicalInterest (" immunology protein of interest matter sequence "), the 5th edition, Public Health Service, NIH, Bethesda, MD (1991)) and/or the residue of " hypermutation ring " is (promptly, the residue 26-32 (L1) of variable region of light chain, 50-52 (L2) and 91-96 (L3), the residue 26-32 (H1) of variable region of heavy chain, 53-55 (H2) and 96-101 (H3); Chothia and Lesk, 1987, J.Mol.Biol., 196:, 901-917)." framework region " or " FR " residue is the variable region residue except that hypervariable region residue defined herein.

Term used herein " is hybridized under the preciseness condition " and has been described the common hybridization and the wash conditions that can make the mutually the same nucleotide sequence of at least 30% (for example, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%) keep hybridization each other.The known this preciseness condition of those skilled in the art can be referring to Current Protocols in MolecularBiology (" up-to-date molecular biology method "), John Wiley ﹠amp; Sons, New York, (1989), 6.3.1-6.3.6.

To concrete sequence, selected preciseness condition is hanged down about 5-10 ℃ than the pyrolysis chain temperature (Tm) of this sequence usually when the ionic strength of determining, pH.Tm is 50% a temperature (at Tm time, excessive owing to target sequence, 50% probe is occupied during balance) when being in balance with the hybridization of the complementary probe of target (sequence) and this target sequence under ionic strength, pH and the nucleic acid concentration of regulation.The preciseness condition be that salinity is less than about 1.0M sodium ion, be generally about 0.01-1.0M Na ion concentration (or other salt), pH 7.0-8.3, for short probe (for example, 10-50 nucleotide), temperature is at least about 30 ℃, for long probe (for example, greater than 50 nucleotide), temperature is at least about 60 ℃.Also can be by adding destabilizing agent, for example Methanamide is realized the preciseness condition.For selectivity or specific hybrid, positive signal is the twice of background at least, preferably 10 of background hybridization times.

In a non-limitative example, the preciseness hybridization conditions is in about 45 ℃ of hybridization in 6 * sodium chloride/sodium citrate (SSC), then about 68 ℃ with 0.1 * SSC, 0.2%SDS washs one or many.In a non-limitative example, the preciseness hybridization conditions is to hybridize in 6 * SSC at about 45 ℃, then about 50-65 ℃ with 0.2 * SSC, 0.1%SDS washing one or many (that is, at 50 ℃, 55 ℃, 60 ℃ or 65 ℃ of washing one or many).Will be appreciated that nucleic acid of the present invention be not included under these conditions can only with the nucleic acid molecules of the nucleotide sequence hybridization that only constitutes by A or T nucleotide.

Term used herein " super proliferative cell disease (hyperproliferative cell disorder) " or " excessively cell cumulative bad disease (excessive cell accumulation disorder) " refer to the non-tumorigenic disease, and wherein super propagation of cell or the accumulation of any type of cell cause the pathologic state or the symptom of this disease.In some embodiments, super proliferative cell or excessive cell accumulation disease are characterised in that the epithelial cell of super propagation.Super propagation epithelial cell disease includes but not limited to: asthma, COPD, pulmonary fibrosis, bronchial hyperreactivity, psoriasis, seborrheic dermatitis and cystic fibrosis.In other embodiments, super proliferative cell disease or excessive cell cumulative bad disease are characterised in that the endotheliocyte of super propagation.Super proliferative endotheliocyte disease includes but not limited to: restenosis, super proliferative angiopathy (hyperproliferativevascular disease), behcet's syndrome, atherosclerosis and degeneration of macula.In other embodiments, super proliferative cell disease or excessive cell cumulative bad disease are characterised in that the fibroblast of super propagation.

Term used herein " immunomodulator " refers to can the immune medicine of controlled plant.Specifically, immunomodulator is the medicine that can change the ability that the object-immunity system reacts to one or more exotic antigens.In a specific embodiment, immunomodulator is to change object-immunity responsing reaction medicine in a certain respect.In another embodiment of the present invention, immunomodulator is the medicine (that is immunosuppressant) that can suppress or reduce the object-immunity responsing reaction.In one embodiment, the immunomodulator of inhibition or reduction object-immunity responsing reaction can suppress or reduce the ability that the object-immunity system reacts to one or more exotic antigens.

Term used herein " coupling " refers to utilize multiple preventative and/or curative drug.Use term " coupling " not to limit to need the order of the preventative and/or curative drug of the object for the treatment of.Can be before the object that the second preventative or curative drug is needed treatment (for example, 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, before 8 weeks or 12 weeks), while or (for example, 1 minute afterwards, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, after 8 weeks or 12 weeks) give the first preventative or curative drug.Preventative or the curative drug of any interpolation can any order gives with the preventative or curative drug of other interpolation.In some embodiments, can unite and give Eph/ liver of the present invention and join protein modulators and one or more preventative or curative drugs (non--Eph/ liver that is used for the treatment of disease that for example, gives is at present joined protein modulators, analgesics, anesthetis, antibiotic, immunomodulator).

Term used herein " isolating " refers to that in the context of the organic or inorganic molecule except that protein drug or nucleic acid (no matter it is micromolecule or macromole) this organic or inorganic molecule is substantially free of different organic or inorganic molecules.In one embodiment, 60% of the organic or inorganic molecule, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% does not contain second kind of different organic or inorganic molecule.In another embodiment, organic and/or inorganic molecule is isolating.

Term used herein " isolating " at protein drug (for example, peptide, polypeptide, fusion rotein or antibody) context in refer to that this protein drug is substantially free of its cellular material or the contaminative protein in cell or tissue source of deriving, and perhaps is substantially free of precursor or other chemicals when the chemosynthesis protein drug.Statement " is substantially free of cellular material " and comprises the cellular component that the protein drug that makes in the protein drug goods and separation or reorganization produce its cell and is separated.Therefore, the protein drug that is substantially free of cellular material comprises that contained heterologous protein, polypeptide, peptide or antibody (being also referred to as " contaminative albumen ") are lower than about 30%, 20%, 10% or 5% (with dry weight basis) protein drug goods.When reorganization produces protein drug, also preferably be substantially free of culture medium, the volume of promptly cultivating fiduciary point protein drug goods is less than about 20%, 10% or 5%.When chemosynthesis produces protein drug, preferably be substantially free of precursor or other chemicals, be about to it and be separated with the participation synthetic precursor of protein drug or other chemicals.Therefore, this goods of protein drug contain precursor or the chemical compound except that the proteins of interest medicine that is lower than about 30%, 20%, 10% or 5% (with dry weight basis).In a specific embodiment, protein drug disclosed herein is isolating.In another specific embodiment, antibody of the present invention is isolating.

Term used herein " isolating " in the context of nucleic acid molecules, refer to this nucleic acid molecules and natural origin in other nucleic acid molecules of existing be separated.In addition, when producing " isolating " nucleic acid molecules by recombinant technique, for example cDNA divides the period of the day from 11 p.m. to 1 a.m, preferably is substantially free of other cellular material or medium component, perhaps when chemosynthesis, is substantially free of precursor or other chemicals.In a specific embodiment, nucleic acid molecules is isolating.In another specific embodiment, the nucleic acid molecules of code book invention antibody is isolating.

Term used herein " low toleration " refers to that the patient is treated side effect and makes it surpass the state that the treatment benefit does not benefit and/or stops to treat because of ill effect and/or harmful side effect from treatment.

Term used herein " control ", " control " and " control method " refer to that object obtains beneficial effect from preventative or curative drug, but can not cure this disease.In some embodiments, give object one or more preventative or next " control " diseases of curative drug, thereby prevent this progression of disease or deterioration (that is, progression of disease being stagnated).

The cell of term used herein " oncogenicity " indication disease has the potential that is transferred to distal site and shows the phenotypic character that is different from the non-tumorigenic cell, described phenotypic character for example is can be at the three-dimensional substrates thing, for example form colony in the soft agar or at three-dimensional substrates film or extracellular matrix goods, for example MATRIGEL ^TMMiddle microtubule network or the pseudostructure of forming.The non-tumorigenic cell can not form colony in soft agar, can not form chondritic clearly in three-dimensional substrates film or extracellular matrix goods.The oncogenicity cell obtains the series of features sexual function in its growth course, though be to pass through different mechanisms.This function comprise evade apoptosis, growth signals self-sufficient, antagonism-growth signals is insensitive, the potential and the persistent angiogenesis of tissue intrusion/transfer ability, infinite copy.Term " non-tumorigenic cell " expression situation, disease or disease do not relate to cancerous cell.

This paper utilizes phrase " unresponsive/refractory " with one or more present available therapies (for example to describe, treatment of cancer), for example chemotherapy, radiotherapy, surgical operation, hormonotherapy and/or biotherapy/immunotherapy, when particularly the standard care scheme of particular cancers is treated the patient, described therapy is not enough to treat these patients clinically, for example treatment is kept insensitive, thereby make them need other effective treatment.Though this phrase also can be described the patient therapy is responded, be subjected to side effect, recurrence, generation drug resistance etc.In various embodiments, " unresponsive/refractory " expression at least obviously some cancerous cell is not killed or is failed to stop their cell differentiation.Utilize in the literary composition " refractory " in this area acceptable implication, by any method known in the art in vivo or the external test specific cells whether be the effect that " unresponsive/refractory " checks this cell of treatment.In various embodiments, cell number obviously reduces during treatment, or when increasing, this cell is " unresponsive/refractory ".

Term used herein " general specific antibody " refer to can with the bonded antibody of a plurality of member's specificitys in required protein families or the classification (for example, receptor tyrosine kinase).For example, " general specific antibody " described can with Eph receptor family (for example, EphA1-A8, EphA10, EphB1-B6) in the bonded antibody of a plurality of members.

Phrase used herein " pharmaceutically acceptable " is represented through federation management office or state government's approval or lists in American Pharmacopeia, European Pharmacopoeia or other pharmacopeia of generally acknowledging to can be used for animal, more specifically is used for the people.

Preventative or curative drug effectiveness raising when term used herein " enhancing " refers to the dose application of conventional or approval.

Term used herein " prevention ", " prevention " and " prevention method " refer to suppress by the inventive method the generation or the outbreak of the disease will prevent, treat, control or alleviate, perhaps because of (for example giving therapeutic agent, preventative or curative drug) or give therapeutic agent combination (for example, the combination of preventative or curative drug) and prevented recurrence, outbreak or the generation of one or more symptoms of disease.

Term used herein " preventive medicine " refers to can be used for preventing to join with one or more Eph receptors and/or liver any medicine of outbreak, recurrence or the diffusion of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or disease.In some embodiments, term " preventive medicine " refers to that Eph/ liver of the present invention joins protein modulators.In some embodiments, term " preventive medicine " refers to cancer chemotherapy (medicine), radiotherapy (medicine), hormonotherapy (medicine) and/or biotherapy (medicine) (for example, immunotherapy (medicine)).In other embodiments, multiple preventive medicine can be with other preventative and/or curative drug unite and give.

The preventive medicine consumption of term used herein " prevention effective dose " indication is enough to prevent that Eph receptor and/or liver from joining recurrence, diffusion or the outbreak of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or disease.The preventive medicine consumption of prevention effective dose indication is enough to prevent patient or object, (for example include but not limited to the patient of described disease-susceptible humans, in the heredity susceptible or suffered from described disease in the past) in Eph receptor and/or liver join the relevant patient disease of protein abnormal expression (that is rising,, reduction or inappropriate) or outbreak, diffusion or the recurrence of disease.The prevention effective dose also can refer to can be at the preventive medicine consumption that prevents that Eph receptor and/or liver from joining provides the prevention benefit in protein abnormal expression (that is rising,, reduction or the inappropriate) relevant disease.In addition, the prevention effective dose of preventive medicine of the present invention is represented and can prevented that Eph receptor and/or liver from joining protein abnormal expression (promptly, rising, reduction or inappropriate) the independent consumption of preventive medicine of prevention benefit is provided in the relevant disease or unites the consumption that gives with one or more other medicines (for example, the non--Eph/ liver that is used for the treatment of disease is at present joined protein modulators, analgesics, anesthetis, antibiotic, immunomodulator).The consumption that this term is joined protein modulators with Eph/ liver of the present invention can comprise when using can improve that prevention that overall prevention (effect) maybe can improve another preventive medicine is renderd a service or with the synergistic consumption of another preventive medicine.

" scheme " used herein comprises administration time harmony in the exterior dosage regimen.

Term used herein " refractory " refer to Eph receptor and/or liver join protein abnormal expression (that is rising,, reduction or inappropriate) relevant be to the nullvalent disease of concrete therapy.In some embodiments, Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease the therapy refractory are represented at least that obviously the symptom of some and described disease association do not eliminate because of this therapy or alleviate.Can by any method known in the art in vivo or external test Eph receptor and/or liver join protein abnormal expression (promptly, rising, reduction or inappropriate) whether relevant disease be that check the Eph receptor and/or the liver of refractory joined the effect of the treatment of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.

Phrase used herein " side effect " comprises the harmful and opposite effect of preventative or curative drug.Opposite effect usually is deleterious, but deleterious effects is not necessarily opposite.Adverse effect preventative or curative drug may be deleterious uncomfortable or dangerous.The side effect of chemotherapy includes but not limited to: gastrointestinal toxicity, such as but not limited to early stage and late period diarrhoea and flatulence, nauseating, vomiting, inappetence, leukopenia, anemia, neutrophil minimizing, weakness, abdominal cramps, heating, pain, weight loss, dehydration, alopecia, insomnia, dizzy, mucositis, xerostomia and kidney depletion and constipation, influence to N﹠M, temporary or permanent damage to kidney and bladder, influenza-like symptom, fluid retention and temporary or permanent sterile.The side effect of radiotherapy includes but not limited to: tired, xerostomia and forfeiture appetite.The side effect of biotherapy/immunotherapy includes but not limited to: medicine-feeding part generation erythra or swelling, influenza-like symptom is for example generated heat, is shivered and tired, digestive tract problem and anaphylaxis.The side effect of hormonotherapy includes but not limited to: feel sick, fertility Issue, depression, forfeiture appetite, eyes problem, headache and weight fluctuations.A lot of patient known in the art can experience other ill effect usually.Many ill effects are described in Physicians ' Desk Reference (" doctor's desk reference "), (the 56th edition, 2002).

Term used herein " strand Fv " or " scFv " refer to contain the V of antibody _HAnd V _LThe antibody fragment of domain, these domains are present in the polypeptide chain.The Fv polypeptide is generally at V _HAnd V _LAlso contain between the domain and can make scFv form the peptide linker of antigen in conjunction with desired structure.The summary of scFv is seen Pluckthun, publishes in The Pharmacology of Monoclonal Antibodies (" pharmacology of monoclonal antibody "), the 113rd volume, Rosenburg and Moore compile, Springer-Verlag, New York, the 269-315 page or leaf, (1994).Term used herein " object " and " patient " are used interchangeably.Object preferred mammal used herein, for example non-human primate (as, milch cow, pig, horse, cat, Canis familiaris L., rat etc.) and primates (for example, monkey and people), optimum is chosen.In one embodiment, to as if suffer from the mammal that Eph receptor and/or liver are joined protein abnormal expression (that is, rising, reduction or inappropriate) relevant disease, preferred people.In another embodiment, to as if suffer from Eph receptor and/or liver and (for example join the agricultural animal (for example, horse, pig or milch cow) of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease, house pet, Cavia porcellus, Canis familiaris L. or cat) or laboratory animal (for example, animal model).In another embodiment, to as if be in and suffer from Eph receptor and/or liver and join mammal (for example, immunocompromised host or immunosuppressant mammal in protein abnormal expression (that is rising,, reduction or inappropriate) the relevant disease risk, or the mammal of susceptible is gone up in heredity), preferred people.In another embodiment, object is not immunocompromised host or immunosuppressant mammal, preferred people.In another embodiment, be no less than about 500 cell/mm to liking lymphocyte count ³Mammal, preferred people.

Term used herein " is worked in coordination with " and is referred to that therapeutic alliance (for example, preventative or curative drug) is more effective than any addition effect that two or more treat (for example, one or more are preventative or curative drug) separately.Therapeutic alliance (for example, the associating of preventative or curative drug) synergism than one or more treatments of low dosage (for example can adopt, one or more preventative or curative drugs) treat and/or with the lower frequency administration and to suffer from the object that Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.(for example can adopt low therapeutic dose, preventative or curative drug) and/or give the described therapeutic agent of object with lower frequency and can reduce and give described therapeutic agent relevant toxicity, and do not reduce protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease is joined in described treatment prevention or treatment Eph receptor and/or liver effectiveness.In addition, synergism can improve treatment (for example, preventative or curative drug) and joins effectiveness in protein abnormal expression (that is rising,, reduction or the inappropriate) relevant disease prevention or treatment Eph receptor and/or liver.Opposite or the harmful side effect relevant with adopting any independent treatment can be avoided or reduce to the synergism of therapeutic alliance at last, (for example, preventative or curative drug).

Term used herein " curative drug " refers to be used for any medicine that Eph receptor and/or liver are joined treatment, control, prevention, alleviation or the sx of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.Term used herein " curative drug " refers to be used for any medicine that Eph receptor and/or liver are joined treatment, control, prevention, alleviation or the sx of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In some embodiments, term " curative drug " refers to that Eph/A liver of the present invention joins protein modulators.In some embodiments, term " curative drug " refers to the medicine except that EphA/ liver of the present invention is joined protein modulators.Curative drug is preferably known to be can be used for, or has been used for or has been used at present prevention, treatment, control or alleviated the Eph receptor and/or liver is joined the medicine of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or its one or more symptoms.

Term used herein " treatment effective dose " refers to be enough to treatment, control or alleviation Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) the curative drug consumption of symptom of relevant disease, this consumption preferably is enough to eliminate, change or control the related symptoms of this class disease.The treatment effective dose can refer to be enough to delay or reduce the Eph receptor as far as possible and/or liver is joined protein abnormal expression (that is rising,, reduction or the inappropriate) outbreak of relevant disease or the curative drug consumption of the order of severity.The treatment effective dose also can refer to and can join the curative drug consumption that the therapeutic benefit is provided in the treatment of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or the control Eph receptor and/or liver.In addition, the treatment effective dose of curative drug of the present invention is represented to join in the treatment of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or the control Eph receptor and/or liver to be provided the independent consumption of curative drug of treatment benefit or unites the consumption that gives with other therapies.This term is used for can comprising when Eph/ liver of the present invention is joined the consumption of protein modulators and can improves overall treatment (effect), reduce or avoid illeffects, improve another curative drug curative effect or with the synergistic consumption of another curative drug.

Term used herein " treatment " refers to can be used for prevention, treatment, control or alleviates the Eph receptor and/or liver is joined any scheme, method and/or the medicine of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In some embodiments, term " treatment " refers to those skilled in the art, for example the medical worker is known can be used for treatment, control, prevention or alleviates the Eph receptor and/or liver is joined biotherapy, supporting treatment and/or the other therapies of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or its one or more symptoms.

Term used herein " treatment ", " treatment " and " Therapeutic Method " refer to because of (for example giving one or more therapeutic agents, preventative or curative drug) and eradicate, alleviate or alleviated the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) symptom of relevant disease, particularly eradicate, remove, improve or controlled this disease.In some embodiments, this term refer to because of one or more therapeutic agents of object of suffering from this disease (for example, preventative or curative drug) and reduce as far as possible or delayed the diffusion that Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.

4. description of drawings

The architectural feature of Figure 1A-1R. people Eph receptor family.The sequence of band frame has marked consensus sequence.Signal peptide sequence is represented by dotted lines; Liver is joined the protein ligands binding structural domain and represents with thick line; Tumor Necrosis Factor Receptors (TNFR) domain is represented with doublet; Fibronectin III type domain is represented with two-wire; Striding film (domain) represents with the choice refreshments line; The tyrosine kinase catalyst structure domain is represented with single horizontal line (single plain line); SAM motif (sterile alpha motif) domain is represented with big dotted line.People Eph receptor nucleotide sequence and the aminoacid sequence GenBank accession number separately table 1 that sees above.

Fig. 2 A-2G. people liver is joined the architectural feature of protein ligands family.The sequence of band frame has marked consensus sequence.Signal peptide sequence is represented by dotted lines; Liver is joined protein structure domain and represents with single thick line; Membrane spaning domain (just the Type B liver is joined proteic) is represented with two-wire.The people liver is joined pyrenoids nucleotide sequence and the aminoacid sequence GenBank accession number separately table 2 that sees above.

Fig. 3. the liver of reporting in the list of references is joined combining of albumen (part) and Eph receptor.It is up that the Eph receptor is listed in this figure, and Eph part (liver is joined albumen) is listed in this figure first row downwards.Check box shows that liver joins combining of albumen and corresponding Eph receptor.Homogeny percentage ratio between people Eph receptor and the corresponding mice/rat Eph receptor is listed in table down.

Fig. 4 A-4B., resists-Eph antibody capable and different EphA and EphB receptors bind in conjunction with measuring like that as ELISA.This form has been summed up the binding affinity of different antibodies to various Eph receptors.It is up that the Eph receptor is laterally listed in this figure, and antibody is arranged in this figure first row downwards.Number show with (-) or (+), number show in conjunction with strengthening with a plurality of (+) in conjunction with situation.In addition, listed the ELISA O.D. numerical value of several antibody.The digital proof of this two width of cloth figure has produced the member's of receptor tyrosine kinase family (Eph receptor family) general specific antibody.

Heavy chain (the V of the anti--Eph antibody GEA44 of the various affinity maturations of Fig. 5 A. _H) and light chain (V _L) amino acid sequences.The heavy chain amino acid sequence of following antibody is seen the first half of this figure: GEA44,1A4,1B10,1D11,1G11,2C9,3A12,3C6,6B7,6B4 and 11H1 (SEQ IDNo is respectively 114,116,118,120,122,124,126,128,130,132 and 134).The light-chain amino acid sequence of following antibody is seen the latter half of this figure: GEA44,1A4,1B10,1D11,1G11,2C9,3A 12,3C6,6B7,6B4 and 1H1 (SEQ ID No is respectively 115,117,119,121,123,125,127,129,131,133 and 135).The band frame of these sequences partly shows CDR (Kabat definition), and its corresponding SEQ ID NO sees Table 3.

Table 3.

Antibody	V _H CDR SEQ ID No.	V _L CDR SEQ ID No.
Antibody	V _H CDR SEQ ID No.	V _L CDR SEQ ID No.	GEA44	136-138	139-141
1A4	142-144	145-147	GEA44	136-138	139-141
1A4	142-144	145-147	1B10	148-150	151-153
1D11	154-156	157-159	1B10	148-150	151-153
1D11	154-156	157-159	1G11	160-162	163-165
2C9	166-168	169-171	1G11	160-162	163-165
2C9	166-168	169-171	3A12	172-174	175-177
3C6	178-180	181-183	3A12	172-174	175-177
3C6	178-180	181-183	6B7	184-186	187-189
8B4	190-192	193-195	6B7	184-186	187-189
8B4	190-192	193-195	11H1	196-198	199-201

Fig. 5 B. is general-variable region of heavy chain (V of Eph antibody 10C12 (GEA10C12) _H) and variable region of light chain (V _L) nucleotide sequence and aminoacid sequence.Weight chain variable region nucleotide sequence and aminoacid sequence are listed in the first half (SEQ ID No. is respectively 203 and 202) of this figure; The nucleotide sequence of variable region of light chain and aminoacid sequence are listed in the latter half (SEQ ID No is respectively 205 and 204) of this figure.

Amino acid change in Fig. 6 .CDR3 heavy chain has improved the affinity of Fab20 to people EphA4.The aminoacid sequence of Fab20 (Fab of mAb GEA44) CDR3 heavy chain is laterally listed in this figure, has marked corresponding numbers (1-12) on each aminoacid.The Fab20 aminoacid that replaces is listed under the numbered positions together with the antibody title.(x) expression is compared with the female antibody background of Fab20, increases multiple according to catching ELISA (mensuration) affinity.

Fig. 7. the CDR3 heavy chain variant figure of the GEA44 that affinity is optimized.This figure has summed up relatively EphA4 and GEA44 Fab20 and the bonded ELISA result of affinity optimization variant.Between Fab20,10H8,11G6,2A7,4A10,10D7,9B7,2E5,10F9,11F8,11H1 and 11G11, compare.The x-axle is Fab concentration μ g/ml, and the y-axle is O.D.450nm.The result proves that the sudden change in the CDR3 heavy chain has greatly improved the affinity of Fab20 to EphA4.

Fig. 8. the ELISA signal of catching of selected combinatory variants improves multiple.This form has been summed up GEA44 Fab22 affinity and has been optimized the affinity raising situation of variant to EphA4.First has listed antibody cloning; Secondary series has been listed with female monoclonal antibody 22 and has been compared, and each clones the raising multiple of binding affinity; The 3rd has listed with GEA44 derivant 11H1 and has compared, and each clones the raising multiple of binding affinity.

Fig. 9. the sequence of the Fab20 variant that anti--Eph affinity is optimized.This form has been summed up the aminoacid replacement among each Fab22 variant CDR.Fab20 variant (clone) is listed in first row downwards; CDR (CDR _L1-3 and CDR _H1-3) laterally list in up.The Fab20 aminoacid that replaces is listed in corresponding C DR below.

The variant figure that the affinity of Figure 10 A-10H.GEA44 is optimized.These figure have summed up relatively, and GEA44Fab20 optimizes the bonded ELISA result of variant (with Eph) with different affinitys.Figure 10 A has compared the situation that combines with reorganization-people EphA4; Figure 10 B has compared the situation that combines with reorganization-people EphA1; Figure 10 C has compared the situation that combines with reorganization-people EphA2; Figure 10 D has compared the situation that combines with reorganization-mice EphA3; Figure 10 E has compared the situation that combines with reorganization-mice EphA4; Figure 10 F has compared the situation that combines with reorganization-mice EphA7; Figure 10 G has compared the situation that combines with reorganization-mice EphA8; Figure 10 H has compared the situation that combines with reorganization-mice EphA2.In each figure, the x-axle is Fab concentration μ g/ml, and the y-axle is O.D.450nm.The result proves that different variants significantly change the affinity of various Eph receptors.

Figure 11. combinatorial libraries makes up.On behalf of another group, this figure make various aminoacid replacement in the CDR of GEA44.The amino acid position of CDR and corresponding replacement is listed in first row; Clone corresponding to this replacement lists in secondary series; The aminoacid sequence of each corresponding CDR is listed in last string, and the aminoacid of replacement is listed in its below.

Figure 12 A-12J. compares the Fab of GEA44 affinity optimization and the figure of IgG and various Eph receptors bind.These figure have summed up relatively, and GEA44Fab20 optimizes the bonded ELISA result of variant (with Eph) with GEA44IgG with different affinitys.Figure 12 A has compared the situation that combines with reorganization-people EphA1; Figure 12 B has compared the situation that combines with reorganization-people EphA2; Figure 12 C has compared the situation that combines with reorganization-mice EphA2; Figure 12 D has compared the situation that combines with reorganization-mice EphA3; Figure 12 E has compared the situation that combines with reorganization-mice EphA4; Figure 12 F has compared the situation that combines with reorganization-people EphA4; Figure 12 G has compared the situation that combines with reorganization-mice EphA7; Figure 12 H has compared the situation that combines with reorganization-mice EphA8; Figure 12 I has compared the situation that combines with reorganization-rat EphA5; Figure 12 J has compared the situation that combines with reorganization-mice EphA6.In each figure, the x-axle is Fab and IgG concentration μ g/m1, and the y-axle is O.D.450nm.The result proves that different variants significantly change the affinity of various Eph receptors.

The variant that Figure 13 A-13B.GEA44 affinity is optimized is to the binding affinity of EphA1-Fc.Adopt the BIAcore test to detect binding affinity.Usually the EphA-Fc fusant is fixed on sensor chip surface, makes the IgG of detection flow through fixed EphA receptor.Utilization is fixed with people EphA1 and the antigenic surface of people EphA2, produces the BIAcore data with each IgG variant mAb of 100nM concentration as analyte.Figure 13 A has summed up the affinity result at EphA1-Fc; Figure 13 B has summed up the affinity result at EphA2-Fc.The x-axle is time (second), and the y-axle is for replying difference (Resp.Diff.).These results prove that further different variants significantly change the affinity of single Eph receptor.

Figure 14. the antibody that the GEA44 affinity of measuring by ELISA is optimized and different EphA receptors in conjunction with situation.This figure has summed up the binding affinity of the variant of different GEA44 affinitys optimizations to various EphA receptors.It is up that the Eph receptor is laterally listed in this figure, and antibody is arranged in this figure first row downwards.Number show with (-) or (+), number show in conjunction with strengthening with a plurality of (+) in conjunction with situation.

Figure 15 A-15B. is anti--and Eph IgG antibody is to the affinity of EphA4-Fc and EphA4-his.Adopt the BIAcore test to detect binding affinity.Usually IgG antibody is fixed on sensor chip surface, makes the EphA4 analyte flow through this fixed antibody.Adopt BIAcore, obtain the kinetic measurement value of variant as analyte people EphA4 with fixed variant antibody and people EphA4-Fc and EphA4-His.These forms have been summed up the binding affinity of the various affinity maturation variants of GEA44 to EphA4.First has listed different antibodies; Secondary series has provided kon (1/Ms) value; The 3rd row have provided kofff (1/s) value; The 4th row have provided K _D(nM) value; Last is listed in suitable part and estimates.Data obviously proof are compared with female antibody GEA44, and the affinity maturation variant significantly improves the affinity of EphA4.

The member of Figure 16 A-16D. receptor tyrosine kinase (RTK) family.These accompanying drawings have been represented the many different members in the RTK family, different classes of disaggregated classification (breakdown) in relation between the representational different members and the RTK family.

5. detailed Description Of The Invention

The inventive method comprises that other prevention alone or in combination or medicine give the multiple Eph kinases of one or more preferential targets of effective dose and/or Eph/ liver that liver is joined albumen is joined protein modulators. The present invention also provides prevention, control, treatment and/or alleviation Eph acceptor and/or liver to join protein abnormal expression (namely, rising, reduction or inappropriate) method of relevant disease or its symptom, described method comprises that the Eph/ liver of the object effective dose that needs joins the treatment agent except the Eph/ liver is joined protein modulators of protein modulators and/or effective dose (for example, Immunomodulatory therapeutic agents, anti-angiogenic generation therapeutic agent, anticancer therapeutic agent, anti-inflammatory therapeutics etc.).

the non-limitative example that Eph/ liver of the present invention is joined protein modulators is by (directly or indirectly): (i) for example transcribing, after transcribing, after translation or translation, horizontal adjusted Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or the endogenic ligand of Eph acceptor is (for example, liver is joined albumin A 1, liver is joined albumin A 2, liver is joined albumin A 3, liver is joined albumin A 4, liver is joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver are joined protein B 3) expression, and/or (ii) regulate that Eph acceptor and/or liver are joined the activity of albumen and the medicine of giving biological efficacy.

In the specific embodiment of the present invention, protein modulators is designed to join unique zone combination of albumen with specific Eph acceptor and/or liver and/or this Eph acceptor is regulated in interaction and/or liver is joined the active of albumen and/or expresses thereby Eph/ liver of the present invention can be joined. In another specific embodiment, can Eph/ liver of the present invention be joined protein modulators according to the inventive method and be designed to and can join total or the regional combination of homology and/or interaction between albumen with specific Eph acceptor and/or liver, thereby can regulate simultaneously multiple Eph acceptor and/or liver is joined the active of albumen and/or expresses.

The example that the Eph/ liver is joined protein modulators includes but not limited to suppress or to reduce the endogenic ligand of Eph acceptor and Eph acceptor, and for example liver is joined the medicine (hereinafter referred to as " the Eph/ liver is joined the protein-interacting inhibitor ") of albumen interaction. The non-limitative example that the Eph/ liver is joined the protein-interacting inhibitor comprises: (i) can with the Eph receptors bind, prevent or reduce that medicine that Eph acceptor and liver join the albumen interaction and induce the transduction of Eph receptor signal (for example, liver join albumen soluble form (as, monomeric form or poly form)), with can with the Eph receptors bind, the antibody (that is, Eph receptor agonism antibody) of inducement signal transduction and Eph receptor phosphorylation; (ii) can with the Eph receptors bind, prevent or reduce the medicine (for example, Eph receptor antagonism antibody and liver are joined the dominant form of albumen) that Eph acceptor and liver are joined the albumen interphase interaction and prevent or induce very low Eph receptor signal to ignoring level to transduce; (iii) can join protein combination with liver, prevent or reduce the Eph acceptor and liver is joined the albumen interphase interaction, and induce liver to join the medicine of protein signal transduction (for example, the soluble form of Eph acceptor and can join protein combination with liver and induce liver to join the antibody of protein signal transduction); (iv) can join protein combination with liver and prevent or reduce the medicine (for example, the dominant form of Eph acceptor and resisting-liver is joined protein antibodies) that Eph acceptor and liver are joined the albumen interphase interaction and prevent or induce very low Eph receptor signal transduction to ignoring level.

In other embodiments, the Eph/ liver is joined protein modulators and includes but not limited to regulate the medicine of Eph expression of receptor. This medicine can (for example reduce/lower the Eph expression of receptor, Eph receptor antisense molecule, RNAi and ribozyme) or improve/raise the Eph expression of receptor and the endogenic ligand that makes the Eph of cell surface surpassed by the scale of construction to can be used for combination (for example, liver is joined albumen) amount, therefore improve unconjugated Eph and be subjected to the scale of construction (for example, the nucleic acid of coding Eph acceptor).

In other embodiments, the Eph/ liver to join protein modulators be can regulate liver to join the medicine of protein expression. This medicine can reduce/lower liver and joins protein expression (for example, liver is joined the albumen antisense molecule, RNAi and ribozyme) or improve/raise liver and join protein expression (for example, the coding liver is joined the nucleic acid of albumen).

In also having other embodiment, Eph/ liver of the present invention joins that protein modulators includes but not limited to regulate the Eph acceptor or liver is joined the protein stability of albumen or the medicine of protein accumulation.

In other embodiments, it is to promote the kinase activity medicine of (for example, the activity of Eph acceptor, liver are joined the active or known activity of to Eph acceptor or the liver of cell membrane, joining the relevant heterologous protein of albumen of albumen) that Eph/ liver of the present invention is joined protein modulators.

In also having other embodiment, the Eph/ liver is joined protein modulators and includes but not limited to: can and prevent or reduce the Eph receptor signal and transduce with the Eph receptors bind, but do not suppress or reduce Eph acceptor and liver and join the medicine (for example, Eph acceptor intracellular antibody) of albumen interphase interaction; Can join protein combination with liver and prevent or reduce liver and join the protein signal transduction, but not suppressing or reduce the medicine (for example, B-type liver is joined the albumen intracellular antibody) that liver is joined albumen and Eph receptor interaction.

In a specific embodiment, it is not to suppress or to reduce Eph acceptor and endogenic ligand that the Eph/ liver is joined protein modulators, and for example liver is joined the medicine of albumen interphase interaction. In another specific embodiment, it is not can regulate (raise or reduce) Eph acceptor and/or liver to join the medicine of protein expression that the Eph/ liver is joined protein modulators. In also having an embodiment, it is not can regulate the Eph acceptor or liver is joined the protein stability of albumen or the medicine of protein accumulation that the Eph/ liver is joined protein modulators. In another embodiment in addition of the present invention, it is not to promote the kinase activity medicine of (for example, the activity of Eph acceptor, liver are joined the active or known activity of to Eph acceptor or the liver of cell membrane, joining the relevant heterologous protein of albumen of albumen) that the Eph/ liver is joined protein modulators. In another specific embodiment, it is not and to prevent or to reduce Eph receptor signal transduction with the Eph receptors bind that the Eph/ liver is joined protein modulators, but do not prevent Eph acceptor and liver join the albumen interphase interaction medicine; Or be not can join protein combination with liver and prevent or reduce liver and join protein signal transduction, but do not prevent liver join albumen and Eph receptor interaction medicine. In a specific embodiment, it is not EphA2 agonistic antibody or EphA2 antagonistic antibodies that the Eph/ liver is joined protein modulators. In another embodiment, the Eph/ liver to join protein modulators be not that Eph receptor antisense molecule or liver are joined the albumen antisense molecule. In also having another embodiment, it (is for example, Eph-Fc) or not that the liver of soluble form is joined albumen (for example, liver is joined albumen-Fc) that the Eph/ liver is joined the Eph acceptor that protein modulators is not soluble form.

The invention provides screening and identification and (for example can regulate the Eph acceptor, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver join the expression of protein ligands (for example, liver join albumin A 1, liver join albumin A 2, liver and join albumin A 3, liver and join that albumin A 4, liver are joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver and joins protein B 3) and/or the method that active Eph/ liver is joined protein modulators.

The present invention also provides and is designed for treatment, control, prevention and/or alleviates the Eph acceptor and/or liver is joined pharmaceutical composition and prevention and the therapeutic scheme of protein abnormal expression (that is, rising, reduction or inappropriate) relevant disease or its symptom. The present invention also provides and utilizes Eph/ liver of the present invention to join protein modulators to assess treatment Eph acceptor and/or liver and join the diagnostic method of the curative effect of medication of protein abnormal expression (that is, rising, reduction or inappropriate) relevant disease or its symptom.

The present invention also provides the kit that pharmaceutical composition of the present invention or diagnostic reagent are housed.

Hereinafter table 4 has been summed up various Eph acceptors and liver is joined albumen, expresses the non-limitative example of their tissue, comprises with the disease of the inventive method treatment and the relevant references into reference received in full.

Table 4

Target	Express its tissue	Indication	List of references
Target	Express its tissue	Indication	List of references	EphA1(Eph)	Liver, kidney, lung, skin	Liver cancer and metastatic carcinoma; Lung cancer; Kidney; Oophoroma; Colon cancer and metastatic carcinoma	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2003/0157082 (on August 21st, 2003); WO 0194629
EphA2(Eck)	The Langerhans cell of brain, kidney, lung, skin, ovary, BMDC pedigree, endothelial cell	The cancer in epithelial cell source; Oophoroma; Breast cancer; Lung Langerhans cell increase disease (PLCH); Graft versus host disease(GVH disease) (GVHD)	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2004/0106132 (on June 3rd, 2004) and US2003/0224374 (on June 13rd, 2002); Cheng etc., 2002, Mol.CancerRes., 1:2-11; Vassallo etc., 2000, New Engl.J.Med., 342:1969-1978; Sundar etc., 2003, Chest, 123:1673-1683; Tazi etc., 1999, J.Immunol., 163:3511-3515; Zeid etc., 1995, Pathology, 27:247-254; De Saint-Vis etc., 2003, Blood, 102:4431-4440; Munthe etc., 2004, BMC Immunol., 5:9; Merad etc., 2004, Nat.Med., 10:510-517; Emerson SG, 2004, Nat.Med, 10:451-452	EphA1(Eph)	Liver, kidney, lung, skin
EphA2(Eck)				EphA3(Hek/Mek4)	Brain, spleen, kidney, lung, skin, ovary	The Primary Congestive DCM; Granulomatous myocarditis; Prostate cancer; Chronic pancreatitis; The benign protuberance hyperplasia; Cancer of pancreas; Cirrhosis (all inducements); Carcinoma of testis; Kidney	Zhou etc., 1998, Pharmacol.Ther., 77 (3):, 151-181; WO 03009814; U.S. Patent Application Publication No. US 2003/0108963 (on June 12nd, 2003)
EphA4(Sek/Hek8)	Brain, kidney, lung, muscle, heart, testis, ovary	Breast cancer; Lung cancer (lowering in lung cancer); Prostate cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2003/0224374 (on June 13rd, 2002); WO 0194629; Ashida etc., 2004, Cancer Res., 64:5963-5972	EphA3(Hek/Mek4)	Brain, spleen, kidney, lung, skin, ovary
EphA4(Sek/Hek8)	Brain, kidney, lung, muscle, heart, testis, ovary			EphA5(Bsk/Hek7)	Brain, testis, nervous system	Brain tumor; Neural cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent number 5,798,448; 5,843,749; 6,280,732
EphA6(Ehk2)	Brain, neuronal tissue, tracheae, kidney, liver, testis, prostate, thyroid gland, stomach, small intestine, colon, uterus, bladder, cervix, pericardium	The cancer of brain, neuronal tissue, tracheae, kidney, liver, testis, prostate, thyroid gland, stomach, small intestine, colon, uterus, bladder, cervix, pericardium	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; Park and Sanchez, 1997, Oncogene, 14:533-542; U.S. Patent number 6,586,230	EphA5(Bsk/Hek7)	Brain, testis, nervous system	Brain tumor; Neural cancer

EphA7 (Hek11/MCK1)	Brain, kidney, lung, testis, neuronal tissue	Colorectal cancer; Cancer of the stomach; Carcinoma of endometrium; Carcinoma of testis; Prostate benign protuberance hyperplasia; Prostate cancer; Oophoroma; Kidney (clear-cell carcinoma)	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; Park and Sanchez, 1997, Oncogene, 14:533-542
EphA7 (Hek11/MCK1)	Brain, kidney, lung, testis, neuronal tissue			EphA8(Eek)	Brain, testis, mammary gland, central nervous system, dermal fibroblast	Chronic pancreatitis; Cancer of pancreas; Breast cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; WO 02/30979
EphA10(Ephx)	Testis	Carcinoma of testis	Aasheim etc., 2005, Biochim Biophys Acta, 1723 (1-3): 1-7	EphA8(Eek)		Chronic pancreatitis; Cancer of pancreas; Breast cancer
EphA10(Ephx)	Testis	Carcinoma of testis	Aasheim etc., 2005, Biochim Biophys Acta, 1723 (1-3): 1-7	EphB1(Elk/NET)	Brain, testis, neuronal tissue, mammary gland	Breast cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; WO 03/016475; Chen etc., 2004, J.Cell Biochem., announce (on September 24th, 2004) with electronic edition before printing
EphB2(Erk/Nuk)	Brain, neuronal tissue, thymus gland, kidney, lung, small intestine, testis, ovary, mammary gland	Breast cancer; Cancer of the stomach; Lung cancer (cellule and large cell carcinoma; Primary); Colon cancer is (except mucoprotein type gland cancer; Primary); Soft-tissue cancers (any body part, neurinoma, malignant fibrous cytosis; Primary); Osteocarcinoma (osteosarcoma; Primary); Carcinoma of testis (mixed type gonioma; Primary); Cancer of the stomach (comprises gland cancer, except cell Signet Ring type; Primary); Carcinoma of endometrium (Miu Shi mixed rumour; Primary), the kidney (nephroblastoma; Primary); Uterus/cervix cancer (squamous cell carcinoma; Primary); Cancer of the esophagus (gland cancer; Primary)	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent number 6,218,356 and 6,440,663	EphB1(Elk/NET)	Brain, testis, neuronal tissue, mammary gland	Breast cancer
EphB2(Erk/Nuk)				EphB3 (Hek2/MDK5)	Brain, spleen, liver, kidney, lung, skin, muscle, heart, small intestine, testis, placenta, pancreas	Oophoroma; Colon cancer (adenoma) and transfer; Carcinoma of endometrium; The carcinoma of the rectum; Breast cancer; Synovial sarcoma; Parotid gland cancer (pleomorphic adenoma, mixed tumour); Soft tissue cancer (any body part, synovial sarcoma; Primary); Kidney (the nephroblastoma; Primary); Metastatic liver cancer; Lung cancer; Liver cancer and metastatic carcinoma; Prostate cancer; The defect of glucose transport relevant disease	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2003/0157082 (on August 21st, 2003) and US2003/0224374 (on June 13rd, 2002); U.S. Patent number 5,506,205 and 6,506,607
EphB4(Htk/MDK2)	Brain, liver, kidney, lung, muscle, heart, small intestine, testis	Breast cancer (cancer); Sarcolipoma; The carcinoma of the rectum; Osteocarcinoma (osteosarcoma); Cancer of the esophagus; Colon cancer (adenoma); Carcinoma of testis; Carcinoma of parotid gland; Colon cancer; Lung cancer (squamous cell carcinoma); Kidney; Liver cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2004/0115625 (on June 17th, 2004); U.S. Patent number 6,673,343; WO 0194629	EphB3 (Hek2/MDK5)
EphB4(Htk/MDK2)				EphB5(Cek9)	Brain, thymus gland, kidney, neuronal tissue	The cancer of brain, thymus gland, kidney, nerve fiber	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; Brambilla etc., 1995, EMBO J., 14:3116-3126
EphB6(Hep/Mep)	Brain, thymus gland, spleen, liver, kidney, lung, muscle,	Neuroblastoma	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent Application Publication No. US 2003/0100497 (2003 5	EphB5(Cek9)	Brain, thymus gland, kidney, neuronal tissue	The cancer of brain, thymus gland, kidney, nerve fiber

	Heart, endothelial cell, cardiovascular system		The moon 29)
	Heart, endothelial cell, cardiovascular system		The moon 29)	Liver is joined albumin A 1 (B61/LERK-1)	Epithelial cell, liver, kidney, lung, muscle, heart, skin, ovary, small intestine	The cancer in epithelial cell source; Lung cancer (small cell carcinoma; Primary); Bone disease (degenerative joint disease; Osteoarthritis); Prostate cancer (gland cancer); Colon cancer; Thyroid disease (Hashimoto thyroiditis); Thyroid cancer; Kidney (clear-cell carcinoma); Lung cancer; Mesometrium cancer (liomyoma); Oophoroma,	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent number 6,087,167 and 5,716,934
Liver is joined albumin A 2 (ELF-1/LERK-6)	Brain, neuronal tissue, alimentary canal, liver, lung	Leukaemia, breast cancer	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; Galang etc., 2004, J.Biol.Chem., 279:11281-11292; U.S. Patent number 5,795,734 and 6,472,174	Liver is joined albumin A 1 (B61/LERK-1)
Liver is joined albumin A 2 (ELF-1/LERK-6)	Brain, neuronal tissue, alimentary canal, liver, lung	Leukaemia, breast cancer		Liver is joined albumin A 3 (LERK-3)	Brain, skin, ovary, a mammary gland	Breast cancer, leukaemia	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; Galang etc., 2004, J.Biol.Chem., 279:11281-11292; U.S. Patent number 6,274,117
Liver is joined albumin A 4 (LERK-4)	Thymus gland, spleen, liver, kidney, lung, muscle, ovary	Cutaneum carcinoma (squamous cell and basal-cell carcinoma); Pancreatic disease (acute pancreatitis); Cancer of pancreas (gland cancer; Islet-cell tumour); Carcinoma of testis (mixed type gonioma); Colon cancer; The carcinoma of the rectum (gland cancer); Breast cancer; Oophoroma; Alzheimer disease; Leukaemia (front-B or T-cell)	Zhou etc., 1998, Pharmacol.Ther., 77 (3): 151-181; U.S. Patent number 6,274,117; 5,516,658; 5,738,844	Liver is joined albumin A 3 (LERK-3)	Brain, skin, ovary, a mammary gland	Breast cancer, leukaemia
Liver is joined albumin A 4 (LERK-4)	Thymus gland, spleen, liver, kidney, lung, muscle, ovary			Liver is joined albumin A 5 (AL-1/LERK-7)	Brain, kidney, heart, nervous system	The neuroendocrine carcinoma of lung (downward)	Zhou etc., 1998, Pharmacol.Ther.77 (3): 151-181; U.S. Patent number 5,798,448; 6,610,296; WO 0194629
Liver is joined protein B 1 (Elk-L/LERK-2)	Brain, thymus gland, spleen, liver, kidney, lung, muscle, heart, skin, ovary, neuronal tissue	Cancer of the stomach, oophoroma (theocoma-fibroma); Soft tissue cancer (any body part; MFH; Primary); Miocardial infarction, gallbladder disease (acute cholecystitis); Nerve degenerative diseases; Colon cancer (downward)	Zhou etc., 1998, Pharmacol.Ther.77 (3): 151-181; U.S. Patent number 5,512,457; 6,540,992; WO 0194629	Liver is joined albumin A 5 (AL-1/LERK-7)	Brain, kidney, heart, nervous system	The neuroendocrine carcinoma of lung (downward)
Liver is joined protein B 1 (Elk-L/LERK-2)				Ephrin B2 (Htk-L/LERK-5/NL ERK-1)	Brain, thymus gland, spleen, liver, kidney, lung, muscle, heart, ovary, prostate	Neuroblastoma; Cancer of the stomach; Kidney (clear-cell carcinoma); Crohn disease, lung cancer; The carcinoma of the rectum; Breast cancer; Colon cancer; Cutaneum carcinoma (malignant mela noma; Basal-cell carcinoma); Kidney; Diverticulitis; Oophoroma (thecoma-fibroma); Non-Hodgkin's lymphoma (all types); Hodgkin's disease (all hypotypes); Ulcerative colitis (activity, chronic inflammation); Psoriasis; Alzheimer disease; Carcinoma of endometrium (gland cancer); Thyroid cancer (follicular carcinoma); Leukaemia, lymthoma	Zhou etc., 1998, Pharmacol.Ther.77 (3): 151-181; Cho etc., 2004, J.Biol.Chem.279:19512-19522; Steube etc., 1999, Leuk. lymthoma 33:371-376; WO 0160860
Liver is joined protein B 3 (Elk-L3/NLERK-2)	Brain, heart, neuronal tissue	Neuroblastoma	Zhou etc., 1998, Pharmacol.Ther.77 (3): 151-181; U.S. Patent number 6,413,730 and 6.602,683	Ephrin B2 (Htk-L/LERK-5/NL ERK-1)

5.1 The EPH/ liver is joined protein modulators

the present invention includes and contain the Eph/ liver and join composition and the method for protein modulators. the Eph/ liver is joined protein modulators and includes but not limited to by (directly or indirectly): (i) for example transcribing, after transcribing, after translation or translation, Level tune Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or the endogenic ligand of Eph acceptor is (for example, liver is joined albumin A 1, liver is joined albumin A 2, liver is joined albumin A 3, liver is joined albumin A 4, liver is joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver are joined protein B 3) expression, and/or (ii) regulate that Eph acceptor and/or liver are joined the activity of albumen and the medicine of giving biological efficacy.

In the specific embodiment of the present invention, protein modulators is designed to join unique zone combination of albumen with specific Eph acceptor and/or liver and/or this Eph acceptor is regulated in interaction and/or liver is joined the active of albumen and/or expresses thereby Eph/ liver of the present invention can be joined. In another specific embodiment, protein modulators is designed to join the total or regional combination of homology between albumen with specific Eph acceptor and/or liver and/or interaction can be regulated multiple Eph acceptor simultaneously and/or liver is joined the active of albumen and/or expresses thereby can Eph/ liver of the present invention be joined according to the inventive method.

The example that the Eph/ liver is joined protein modulators includes but not limited to suppress or to reduce the endogenic ligand of Eph acceptor and Eph acceptor, and for example liver is joined the medicine (hereinafter referred to as " the Eph/ liver is joined the protein-interacting inhibitor ") of albumen interaction. The non-limitative example that the Eph/ liver is joined the protein-interacting inhibitor comprises: (i) can with the Eph receptors bind, prevent or reduce that medicine that Eph acceptor and liver join the albumen interaction and induce the transduction of Eph receptor signal (for example, liver join albumen soluble form (as, monomeric form or poly form)), with can with the Eph receptors bind, the antibody (that is, Eph receptor agonism antibody) of inducement signal transduction and Eph receptor phosphorylation; (ii) can with the Eph receptors bind, prevent or reduce the medicine (for example, Eph receptor antagonism antibody and liver are joined the dominant form of albumen) that Eph acceptor and liver are joined the albumen interphase interaction and prevent or induce very low Eph receptor signal to ignoring level to transduce; (iii) can join protein combination with liver, prevent or reduce the Eph acceptor and liver is joined the albumen interphase interaction, and induce liver to join the medicine of protein signal transduction (for example, the soluble form of Eph acceptor and can join protein combination with liver and induce liver to join the antibody of protein signal transduction); (iv) can join protein combination with liver, prevent or reduce the medicine (for example, the dominant form of Eph acceptor and resisting-liver is joined protein antibodies) that Eph acceptor and liver are joined the albumen interphase interaction and prevent or induce very low Eph receptor signal transduction to ignoring level.

In other embodiments, the Eph/ liver is joined protein modulators and includes but not limited to regulate the medicine of Eph expression of receptor. This medicine can (for example reduce/lower the Eph expression of receptor, Eph receptor antisense molecule, RNAi and ribozyme) thereby or (for example improve/raise endogenic ligand that the Eph expression of receptor makes the Eph of cell surface surpassed by the scale of construction to can be used for combination, liver is joined albumen) amount, therefore improve unconjugated Eph and be subjected to the scale of construction (for example, the nucleic acid of coding Eph acceptor).

in a specific embodiment, it is to reduce or to lower the Eph acceptor that the EphA/ liver is joined protein modulators, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or the EphB6 medicine (for example, using Eph receptor antisense molecule, RNAi and ribozyme) of expressing for example. in a specific embodiment, in test described herein or known in the art (for example, RT-PCR, the Northern trace or such as the immunoassays of ELISA), with the contrast (for example, PBS) compare, Eph/ liver of the present invention is joined protein modulators and the expression of Eph acceptor can be reduced or lower at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. in another embodiment, Eph/ liver of the present invention join protein modulators be can improve/raise the Eph expression of receptor medicine (for example, the nucleic acid of coding Eph acceptor), the endogenic ligand that thereby the Eph that makes cell surface is surpassed by the scale of construction can be used for combination (for example, liver is joined albumin A 1, liver and joins albumin A 2, liver and join albumin A 3, liver and join that albumin A 4, liver are joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver and joins protein B 3) amount, therefore having improved unconjugated Eph is subjected to the scale of construction.

in a specific embodiment, it is to reduce the protein stability of Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or the medicine of protein accumulation that the Eph/ liver is joined protein modulators. in a specific embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, described Eph/ liver is joined protein modulators and the protein stability of Eph acceptor and/or protein accumulation can be reduced or lower at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. in another embodiment, the Eph/ liver to join protein modulators be the medicine that can improve the protein stability of Eph acceptor and/or protein accumulation.

in a specific embodiment, it is the medicine that can promote the Eph receptor signal transduction of Eph acceptor autophosphorylation and/or part-mediation that the Eph/ liver is joined protein modulators. in another embodiment, it is to suppress or reduce (for example after transcribing, transcribing or translation skill) liver to join albumen that the Eph/ liver is joined protein modulators, for example liver is joined albumin A 1, liver and joins albumin A 2, liver and join albumin A 3, liver and join that albumin A 4, liver are joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver and joins the medicine (for example, using liver to join albumen antisense molecule, RNAi and ribozyme) that protein B 3 is expressed. in a specific embodiment, in test described herein or known in the art (for example, RT-PCR, the Northern trace or such as the immunoassays of ELISA), with the contrast (for example, PBS) compare, Eph/ liver of the present invention is joined protein modulators can join liver protein expression reduction at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times.

in another embodiment, it is and to prevent or reduce Eph receptor signal transduction but do not suppress or reduces the medicine (Eph acceptor intracellular antibody or the Eph receptor antibody for example, do not competed with ligand binding) of the endogenic ligand interaction of Eph acceptor and Eph acceptor with the Eph receptors bind that the Eph/ liver is joined protein modulators. in a specific embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, the Eph/ liver is joined protein modulators can reduce at least 25% with the transduction of Eph receptor signal, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, described Eph/ liver join that protein modulators does not reduce or only the interaction between the endogenic ligand of Eph acceptor and Eph acceptor is reduced by 5% or lower, 10% or lower, 15% or lower, 20% or lower, 25% or lower, 30% or lower, 35% or lower, 40% or lower.

in another embodiment, the Eph/ liver to join protein modulators be can join protein combination with liver and prevent or reduce liver and join protein signal transduction but do not suppress or reduce liver and join the interactional medicine of albumen and Eph acceptor. in a specific embodiment, in test described herein or known in the art (for example, detect liver and join the test of protein phosphorylation), with the contrast (for example, PBS) compare, described Eph/ liver is joined protein modulators can join liver protein signal transduction reduction at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, described Eph/ liver joins that protein modulators does not reduce or only with the Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and endogenic ligand is (for example, liver is joined albumin A 1, liver is joined albumin A 2, liver is joined albumin A 3, liver is joined albumin A 4, liver is joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver are joined protein B 3) between interaction reduce by 5% or lower, 10% or lower, 15% or lower, 20% or lower, 25% or lower, 30% or lower, 35% or lower, 40% or lower, or 2 times or lower, 1.5 doubly or lower or 1 times or lower.

in a specific embodiment, it is that the Eph/ liver is joined the protein-interacting inhibitor that the Eph/ liver is joined protein modulators. in one embodiment, the Eph/ liver join the protein-interacting inhibitor be can with the Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) combination, prevent or (for example reduce Eph acceptor and endogenic ligand, liver is joined albumin A 1, liver is joined albumin A 2, liver is joined albumin A 3, liver is joined albumin A 4, liver is joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver are joined protein B 3) interaction, (for example induce the transduction of Eph receptor signal, the liver of soluble form join albumen and can with the antibody of Eph receptors bind), induce the medicine of the transduction of Eph receptor signal and phosphorylation (namely, agonistic antibody)). in a specific embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, this Eph/ liver is joined the protein-interacting inhibitor can be with Eph acceptor and endogenic ligand (for example, liver is joined albumen) between interaction reduce at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, described Eph/ liver is joined the protein-interacting inhibitor can induce at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, the liver of at least 7 times or at least 10 times is joined the protein signal transduction.

in another embodiment, the Eph/ liver join the protein-interacting inhibitor be can with the Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) combination, and prevent or (for example reduce Eph acceptor and endogenic ligand, liver is joined albumin A 1, liver is joined albumin A 2, liver is joined albumin A 3, liver is joined albumin A 4, liver is joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver are joined protein B 3) thus interaction prevents or induces that medicine that very low Eph receptor signal to ignoring level transduces is (for example, antibody). in a specific embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, this Eph/ liver is joined the protein-interacting inhibitor can be with the endogenic ligand of Eph acceptor and Eph acceptor (for example, liver is joined albumen) between interaction reduce at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, described Eph/ liver join the protein-interacting inhibitor can induce 5% or lower, 10% or lower, 15% or lower, 20% or lower, 25% or lower, 30% or lower, 35% or lower, 40% or lower, or 2 times or lower, 1.5 times or lower or 1 times or the transduction of lower Eph receptor signal.

in another embodiment, it is to join protein combination with liver that the Eph/ liver is joined the protein-interacting inhibitor, prevent or reduce the Eph acceptor and liver is joined the albumen interaction, induce liver to join the medicine of protein signal transduction (for example, the Eph acceptor of the Eph acceptor of soluble form, dominant form and can join protein combination with liver and induce liver to join the antibody of protein signal transduction). in a specific embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, this Eph/ liver is joined the interaction that the protein-interacting inhibitor can join Eph acceptor and liver between albumen and reduces at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, described Eph/ liver is joined the protein-interacting inhibitor can induce at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, the liver of at least 7 times or at least 10 times is joined the protein signal transduction.

in another embodiment, it is to join protein combination with liver that the Eph/ liver is joined the protein-interacting inhibitor, prevent or reduce the Eph acceptor and liver is joined the albumen interaction, induce liver to join the medicine of protein signal transduction (for example, the Eph acceptor of the Eph acceptor of soluble form, dominant form and can join protein combination with liver and induce liver to join the antibody of protein signal transduction). in a specific embodiment, in test described herein or known in the art, with the contrast (for example, PBS) compare, this Eph/ liver is joined the interaction that the protein-interacting inhibitor can join Eph acceptor and liver between albumen and reduces at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, at least 7 times or at least 10 times. according to this embodiment, in test described herein or known in the art (for example, immunoassays), with the contrast (for example, PBS) compare, described Eph/ liver is joined the protein-interacting inhibitor and induces at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%, or at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5, at least 5 times, the liver of at least 7 times or at least 10 times is joined the protein signal transduction.

In a specific embodiment, it is not the medicine (for example, Eph receptor antisense molecule, RNAi or ribozyme) that can suppress or reduce the Eph Receptor Gene Expression that the Eph/ liver is joined protein modulators. In another embodiment, it is not that the Eph/ liver is joined protein inhibitor that the Eph/ liver is joined protein modulators, described inhibitor be can with the Eph receptors bind, prevent or reduce the endogenic ligand of Eph acceptor and this Eph acceptor, for example liver is joined the albumen interaction and induces the medicine of Eph receptor signal transduction. In another embodiment, the Eph/ liver to join protein modulators be not the antibody (that is, agonistic antibody) that can be combined and induce Eph receptor signal transduction and phosphorylation with the Eph receptor-specific.

In a specific embodiment, the Eph/ liver is joined protein modulators and has following a kind of, two kinds or all cytological effects: (i) improve the transduction of Eph receptor signal; (ii) improve Eph recipient cytoplasm tail region phosphorylation; (iii) improve Eph acceptor autophosphorylation and/or degraded; (iv) reduce Eph Receptor Gene Expression (for example, after transcribing, transcribing, after translation or translation level), protein stability and/or accumulation; (v) reduction or inhibition cell proliferation, transfer and/or Angiogenesis.

In also having another specific embodiment, the Eph/ liver is joined protein modulators and has following a kind of, two kinds or all cytological effects: (i) reduce the transduction of Eph receptor signal; (ii) reduce Eph recipient cytoplasm phosphorylation; (iii) reduce Eph acceptor autophosphorylation and/or degraded; (iv) improve Eph Receptor Gene Expression (for example, after transcribing, transcribing, after translation or translation level), protein stability and/or accumulation; (v) improve cell proliferation and/or cell survival.

In another embodiment, Eph/ liver of the present invention is joined protein modulators and has following a kind of, two kinds or all cytological effects: (i) improve and express liver and join the liver of albuminous cell and join the protein signal transduction; (ii) improve liver and join protein gene expression (for example, after transcribing, transcribing, after translation or translation level).

In also having another embodiment, Eph/ liver of the present invention is joined protein modulators and has following a kind of, two kinds or all cytological effects: (i) reduce and express liver and join the liver of albuminous cell and join the protein signal transduction; (ii) reduce liver and join protein gene expression (for example, after transcribing, transcribing, after translation or translation level).

Eph/ liver of the present invention is joined protein modulators and includes but not limited to: protein molecular (includes but not limited to peptide, polypeptide, protein, the protein of posttranslational modification, antibody etc.), little molecule (less than 1000 dalton), inorganic or organic compound, nucleic acid molecules (includes but not limited to two strands, single stranded DNA, two strands or single stranded RNA (as antisense (molecule), mediate rna i (mediates RNAi) etc.)), the triple helical nucleic acid molecules, fit and vaccine (for example, Li Site and Fei Lisite vaccine), and the derivative of above any material.

5.1.1 The polypeptide of joining protein modulators as the Eph/ liver

The inventive method comprises as the Eph/ liver of polypeptide joins protein modulators. In one embodiment, polypeptide Eph/ liver to join protein modulators be antibody (for example, monoclonal antibody) or its fragment. In another embodiment, polypeptide Eph/ liver join protein modulators be soluble form the Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or the liver of soluble form join albumen (for example, liver join albumin A 1, liver join albumin A 2, liver and join albumin A 3, liver and join that albumin A 4, liver are joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver and joins protein B 3). In one embodiment, polypeptide Eph/ liver join protein modulators be kept with liver join the protein combination ability and with the soluble form Eph acceptor of the Fc partial fusion of human immunoglobulin(HIg) IgG1 (for example, Eph acceptor-Fc). Referring to, such as receiving in full as the Cheng of reference etc., 2002, Mol.Cancer Res., 1:2-11. In another embodiment, polypeptide Eph/ liver to join protein modulators be kept with the Eph receptor binding capacity and joined albumen with the soluble form liver that the Fc domain of human immunoglobulin(HIg) IgG1 merges (for example, liver is joined albumen-Fc). Referring to, such as receiving in full as the Duxbury of reference etc., 2004, Biochem.﹠ Biophys.Res.Comm., 320:1096-1102.

In another embodiment, it is to contain that polypeptide Eph/ liver is joined protein modulators, and for example liver is joined the dominant form Eph acceptor of protein ligands binding structural domain.

In one embodiment, polypeptide Eph/ liver to join protein modulators be that the Eph/ liver is joined the protein-interacting inhibitor. In a specific embodiment, it is to be combined with the Eph receptor-specific that the Eph/ liver is joined protein modulators, prevent or reduce Eph acceptor and endogenic ligand, for example liver is joined the albumen interaction and induces the Eph receptor antibody of Eph receptor signal transduction (including but not limited to Eph acceptor autophosphorylation). In another embodiment, it is to be combined with the Eph receptor-specific that the Eph/ liver is joined protein modulators, prevent or reduce Eph acceptor and endogenic ligand, for example liver is joined the albumen interaction and prevents or induce the Eph receptor antibody that extremely hangs down to the Eph receptor signal transduction (including but not limited to Eph acceptor autophosphorylation) that can ignore level. In some embodiments, polypeptide Eph/ liver join protein modulators be not can with the EphA2 specific binding, prevent or reduce the EphA2 antibody that EphA2 and liver are joined albumin A 1 interaction and induce the EphA2 signal transduction.

In a specific embodiment, it is can join protein-specific with liver to be combined that polypeptide Eph/ liver is joined protein modulators, prevents or reduce that the liver that Eph acceptor and liver are joined the albumen interaction and induce liver to join the protein signal transduction joins protein antibodies. In another embodiment, it is can join protein-specific with liver to be combined that the Eph/ liver is joined protein modulators, prevents or reduces Eph acceptor and liver and join the albumen interaction and prevent or the abduction delivering liver is joined and extremely lowly in the cell of albumen joins to the liver that can ignore level the liver that protein signal transduces and join protein antibodies.

In a specific embodiment, the Eph/ liver join protein modulators be can with the Eph receptors bind, prevent or reduce Eph acceptor and liver and join the albumen interaction and induce the liver of the soluble form of Eph receptor signal transduction (including but not limited to Eph acceptor autophosphorylation) to join albumen or liver is joined protein fragments. In another specific embodiment, the Eph/ liver join protein modulators be can with the Eph receptors bind, prevent or reduce Eph acceptor and liver and join the albumen interaction and prevent from or induce extremely lowly joining protein signal to the liver that can ignore level and transduceing that the liver of soluble form of (including but not limited to Eph acceptor autophosphorylation) is joined albumen or liver is joined protein fragments.

In a specific embodiment, the Eph/ liver join protein modulators be can with endogenic ligand (for example, liver is joined albumen) combination, prevent or reduce Eph acceptor and endogenic ligand (for example, liver is joined albumen) interaction and induce liver to join the soluble form Eph acceptor of protein signal transduction or the fragment of Eph acceptor. In another embodiment, the Eph/ liver join protein modulators be can with endogenic ligand (for example, liver is joined albumen) combination, prevent or reduce Eph acceptor and endogenic ligand (for example, liver is joined albumen) interaction and prevent or the abduction delivering liver is joined and extremely lowly in the cell of albumen to the liver that can ignore level, joins soluble form Eph acceptor that protein signal transduces or the fragment of Eph acceptor.

In a specific embodiment, the Eph/ liver join protein modulators be can with endogenic ligand (for example, liver is joined albumen) combination, prevent or reduce Eph acceptor and endogenic ligand (for example, liver is joined albumen) interaction and abduction delivering liver and join liver in the cell of albumen and join the Eph acceptor of the dominant form of protein signal transduction. In another embodiment, the Eph/ liver join protein modulators be can with endogenic ligand (for example, liver is joined albumen) combination, prevent or reduce Eph acceptor and endogenic ligand (for example, liver is joined albumen) interaction and prevent or the abduction delivering liver is joined and extremely lowly in the cell of albumen to the liver that can ignore level, joins the dominant form Eph acceptor that protein signal is transduceed.

In also having another embodiment, the Eph/ liver join protein modulators be can with the isolated polypeptide of Eph receptor family member selective binding. The non-limitative example of these polypeptide is seen U.S. Patent Application Publication 2004/0180823 A1 that receives in full as reference.

5.1.1.1 The antibody of joining protein modulators as the Eph/ liver

Antibody plays key effect in our immune response. They can make virus and bacteriotoxin deactivation, kill and wound the microorganism of invasion and greatly essential in parasite raising complement system and various types of leucocyte. Antibody is only synthetic by bone-marrow-derived lymphocyte, and the antibody of generation has millions of kinds of forms, and each form has different amino acid sequences and different antigen binding sites. The antibody that is referred to as immunoglobulin (Ig) is rich in protein component in blood. Alberts etc., Molecular Biology ofthe Cell (" molecular biology of cell "), second edition, 1989, Garland Publishing, Inc..

Typical antibody is the Y shape molecule with two identical heavy (H) chains (respectively containing 440 amino acid of having an appointment) and two identical light (L) chains (respectively containing 220 amino acid of having an appointment). These four chains combine by non-covalent and covalent bond (disulfide bond). Proteolytic enzyme, for example papain and pepsin can divide antibody molecule and cut into as the different characteristic fragment. Papain produces two independences and identical Fab fragment, respectively has an antigen binding site and a Fc fragment. F of pepsin generation (ab ')₂Fragment. Alberts etc., Molecular Biology ofthe Cell (" molecular biology of cell "), second edition, 1989, Garland Publishing, Inc..

L and H two chains have variable sequence at their amino terminal, but at their carboxyl terminal, have constant series. The L chain has the variable region that is about 110 amino acid whose constant regions and formed objects. The H chain also has and is about 110 amino acid whose variable regions, but its constant region is about 330 or 440 amino acid according to the classification of H chain. Alberts etc., Molecular Biology of the Cell (" molecular biology of cell "), second edition, 1989, Garland Publishing, Inc., the 1019th page.

Only have the variable region part to participate in the antigen combination directly. Studies show that, the variation of L and H chain variable region is confined in three little hypervariable regions (also referred to as complementary determining region or CDR) of each chain mostly. The remainder of variable region is relatively stable, is called framework region (FR). Alberts etc., Molecular Biology of the Cell (" molecular biology of cell "), second edition, 1989, Garland Publishing, Inc., 1019-1020 page.

Will be appreciated that the alleged complementary determining region of this paper (CDR) residue numbering is as Kabat etc. (1991, NIH publication 91-3242, National Technical Information Service (national technical information service department), Springfield, VA) numbering. Specifically, residue 24-34 (CDR1), 50-56 (CDR2) and 89-97 (CDR3) are positioned at variable region of light chain, and 31-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3) are positioned at variable region of heavy chain. Notice antibody and antibody difference very large (rely on and define the homology that can not show with the Kabat consensus sequence). The high specific of framework residue inserts with " room " residue the numbering system that is used for the Fv district to often needing. Will be appreciated that the alleged CDR of this paper defines as (the same) such as Kabat. In addition, the identity of some single residue that is in any given Kabat site numbering may be because of species between antibody chain and antibody chain between or allele divergence (allelic divergence) different.

The antibody that it is contemplated that the multiple tyrosine kinase receptor of target (for example, EphA1-8, EphA10, EphB1-6) is the Perfected process that prevents to treat tolerance. For improving effect, reduce side effect, target specific cells or tyrosine kinase receptor as far as possible and express other relevant reason, also it is contemplated that and (for example may need the specific tyrosine kinase receptor of a kind of antibody target, target EphA2) or receptor combination (for example, target EphA2 and EphA4), maybe can reduce the affinity to the specificity tyrosine kinase receptor.

In one embodiment, it is antibody that the Eph/ liver is joined protein modulators, for example monoclonal antibody or its fragment. Antibody Eph/ liver of the present invention join protein modulators can with the Eph acceptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver (for example join albumen, liver is joined albumin A 1, liver and joins albumin A 2, liver and join albumin A 3, liver and join that albumin A 4, liver are joined albumin A 5, liver is joined protein B 1, ephrin B2 or liver and joins protein B 3) specific binding, regulate one or more Eph acceptors and/or liver and join the active of protein ligands and/or express.

In a specific embodiment, the ectodomain of antibody capable of the present invention and Eph acceptor (for example, in Eph receptors ligand binding site or outer epi-position) specific binding, reduce recipient cytoplasm tail region phosphorylation, but do not cause the degraded of Eph acceptor. In another specific embodiment, the ectodomain of described antibody capable and Eph acceptor (for example, in Eph receptors ligand binding site or outer epi-position) combination, suppress or reduce the degree of Eph receptor-ligand binding. In another specific embodiment, the ectodomain of antibody capable of the present invention and Eph acceptor (for example, in Eph receptors ligand binding site or outer epi-position) specific binding, reduce Eph receptor signal transduction (including but not limited to Eph acceptor autophosphorylation). In also having another embodiment, the ectodomain of antibody capable of the present invention and Eph acceptor (for example, in Eph receptors ligand binding site or outer epi-position) specific binding, reduce Eph receptor signal transduction (including but not limited to Eph acceptor autophosphorylation), suppress or reduce the degree of Eph receptor-ligand binding.

In one embodiment, antibody capable of the present invention and certain liver are joined protein ligands (for example, in the Eph receptor binding site or outer epi-position) specific binding, prevent or reduce Eph receptors bind relevant to it. In another embodiment, liver of the present invention is joined protein antibodies can (for example join albumen with certain liver, in the Eph receptor binding site or outer epi-position) specific binding, regulate (induce or suppress) and express the liver that liver joins in the cell of albumen and join the protein signal transduction. In another specific embodiment, antibody capable of the present invention and liver are joined albumen (for example, in the Eph receptor binding site or outer epi-position) specific binding, reduce liver and join the protein signal transduction, suppress or reduce Eph acceptor-liver and join the degree of protein-interacting. In another specific embodiment, antibody capable of the present invention and liver are joined albumen (for example, in the Eph receptor binding site or outer epi-position) specific binding, induce liver to join the protein signal transduction, suppress or reduce the Eph-liver and join the degree of protein-interacting. In the embodiment that also has, antibody capable of the present invention and liver (are for example joined albumen, in the Eph receptor binding site or outer epi-position) specific binding, suppress or reduce liver and join albumen and other molecule, for example the Src family kinase (as, Fyn) interact, suppress or reduce liver and join the protein signal transduction.

In concrete embodiment, the difference of Subcellular Localization, ligand binding characteristic or protein construct are (for example, orientation in structure, cell membrane) can further distinguish and be subjected to Eph acceptor and/or liver to join protein abnormal expression (namely, rising, reduction or inappropriate) specific Eph acceptor and/or liver are joined albumen and join albumen with Eph acceptor and/or the liver of normal cell expression in the cell (for example, cancer cell) of relevant disease impact. Such as but not limited to, EphA2 expression on non-cancer cell is low, and is positioned at the cell contact site of energy in conjunction with (engage) its film grappling part. Yet the common showed cell Contact of cancer cell reduces, and this may cause the EphA2-ligand binding to reduce. In addition, the EphA2 overexpression may cause EphA2 excessive with respect to part, thereby has improved not the EphA2 content with ligand binding. Therefore, the variation that the subcellular fraction of EphA2 distributes or film is orientated causes EphA2 to be positioned can not be near the site of part in cancer cell. In addition, in cancer cell, the ligand binding characteristic of EphA2 may change (for example, because of conformational change), thereby it can not stably be interacted with its part, no matter and whether it is positioned at the iuntercellular tie point. In various situations, these variations may expose some epi-position of EphA2 in cancer cell, and these epi-positions do not expose (that is, occlusion body epi-position) in non-cancer cell. Therefore, the present invention also provides and can join protein-specific with Eph acceptor and/or liver and be combined, but preferential be subjected to Eph acceptor and/or liver to join protein abnormal expression (namely with being exposed to, rising, reduction or inappropriate) relevant disease impact cell (for example, cancer cell), rather than the Eph acceptor on normal cell and/or liver join the antibody of albumen epi-position in conjunction with (" the Eph acceptor epitope antibodies of exposure " or " liver of exposure is joined the albumen epitope antibodies "). Make and be subjected to Eph acceptor and/or liver to join protein abnormal expression (namely; rising, reduction or inappropriate) relevant disease impact cell (for example; cancer cell) thus joining the albumen epitope antibodies with the liver of the Eph acceptor epitope antibodies of this exposure or exposure contacts the multiplication capacity that makes therapeutic/affected cell of primary antibody target and prevent or reduce this cell; protect simultaneously unaffected cell, because the Eph acceptor of preferential selective that expose or the increase with described cell but not on undesired cell of described antibody capable or liver are joined the albumen epi-position, be combined.

Antibody of the present invention includes but not limited to: the Fv (sdFv) that the antibody that synthetic antibody, monoclonal antibody, restructuring produce, multi-specificity antibody (comprising bispecific antibody), people's antibody, humanized antibody, chimeric antibody, intracellular antibody, scFv (scFv) (for example, comprising that monospecific is connected with bispecific), Fab fragment, F (ab ') fragment, disulfide bond connect, antiidiotype (anti--Id) the epi-position binding fragment of antibody and above any antibody. Specifically, antibody of the present invention comprises the immunologic competence part of immunoglobulin molecules and immunoglobulin molecules, namely contain and can join the antigen binding site that albumin A 1 antigentic specificity the is combined molecule of (for example, anti--EphA2 antibody or anti-liver are joined one or more complementary determining regions (CDR) of albumin A 1 antibody) with EphA2 antigen or liver. Antibody of the present invention can be any type (for example, IgG, IgE, IgM, IgD, IgA and IgY), classification (for example, IgG₁、IgG ₂、IgG ₃、 IgG ₄、IgA ₁And IgA₂) or the immunoglobulin molecules of subclass.

The present invention includes and can be combined with the Eph receptor-specific and exciting Eph acceptor, namely cause the agonistic antibody that the Eph receptor signal is transduceed and reduced the Eph expression of receptor. Excitability Eph receptor antibody can be induced Eph acceptor autophosphorylation, thereby causes Eph acceptor degraded subsequently and then lower the Eph expression of receptor and suppress the Eph acceptor and endogenic ligand (for example, liver is joined albumen) interaction. Include in full this paper as a reference with Publication about Document this antibody is disclosed (for example, excitability EphA2 antibody (as EA2, EA3, EA4 and EA5)): U.S. Patent Publication US 2004/0091486 A1 (on May 13rd, 2004) and US 2004/0028685 A1 (on February 12nd, 2004) and U.S. Patent Application Serial 10/823,254 (on April 12nd, 2004), " EphA2 and Hyperproliferative Cell Disorders " (EphA2 and super proliferative cell disease) (lawyer's file number 10271-060-999) by name. In a specific embodiment, the inventive method antibody used is Eph099B-102.147, Eph099B-208.261, Eph099B-210.248, B233, EA2 or EA5. In another specific embodiment, the inventive method antibody used is people or humanized Eph099B-102.147, Eph099B-208.261, Eph099B-210.248, B233, EA2 or EA5. In a specific embodiment, it is not Eph099B-102.147, Eph099B-208.261, Eph099B-210.248, B233, EA2 or EA5 that the EphA2/ liver is joined albumin A 1 conditioning agent.

In a specific embodiment, antibody of the present invention comprises antibody GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 (SEQ ID No 114-135,136-201; Fig. 5 A-B) Fab (containing VH, VL or CDRs) amino acid sequence.

In also having a specific embodiment, antibody of the present invention is selected from GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4.

In another specific embodiment, antibody of the present invention is not D7, EA2, EA5, B210, B233 or B208.

The present invention also comprise utilization can with certain member's specific binding of Eph receptor family and the exciting Eph epi-position of cancer cell and/or the antibody of preferential and its combination of being exposed to, described antibody contains one or more vH CDR and the one or more VL CDR of GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4. Specifically, the present invention includes utilization can with certain member's specific binding of Eph receptor family and the exciting Eph epi-position of cancer cell and/or the antibody of preferential and its combination of being exposed to, described antibody contains following VH CDR and VL CDR:VH CDR1 and the VL CDR1 of GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4; VH CDR1 and a VL CDR2; VH CDR1 and VL CDR3; VH CDR2 and VL CDR1; VH CDR2 and VL CDR2; VH CDR2 and VL CDR3; VH CDR3 and VL CDR1; VH CDR3 and VL CDR2; VH CDR3 and VL CDR3; VH1 CDR1, VH CDR2 and VL CDR1; VH CDR1, VH CDR2 and VL CDR2; VH CDR1, VH CDR2 and VL CDR3; VH CDR2, VH CDR3 and VL CDR1, VH CDR2, VH CDR3 and VL CDR2; VH CDR2, VH CDR3 and VL CDR3; VH1 CDR1, VH CDR3 and VL CDR1; VH CDR1, VH CDR3 and VL CDR2; VH CDR1, VH CDR3 and VL CDR3; VH CDR1, VL CDR1 and VL CDR2; VH CDR1, VL CDR1 and VL CDR3; VH CDR1, VL CDR2 and VL CDR3; VH CDR2, VL CDR1 and VL CDR2; VH CDR2, VL CDR1 and VL CDR3; VH CDR2, VL CDR2 and VL CDR3; VH CDR3, VL CDR1 and VL CDR2; VH CDR3, VL CDR1 and VL CDR3; VH CDR3, VL CDR2 and VL CDR3; VH CDR1, VH CDR2, VH CDR3 and VL CDR1; VH CDR1, VH CDR2, VH CDR3 and VL CDR2; VH CDR1, VH CDR2, VH CDR3 and VL CDR3; VH CDR1, VL CDR1, VL CDR2 and VL CDR3; VH CDR2, VL CDR1, VL CDR2 and VL CDR3; VH CDR3, VL CDR1, VL CDR2 and VL CDR3; VH CDR1, VH CDR2, VL CDR1 and VL CDR2; VH CDR1, VH CDR2, VL CDR1 and VL CDR3; VH CDR1, VH CDR2, VL CDR2 and VL CDR3; VH CDR1, VH CDR3, VL CDR1 and VL CDR2; VH CDR1, VH CDR3, VL CDR1 and VL CDR3; VH CDR1, VH CDR3, VL CDR2 and VL CDR3; VH CDR2, VH CDR3, VL CDR1 and VL CDR2; VH CDR2, VH CDR3, VL CDR1 and VL CDR3; VH CDR2, VH CDR3, VL CDR2 and VL CDR3; VH CDR1, VH CDR2, VH CDR3, VL CDR1 and VL CDR2; VH CDR1, VH CDR2, VH CDR3, VL CDR1 and VL CDR3; VH CDR1, VH CDR2, VH CDR3, VL CDR2 and VL CDR3; VH CDR1, VH CDR2, VL CDR1, VL CDR2 and VL CDR3; VH CDR1, VH CDR3, VL CDR1, VL CDR2 and VL CDR3; VH CDR2, VH CDR3, VL CDR1, VL CDR2 and VL CDR3; VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2 and VL CDR3 or their any combination.

The present invention also comprises the antibody of energy and GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 or the competition of their Fab and Eph receptors bind. Those skilled in the art know the competition experiments that can be used for identifying this antibody. In a specific embodiment, the antibody capable of the present invention that the ORIGEN that knows test detects 1 μ g/m1 prevents GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 and the biotin labeled Eph receptors bind of 75%, 80%, 85% or 90% ORIGEN TAG mark.

The present invention also provides the antibody that contains the known framework region of those skilled in the art. In one embodiment, the fragment district of antibody of the present invention or its fragment is the people's or humanized.

(for example remove any other replacement or change, Fc replaces) outside, the antibody that the present invention includes contains sudden change (for example, one or more 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors) in the framework region of GEA-44,1A4,1B 10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 or variable region amino acid sequence. In one embodiment, affinity and/or the affinity of these antibody to the Eph acceptor of their institute's specific bindings has been kept, has been reduced or improved in the sudden change in these antibody. The technology of the affinity of specific these antibody of modification has hereinafter been described. Can adopt standard technique well known by persons skilled in the art (for example, immunoassays) to check the affinity of certain antibody to specific antigen.

The present invention includes the nucleic acid molecules (normally separating) of the antibody that utilizing encodes can be combined with the Eph receptor-specific. In a specific embodiment, the antibody that the nucleic acid molecule encoding of separation can be combined with certain Eph receptor-specific, described antibody has the amino acid sequence of GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4. In another embodiment, the antibody that the nucleic acid molecule encoding that separates can be combined with the Eph receptor-specific, the VH domain of described antibody contains the amino acid sequence of the VH domain of GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4. In another embodiment, the antibody that the nucleic acid molecule encoding that separates can be combined with the Eph receptor-specific, the VL domain of described antibody contains the amino acid sequence of the VL domain of GEA-44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4.

The present invention includes the isolated nucleic acid molecule that utilizes the antibody that coding can be combined with the Eph receptor-specific, the VH CDR of described antibody has the amino acid sequence of arbitrary VH CDR shown in Fig. 5 A-B and/or derived from the heavy chain of arbitrary antibody shown in Fig. 5 A-B. Specifically, the present invention includes the isolated nucleic acid molecule that utilizes the antibody that coding can be combined with certain Eph receptor-specific, one of described antibody, two or more VH CDR have the amino acid sequence of arbitrary VH CDR shown in Fig. 5 A-B and/or derived from the heavy chain of arbitrary antibody shown in Fig. 5 A-B.

The present invention includes the isolated nucleic acid molecule that utilizes the antibody that coding can be combined with the Eph receptor-specific, the VL CDR of described antibody has the amino acid sequence of arbitrary VL CDR shown in Fig. 5 A-B and/or derived from the light chain of arbitrary antibody shown in Fig. 5 A-B. Specifically, the present invention includes the isolated nucleic acid molecule that utilizes the antibody that coding can be combined with certain Eph receptor-specific, one of described antibody, two or more VL CDR have the amino acid sequence of arbitrary VL CDR shown in Fig. 5 A-B and/or derived from the light chain of arbitrary antibody shown in Fig. 5 A-B.

The present invention includes the antibody that utilization can be combined with certain Eph receptor-specific, these antibody comprise the derivative of VH domain, VH CDR, VL domain or the VL CDR that can be combined with certain Eph receptor-specific described herein. Can adopt standard technique well known by persons skilled in the art (for example to introduce sudden change in the nucleotide sequence of code book invention antibody, add, lack and/or replace), for example the mutagenesis of conventional employing direct mutagenesis and PCR-mediation produces 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor. Hereinafter be described in further detail the technology that instructs antibody selection and specific modified antibodies.

In one embodiment, with original VH and/or VL CDR, compare, the 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor that VH and/or VL CDR derivative contain is less than 25, be less than 20, be less than 15, be less than 10, be less than 5, be less than 4, be less than 3 or be less than 2. In another embodiment, VH and/or VL CDR derivative are at the non-key amino acid residue place of its one or more expectations (namely, be combined and be not vital amino acid residue with certain Eph receptor-specific for antibody) can contain conservative amino acid replacement (for example, the same). Perhaps, can will suddenly change and introduce at random in the coded sequence all or in part of VH and/or VL CDR by for example saturation mutagenesis, the BA of the mutant that screening obtains have kept active mutant with evaluation. After mutagenesis, can express the antibody of coding, measure the activity of this antibody.

Present invention resides in and contain GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or the 8B4 antibody that one or more additional amino acid residues replace in light chain variable (VL) domain and/or weight chain variable (VH) domain.The present invention is also included within and contains GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or the 8B4 antibody that one or more additional amino acid residues replace among one or more VL CDR and/or the one or more VH CDR.Can in external or body, detect, for example by in VH domain, VH CDR, VL domain and/or the VL CDR of GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 antibody, introduce to replace the antibody that produced can with certain Eph receptors bind (by, for example immunoassay, include but not limited to ELISA and BIAcore), or detect it and can mediate ADCC, prevention, treatment, control or alleviate cancer or its one or more symptoms.

The present invention also comprise utilization can with at least a Eph receptor or the bonded antibody of its fragments specific, the variable region of heavy chain of described antibody and/or the aminoacid sequence of variable region of light chain or its fragment (for example, one or more CDR) and GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 (SEQ ID 114-135,136-201; Fig. 5 A-B) it is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical that the variable region of heavy chain and/or the aminoacid sequence of variable region of light chain have.The present invention also comprise utilization can with at least a Eph receptor or the bonded antibody of its fragments specific, the variable region of heavy chain of described antibody and/or the aminoacid sequence of variable region of light chain and GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6, the variable heavy chain of 6B7 or 8B4 and/or the aminoacid sequence of variable light chain have at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or identical at least about 99%.The present invention also comprise utilization can with at least a Eph receptor or the bonded antibody of its fragments specific, it is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical that the aminoacid sequence of one or more CDR of described antibody or antibody fragment and the aminoacid sequence of one or more CDR of GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 have.

The present invention also comprise utilization can with at least a Eph receptor or the bonded antibody of its fragments specific, the aminoacid sequence of one or more CDR of described antibody or antibody fragment and the aminoacid sequence of one or more CDR of GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4 have at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or identical at least about 99%.Can adopt any method well known by persons skilled in the art to measure the homogeny percentage ratio of two aminoacid sequences, comprise the retrieval of the basic gopher of local sequence alignment (BLAST) protein (Altschul, S.F. etc., 1990, J.Mol.Biol., 215:403-410).

The present invention also comprise utilization can with at least a Eph receptor or the bonded antibody of its fragments specific, described antibody by can be under rigorous condition nucleotide sequence coded with the nucleotide sequence hybridization of GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4.In another embodiment, the present invention includes can with certain Eph receptor or the bonded antibody of its fragments specific, one or more CDR of described antibody by can be under rigorous condition nucleotide sequence coded with the nucleotide sequence hybridization of one or more CDR of GEA44,1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 or 8B4.Rigorous hybridization conditions includes but not limited to: hybridize with the DNA that is combined on the filter membrane in 6 * sodium chloride/sodium citrate (SSC), wash one or many at about 50-65 ℃ with 0.2 * SSC/0.1%SDS then for about 45 ℃; Highly rigorous condition be for example about 45 ℃ in 6 * SSC with the DNA hybridization that is combined on the filter membrane, then about 60 ℃ with 0.1 * SSC/0.2%SDS washing one or many; Or any other rigorous hybridization conditions well known by persons skilled in the art (referring to, Ausubel for example, F.M. wait volume, 1989, Current Protocols in MolecularBiology (" up-to-date molecular biology method "), the first volume, Green Publishing Associates, Inc. and John Wiley ﹠amp; Sons, Inc., New York, 6.3.1 page or leaf-6.3.6 page or leaf and 2.10.3 page or leaf).

In a specific embodiment, antibody of the present invention contains the variable region of heavy chain and/or the light chain variable region amino acid sequence of antibody sequence shown in Fig. 5 A and the 5B, and it is 90% identical that the variable region of heavy chain of the aminoacid sequence of wherein said antibody and antibody shown in Fig. 5 A and the 5B or light chain variable region amino acid sequence have at least.In also having a specific embodiment, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or at least one CDR of sequence of light chain (SEQ ID No 114-201), and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.In another embodiment, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or at least two CDR of sequence of light chain, and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.In also having another embodiment, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or at least three CDR of sequence of light chain, and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.In also having a specific embodiment, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or at least four CDR of sequence of light chain, and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.In another specific embodiment, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or at least five CDR of sequence of light chain, and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.In the specific embodiment that also has, antibody of the present invention contains the described heavy chain of antibody shown in Fig. 5 A and the 5B and/or all six CDR of sequence of light chain, and wherein said CDR is identical with the corresponding CDR shown in Fig. 5 A and the 5B.

In another specific embodiment, these antibody capables combine with certain Eph receptor or its fragment, and at least two CDR of described heavy chain that described antibody contains and/or sequence of light chain are identical with the corresponding CDR of antibody shown in Fig. 5 A and the 5B.In also having a specific embodiment, these antibody capables combine with certain Eph receptor or its fragment, and at least three CDR of described heavy chain that described antibody contains and/or sequence of light chain are identical with the corresponding CDR of antibody shown in Fig. 5 A and the 5B.In another specific embodiment, these antibody capables combine with certain Eph receptor or its fragment, and at least four CDR of described heavy chain that described antibody contains and/or sequence of light chain are identical with the corresponding CDR of antibody shown in Fig. 5 A and the 5B.In also having a specific embodiment, these antibody capables combine with certain Eph receptor or its fragment, and at least five CDR of described heavy chain that described antibody contains and/or sequence of light chain are identical with the corresponding CDR of antibody shown in Fig. 5 A and the 5B.In also having a specific embodiment, these antibody capables combine with certain Eph receptor or its fragment, and six CDR of described heavy chain that described antibody contains and/or all of sequence of light chain are identical with the corresponding CDR of antibody shown in Fig. 5 A and the 5B.

Imagination can be according to the binding affinity difference of required antigen (for example, the member of receptor tyrosine kinase family or classification) is come specific modifications and selected antibody of the present invention.Can adopt various techniques known in the art to detect binding affinity.For example, adopt enzyme-linked immunosorbent assay (ELISA) screening to have the antibody of required binding affinity.Adopt the non-limitative example of this technology embodiment 1 that sees below.ELISA generally includes preparation antigen, with antigen coated microtitre plate hole, flush away not with the bonded antigen of plate hole, but add and detection compound to each hole, for example zymolyte (as, horseradish peroxidase or alkali phosphatase) link coupled antibody interested, cultivate one period, the antibody of unconjugated antibody of flush away or non-specific binding, detect whether exist can with bag by the bonded antibody of the antigenic specificity in hole.In ELISA, but not necessarily with interested antibody and detection compound coupling; But but but Xiang Kongzhong adding and the link coupled second antibody of detection compound (can discern antibody interested).In addition, except using antigen coated hole, the available antibodies bag is by the hole.In this case, but but detection molecules can be and detection compound, for example zymolyte (as, horseradish peroxidase or alkali phosphatase) link coupled antigen.Those skilled in the art will know that and to improve these parameters to strengthen detection signal and ELISA other factors known in the art.The further discussion of ELISA can referring to, volume such as Ausubel for example, 1994, Current Protocols inMolecular Biology (" up-to-date molecular biology method "), I volume, John Wiley ﹠amp; Sons, Inc., New York, 11.2.1. page or leaf.

In detecting another example of affinity, can adopt the BIAcore dynamic analysis to measure combining and the speed of dissociating (Kd) of antibody of the present invention and specific antigen.The BIAcore dynamic analysis comprises analyzes combining and the situation of dissociating of antigen and the chip that is fixed with antibody of the present invention on the surface.Referring to including this paper Wu as a reference etc., 1999, J.Mol.Biol., 294:151-162 in full in.In brief, the antigen-Ig by the preparation of injection sodium acetate is fixed on antigen-Ig fusion rotein on (hydrochloric acid 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) and the N-hydroxyl-butanimide-activatory sensor chip CM5.Low-density immobilized antigen-Ig is in case Fab combination again during dissociating.The association rate of measuring the following 6 kinds of different Fab concentration of specific flow velocity is to obtain association rate constant (Kon).Dissociation rate constant (Koff) be by analytic solution from during the meansigma methods of 6 measured values obtaining.With BIAevaluation (BIA assessment) 3.0 program analysis sensing figure.With Kd=Koff/Kon calculating K d.Residual Fab is removed in each back of detecting by dissociating for a long time.

Also can adopt competition in conjunction with the dissociation rate of test determination antibody (comprising the scFv or other molecule that contain or constitute by antibody fragment or its variant) with antigenic binding affinity and antibody-AI.Competition is a radioimmunoassay in conjunction with an example of test, its be included in unlabelled antigen that content increases progressively exist cultivate labelling down antigen (for example, ³H or ¹²¹I), detect and the bonded antibody of labelled antigen with antibody interested.The affinity of the data determination antibody of the present invention of available Scatchard mapping analysis and in conjunction with dissociation rate.Also can adopt radioimmunoassay to detect competition with second antibody.In this case, (for example, in the presence of the unlabelled antigen that content increases progressively, cultivate antigen and the underlined chemical compound of coupling ³H or ¹²¹I) antibody of the present invention.

Also can adopt other to test that for example immunoassay are screened or the further binding specificity of characterized humanized antibody, described immunoassay include but not limited to: adopt such as competition and non-competing pilot system, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), sandwich immunoassay, immune precipitation determination, precipitation, gel diffusion precipitation reaction, immunodiffusion mensuration, agglutination test, complement fixation test, fluorescence immunoassay and the A protein immunization of western engram technology and measure.Well known this routine test (referring to, for example include this paper volumes such as Ausubel as a reference in, 1994, CurrentProtocols in Molecular Biology (" up-to-date molecular biology method "), I volume, John Wiley﹠amp; Sons, Inc., New York).

In a specific embodiment, binding affinity that can specific modification antibody of the present invention makes it compare at least 1.1 times of raisings with Eph receptor family member's binding affinity with at least one other member of this Eph receptor family, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 200 times, at least 300 times, at least 400 times, at least 500 times or at least 1000 times.

In another specific embodiment, binding affinity that can specific modification antibody of the present invention makes it compare at least 1.1 times of reductions with Eph receptor family member's binding affinity with at least one other member's of this Eph receptor family binding affinity, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 200 times, at least 300 times, at least 400 times, at least 500 times or at least 1000 times.

In another specific embodiment, binding affinity that can specific modification antibody of the present invention makes the K of antibody of the present invention to the one or more members' of Eph receptor family binding affinity _DValue is at least 1 * 10 ⁶M ^-1, at least 1 * 10 ⁷M ^-1, at least 1 * 10 ⁸M ^-1, at least 1 * 10 ⁹M ^-1, at least 1 * 10 ¹⁰M ^-1, at least 1 * 10 ¹¹M ^-1, at least 1 * 10 ¹²M ^-1, at least 1 * 10 ¹³M ^-1, at least 1 * 10 ¹⁴M ^-1Or at least 1 * 10 ¹⁵M ^-1In also having another specific embodiment, binding affinity that can specific modification antibody of the present invention makes the K of antibody of the present invention to the one or more members' of Eph receptor family binding affinity _DValue is between 1 * 10 ⁶M ^-1-1 * 10 ⁷M ^-1Between, between 1 * 10 ⁷M ^-1-1 * 10 ⁸M ^-1Between, between 1 * 10 ⁸M ^-1-1 * 10 ⁹M ^-1Between, between 1 * 10 ⁹M ^-1-1 * 10 ¹⁰M ^-1Between, between 1 * 10 ¹⁰M ^-1-1 * 10 ¹¹M ^-1Between, between 1 * 10 ¹¹M ^-1-1 * 10 ¹²M ^-1Between, between 1 * 10 ¹²M ^-1-1 * 10 ¹³M ^-1Between, between 1 * 10 ¹³M ^-1-1 * 10 ¹⁴M ^-1Between or between 1 * 10 ¹⁴M ^-1-1 * 10 ¹⁵M ^-1

In one embodiment, the preferential combination with EphA2 of antibody of the present invention surpasses other Eph receptor.In another embodiment, the preferential combination with EphA4 of antibody of the present invention surpasses other Eph receptor.In also having another embodiment, antibody capable of the present invention and one or more Eph receptor complexes (for example, Eph receptor-liver is joined albumen composition) specificity combination.In also having another embodiment, antibody capable of the present invention combines with multiple Eph receptor-specific.Can make up as follows with the bonded Eph receptor of multiple Eph receptor-specific bonded antibody institute: EphA (x)+[EphB (y)] (n ₂); EphA (x)+[EphA (x)] (n ₁); EphB (y)+[EphB (y)] (n ₂); EphB (y)+[EphA (x)] (n ₁) or [EphA (x)] (n ₁EphB)+[(y)] (n ₂), wherein (x) be 1,2,3,3a, 3b, 4,5,5a, 5b, 6,7,8 or 10; (y) be 1,2,2a, 2b, 3,4,5 or 6; (n ₁) be the multiple of 0-8; (n ₂) be the multiple of 0-5.In a specific embodiment, can combine with the antibody capable of multiple Eph receptor-specific reaction, for example EphA2+EphA4, EphA2+EphA3, EphA2+EphB4, EphA4+EphA3, EphA4+EphB4, EphA2+EphA3+EphA4+EphA5+EphA6+EphA7+EphA8, EphaA1+EphA5, EphA2+EphA3+EphA4+EphA5+EphA6+EphA7+EphA8+EphB1+EphB2+Ep hB3.Imagination can specific modification can with the binding affinity of the antibody of multiple Eph receptors bind shown in the following formula, make it that each target receptor is had identical affinity, or raising is to the affinity of a kind of, some or all of target receptors, or reduce affinity to a kind of, some or all of target receptors or any combination identical, that improve or reduce binding affinity.

In a specific embodiment, can be bi-specific antibody with the bonded antibody of multiple Eph receptor-specific.In another specific embodiment, can be three special (trispecific) property antibody with the bonded antibody of multiple Eph receptor-specific.

Though those skilled in the art will know that the member of Eph receptor family is different protein, have homology region (referring to, Figure 1A-1R and 2A-2G).Therefore, think that high-affinity antibody or its fragment can (for example, EphA2) and the combination of antigenicity fragments specific, but not combine with second kind of Eph receptor and antigenicity fragment thereof with first kind of Eph receptor.Also think the epi-position that high-affinity antibody of the present invention can be total with a kind of, several or all Eph receptors, a kind of, several or epi-position or epitope specificity combination a kind of, several or that all EphB receptors are total that all EphA receptors are total.

Can be called " antigenicity determinant " or " epi-position " (Janeway and Travers, Immunobiology (" immunology "), chapter 3, Garland Publishing, Inc., the third edition, 1997) in certain molecule with the bonded zone of antigenic specificity.These sites on the protein are made of the aminoacid of the different piece of protein amino acid sequence usually, these aminoacid are combined and are formed three-dimensional epi-position (Janeway and Travers when protein folding, Immunobiology (" immunology "), chapter 3, GarlandPublishing, Inc., the third edition, 1997).The epi-position of these types is called " comformational epitope " or " discontinuous epi-position ", because according to the one-level aminoacid sequence, they are formed by discontinuous aminoacid sequence, but they constitute (Janeway and Travers, Immunobiology (" immunology "), chapter 3 by successive aminoacid sequence according to three dimensional structure, Garland Publishing, Inc., the third edition, 1997).On the contrary, the epi-position that is made of the successive one-level aminoacid sequence of certain proteinic length is called " continuous epitope " or " linear epi-position " (Janeway and Travers, Immunobiology (" immunology "), chapter 3, Garland Publishing, Inc., the third edition, 1997).

Total epi-position can be identical in the Eph receptor of all Eph receptors or selection.In this case, it is identical to contain the aminoacid sequence of this epi-position in the target Eph receptor.Therefore, one of antibody capable of the present invention and Eph family, several or all member's specificitys combine (for example, specific recognition be present in identical epi-position in a kind of, several or all Eph receptors antibody).Perhaps, the total epi-position among of the Eph receptor family, several or all members can be similar.For example, similar epi-position can be enjoyed between remarkable homology (for example, 60%-99% is identical) and/or the different Eph receptor and take similar three-dimensional conformation, thereby makes antibody capable of the present invention and should share epitope specificity and combine.Therefore, one of antibody capable of the present invention and Eph family, total epitope specificity several or all members combine.Antibody of the present invention can have different affinitys to one of Eph family, total epi-position or similar epi-position several or all members.Therefore, think that also antibody capable of the present invention combines with the identical or binding affinity that changes and Eph family one, several or all members.In a specific embodiment, these antibody or its fragment can combine and surpass other antigen with one of Eph family, several or all member's specificitys.The monoclonal anti physical ability that also has a specific embodiment to provide combines with the bonded Eph receptor epitope specificity of monoclonal antibody GEA44.

The present invention also comprises can combine the also antagonistic antibodies of antagonism Eph receptor with the Eph receptor-specific, promptly reduces Eph recipient cytoplasm tail region phosphorylation and reduction/interference Eph receptor-ligand binding.Antagonism Eph receptor antibody can reduce or suppress Eph receptor autophosphorylation phosphorylation, thereby improves the protein stability or the protein accumulation of Eph receptor.This antibody (for example, antagonism EphA2 antibody) be disclosed in the full text of submitting on April 12nd, 2004 and include this paper U.S. Patent Application Serial 10/823 as a reference in, 259, its " EphA2; Hypoproliferative Cell Disorders and Epithelialand Endothelial Cell Reconstitution " by name (EphA2, low proliferative cell disease and epithelium and endotheliocyte are rebuild).

The same with all polypeptide, antibody has isoelectric point, IP (pI), the pH when it is normally defined polypeptide and does not carry net charge.This area knows that proteinic dissolubility is minimum usually when the pH of solution equals isoelectric point of protein (pI).Number that can be by changing ionizable residue in the antibody and position are regulated pI and are optimized dissolubility.For example, can handle the pI of polypeptide by suitable aminoacid replacement (for example, use charged aminoacid, replace uncharged residue as lysine) as alanine.Do not want to be subjected to the constraint of any particular theory, the antibody aminoacid replacement that causes described antibody pI to change can improve the dissolubility and/or the stability of this antibody.Those skilled in the art will know which kind of aminoacid replacement is for the required pI of the most suitable acquisition of certain antibody specific.Can adopt the whole bag of tricks, include but not limited to: isoelectric focusing and various computerized algorithm (referring to, Bjellqvist etc. for example, 1993, Electrophoresis 14:1023) measures proteinic pI.

In one embodiment, the replacement that causes antibody pI of the present invention to change can obviously not reduce its binding affinity to receptor tyrosine kinase family or classification member.PI value defined used herein is the pI of main charged form.Can adopt the whole bag of tricks, include but not limited to: isoelectric focusing and various computerized algorithm (referring to, Bjellqvist etc. for example, 1993, Electrophoresis 14:1023) measures proteinic pI.In a specific embodiment, the concrete pI of antibody of the present invention is at least 6.0, at least 6.1, at least 6.2, at least 6.3, at least 6.4, at least 6.5, at least 6.6, at least 6.7, at least 6.8, at least 6.9, at least 7.0, at least 7.1, at least 7.2, at least 7.3, at least 7.4, at least 7.5, at least 7.6, at least 7.7, at least 7.8, at least 7.9, at least 8.0, at least 8.1, at least 8.2, at least 8.3, at least 8.4, at least 8.5, at least 8.6, at least 8.7, at least 8.8, at least 8.9 or at least 9.0.

The Tm of certain monoclonal antibody domain is the good index of antibody heat stability, has also shown its storage life.Tm is low to show the more/less stable of cohesion, and Tm higher show cohesion less/stability better.Therefore, the preferred higher antibody of Tm.In one embodiment, the Tm value of certain monoclonal antibody domain is higher than at least 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃, 90 ℃, 95 ℃, 100 ℃, 105 ℃, 110 ℃, 115 ℃ or 120 ℃.In another embodiment, the Tm value of certain monoclonal antibody domain is higher than at least about 50 ℃, about 55 ℃, about 60 ℃, about 65 ℃, about 70 ℃, about 75 ℃, about 80 ℃, about 85 ℃, about 90 ℃, about 95 ℃, about 100 ℃, about 105 ℃, about 110 ℃, about 115 ℃ or about 120 ℃.Can adopt any standard method known in the art, for example differential scanning calorimetry detect protein domain (for example, the Fab domain) pyrolysis chain temperature (Tm) (referring to, Vermeer etc. for example, 2000, Biophys.J., 78:394-404; Vermeer etc., 2000, Biophys.J., 79:2150-2154).

The present invention also comprises the active Fc variant antibody that improves of antibody dependent cellular mediated cell toxicity.The non-limitative example of this Fc variant antibody is disclosed in U.S. Patent application 11/203,253 (submissions on August 15th, 2005) and 11/203,251 (submissions on August 15th, 2005), U.S. Provisional Patent Application 60/674,674 (submissions on April 26th, 2005) and 60/713,711 (JIUYUE was submitted on the 6th in 2005), each piece document is included this paper in as a reference in full.

The present invention also comprises single domain antibody, comprise camelization (camelized) single domain antibody (referring to, Muyldermans etc. for example, 2001, Trends Biochem.Sci., 26:230; Nuttall etc., 2000, Cur.Pharm.Biotech., 1:253; Reichmann and Muyldermans, 1999, J.Immunol.Meth., 231:25; International Patent Publication No. W WO 94/04678 and WO 94/25591; U.S. Patent number 6,005,079; These documents are included this paper in as a reference in full).In one embodiment, the invention provides and contain two V _HThe single domain antibody of domain, described two V _HDomain contains any Eph receptor or liver is joined protein antibodies V _HThe aminoacid sequence of domain is modified and form single domain antibody.In another embodiment, the present invention also provides and contains two V _HThe single domain antibody of domain, described two V _HDomain contains any Eph receptor or liver is joined one or more V of protein antibodies _HCDR.

Antibody of the present invention comprises that Eph receptor or liver join proteic intracellular antibody (referring to the 6.1.1.1.1 part).It is intracellular antibody that antibody Eph/ liver of the present invention is joined protein modulators, and it can be joined with Eph receptor or liver, and protein-specific combines and regulate (improve or reduce) Eph receptor or liver is joined proteic expression and/or activity.In a specific embodiment, intracellular antibody of the present invention can combine with born of the same parents' intracellular domain specificity of Eph receptor, and reduces Eph recipient cytoplasm tail region phosphorylation but do not cause the degraded of Eph receptor.In another embodiment, intracellular antibody of the present invention can combine with the Eph receptor-specific, and prevent or reduce Eph receptor signal transduction (including but not limited to Eph receptor autophosphorylation phosphorylation), but do not suppress or reduce Eph receptor and Eph endogenic ligand, for example liver is joined proteic interaction.

The used antibody of the inventive method can comprise birds and mammal (for example, people, Mus, donkey, sheep, rabbit, goat, Cavia porcellus, camel, horse or chicken) from any animal origin.In a specific embodiment, described antibody be the people and or through humanized." people " used herein antibody comprises the antibody of the aminoacid sequence with human normal immunoglobulin and isolated antibody from the human normal immunoglobulin library or from the mice of expressing human gene antibody.

The used antibody of the inventive method can be monospecific, bispecific, tri-specific or polyspecific more.Multi-specificity antibody can be joined the different epitope specificity combinations of protein polypeptide with Eph receptor polypeptides or liver, or can join protein polypeptide and allos epi-position with multiple Eph receptor polypeptides and/or multiple liver, for example heterologous polypeptide or the combination of solid support material specificity.Referring to, for example International Patent Publication No. W WO93/17715, WO 92/08802, WO 91/00360 and WO 92/05793; Tutt etc., 1991, J.Immunol., 147:60-69; U.S. Patent number 4,474,893; 4,714,681; 4,925,648; 5,573,920 and 5,601,819; Kostelny etc., 1992, J.Immunol., 148:1547-1553.

In a specific embodiment, the present invention includes to can be used for reducing as far as possible and use any antibody of the present invention, (for example, EphA2) regulating liver-QI is joined protein antibodies and the method to Normocellular genotoxic potential that causes to include but not limited to the Eph receptor antibody.In one embodiment, the included method of the present invention comprises general phage or the antibody library of utilization at normal structure.Except that this embodiment, this method comprises the antibody of energy of adsorption in advance and normal or healthy cell or tissue reaction.Source normal or healthy cell or tissue can be separated certainly; for example blood, skin and/or to its have genotoxic potential (influence) concrete organ (as, heart, lung, pancreas, ovary, spleen, testis, adrenal gland, colon, uterus, prostate, skin, kidney, bladder or liver).In another embodiment, the available primary cell line that derives from normal structure adsorbs this antibody to prevent or to reduce toxicity as far as possible.In a specific embodiment, Eph/ liver of the present invention is joined protein modulators antibody and can not combine with the human heart normal cell, perhaps the human heart normal cell is not had genotoxic potential.

5.1.1.1.1 Intracellular antibody

In some embodiments, the used antibody capable of the present invention combines with epi-position in the born of the same parents, i.e. intracellular antibody.In a specific embodiment, intracellular antibody of the present invention can combine with the cytoplasmic structure territory of Eph receptor, prevents Eph receptor signal transduction (for example, autophosphorylation).In another specific embodiment, intracellular antibody of the present invention can be joined the albumen cytoplasmic structure territory combination of (for example, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) with B-type liver.The contained at least a portion of intracellular antibody can combine with antigenic specificity, does not preferably contain the sequence of coding at antigen secretions.This antibody can combine with antigen in born of the same parents.In one embodiment, intracellular antibody comprises strand Fv (" scFv ").ScFvs is the V that contains antibody _HAnd V _LThe antibody fragment of domain, these domains are present in the polypeptide chain.ScFv is usually at V _HAnd V _LAlso containing a peptide linker between the domain makes scFv formation combine required structure with antigen.The summary of scFV is seen Pluckthun, publishes in The Pharmacology of Monoclonal Antibodies (" pharmacology of monoclonal antibody "), the 113rd volume, Rosenburg and Moore compile, Springer-Verlag, New York, the 269-315 page or leaf, (1994).In also having an embodiment, the intracellular antibody operability secretion sequence of preferably not encoding, thereby can be retained in (usually can be referring to Marasco in the cell, WA, 1998, " Intrabodies:Basic Research and Clinical Gene Therapy Applications " (intracellular antibody: basic retrieval and clinical gene therapy are used), Springer: New York).

Those skilled in the art know the production method of intracellular antibody, and it is described in, and for example include this paper U.S. Patent number 6,004,940 as a reference in full in; 6,072,036; 5,965,371.In addition, the structure of intracellular antibody is described in Ohage and Steipe, 1999, J.Mol.Biol., 291:1119-1128; Ohage etc., 1999, J.Mol.Biol., 291:1129-1134; Wirtz and Steipe, 1999, ProteinScience, 8:2245-2250, these lists of references are included this paper in as a reference in full.Also can adopt recombinant molecule biology techniques (for example the reorganization of antibody produces described) to produce intracellular antibody.

In one embodiment, intracellular antibody of the present invention kept complete antibody (that is, having complete constant region and variable region) to antigen in conjunction with render a service at least about 75%.In another embodiment, intracellular antibody has kept complete antibody in conjunction with at least 85% of effectiveness.In also having an embodiment, intracellular antibody has kept complete antibody in conjunction with at least 90% of effectiveness.In also having other embodiment, intracellular antibody has kept complete antibody in conjunction with at least 95% of effectiveness.

Preparation can utilize during intracellular antibody, for example hybridoma mRNA or spleen (cell) mRNA as the pcr amplification template of this domain (Huse etc., 1989, Science 246:1276) comes clones coding V interested _HAnd V _LThe two the polynucleotide of variable region of chain.In one embodiment, can pass through, the polynucleotide sequence of coding joint connects coding V _HAnd V _LThe polynucleotide of domain produce single-chain antibody (scFv).It is V that scFv comprises sequence usually _H-joint-V _LOr V _L-joint-V _HA peptide.Select joint with heavy chain and light chain with suitable conformation orientation combine (referring to, for example include this paper Huston as a reference etc. in, 1991, Methods in Enzym., 203:46-121).In also having an embodiment, joint can be crossed over distance between its merging point and each variable domains (for example, 3.5nm) to reduce the distortion of natural Fv conformation as far as possible.In this embodiment, joint is the polypeptide of at least 5 amino acid residues, at least 10 amino acid residues, at least 15 amino acid residues or more a plurality of amino acid residues.In also having an embodiment, joint is not answered spatial interference V _HAnd V _LThe binding site of domain.In this embodiment, this joint be 35 aminoacid or less than, 30 aminoacid less than or 25 aminoacid or less than.Therefore, in also having another embodiment, this joint length is between 15-25 aminoacid.In also having an embodiment, this joint is hydrophilic, and its pliability is enough to make V _HAnd V _LDomain can take to detect the required conformation of antigen.Can be created in identical V _HAnd V _LBe inserted with the intracellular antibody of different joint sequences in the domain.Can determine certain concrete a pair of V by rule of thumb by the antigen combination degree of assessment each (antibody) _HAnd V _LDomain has the joint of proper characteristics.The example of joint includes but not limited to: those sequences shown in the table 5.

Table 5

Sequence	SEQ ID NO.
Sequence	SEQ ID NO.	(Gly Gly Gly Gly Ser) ₃	SEQ ID NO：73
Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser	SEQ ID NO：74	(Gly Gly Gly Gly Ser) ₃	SEQ ID NO：73
Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser	SEQ ID NO：74	Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr	SEQ ID NO：75
Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gln	SEQ ID NO：76	Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr	SEQ ID NO：75
Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gln	SEQ ID NO：76	Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Val Asp	SEQ ID NO：77
Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly	SEQ ID NO：78	Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Val Asp	SEQ ID NO：77
Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly	SEQ ID NO：78	Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser Leu Asp	SEQ ID NO：79
Glu Ser Gly Ser Val Ser Ser Glu Glu Leu Ala Phe Arg Ser Leu Asp	SEQ ID NO：80		SEQ ID NO：79

In one embodiment, intracellular antibody is expressed in the kytoplasm.In other embodiments, intracellular antibody is positioned at various born of the same parents position.In this embodiment, thus specific positioning sequence can be linked to each other with the intracellular antibody polypeptide intracellular antibody is caused ad-hoc location.Intracellular antibody can be positioned, for example with position in the lower eyelid: endoplasmic reticulum (Munro etc., 1987, Cell 48:899-907; Hangejorden etc., 1991, J.Biol.Chem.266:6015); Nuclear (Lanford etc., 1986, Cell 46:575; Stanton etc., 1986, PNAS 83:1772; Harlow etc., 1985, Mol.Cell Biol.5:1605; Pap etc., 2002, Exp.Cell Res.265:288-93); Nucleolar zone (Seomi etc., 1990, J.Virology64:1803; Kubota etc., 1989, Biochem.Biophys.Res.Comm.162:963; Siomi etc., 1998, Cell 55:197); Endosome chamber (endosomal compartment) (Bakke etc., 1990, Cell 63:707-716); Mitochondrial matrix (Pugsley, A.P., 1989, " Protein Targeting " (" protein targeting "), Academic Press, Inc.); Golgi body (Tang etc., 1992, J.Bio.Chem.267:10122-6); Liposome (Letourneur etc., 1992, Cell 69:1183); Peroxisome (Pap etc., 2002, Exp.Cell Res.265:288-93); Trans-Golgi network (Pap etc., 2002, Exp.Cell Res.265:288-93); And plasma membrane (Marchildon etc., 1984, PNAS81:7679-82; Henderson etc., 1987, PNAS 89:339-43; Rhee etc., 1987, J.Virol.61:1045-53; Schultz etc., 1984, J.Virol.133:431-7; Ootsuyama etc., 1985, Jpn.J.Can.Res.76:1132-5; Ratner etc., 1985, Nature 313:277-84).The example of localization signal peptide includes but not limited to those sequences shown in the table 6.

Table 6

The location	Sequence	SEQ ID NO.
The location	Sequence	SEQ ID NO.	Endoplasmic reticulum	Lys Asp Glu Leu	SEQ ID NO：81
Endoplasmic reticulum	Asp Asp Glu Leu	SEQ ID NO：82	Endoplasmic reticulum	Lys Asp Glu Leu	SEQ ID NO：81
Endoplasmic reticulum	Asp Asp Glu Leu	SEQ ID NO：82	Endoplasmic reticulum	Asp Glu Glu Leu	SEQ ID NO：83
Endoplasmic reticulum	Gln Glu Asp Leu	SEQ ID NO：84	Endoplasmic reticulum	Asp Glu Glu Leu	SEQ ID NO：83
Endoplasmic reticulum	Gln Glu Asp Leu	SEQ ID NO：84	Endoplasmic reticulum	Arg Asp Glu Leu	SEQ ID NO：85
Nuclear	Pro Lys Lys Lys Arg Lys Val	SEQ ID NO：86	Endoplasmic reticulum	Arg Asp Glu Leu	SEQ ID NO：85
Nuclear	Pro Lys Lys Lys Arg Lys Val	SEQ ID NO：86	Nuclear	Pro Gln Lys Lys Ile Lys Ser	SEQ ID NO：87
Nuclear	Gln Pro Lys Lys Pro	SEQ ID NO：88	Nuclear	Pro Gln Lys Lys Ile Lys Ser	SEQ ID NO：87
Nuclear	Gln Pro Lys Lys Pro	SEQ ID NO：88	Nuclear	Arg Lys Lys Arg	SEQ ID NO：89
Nuclear	Lys Lys Lys Arg Lys	SEQ ID NO：90	Nuclear	Arg Lys Lys Arg	SEQ ID NO：89
Nuclear	Lys Lys Lys Arg Lys	SEQ ID NO：90	Nucleolar zone	Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala His Gln	SEQ ID NO：91
Nucleolar zone	Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln Arg	SEQ ID NO：92	Nucleolar zone	Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala His Gln	SEQ ID NO：91
Nucleolar zone		SEQ ID NO：92	Nucleolar zone	Met Pro Leu Thr Arg Arg Arg Pro Ala Ala Ser Gln Ala Leu Ala Pro Pro Thr Pro	SEQ ID NO：93

The location	Sequence	SEQ ID NO.
The location	Sequence	SEQ ID NO.	The endosome chamber	Met Asp Asp Gln Arg Asp Leu Ile Ser Asn Asn Glu Gln Leu Pro	SEQ ID NO：94
Mitochondrial matrix	Met Leu Phe Asn Leu Arg Xaa Xaa Leu Asn Asn Ala Ala Phe Arg His Gly His Ash Phe Met Val Arg Asn Phe Arg Cys Gly Gln Pro Leu Xaa	SEQ ID NO：95	The endosome chamber	Met Asp Asp Gln Arg Asp Leu Ile Ser Asn Asn Glu Gln Leu Pro	SEQ ID NO：94
Mitochondrial matrix		SEQ ID NO：95	Peroxisome	Ala Lys Leu	SEQ ID NO：96
Trans-Golgi network	Ser Asp Tyr Gln Arg Leu	SEQ ID NO：97	Peroxisome	Ala Lys Leu	SEQ ID NO：96
Trans-Golgi network	Ser Asp Tyr Gln Arg Leu	SEQ ID NO：97	Plasma membrane	Gly Cys Val Cys Ser Ser Asn Pro	SEQ ID NO：98
Plasma membrane	Gly Gln Thr Val Thr Thr Pro Leu	SEQ ID NO：99	Plasma membrane	Gly Cys Val Cys Ser Ser Asn Pro	SEQ ID NO：98
Plasma membrane	Gly Gln Thr Val Thr Thr Pro Leu	SEQ ID NO：99	Plasma membrane	Gly Gln Glu Leu Ser Gln His Glu	SEQ ID NO：100
Plasma membrane	Gly Ash Ser Pro Ser Tyr Asn Pro	SEQ ID NO：101	Plasma membrane	Gly Gln Glu Leu Ser Gln His Glu	SEQ ID NO：100
Plasma membrane	Gly Ash Ser Pro Ser Tyr Asn Pro	SEQ ID NO：101	Plasma membrane	Gly Val Ser Gly Ser Lys Gly Gln	SEQ ID NO：102
Plasma membrane	Gly Gln Thr Ile Thr Thr Pro Leu	SEQ ID NO：103	Plasma membrane	Gly Val Ser Gly Ser Lys Gly Gln	SEQ ID NO：102
Plasma membrane	Gly Gln Thr Ile Thr Thr Pro Leu	SEQ ID NO：103	Plasma membrane	Gly Gln Thr Leu Thr Thr Pro Leu	SEQ ID NO：104
Plasma membrane	Gly Gln Ile Phe Ser Arg Ser Ala	SEQ ID NO：105	Plasma membrane	Gly Gln Thr Leu Thr Thr Pro Leu	SEQ ID NO：104
Plasma membrane	Gly Gln Ile Phe Ser Arg Ser Ala	SEQ ID NO：105	Plasma membrane	Gly Gln Ile His Gly Leu Ser Pro	SEQ ID NO：106
Plasma membrane	Gly Ala Arg Ala Ser Val Leu Ser	SEQ ID NO：107	Plasma membrane	Gly Gln Ile His Gly Leu Ser Pro	SEQ ID NO：106
Plasma membrane	Gly Ala Arg Ala Ser Val Leu Ser	SEQ ID NO：107	Plasma membrane	Gly Cys Thr Leu Ser Ala Glu Glu	SEQ ID NO：108

V _HAnd V _LDomain is made of the immunoglobulin domains that has conservative disulfide bond structure usually.In the embodiment of expressing in the reproducibility environment (for example, kytoplasm), this architectural feature can not exist at intracellular antibody.Can make sudden change in the intracellular antibody peptide sequence reduces to remedy the immunoglobulin structure stability that does not have disulfide bond formation to cause.In one embodiment, the V of intracellular antibody _HAnd/or V _LDomain contains one or more point mutation, make they can be in the reproducibility environment stably express (referring to Steipe etc., 1994, J.Mol.Biol.240:188-92; Wirtz and Steipe, 1999, Protein Science8:2245-50; Ohage and Steipe, 1999, J.Mol.Biol.291:1119-28; Ohage etc., 1999, J.Mol Biol.291:1129-34).

Intracellular antibody albumen is as therapeutic agent

In one embodiment, give the patient with recombinant expressed intracellular antibody albumen.This intracellular antibody polypeptide must could mediate preventative in born of the same parents or the therapeutic effect.In this embodiment of the present invention, the intracellular antibody polypeptide is connected with " but film permeability sequence ".But film permeability sequence is the polypeptide that can enter cell interior from the extracellular permeate through cell membranes.When but film permeability sequence links to each other with another polypeptide, also can guide this polypeptide to pass the cell membrane transposition.

In one embodiment, but film permeability sequence be signal peptide water repellent region (referring to, Hawiger for example, 1999, Curr.Opin.Chem.Biol.3:89-94; Hawiger, 1997, Curr.Opin.Immunol.9:189-94; U.S. Patent number 5,807,746 and 6,043,339; These documents are included this paper in as a reference in full).But the water repellent region that the sequence of film permeability sequence can any signal peptide is the basis.Signal peptide can from, for example the SIGPEP data base select (referring to, von Heijne for example, 1987, Prot.Seq.Data Anal.1:41-2; Von Heijne and Abrahmsen, 1989, FEBS Lett.224:439-46).When the target of inserting the intracellular antibody polypeptide is the cell of particular type, but film permeability sequence is preferably based on the endogenous signal peptide of the type cell.In another embodiment, but film permeability sequence be a kind of virus protein (for example, protein herpesvirus VP22) or its fragment (referring to, Phelan etc. for example, 1998, Nat.Biotechnol.16:440-3).But but can come to determine by rule of thumb to have the film permeability sequence of proper characteristics by assessing ability that each film permeability sequence guiding intracellular antibody passes the cell membrane transposition for specific intracellular antibody and/or particular target cell type.But the example of film permeability sequence includes but not limited to those sequences shown in the table 7.

Table 7

Sequence	SEQ ID NO.
Sequence	SEQ ID NO.	Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro	SEQ ID NO：109
Ala Ala Val Leu Leu Pro Val Leu Leu Ala Ala Pro	SEQ ID NO：110		SEQ ID NO：109
Ala Ala Val Leu Leu Pro Val Leu Leu Ala Ala Pro	SEQ ID NO：110	Val Thr Val Leu Ala Leu Gly Ala Leu Ala Gly Val Gly Val Gly	SEQ ID NO：111

In another embodiment, but film permeability sequence can be a derivant.In this embodiment, but replace by introducing amino acid residue, disappearance, add and/or modify the aminoacid sequence that changes film permeability sequence.Such as but not limited to, cut, derive and come modified polypeptide with known protection/blocking groups, proteolysis with (carrying out) glycosylation, acetylation, pegization, phosphorylation, amidatioons such as cell ligand or other protein are connected.Can adopt technology well known by persons skilled in the art, carry out the derivant that chemical modification comes modified membrane permeability sequences polypeptide but include but not limited to that the metabolism of specificity chemical cleavage, acetylation, formylated, tunicamycin is synthetic etc.In addition, but the derivant of film permeability sequences polypeptide can contain one or more atypia aminoacid.In one embodiment, polypeptide derivative has and does not change the similar or identical functions of polypeptide.In another embodiment, compare with unaltered polypeptide, but the activity change of the derivant of film permeability sequences polypeptide.For example, but deutero-film permeability sequences polypeptide can more effectively pass the cell membrane transposition or more tolerate Proteolytic enzyme.

But available many modes link to each other film permeability sequence with intracellular antibody.In one embodiment, but film permeability sequence and intracellular antibody with expressing fusion protein.In this embodiment, adopt the standard recombinant dna technology (referring to, Rojas etc. for example, 1998, but Nat.Biotechnol.16:370-5) will the encode nucleic acid of film permeability sequence links to each other with the nucleic acid of the intracellular antibody of encoding.In also having an embodiment, but the nucleotide sequence of encoded interval arm peptide is placed between the nucleic acid of coding film permeability sequence and coding intracellular antibody.In another embodiment, distinguish separately recombinant expressed after, but again junctional membrane permeability sequence and intracellular antibody (referring to, Zhang etc. for example, 1998, PNAS 95:9184-9).In this embodiment, the standard method that can adopt this area with peptide bond or non-peptide bond (for example, use cross-linking agent, as glutaraldehyde or Thiazolidine connecting key, referring to as Hawiger, 1999, Curr.Opin.Chem.Biol.3:89-94) connect these polypeptide.

But film permeability sequence-intracellular antibody polypeptide can give by parenteral, for example by intravenous injection, comprises that the tissue by containing target cell or the supply vessels of organ carry out regional perfusion; Or suction aerosol; Subcutaneous or intramuscular injection; Topical administration is skin wound and sick damage place for example; Direct transfection is prepared the medullary cell of transplanting, is implanted into object subsequently; With the direct transfection organ, be implanted into object subsequently.Other medication comprises oral administration, particularly when complex wraps up; Or rectally, particularly when complex is taked suppository form.Pharmaceutically acceptable carrier comprises and not being biologically or opposite bad any material, can give individuality with the complex of selection with this material, but do not cause any bad biological effect or with harmful mode and this pharmaceutical composition contained other component interaction.

In view of the guidance of this area (referring to, Remington ' s Pharmaceutical Sciences (" Lei Mingdun pharmaceutical science ") for example, the 18th edition, E.W.Martin compiles, Mack Publishing Co., Easton, Pa. (1990)), but the administration condition of the definite film permeability sequence-intracellular antibody polypeptide of being not difficult.If pass through, for example regional perfusion's organ or tumor are come particular cell types in the targeting body, can carry out biological biopsy to the cell of target tissue, determine to make the optimal dose of complex input target tissue to optimize dosage in the body external, comprise concentration and time span.Perhaps, also can adopt cultured cell optimization of same cell type to be used for the dosage of target cell in the body.

Intracellular antibody gene therapy and therapeutic agent

In another embodiment, can give the patient (for example, in gene therapy) with the polynucleotide of coding intracellular antibody.In this embodiment, can adopt the described method afford of 6.4.1 chapters and sections polynucleotide of the present invention.

5.1.1.1.2 Antibody conjugates

The present invention includes and utilize the Eph/ liver (for example to join protein modulators, can with Eph/ receptor and/or liver join the bonded Eph receptor of protein-specific (as, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or liver (for example join albumen, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) antibody or its fragment) and heterologous protein or polypeptide (or its fragment, for example, have at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acid whose polypeptide) reorganization is merged or chemically conjugated (comprising covalency and non-covalent puting together) produces fusion rotein.For example, can be by the specific antibody of these antibody and specific cells surface receptor being merged or puts together, thereby can utilize these antibody in external or body with heterologous polypeptide targeting particular cell types.The antibody that adopts means known in the art and heterologous polypeptide to merge or put together also can be used for external immunoassay and purification process.Referring to, for example international publication WO 93/21232; EP439,095; Naramura etc., 1994, Immunol.Lett.39:91-99; United States Patent (USP) 5,474,981; Gillies etc., 1992, PNAS 89:1428-1432; With Fell etc., 1991, J.Immunol.146:2446-2452; These documents are included this paper in as a reference in full.In the specific embodiment, the disease of utilizing the inventive method to prevent, treat, control or alleviate is that Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.

The present invention also comprises the compositions that contains the heterologous polypeptide that merges with antibody fragment or put together.For example, can be with heterologous polypeptide and Fab fragment, Fd fragment, Fv fragment, F (ab) ₂A fragment or their part merge or put together.The method that protein, polypeptide or peptide and antibody or antibody fragment are merged or put together known in the art.Referring to, for example U.S. Patent number 5,336, and 603; 5,622,929; 5,359,046; 5,349,053; 5,447,851 and 5,112,946; European patent number EP 307,434 and EP 367,166; International publication number WO96/04388 and WO 91/06570; Ashkenazi etc., 1991, Proc.Natl.Acad.Sci.USA, 88:10535-10539; Zheng etc., 1995, J.Immuno1.154:5590-5600; With Vil etc., 1992, Proc.Natl.Acad.Sci.USA 89:11337-11341 (described list of references is included this paper in as a reference in full).

Can reorganize by gene, the technology of motif reorganization, exon reorganization and/or codon reorganization (being referred to as " DNA reorganization ") produces other fusion rotein, for example any Eph/ liver of the present invention is joined the fusion rotein of protein modulators.Can adopt DNA to reorganize and change antibody of the present invention or its segmental activity (antibody or its fragment that for example, have higher affinity and low dissociation rate).Generally can referring to, U.S. Patent number 5,605,793; 5,811,238; 5,830,721; 5,834,252 and 5,837,458; Patten etc., 1997, Curr.OpinionBiotechnol.8:724-33; Harayama, 1998, Trends Biotechnol.16:76; Hansson etc., 1999, J.Mol.Biol.287:265; Lorenzo and Blasco, 1998, BioTechniques24:308 (each part patent and publication are included this paper in as a reference in full).Carry out random mutagenesis by fallibility PCR, random nucleotide insertion or other method earlier, reorganization can change antibody or its fragment again, perhaps Bian Ma antibody or its fragment.Can with the coding each several part can with the Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or liver is joined albumen, and (for example, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) one or more parts of the polynucleotide of the bonded antibody of specificity or antibody fragment and one or more components of one or more heterologous molecule, motif, section, part, domain, reorganization such as fragment (recombine).

In addition, can be with these antibody or its fragment and labelled sequence, for example peptide merges to promote purification.In some embodiments, marker amino acid sequence is the peptide of six-histidine, for example, the label that provides in the pQE carrier (QIAGEN, Inc., Chatsworth, California) etc., wherein many labellings can commerce be buied.As Gentz etc. (1989, PNAS, 86:821) described in, six-histidine is that the purification of fusion rotein is provided convenience.Other peptide tag that can be used for purification includes but not limited to: (Wilson etc., Cell is 37:767) with " flag " label corresponding to hemagglutinin " HA " label derived from the influenza hemagglutinin protein epi-position.

In other embodiments, but antibody of the present invention or its fragment or variant can be puted together with diagnosis or detectable.Can utilize this antibody to monitor as the part of Clinical Laboratory method or the generation or the progress of prognosis cancer, for example measure the effectiveness of concrete therapy.In addition, available this antibody detection or prognosis Eph receptor and/or liver are joined the generation or the progress of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In a specific embodiment, can be (for example with Eph receptor of the present invention, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) antibody or liver join albumen (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) but antibody and diagnostic or detectable are puted together.

Antibody and detectable substance coupling can be realized this diagnosis and detection, described detectable substance includes but not limited to: various enzymes, such as but not limited to horseradish peroxidase, alkali phosphatase, beta galactosidase or acetylcholinesterase; Prothetic group is such as but not limited to Streptavidin/biotin and avidin/biotin; Fluorescent material is such as but not limited to umbelliferone, fluorescein, Fluorescein isothiocyanate, rhodamine, dichlorotriazine base amine fluorescein (diehlorotriazinylamine fluorescein), dansyl Cl or phycoerythrin; Luminescent material is such as but not limited to luminol; The bioluminescence material is such as but not limited to luciferase, luciferin and aequorin; Radioactive substance, such as but not limited to bismuth ( ²¹³Bi), carbon ( ¹⁴C), chromium ( ⁵¹Cr), cobalt ( ⁵⁷Co), fluorine ( ¹⁸F), gadolinium ( ¹⁵³Gd, ¹⁵⁹Gd), gallium ( ⁶⁸Ga, ⁶⁷Ga), germanium ( ⁶⁸Ge), holmium ( ¹⁶⁶Ho), indium ( ¹¹⁵In, ¹¹³In, ¹¹²In, ¹¹¹In), iodine ( ¹³¹I, ¹²⁵I, ¹²³I, ¹²¹I), lanthanum ( ¹⁴⁰La), lutecium ( ¹⁷⁷Lu), manganese ( ⁵⁴Mn), molybdenum ( ⁹⁹Mo), palladium ( ¹⁰³Pd), phosphorus ( ³²P), praseodymium ( ¹⁴²Pr), promethium ( ¹⁴⁹Pm), rhenium ( ¹⁸⁶Re, ¹⁸⁸Re), rhodium ( ¹⁰⁵Rh), ruthenium ( ⁹⁷Ru), samarium ( ¹⁵³Sm), scandium ( ⁴⁷Sc), selenium ( ⁷⁵Se), strontium ( ⁸⁵Sr), sulfur ( ³⁵S), technetium ( ⁹⁹Tc), thallium ( ²⁰¹Ti), stannum ( ¹¹³Sn, ¹¹⁷Sn), tritium ( ³H), xenon ( ¹³³Xe), ytterbium ( ¹⁶⁹Yb, ¹⁷⁵Yb), yttrium ( ⁹⁰Y), zinc ( ⁶⁵Zn); The positron emitting metal and the on-radiation paramagnetic metal ion that are used for various positron emission tomographies.

The present invention also comprises and utilizes antibody or its fragment and preventative or curative drug to put together.The non-limitative example of these conjugates is disclosed in the U.S. Provisional Application 60/714,362 of JIUYUE in 2005 submission on the 7th; United States Patent (USP) provisional application US2005/0180972 A1 and United States Patent (USP) provisional application US2005/0123536 A1, each part application is included this paper in as a reference in full.Can be with antibody or its fragment and therapeutic part, cytotoxin for example, as suppressing cell or cytocide thing, curative drug or radioactive metal ion are puted together as α-(ray) emitter.Cytotoxin or cytotoxic drug can be the deleterious any medicines of pair cell.Therapeutic partly includes but not limited to: antimetabolite (for example, methotrexate, Ismipur, 6-thioguanine, cytosine arabinoside, 5-fluorouracil, dacarbazine (decarbazine)); (for example, chlormethine (mechlorethamine), thioepa chlorambucil, melphalan, Carmustine (BCNU) and lomustine (lomustine) are (CCNU) for alkylating agent; Cyclophosphamide, busulfan, mitobronitol, streptozotocin, ametycin and cis dichloro diamidogen platinum (II) (DDP) and cisplatin); Anthracycline antibiotics (for example, daunoblastin (being called daunomycin in the past) and amycin); Antibiotic (for example, actinomycin D (dactinomycin) (being called D actinomycin D (actinomycin) in the past), bleomycin, mithramycin and anthramycin (AMC)); Auristatin molecule (for example, auristatin E, auristatin F, auristatin PHE, MMAE, MMAF, bryostatin 1 and solastatin 10; Referring to Woyke etc., Antimicrob.Agents Chemother.46:3802-8 (2002); Woyke etc., Antimicrob.Agents Chemother.45:3580-4 (2001); Mohammad etc., Anticancer Drugs 12:735-40 (2001); Wall etc., Biochem.Biophys.Res.Commun.266:76-80 (1999), Mohammad etc., Int.J.Oncol.15:367-72 (1999), all documents include this paper in as a reference in full); Hormone (for example, glucocorticoid, progesterone, androgen and estrogen), DNA-repairase inhibitor (for example, etoposide or topotecan), inhibitors of kinases (for example, compound S T1571, imatinib mesylate (Kantarjian etc., Clin Cancer Res.8 (7): 2167-76 (2002)); Cytotoxic drug (for example, paclitaxel, cytochalasin B, Gramicidin D, the pyridine of bromination second, ipecine, mitomycin, etoposide, teniposide (tenoposide), vincristine, vincaleucoblastine, Colchicine, amycin, daunoblastin, dihydroxy anthracin diketone (dihydroxy anthracin dione), istizin, mithramycin, actinomycin D, 1-dehydrogenation testosterone, glucocorticoid, procaine, tetracaine, lignocaine, Propranolol, with puromycin and their analog or homologue and disclosed those chemical compounds of following U.S. Patent number: 6,245,759; 6,399,633; 6,383,790; 6,335,156; 6,271,242; 6,242,196; 6,218,410; 6,218,372; 6,057,300; 6,034,053; 5,985,877; 5,958,769; 5,925,376; 5,922,844; 5,911,995; 5,872,223; 5,863,904; 5,840,745; 5,728,868; 5,648,239; 5,587,459); Farnesyl transferase inhibitor (for example, R115777, BMS-214662 and disclosed those chemical compounds of for example following U.S. Patent number: 6,458,935; 6,451,812; 6,440,974; 6,436,960; 6,432,959; 6,420,387; 6,414,145; 6,410,541; 6,410,539; 6,403,581; 6,399,615; 6,387,905; 6,372,747; 6,369,034; 6,362,188; 6,342,765; 6,342,487; 6,300,501; 6,268,363; 6,265,422; 6,248,756; 6,239,140; 6,232,338; 6,228,865; 6,228,856; 6,225,322; 6,218,406; 6,211,193; 6,187,786; 6,169,096; 6,159,984; 6,143,766; 6,133,303; 6,127,366; 6,124,465; 6,124,295; 6,093,737; 6,090,948; 6,080,870; 6,077,853; 6,071,935; 6,066,738; 6,063,930; 6,054,466; 6,051,582; 6,051,574 and 6,040,305); Topoisomerase enzyme inhibitor (for example, camptothecine; Irinotecan (irinotecan); SN-38; Topotecan; 9-amino based camptothecine; GG-211 (GI 147211); DX-8951f; IST-622; Rubitecan (rubitecan); Pyrazoles acridine (pyrazoloacridine); XR-5000; Saintopin; UCE6; UCE1022; TAN-1518A; TAN-1518B; KT6006; KT6528; ED-110; NB-506; ED-110; NB-506; With butterfly mycin (rebeccamycin)); Bulgarein; DNA minor groove binders, for example Hoescht dyestuff 33342 and Hoechst dyestuff 33258; Nitidine; Fagaronine (fagaronine); Epiberberine; Coralyne; β-lapachol; BC-4-1; Di 2 ethylhexyl phosphonic acid (bisphosphonate) (for example, alendronate, ineadronic acid disodium (cimadronte), sodium clodronate, Tiludronate (tiludronate), etidronic acid salt, ibandronate (ibandronate), neridronic acid sodium (neridronate), olpadronic acid sodium (olpandronate), risedronate sodium (risedronate), a upright phosphonate (piridronate), Sodium Pamidronate, zoledronic acid salt (zolendronate)); HMG-CoA reductase inhibitor (for example, lovastatin, simvastatin, atorvastatin, pravastatin, fluvastatin, inhibin, cerivastatin, lescol see fluvastatin, power general appropriate (1upitor), rosuvastatin and atorvastatin); Antisense oligonucleotide (for example, U.S. Patent number 6,277,832; 5,998,596; 5,885,834; 5,734,033 and 5,618,709 is disclosed); Adenosine deaminase inhibitors (for example, fludarabine phosphate (Fludarabine phosphate) and 2-chlorodeoxyadenosine); Ibritumomab tiuxetan (ibritumomab tiuxetan) (Zevalin_); Tositumomab (tositumomab) is (Bexxar_)) and their pharmaceutically acceptable salts, solvate, clathrate and prodrug.In a specific embodiment, join preventative or curative drug that protein modulators puts together to target cell (for example, express Eph receptor or liver and join proteic cell) no cytotoxicity with Eph/ liver of the present invention.

In addition, can be with antibody and therapeutic part, for example radioactive substance or the can be used for macrocyclic chelants of puting together radiation metal ion (example of the radioactive substance that sees above) is puted together.In some embodiments, macrocyclic chelants be can through linkers link to each other with

antibody

1,4,7,10-tetraazacyclododecanand-N, N ', N ", N "-tetraacethyl (DOTA).Following document description conventional known this linkers: the Denardo etc. in this area, 1998, Clin Cancer Res.4:2483-90; Peterson etc., 1999, Bioconjug.Chem.10:553; Zimmerman etc., 1999, Nucl.Med.Biol.26:943-50, each piece document is included this paper in as a reference in full.

In addition, antibody or its fragment can be puted together with the preventative or therapeutic part or the drug moiety that can improve the biological answer-reply reaction.Therapeutic part or drug moiety should not be construed as and only limit to typical chemotherapeutics.For example, drug moiety can be protein, peptide or the polypeptide with required biologic activity.This protein comprises, toxin for example is as Agglutinin, ricin A, Pseudomonas exotoxin, cholera toxin or diphtheria toxin, diphtherotoxin; Protein, as tumor necrosis factor, alpha-interferon, beta-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, apoptosis material (as TNF-α, TNF-β), AIM I (referring to international publication number WO 97/33899), AIM II (referring to international publication number WO 97/34911), Fas part (Takahashi etc., 1994, Int.Immunol., 6:1567-1574) and VEGI (referring to international publication number WO 99/23105); Anti-angiogenic medicaments, for example component of angiostatin, endostatin or coagulation pathway (coagulation pathway) (as, tissue factor); Or biological response modifier, as lymphokine (as, interferon gamma (" IFN-γ "), il-1 (" IL-1 "), interleukin-2 (" IL-2 "), interleukin-5 (" IL-5 "), interleukin-6 (" IL-6 "), interleukin-7 (" IL-7 "), IL-10 INTERLEUKIN-10 (" IL-10 "), il-1 2 (" IL-12 "), interleukin-15 (" IL-15 "), IL-23 (" IL-23 "), granulocyte macrophage colony stimulating factor (" GM-CSF ") and granulocyte colony-stimulating factor (" G-CSF ")), or somatomedin (as, growth hormone (" GH ")), or blood-clotting agent (as, calcium, vitamin K, tissue factor is such as but not limited to the Hageman factor (factor XI, plasma thromboplastin antecedent I), high molecular weight kininogen (HMWK), prekallikrein (PK), blood coagulating protein factor II (thrombinogen), factor V, XIIa, VIII, XIIIa, XI, XIa, IX, IXa, X, the phospholipid fibrinopeptide A and the B of the α of fibrinogen and β chain, fibrin monomer).In a specific embodiment, can will be able to put together with bonded antibody of IL-9 polypeptid specificity and leukotriene antagonist (for example, montelukast (montelukast), zafirlukast (zafirlukast), pranlukast (pranlukast), zileuton (Zyleuton)).

In addition, can be with antibody and preventative or therapeutic part, radioactive metal ion for example, as α-(ray) emitter (as ²¹³Bi) or be used for isotopic ion is included but not limited to ¹³¹In, ¹³¹L, ¹³¹Y, ¹³¹Ho, ¹³¹The macrocyclic chelants of Sm and conjugation of polypeptides or any above listed material are puted together.In some embodiments, described macrocyclic chelants be can through linkers link to each other with

antibody

1,4,7,10-tetraazacyclododecanand-N, N ', N ", N "-tetraacethyl (DOTA).Following document description conventional known this linkers: the Denardo etc. in this area, 1998, Clin Cancer Res.4 (10): 2483-90; Peterson etc., 1999, Bioconjug.Chem.10 (4): 553; Zimmerman etc., 1999, Nucl.Med.Biol.26 (8): 943-50, each piece document is included this paper in as a reference in full.

In another embodiment, antibody can merge with liposome or put together, wherein said liposome is used to wrap up preventative or curative drug (referring to, Park etc., 1997, Can.Lett., 118:153-160; Lopes de Menezes etc., 1998, Can.Res.58:3320-30; Tseng etc., 1999, Int.J.Can.80:723-30; Crosasso etc., 1997, J.Pharm.Sci.86:832-9).In also having an embodiment, by the lipid derivate with PEG mix the pharmacokinetics that improved liposome in the Liposomal formulation and clearance rate (referring to, Allen etc. for example, 1991, Biochem Biophys Acta1068:133-41; Huwyler etc., 1997, J.Pharmacol.Exp.Ther.282:1541-6).

Preventative or therapeutic part are known with the technology that antibody is puted together.Can each several part and antibody be puted together by technology known in the art, described technology includes but not limited to: aldehyde/Schiff connecting key, sulfydryl connecting key, sour unstable connecting key, cis Aconitum carmichjaelii Debx. connecting key, hydrazone connecting key, enzyme degradable connecting key (usually can be referring to Garnett, 2002, Adv.Drug Deliv.Rev.53:171-216).Preventative or therapeutic part are known with other technology that antibody is puted together.Can be referring to for example Arnon etc., " MonoclonalAntibodies For Immunotargeting Of Drugs In Cancer Therapy " (monoclonal antibody that is used for the immune targeting of medicine in the treatment of cancer), publish in Monoclonal Antibodies And CancerTherapy (" monoclonal antibody and treatment of cancer "), volumes such as Reisfeld, the 243-56 page or leaf, (Alan R.Liss, Inc.1985); Hellstrom etc., publish in Controlled Drug Delivery (" controlled drug is sent ") at " Antibodies For Drug Delivery " (being used for the antibody that medicine is sent), (second edition), volumes such as Robinson, 623-53 page or leaf, (Marcel Dekker, Inc.1987); Thorpe, " AntibodyCarriers Of Cytotoxic Agents In Cancer Therapy:A Review " (antibody carrier of the cytotoxic drug in the treatment of cancer: summary), publish in Monoclonal Antibodies ' 84:Biological And Clinical Applications (" monoclonal antibody ' 84: biology and clinical practice "), volumes such as Pinchera, the 475-506 page or leaf, (1985); " Analysis; Results; And FutureProspective Of The Therapeutic Use Of Radiolabeled Antibody In CancerTherapy " (therapeutic of radiolabelled antibody is used in the treatment of cancer), publish in MonoclonalAntibodies For Cancer Detection And Therapy (" monoclonal antibody of cancer detection and treatment "), volumes such as Baldwin, the 303-16 page or leaf, (Academic Press 1985) and Thorpe etc., 1982, Immunol.Rev.62:119-58.The method that antibody and polypeptide portion are merged or put together known in the art.Can referring to, for example U.S. Patent number 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851 and 5,112,946; EP 307,434; EP 367,166; International publication number WO 96/04388 and WO 91/06570; Ashkenazi etc., 1991, PNAS 88:10535-10539; Zheng etc., 1995, J.Immunol.154:5590-5600; Vil etc., 1992, PNAS 89:11337-11341.The fusion of antibody and certain part not necessarily necessary directly (fusion), and can merge by joint sequence.This linkers is that this area routine is known, is described in Denardo etc., 1998, and Clin Cancer Res, 4:2483; Peterson etc., 1999, Bioconjug Chem, 10:553; Zimmerman etc., 1999, NuclMed Biol, 26:943; Garnett, 2002, Adv Drug Deliv Rev, 53:171, each piece document is included this paper in as a reference in full.

Put together the relative effectivenes that medicine compares with free drug and depend on many factors.For example, antibody-drug is taken in the speed (for example, by endocytosis) of cell, speed/efficient that medicine discharges from antibody, medicine all can influence medicine from the speed of cell traffic effectiveness.Can be used for the antibody of targeted delivery of drugs by the ability of cells involved type (that is the cell type of disease association to be treated) endocytosis by any method check known in the art.In addition, can be used for connecting key type that medicine and antibody are puted together by any method check known in the art, thereby not hinder the effect of medicine in target cell.

Perhaps, antibody and second antibody can be puted together and form Segal and including this paper U.S. Patent number 4,676 as a reference, the heterogeneous conjugate of the antibody described in 980 in full in.

Should select (for example to join protein modulators with Eph/ liver of the present invention, the Eph receptor or can join protein polypeptide with Eph receptor or liver respectively or the bonded liver of its fragments specific is joined protein antibodies) the preventative or therapeutic part of puting together or medicine realize that treatment, control or prevention Eph receptor and/or liver join the required prevention or the therapeutical effect of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.Join protein polypeptide or its segmental antibody when puting together when decision combines Eph receptor or liver with which kind of therapeutic part or medicine with the energy specificity, clinicist or other healthcare givers should consider following problem: the situation of the character of disease, the order of severity of disease and object.

Also antibody solid support be can be connected in and the immunoassay or the purification of target antigen specifically are applied to.This solid support includes but not limited to: glass, cellulose, polyacrylamide, nylon, polystyrene, polrvinyl chloride or polypropylene.

Perhaps, can adopt above-mentioned arbitrary method to produce the Eph/ liver of joining fusion protein and join protein modulators (, the same) referring to chapters and sections 6.1.2 as Eph receptor and/or liver.

5.1.1.1.3 Multi-specificity antibody

The concrete embodiment of the present invention provides can be simultaneously with a kind of, more preferably two kinds, three kinds, four kinds or five kinds of Eph receptors are (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or liver (for example join albumen, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) in conjunction with and excitement or antagonism Eph receptor and/or liver are joined protein expression and (for example, are transcribing, after transcribing, on translation or the translation back level) and/or active multi-specificity antibody.In concrete embodiment, protein of the present invention can be puted together to produce conjugated protein with one or more heterologous proteins or peptide (or its fragment is for example with at least 10,20,30,40,50,60,70,90 or 100 aminoacid of certain polypeptide) at least at least at least at least at least at least at least at least.Specifically, the invention provides and contain certain antigen-binding fragments of antibodies described herein (for example, Fab fragment, Fd fragment, Fv fragment, scFv, F (ab) ₂Fragment, V _HDomain, V _HCDR, V _LDomain or V _LCDR) and the protein conjugate of one or more heterologous proteins, polypeptide or peptide.The method that protein, polypeptide or peptide and certain antibody or antibody fragment are puted together is known in the art.Referring to, for example U.S. Patent number 5,336, and 603; 5,622,929; 5,359,046; 5,349,053; 5,447,851 and 5,112,946; European patent number EP 307,434 and EP 367,166; International publication number WO 96/04388 and WO 91/06570; Ashkenazi etc., 1991, Proc.Natl.Acad.Sci.USA 88:10535-10539; Zheng etc., 1995, J.Immunol.154:5590-5600; Vil etc., 1992, Proc.Natl.Acad.Sci.USA 89:11337-11341 (described list of references is included this paper in as a reference in full).

5.1.1.1.4 The BiTE molecule

In a specific embodiment, the used antibody of the inventive method is that bispecific T cell is convened antibody (bispecific T cell engager) (BiTE).It is the T cell can be redirected and the bi-specific antibody of antigenic specificity elimination target that bispecific T cell is convened antibody (BiTE).The BiTE molecule its molecule one end contain can with the T cellular antigens (for example, CD3) bonded antigen binding structural domain, (at the other end) contain can with the bonded antigen binding structural domain of the antigen on the target cell.In recent years, include this paper WO 99/54440 as a reference in and described BiTE.This publication has been described the novel strand multifunctional polypeptides that contains CD19 and CD3 antigen binding site (CD19 * CD3).This molecular source is from two kinds of antibody, and CD19 a kind of and on the B cell combines, and another kind of antibody combines with CD3 on the T cell.The variable region of these different antibodies connects by a peptide sequence, thereby produces a kind of molecule.(this publication) also described and utilized the pliability joint to connect heavy chain (V _H) and light chain (V _LThereby) variable domains generation single chain bispecific antibody.

The part that can comprise in an embodiment of the invention, the BiTE molecule with polypeptide of interest bonded antibody of (for example, Eph receptor and/or liver are joined albumen) specificity or part.For example, can with the V of polypeptide of interest (for example, Eph receptor and/or liver are joined albumen) the bonded antibody of specificity _HAnd/or V _L(for example, scFV) with anti--CD3 bound fraction, this partial fusion of above-mentioned molecule for example, thus produce the BiTE molecule of targeting polypeptide of interest (for example, Eph receptor and/or liver are joined albumen).Except anti-polypeptide of interest (for example, Eph receptor and/or liver are joined albumen) the heavy chain and/or light chain variable domain of antibody outside, can with polypeptide of interest (for example, Eph receptor and/or liver are joined albumen) bonded other molecule can comprise the BiTE molecule, receptor (for example, Eph receptor and/or liver are joined albumen) for example.In another embodiment, the BiTE molecule can comprise can with the bonded molecule of other T cellular antigens (except that CD3).For example, consideration can with the T cellular antigens, for example CD2, CD4, CD8, CD11a, TCR and the bonded part of CD28 specificity and/or antibody are parts of the present invention.This inventory be not exclusiveness and just explanation can be used as the part of BiTE molecule with bonded other molecule of T cellular antigens specificity.These molecules can comprise the VH and/or the VL part of antibody or native ligand (for example, LFA3, the CD3 of its native ligand).

5.1.1.1.4 Produce the method for antibody

Can adopt the synthetic any method of antibody known in the art, particularly by chemosynthesis or preferably by recombination and expression techniques produce can with the bonded antibody of certain antigenic specificity.

Can adopt the whole bag of tricks well known in the art to produce certain antigenic specific polyclonal antibody.For example, the human antigen can be given various host animals, include but not limited to: rabbit, mice, rat are waited to induce and produce the serum that contains human antigen's specific polyclonal antibody.According to host type, can utilize various adjuvants to improve immunoreation, described adjuvant includes but not limited to: Freund adjuvant (fully with incomplete), mineral coagulant (for example aluminium hydroxide), surfactant are (for example, LYSOLECITHIN SUNLECITHIN A, pluronic polyhydric alcohol, polyanion), peptide, oil emulsion, keyhole _ hemocyanin, dinitrophenol,DNP and people's adjuvant of coming in handy, for example BCG (bacill calmette-guerin) and spillikin bacillus (Corynebacterium parvum).This adjuvant is also known in this area.

Can adopt various techniques known in the art, comprise and utilize hybridoma, recombinant and display technique of bacteriophage or their combination to prepare monoclonal antibody.For example, can adopt hybridoma technology to prepare monoclonal antibody, this technology comprise known in the art and following document is instructed those: Harlow etc., Antibodies:ALaboratory Manual (" antibody: laboratory manual "), (publishing house of cold spring harbor laboratory, second edition, 1988); Hammerling etc. publish in Monoclonal Antibodies and T-CellHybridomas (" monoclonal antibody and T quadroma "), 563-681, (Elsevier, New York, 1981) (described list of references is included this paper in as a reference in full).Term used herein " monoclonal antibody " is not limited to the antibody by the hybridoma technology generation.Term " monoclonal antibody " refers to be derived from a clone's (comprising any eucaryon, protokaryon or phage clone) antibody, rather than refers to its production method.

The well known conventional method of utilizing hybridoma technology preparation and screening specific antibody.In brief, the former immune mouse of available non-mouse-anti in case detect immunoreation, for example detects this antigenic specific antibody in mice serum, promptly collect mouse spleen and separating Morr. cell.By knowing technology splenocyte and any suitable myeloma cell (for example cell line SP20 cell that can obtain from ATCC) are merged then.Select hybridoma, clone by limiting dilution assay.By secretion among the means known in the art checks hybridoma clone can with the cell of the bonded antibody of polypeptide of the present invention.Can clone immune mouse by positive hybridoma and produce the ascites that contains high-level antibody usually.

Therefore, the antibody that the invention provides the preparation monoclonal antibody method and produce with the method, comprise that cultivation can secrete the hybridoma of antibody of the present invention, wherein said hybridoma merges acquisition with the separating Morr. cell and the myeloma cell of the former mice immunized of non-mouse-anti; Secrete in the hybridoma that the screening fusion obtains then and can clone with the hybridoma of the bonded antibody of polypeptide of the present invention.

Can produce the antibody fragment of energy identification specificity epi-position by any technology well known by persons skilled in the art.For example, available enzyme produces F (ab ') 2 fragments as papain (producing the Fab fragment) or stomach trypsin), prepare Fab of the present invention and F (ab ') 2 fragments by proteolysis cutting immunoglobulin molecules.F (ab ') 2 fragments contain the CH1 domain of variable region, constant region of light chain and heavy chain.In addition, also can adopt various phage display method known in the art to produce antibody of the present invention.

Engineering reform antibody and produce characteristic change (for example, affinity) monoclonal antibody be well known in the art (referring to, McCarthy etc. for example, 2001, J Imm Meth.251:137-149; Beiboer etc., 2000, J Mol Biol., 296:833-849; Mohan etc., 2003, Biophys J., 85:3221-3236; Diamond etc., 1984, PNAS, 81:5841-5844; Sinha etc., 2002, Biophys J., 83:2946-2968; Davies and Cohen, 1996, PNAS, 93:7-12; Cauerhff etc., 2004, PNAS, 101 (10): 3539-3544; Vasudevan etc., 2004, Blood Cells Mol Dis.32:176-181; Zebedee etc., 1992, PNAS, 89:3175-3179).The invention describes those skilled in the art and can adopt, make it method at different members in the receptor tyrosine family based on the next given antibody of specific modification (for example, the general specific antibody) specificity of the affinity maturation method in library.Each family or the classification of receptor tyrosine kinase family, the member's of each family or classification example are seen Figure 19 A-D of the present invention.It is contemplated that the specific performance behind the given antibody of specific modification meets required therapeutic or diagnostic needs.An embodiment of the invention provide specific modification can with the specific method of at least two bonded general specific antibodies of member's specificity in the receptor tyrosine kinase family, described method comprises each the aminoacid randomization of CDR that makes described general specific antibody; Generation contains the library of described randomization CDR; Screen the clone who in the described library required receptor affinity is improved or reduces.

In one embodiment, described general specific antibody is at certain member of receptor tyrosine kinase family.In a specific embodiment, described receptor tyrosine kinase family is selected from: the I class of this receptor family tyrosine kinase, II class, III class, IV class, V class, VI class, VII class, VIII class, IX class, X class, XI class, XII class, XIII class, XIV class, XV class, XVI class, XVII class, XVIII class and XIX member.In also having a specific embodiment, described general specific antibody is at the member of receptor tyrosine kinase family, and this member is the Eph receptor family.In another specific embodiment, described library is the eucaryon library.In also having a specific embodiment, described library is the protokaryon library.In a specific embodiment, described library is an expression library.In another specific embodiment, described library is a display libraries.In also having another specific embodiment, described library is a phage display library.In also having a specific embodiment, described general specific antibody is at EphA receptor family member.In also having a specific embodiment, described general specific antibody is at EphB receptor family member.

In one embodiment, described general specific antibody can combine with at least two member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least three member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least four member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least five member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least six member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least seven member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least eight member's specificitys of Eph receptor family.In also having another embodiment, described general specific antibody can combine with at least nine member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least ten member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least ten member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least ten two member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with at least ten three member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least ten four member's specificitys of Eph receptor family.In also having another embodiment, described general specific antibody can combine with at least ten five member's specificitys of Eph receptor family.In another embodiment, described general specific antibody can combine with at least ten six member's specificitys of Eph receptor family.In also having an embodiment, described general specific antibody can combine with all member's specificitys of Eph receptor family.

In another embodiment, described general specific antibody can combine with at least one member's specificity of the EphA family of receptor.In also having an embodiment, described general specific antibody can combine with at least two member's specificitys of EphA receptor family.In also having an embodiment, described general specific antibody can combine with at least three member's specificitys of EphA receptor family.In another embodiment, described general specific antibody can combine with at least four member's specificitys of EphA receptor family.In also having an embodiment, described general specific antibody can combine with at least five member's specificitys of EphA receptor family.In another embodiment, described general specific antibody can combine with at least six member's specificitys of EphA receptor family.In also having an embodiment, described general specific antibody can combine with at least seven member's specificitys of EphA receptor family.In also having an embodiment, described general specific antibody can combine with at least eight member's specificitys of EphA receptor family.In another embodiment, described general specific antibody can combine with at least nine member's specificitys of EphA receptor family.In also having an embodiment, described general specific antibody can combine with all member's specificitys of EphA receptor family.

In also having an embodiment, described general specific antibody can combine with at least one member's specificity of EphB receptor family.In another embodiment, described general specific antibody can combine with at least two member's specificitys of EphB receptor family.In also having an embodiment, described general specific antibody can combine with at least three member's specificitys of EphB receptor family.In also having an embodiment, described general specific antibody can combine with at least four member's specificitys of EphB receptor family.In another embodiment, described general specific antibody can combine with at least five member's specificitys of EphB receptor family.In also having another embodiment, described general specific antibody can combine with at least six member's specificitys of EphB receptor family.In also having an embodiment, described general specific antibody can combine with all member's specificitys of EphB receptor family.

As indicated above, can adopt the required affinity of antibody feature of several diverse ways screenings.In having a liking for the thalline methods of exhibiting, the functional antibodies domain be illustrated in carry the polynucleotides encoding them sequence have a liking for the thalli granule surface.Specifically, the DNA sequence of (for example, the people of affected tissue or Mus cDNA library) amplification coding VH and VL domain from animal cDNA library.Can make the DNA and the reorganization of scFv joint of coding VH and VL domain by PCR, be cloned into the phasmid carrier then.The carrier electroporation is entered escherichia coli, infect this escherichia coli with helper phage.These methods are used have a liking for that thalline normally contains fd and M13 threadly have a liking for thalline, wherein VH and VL domain (gene) usually with have a liking for thalline gene III or gene VIII reorganization and merge.Can utilize antigen, for example with the antigen of labelling or be incorporated into or be captured in antigen on the surface of solids or the pearl select or identify have a liking for that thalline expresses can with the bonded antigen binding structural domain of specific antigen.The example of having a liking for the thalline methods of exhibiting that can be used for preparing antibody of the present invention comprises that following document is disclosed: Brinkman etc., 1995, J.Immunol.Methods 182:41-50; Ames etc., 1995, J.Immunol.Methods 184:177-186; Kettleborough etc., 1994, Eur.J.Immunol.24:952-958; Persic etc., 1997, Gene 187:9-18; Burton etc., 1994, Advances inImmunology 57:191-280; International application no PCT/GB91/O1 134; International publication number WO90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO95/15982, WO 95/20401 and WO 97/13844; U.S. Patent number 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; Each piece document is included this paper in as a reference in full.

As described in above list of references, after thalline is had a liking in selection, the separable antibody coding region of having a liking for thalline is used to produce whole antibody (comprising people's antibody) or any other required Fab and expresses in any host (comprise mammalian cell, insect cell, plant cell, yeast and antibacterial, example is as will be detailed later).For example, also can utilize reorganization to produce Fab, Fab ' and F (ab ') 2 segmental technology, described technology adopts the open WO 92/22324 of the disclosed means known in the art of for example following document: PCT; Mullinax etc., 1992, BioTechniques, 12 (6): 864-869; Sawai etc., 1995, AJRI, 34:26-34; With Better etc., 1988, Science, 240:1041-1043 (described list of references is included this paper in as a reference in full).

Be to produce complete antibody, can utilize the PCR primer of the flanking sequence that contains VH or VL nucleotide sequence, restriction site and this restriction site of protection increase VH or VL sequence among the scFV clone.Adopt clone technology well known by persons skilled in the art, the VH domain of pcr amplification can be cloned into and express the VH constant region, for example in the carrier of people γ 4 constant regions, the VL domain of pcr amplification is cloned into expresses the VL constant region, for example in the carrier of people κ or λ constant region.In one embodiment, the carrier of expressing VH or VL domain comprises the cloning site and the selected marker of EF-1 α promoter, secretion signal, variable domains, constant domain, for example neomycin.Also VH and VL domain can be cloned in the carrier of expressing required constant region.Adopt technology known in the art that heavy chain is changed carrier and light chain conversion carrier then and be transfected into cell line jointly, can express full length antibody thereby produce, for example stable the or instantaneous cell line of IgG.

For some application, be included in and use antibody and vitro detection test in the human body, preferably utilize humanization or mosaic type antibody.For therapeutic treatment people patient, people's antibody or humanized antibody are desirable especially completely.Can be by prepared in various methods people's antibody known in the art, what comprise the antibody library that utilizes the derived from human immunoglobulin sequences above-mentionedly has a liking for the thalline methods of exhibiting.Also referring to U.S. Patent number 4,444,887 and 4,716,111; PCT open WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO96/34096, WO 96/33735 and WO 91/10741; Each piece document is included this paper in as a reference in full.

Also can utilize the endogenous immunoglobulin that to express function, but the transgenic mice of energy expressing human immunoglobulin gene produces people's antibody.For example, people's heavy chain and light chain immunoglobulin gene complex can be introduced in the mouse embryo stem cell at random or through homologous recombination.Perhaps, except people's heavy chain and light chain gene, people variable region, constant region and variable region (gene) can be introduced in the mouse embryo stem cell.Can introduce human immunoglobulin gene's seat by homologous recombination makes murine heavy chain and light chain immunoglobulin gene not have function respectively or simultaneously.Specifically, the deletion JH district of isozygotying has stoped the endogenous antibody generation.The embryonic stem cell that amplification is modified goes in the blastocyst its microinjection to produce the mosaic type mice.Make the copulation of mosaic type mice to produce the offspring of isozygotying of energy expressing human antibody then.With the antigen of selecting, all or part of of polypeptide of the present invention this transgenic mice of immunity in a usual manner for example.Can adopt conventional hybridization tumor technology to obtain at this antigenic monoclonal antibody from the transgenic mice of immunity.The contained somebody's immunoglobulin of transgenic mice transgenic is reset during the B cell differentiation, experiences classification conversion and somatic mutation then.Therefore, adopt this technology can produce treatment and go up useful IgG, IgA, IgM and IgE antibody.The summary that produces this technology of people's antibody can be referring to Lonberg and Huszar, 1995, Int.Rev.Immunol., 13:65-93.The scheme that produces this technology of people's antibody and human monoclonal antibodies and produce this antibody describe in detail can referring to, for example international publication number WO98/24893, WO 96/34096, WO 96/33735; With U.S. Patent number 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318 and 5,939,598, each piece document is included this paper in as a reference in full.In addition, can employ for example Abgenix, Inc. (Freemont, California) and Genpharm companies such as (San Jose, California) adopt above-mentioned similar technique to provide at selected antigenic people's antibody.

Mosaic type antibody is the molecule that the different piece of this antibody is derived from different immunoglobulin molecules.The method that produces mosaic type antibody is known in the art.Referring to, Morrison for example, 1985, Science 229:1202; Oi etc., 1986, BioTechniques 4:214; Gillies etc., 1989, J.Immunol.Methods125:191-202; With U.S. Patent number 5,807,715; 4,816,567; 4,816,397 and 6,311,415; Each piece document is included this paper in as a reference in full.

The corresponding residue of the CDR donor antibody commonly used of the framework residue in the framework region replaces to change, to improve or to reduce antigen in conjunction with (ability).Available method well known in the art identifies that these frameworks replace, for example identify for antigen in conjunction with important framework residue by the interaction of simulation CDR and framework residue, with carry out the sequence comparison with evaluation be positioned at ad-hoc location unusual framework residue (referring to, for example include this paper U.S. Patent number 5 as a reference in full in, 585,089; Riechmann etc., 1988, Nature, 332:323).

Humanized antibody be can with the bonded antibody of certain predetermined antigens or its variant or its fragment, its framework region has human normal immunoglobulin's aminoacid sequence basically, its CDR has the aminoacid sequence of non-human immunoglobulin basically.Humanized antibody comprises all at least one basically, common two variable domains (Fab, Fab ', F (ab ') ₂, Fabc, Fv), wherein all or basically all CDR districts corresponding to those CDR of non-human immunoglobulin (that is, donor antibody), all or basically all framework regions corresponding to those framework regions of human normal immunoglobulin's consensus sequence.In one embodiment, humanized antibody also comprises normally at least a portion of human normal immunoglobulin's constant region for immunoglobulin (Fc).This antibody generally contains the light chain and the variable domains of heavy chain at least.This antibody also can contain CH1 district, hinge region, CH2 district, CH3 district and the CH4 district of heavy chain.Can comprise IgM, IgG, IgD, IgA and IgE and any isotype (comprising IgG1, IgG2, IgG3 and 1gG4) selection humanized antibody from the immunoglobulin of any kind.Constant domain normally the active required complement of humanized antibody showed cell toxicity in conjunction with constant domain, IgG1 class normally.When not needing this cellular cytoxicity activity, constant region can be the IgG2 class.Humanized antibody can contain the sequence of polytype or isotype, and those of ordinary skills know and select the particular constant domain can optimize required effector function.The framework region of humanized antibody and CDR district need not and female antibody sequence, for example donor CDR is accurately corresponding, perhaps can come the total framework of mutation, thereby make the CDR in this site or framework residue not correspond to total antibody or input antibody (import antibody) by replacement, insertion or the disappearance of at least one residue.Yet this sudden change is not widely.Usually have at least 75%, more commonly have 90%, most preferably greater than 95% humanized antibody residue those residues corresponding to female antibody framework and CDR sequence.Can adopt various techniques known in the art to prepare humanized antibody, include but not limited to: the CDR-grafting is (referring to european patent number EP 239,400; International publication number WO 91/09967; With U.S. Patent number 5,225,539; 5,530,101 and 5,585,089; Each part full patent texts is included this paper in as a reference), veneer (veneering) or resurfacing (resurfacing) (referring to, for example european patent number EP 592,106 and EP519,596; Padlan, 1991, Molecular Immunology, 28 (4/5): 489-498; Studnicka etc., 1994, Protein Engineering, 7 (6): 805-814; Roguska etc., 1994, PNAS, 91:969-973, each piece document is included this paper in as a reference in full), chain reorganization (referring to, this paper U.S. Patent number 5,565 as a reference for example included in full in, 332) and the disclosed technology of following document: for example U.S. Patent number 6,407, and 213; U.S. Patent number 5,766,886; International publication number WO 9317105; Tan etc., J.Immunol.169:1119 25 (2002); Caldas etc., Protein Eng.13 (5): 353 60 (2000); Morea etc., Methods 20 (3): 267 79 (2000); Baca etc., J.Biol.Chem.272 (16): 10,678 84 (1997); Roguska etc., Protein Eng.9 (10): 895 904 (1996); Couto etc., Cancer Res.55 (23 supplementary issue): 5973s-5977s (1995); Couto etc., Cancer Res.55 (8): 1,717 22 (1995); SandhuJS, Gene 150 (2): 409 10 (1994) and Pedersen etc., J.Mol.Biol.235 (3): 959 73 (1994), each piece document is included this paper in as a reference in full.The corresponding residue of the CDR donor antibody commonly used of the framework residue in the framework region replaces to change, to improve or to reduce antigen in conjunction with (ability).Can identify that these frameworks replace by method well known in the art, for example identify for antigen in conjunction with important framework residue with carry out the sequence comparison is positioned at ad-hoc location with evaluation unusual framework residue by the interaction of simulation CDR and framework residue.(referring to, Queen etc. for example, U.S. Patent number 5,585,089; Riechmann etc., 1988, Nature, 332:323, each piece document include this paper in as a reference in full).

In addition, can adopt technology well known to those skilled in the art (referring to, for example Greenspan and Bona, 1989, FASEB J., 7 (5): 437-444 and Nissinoff, 1991, J.Immunol., 147 (8): 2429-2438) so that utilize can with the Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) and/or liver is joined albumen, and (for example, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) or the bonded antibody of its fragments specific produce can analogue antigen anti-idiotype antibody.

5.1.1.1.6 Antibody recombinant expressed

The recombinant expressed expression vector that needs to make up the polynucleotide that contain this antibody of encoding of antibody of the present invention, its derivant, analog or fragment (for example, the heavy chain of antibody of the present invention or light chain or its part or single-chain antibody of the present invention).In case obtain heavy chain or light chain or its a part of polynucleotide that code book is invented certain antibody molecule or certain antibody, can adopt technology well known in the art to produce the used carrier of antibody molecule by the recombinant DNA technology preparation.Therefore, this paper has described the polynucleotide that contain the nucleotide sequence of encoding antibody by expression and has prepared method of protein.Sequence that can adopt method well known to those skilled in the art to make up to contain encoding antibody and the suitable expression vector of transcribing and translate control signal.These methods comprise, for example genetic recombination in extracorporeal recombinant DNA technology, synthetic technology and the body.Therefore, the invention provides the heavy chain of the heavy chain that contains code book invention antibody molecule or antibody or light chain or antibody or light chain variable domain or its part or heavy chain or light chain CDR and the replicable vector of the nucleotide sequence that links to each other with the promoter operability.This carrier can comprise this antibody molecule constant region of encoding nucleotide sequence (referring to, for example international publication number WO 86/05807 and WO 89/01036; With U.S. Patent number 5,122,464), the variable domains of this antibody can be cloned into heavy chain that this carrier comes The expressed, complete light chain or the heavy chain and the light chain of The expressed simultaneously.

Can this expression vector be transported in the host cell by routine techniques, cultivate cells transfected to produce antibody of the present invention by routine techniques then.Therefore, the present invention includes that contain can code book invention antibody or its fragment, or its heavy chain or light chain, or its part, or the host cell of single-chain antibody of the present invention and the polynucleotide that link to each other with the allogeneic promoter operability.The following detailed description in detail, in expressing some embodiment of double-stranded antibody, thereby can be in host cell the immunoglobulin molecules of carrier The expressed of co expression encoding heavy chain and light chain.

Can utilize various host expresses carrier systems express antibody molecule of the present invention (referring to, for example U.S. Patent number 5,807,715).This host expression system provides and has produced the carrier that is purified behind the coded sequence interested, transforms or cell that can expressed in situ antibody molecule of the present invention during transfection but also provide with suitable nucleotide coding sequence.These systems include but not limited to: microorganism, for example antibacterial (as escherichia coli, Bacillus subtillis (B.subtilis)) that transforms with the recombinant bacteria phage DNA that contains antibody coding sequence, plasmid DNA or cosmid DNA expression vector; Yeast (as yeast (Saccharomyces), Pichia sp. (Pichia)) with the recombinant yeast expression vector conversion that contains antibody coding sequence; Insect cell system with the recombinant virus expression vector that contains antibody coding sequence (for example, baculovirus) infection; With the recombinant virus expression vector that contains antibody coding sequence (for example, cauliflower mosaic virus, CaMV; Tobacco mosaic virus (TMV) TMV) infects or with the recombinant plasmid expression vector that contains antibody coding sequence (for example, Ti-plasmids) plant transformed cell system; Or comprise and contain the promoter that is derived from the genomic promoter of mammalian cell (as metallothionein promoter) or is derived from mammalian virus (as gland virus stage starting; The mammal cell line system (as COS, CHO, BHK, 293, NS0 and 3T3 cell) of recombinant expression construct thing vaccinia virus 7.5K promoter).For example, can utilize bacterial cell (as escherichia coli) or eukaryotic cell, come the expressing recombinant antibody molecule especially for the cell of The expressed recombinant antibody molecule.For example, mammalian cell (as Chinese hamster ovary cell (CHO)) is effective expression system (Foecking etc., 1986, Gene, the 45:101 of antibody together with carrier (as the main middle early gene promoter sub-element of human cytomegalic inclusion disease virus); Cockett etc., 1990, Bio/Technology, 8:2).In a specific embodiment, coding can be regulated by constitutive promoter, inducible promoter or tissue-specific promoter by specificity in conjunction with the antibody of also identification (Eph receptor) or the expression of its segmental nucleotide sequence.

In bacterial system, can carry out preferably many expression vectors according to antibody molecule to be expressed.For example, in the time will producing this protein in a large number,, need carrier to instruct and express the high-level fusion protein product that is easy to purification for producing the pharmaceutical composition of certain antibody molecule.This carrier includes but not limited to: and coli expression carrier pUR278 (Ruther etc., 1983, EMBO J., 2:1791), thereby the antibody coding sequence in this carrier can connect into carrier separately and the lacZ coding region can produce fusion rotein with frame; PIN carrier (Inouye and Inouye, 1985, Nucleic Acids Res., 13:3101-3109; Van Heeke and Schuster, 1989, J.Biol.Chem., 24:5503-5509) or the like.Also can utilize the pGEX carrier to express external polypeptide, for example contain the fusion rotein of glutathione S-transferase (GST).This fusion rotein generally is soluble, is not difficult from cracked cell purification by combine then in the presence of free glutathione eluting with the absorption of substrate glutathion-agar beads.The pGEX carrier can be designed to contain the cleavage site of thrombin or factor Xa protease, thereby can partly discharge clone's target gene product from GST.

In insecticide (cell) system, autographa california (Autographa californica) nuclear polyhedrosis virus (AcNPV) can be used as the carrier of expressing alien gene.This virus can be cultivated in greedy noctuid (Spodoptera frugiperda) cell in meadow.Antibody coding sequence can be cloned into the nonessential zone (for example polyhedron gene) of this virus separately and place under the control of AcNPV promoter (for example polyhedrin promoter).

In mammalian host cell, can utilize many virus expression systems.When utilizing adenovirus as expression vector, interested antibody coding sequence and adenovirus can be transcribed/translated the control complex, for example late promoter links to each other with three fens targeting sequencings.Can this mosaic type gene be inserted in the adenoviral gene group by reorganization in external or the body then.(for example insert virus genomic nonessential zone, area E 1 or E3) can obtain to survive and can be in infection host the recombinant virus of expressed antibody molecule (for example, referring to Logan and Shenk, 1984, Proc.Natl.Acad.Sci.USA, 81:3655-3659).Also need the specificity initial signal effectively to translate the antibody coding sequence that is inserted.These signals comprise the ATG start codon and adjoin sequence.In addition, this start codon must be arranged in the frame of required coded sequence to guarantee to translate whole insertion (sequence).These exogenous translation control signals and start codon can be various sources, and be natural and synthetic.Can improve expression efficiency by comprising suitable transcriptional enhancer element, transcription terminator etc.(referring to Bittner etc., 1987, Methods in Enzymol., 153:516-544).

In addition, can select and to regulate the expression of insertion sequence or the host cell strain of modification and processed gene product with required ad hoc fashion.This modification of protein (for example, glycosylation) and processing (for example, cutting) may be most important to this proteinic function.For the translation post-treatment and the modification of protein and gene outcome, different host cells have the characteristic and the concrete mechanism of (difference).Can select suitable cell line or host system to guarantee the correct modification and the processing of expressed extraneous protein.For this purpose, can utilize to have and suitably to process primary transcript, the eukaryotic host cell of the cell mechanism of gene outcome glycosylation and phosphorylation.This mammalian host cell includes but not limited to: CHO, VERO, BHK, Hela, COS, MDCK, 293,3T3, W138, BT483, Hs578T, HTB2, BT2O, NSl, T47D, NS0 (the rat bone marrow tumour cell system that can endogenous produce any immunoglobulin chain), CRL7030 and Hs578Bst.

For extended high rate amount ground produces recombiant protein, best stably express.For example, can be engineered can the stably express antibody molecule cell line.Except utilization contains the expression vector of virus replication starting point, the available DNA transformed host cell that is subjected to suitable expression control element (for example promoter, enhancer sequence, transcription terminator, polyadenylic acid site etc.) and can selects marking of control.After introducing foreign DNA, culturing engineering is transformed in enrichment medium cell 1-2 days, changes selective medium then over to.But the selected marker in the recombiant plasmid can be given selecting the resistance of (pressure), and cell stably is integrated into plasmid in their chromosome, and growth forms the cell kitchen range, and then clone and amplification are cell line.The preferred cell line that adopts this method to come engineered expressed antibody molecule.This engineered cell line be particularly useful for the screening and the assessment can with the direct or indirect interactional chemical compound of this antibody molecule.

Can adopt many selective systems, include but not limited to: herpes simplex virus thymidine kinase (Wigler etc., 1977, Cell, 11:223), glutamine synthetase, hypoxanthine-guanine phosphoribosyltransferase (Szybalska and Szybalski, 1992, Proc.Natl.Acad.Sci.USA, 48:202) and adenine phosphoribosyl transferase (Lowy etc., 1980, Cell, 22:817) gene can be respectively applied in tk-, gs-, hgprt-or the aprt-cell.Also can utilize the basis of antimetabolite resistance: give dhfr (Wigler etc., 1980, PNAS, 77:357 to the methotrexate resistance as the following gene of selection; O ' Hare etc., 1981, PNAS, 78:1527); Give gpt to the mycophenolic acid resistance (Mulligan and Berg, 1981, PNAS, 78:2072); Give neo (Wu and Wu, 1991, Biotherapy, 3:87 to aminoglycoside G-418 resistance; Tolstoshev, 1993, Ann.Rev.Pharmacol.Toxicol., 32:573; Mulligan, 1993, Science, 260:926; Morgan and Anderson, 1993, Ann.Rev.Biochem., 62:191; May, 1993, TIB TECH, 11:155); With give hygro to hygromycin resistance (Santerre etc., 1984, Gene, 30:147).Can select required recombinant clone by the conventional conventional known method of using the recombinant DNA technology field, this method is described in volumes such as Ausubel, Current Protocols in Molecular Biology (" up-to-date molecular biology method "), John Wiley ﹠amp; Sons, New York, (1993); Kriegler, Gene Transfer andExpression, A Laboratory Manual (" gene transfer and expression, laboratory manual "), StocktonPress, New York, (1990); Volumes such as Dracopoli, Current Protocols in Human Genetics (" human genome fresh approach "), the 12nd and 13 chapters, John Wiley ﹠amp; Sons, New York, (1994); Colberre-Garapin etc., 1981, J.Mol.Biol., 150:1, above document is included this paper in as a reference in full.

(summary is seen Bebbington and Hentschel can to improve the expression of antibody molecule by carrier amplification, The use of vectors based on gene amplification for the expression ofcloned genes in mammalian cells in DNA cloning (" for the gene of expression cloning in mammal utilizes carrier according to gene amplification in dna clone "), the 3rd volume, (AcademicPress, New York, 1987)).In the time of in certain is marked at the carrier system of expressing antibodies, can increasing, improve the copy number that the inhibitor level that exists in the host cell culture fluid will increase this marker gene.Because the zone of being increased links to each other with antibody gene, antibody production also be increased (Crouse etc., 1983, Mol.Cell.Biol., 3:257).

Available two kinds of common transfection host cells of expression vector of the present invention, the first vector encoded heavy chain polypeptides derived, the polypeptide of the second vector encoded derived light chain.But these two kinds of carriers can contain identical selected marker, thereby can express heavy chain polypeptide and light chain polypeptide with being equal to.Perhaps, the two a kind of carrier of utilizable energy coding (with expressing) heavy chain polypeptide and light chain polypeptide.In this case, light chain should be placed heavy chain before in order to avoid deleterious free heavy chain excessive (Proudfoot, 1986, Nature, 322:562; Kohler, 1980, PNAS, 77:2197).The coded sequence of heavy chain and light chain can comprise cDNA or genomic DNA.

In case produced antibody molecule of the present invention by recombinant expressed, can come purification by the known any method in immunoglobulin molecules purification field, for example chromatography (as, ion exchange, affinity particularly utilize the affinity to this specific antigen behind A albumen and molecular size column chromatography), any other standard technique of centrifugal, difference dissolubility or protein purification.In addition, antibody of the present invention or its fragment and other allogeneic polypeptide sequence described herein or known in the art can be merged to promote purification.

5.1.2 Avimer joins protein modulators as the Eph/ liver

In one embodiment, Eph/ liver of the present invention join protein modulators be a kind of Avimer (Avidia, Inc.).Avimer is new class people source treatment protein, it has nothing to do with antibody and antibody fragment, constitute by several modularitys and reusable binding structural domain, the molecular weight of each binding structural domain is 4.5kD, this proteic molecular weight is usually between 9kD-18kD, this albumen can be designed to apply antagonism or agonist activity, this albumen can combine with a plurality of epi-positions with high-affinity simultaneously, binding affinity (Kd) and block function (IC50) with inferior nM level, non-glycosylated and can produce by microbial expression, Display Category characteristic during producing, the output height, but injected delivery under the percutaneous, has good tissue penetration (ability), pharmacokinetics distribution pattern with customization, non-immunogenicity in animal (referring to, for example U.S. Patent Application Publication No. 2005/0221384,2005/0164301,2005/0053973,2005/0089932,2005/0048512 and 2004/0175756, each part application is included epi-position in as a reference in full).

5.1.3 Eph receptor fragments regulating liver-QI is joined protein fragments and is joined protein modulators as the Eph/ liver

In one embodiment, it is Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) polypeptide that Eph/ liver of the present invention is joined protein modulators.According to this embodiment, the Eph receptor fragments has kept and the bonded ability of endogenic ligand (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) in some embodiments.In one embodiment, the Eph receptor fragments has kept with liver and has joined protein binding and suppress endogenous Eph receptor and endogenic ligand, and for example liver is joined protein bound ability.

The segmental non-limitative example of Eph includes but not limited to contain the ligand binding domains (concrete amino acid residue sees Table 1, and is the same) of people EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6 and the Eph receptor fragments of one or more following domains: the first fibronectin III type domain; The second fibronectin III type domain; The tyrosine kinase catalyst structure domain; And/or invalid (sterile) α motif " SAM " domain, its sequence sees that the GenBank data base (sees Table 1, hereinafter).In a specific embodiment, the Eph receptor fragments is soluble (that is, not combining with film).In a specific embodiment, Eph receptor fragments of the present invention lacks the membrane spaning domain (concrete amino acid residue sees Table 1, and is the same) of Eph receptor and does not combine with film.In the embodiment that also has, Eph receptor fragments of the present invention comprises ectodomain or its part, lacks membrane spaning domain or its part simultaneously, thereby this Eph receptor is not combined with film.In also having other embodiment, Eph receptor fragments of the present invention comprises the part in the cytoplasmic structure territory or the cytoplasmic structure territory of Eph receptor, lacks membrane spaning domain or its part simultaneously, thereby this Eph receptor is not combined with film.In concrete embodiment, Eph receptor fragments of the present invention comprises the ectodomain of people EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6, and (concrete amino acid residue sees Table 1, specific fragment hereinafter).In another specific embodiment, Eph receptor fragments of the present invention lacks the membrane spaning domain of Eph receptor, thereby this Eph receptor is not combined with film.

The Eph receptor fragments comprise with endogenous Eph receptor sequence (referring to, for example table 1 hereinafter) has 100%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40% identical polypeptide.Can adopt any method well known by persons skilled in the art to measure the homogeny percentage ratio of two aminoacid sequences, comprise the retrieval of BLAST protein.In concrete embodiment, analog or derivant that Eph receptor fragments of the present invention can be EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6.For example, Eph receptor fragments of the present invention comprises modified, i.e. the derivant that is connected with this polypeptid covalence of the molecule of any kind.Such as but not limited to; this polypeptide derivative (for example; EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6 polypeptide derivative) comprise usefulness, for example known protection/blocking group, proteolysis cutting, be connected with cell ligand etc. carries out glycosylation, acetylation, pegization, phosphorylation, the amidatioon institute's modified polypeptides of deriving.Can adopt known technology to carry out many chemical modifications, described technology includes but not limited to that the metabolism of specificity chemical cleavage, acetylation, formylated, tunicamycin is synthesized.In addition, this derivant can contain one or more atypia aminoacid.

In a specific embodiment, it is the Eph receptor that lacks signal transduction required cytoplasmic structure territory or its a part of dominant form that Eph/ liver of the present invention is joined protein modulators.In a specific embodiment, the Eph receptor of dominant form kept with endogenic ligand (for example, liver is joined albumen) bonded ability, but can not transduction signal, or induce low to insignificant signal transduction or can not inducing ligand-acceptor interaction after activated all signal transduction pathways.In the specific embodiment, low in the context of Eph receptor, refers in body described herein or well known to those skilled in the art and/or in the in vitro tests compared with the control to insignificant signal transduction, part in conjunction with the time Eph receptor signal transduction any aspect reduction at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 98%.Of the present invention aspect some, Eph receptor signal transduction comprises Eph receptor and its endogenic ligand (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) the activated arbitrary or many bars transduction pathway of combination.The non-limitative example of sort signal transduction pathway includes but not limited to: mitogen-activated protein kinase (MAPK)/ERK approach, Ras approach and relate to the approach of Src kinases family (other Eph receptor pathway can be referring to Cheng etc., 2002, Cytokine ﹠amp; Growth Factor Rev.13:75-85; Kullander and Klein, 2002, NatureRev.3:475-486; Holder and Klein, 1999, Development 126:2033-2044; Zhou, 1998, Pharmacol.Ther.77:151-181; Nakamoto and Bergemann, 2002, Microscopy Res.﹠amp; Technique 59:58-67; Each piece document is all included this paper in as a reference in full).In a specific embodiment, can carry out various test well known by persons skilled in the art and detect the Eph signal transduction.Such as but not limited to: with do not join the control cells that albumen handles and compare with liver, can join the phosphorylation Eph content receptor that exists in the cell of albumen processing by the detection liver and (for example detect the Eph receptor, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) phosphorylation, thereby determine that part is in conjunction with whether having activated the transduction of Eph receptor signal.Can adopt any protein immunoprecipitation method well known by persons skilled in the art to separate the Eph receptor protein with Eph receptor antibody of the present invention.Can adopt any standard immunoassay trace method well known by persons skilled in the art then, detect the Eph receptor of phosphorylation with anti-phosphotyrosine antibody (Upstate Tiotechnology, Inc., Lake Placid, New York).Referring to, Cheng etc. for example, 2002, Cytokine ﹠amp; Growth Factor Rev.13:75-85.In another embodiment, with do not join the control cells that albumen handles and compare with liver, can adopt standard immunoassay well known by persons skilled in the art precipitation and western blot test (referring to, for example include this paper Miao as a reference etc. in full in, 2003, J.Cell Biol.7:1281-1292) detects liver and join the phosphorylation MAPK content that exists in the cell that albumen handles and detect the phosphorylation of MAPK, thereby determine that part is in conjunction with whether having activated Eph receptor (for example, EphA2) signal transduction.

In a specific embodiment, it is that liver is joined proteic fragment (" liver is joined protein fragments ") that Eph/ liver of the present invention is joined protein modulators.According to this embodiment, this liver is joined protein fragments and has preferably kept ability with the Eph receptors bind.In also having a specific embodiment, described liver is joined protein fragments and has kept with the Eph receptors bind and suppress the ability that the endogenous liver is joined albumen and Eph receptors bind.

The non-limitative example that liver is joined protein fragments includes but not limited to: the disclosed people liver of GeneBank data base is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and (for example join any fragment that protein B 2 or liver join protein B 3, referring to table 2, hereinafter).In a specific embodiment, it is soluble (that is, not combining with film) that liver is joined protein fragments.In a specific embodiment, liver of the present invention is joined protein fragments and comprises the people liver and join protein A 1, liver and join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and join ectodomain or its part that protein B 2 or liver are joined protein B 3.In other embodiments, liver of the present invention is joined protein fragments and comprises the people liver and join protein A 1, liver and join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined ectodomain or its part of protein B 3, but does not combine with film.In concrete embodiment, liver of the present invention is joined protein fragments and comprises the people liver and join protein A 1, liver and join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined specific fragment or its part of the ectodomain of protein B 3, but does not combine with film.

Liver is joined protein fragments and comprises and join protein A 1, liver with the endogenous liver and join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and join protein B 2 or liver and join protein B 3 sequences (concrete amino acid residue is referring to table 2, hereinafter) 100%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40% identical polypeptide is arranged.Can adopt any method well known by persons skilled in the art to measure the homogeny percentage ratio of two aminoacid sequences, comprise the retrieval of BLAST protein.In concrete embodiment, it can be that liver is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join protein A 5, liver and join protein B 1, liver and join analog or the derivant that protein B 2 or liver are joined protein B 3 that liver of the present invention is joined protein fragments.For example, liver of the present invention join protein fragments comprise modified, i.e. the derivant that is connected with this polypeptid covalence of the molecule of any kind.Such as but not limited to; this polypeptide derivative (for example; liver is joined protein A 1, liver and joins protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3 polypeptide derivatives) comprise usefulness, for example known protection/blocking group, proteolysis cutting, be connected with cell ligand etc. carries out glycosylation, acetylation, pegization, phosphorylation, the amidatioon institute's modified polypeptides of deriving.Can adopt known technology to carry out many chemical modifications, described technology includes but not limited to that the metabolism of specificity chemical cleavage, acetylation, formylated, tunicamycin is synthesized.In addition, derivant can contain one or more atypia aminoacid.

In a specific embodiment, the Eph/ liver join protein modulators be the Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver join albumen (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) fusion rotein.In one embodiment, Eph receptor or liver to join fusion protein be soluble.The non-limitative example of Eph receptor fusion protein comprise soluble form the Eph receptor (for example, EphA2), for example EphA2-Fc (referring to, for example include in full this paper Cheng as a reference etc., 2002, Mol.Cancer Res.1:2-11 in).In a specific embodiment, the Eph receptor fusion protein comprises the Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) with the Fc partial fusion of human normal immunoglobulin IgG1.In another embodiment, the EphA2 fusion rotein comprise with the Fc partial fusion of human normal immunoglobulin IgG1 and keep it and EphA2 fragment that liver is joined protein A 1 binding ability (for example, the ectodomain of EphA2) (referring to, Carles-Kinch etc. for example, 2002, Cancer Res.62:2840-2847; Cheng etc., 2002, Mol.Cancer Res.1:2-11, these two pieces of documents are included this paper in as a reference in full).

The non-limitative example that liver is joined fusion protein comprises joins albumen by the liver of soluble form (for example, liver is joined albumen-Fc).In a specific embodiment, liver is joined fusion protein and comprises the liver of merging with the Fc domain of human normal immunoglobulin IgG and join albumen.Referring to, for example include this paper Duxbury as a reference etc., 2004, Biochem.﹠amp in full in; Biophys.Res.Comm.320:1096-1102.In another embodiment, liver is joined fusion protein and comprises the liver of merging with the Fc domain of human normal immunoglobulin IgG1 and keeping itself and Eph receptor binding capacity and join protein fragments.

Can prepare Eph receptor or liver and join proteic fragment, adopt biochemistry, biophysics, hereditism and/or the computer technology of research protein protein interaction described herein or methods known in the art to check itself and any liver to join the ability of albumen or Eph receptors bind respectively respectively.Qualitative or detection by quantitative protein bound (for example in external or body, detect the Eph receptor and join the protein binding situation with liver) the non-limitative example of method comprise that the GST-affinity combines test, the far-Western engram analysis, surface plasma resonance (SRP), FRET (fluorescence resonance energy transfer) (FRET), fluorescence polarization (FP), constant temperature titration calorimetry (ITC), circular dichroism (CD), protein fragments complementary assay (PCA), various two-hybrid systems and proteomics and bioinformatics method, for example be used for computer analysis the Scansite program (referring to, for example include this paper Fu as a reference in full in, H., 2004, Protein-Protein Interactions:Methodsand Applications (" protein protein interaction: method and application "), (Humana Press, Totowa, the New Jersey); Protein-Protein Interactions:A Molecular CloningManual (" protein protein interaction: the molecular cloning handbook), 2002, Golemis compiles, (publishing house of cold spring harbor laboratory, cold spring port, New York)).

5.1.4 Modified polypeptides is joined protein modulators as the Eph/ liver

The used polypeptide Eph/ liver of the inventive method join protein modulators (for example, antibody, Eph receptor fragments regulating liver-QI are joined protein fragments) comprise modified, i.e. the derivant that is connected with this polypeptid covalence of the molecule of any kind.Such as but not limited to, this polypeptide derivative comprises usefulness, glycosylation, acetylation, pegization, phosphorylation, the amidatioon institute's modified polypeptides of deriving is carried out in for example known protection/blocking group, proteolysis cutting, be connected with cell ligand etc.Can adopt known technology to carry out many chemical modifications, described technology includes but not limited to that the metabolism of specificity chemical cleavage, acetylation, formylated, tunicamycin is synthesized.In addition, derivant can contain one or more atypia aminoacid.

The inventive method also comprise the half-life (for example, serum half-life) of utilization in mammal (preferred people) greater than 15 days, more preferably greater than 20 days, greater than 25 days, greater than 30 days, greater than 35 days, greater than 40 days, greater than 45 days, greater than 2 months, greater than 3 months, greater than 4 months or join protein modulators greater than 5 months polypeptide Eph/ liver.This polypeptide Eph/ liver is joined the half-life prolongation of protein modulators in mammal (preferred people) and causes described polypeptide Eph/ liver to join the concentration rising of protein modulators in mammal, joins the administration frequency of protein modulators and/or has reduced the consumption that the described polypeptide Eph/ liver that gives is joined protein modulators thereby reduced described polypeptide Eph/ liver.Can produce the polypeptide Eph/ liver that the half-life prolongs in the body by technology well known by persons skilled in the art and join protein modulators.For example, can produce the polypeptide Eph/ liver that the half-life prolongs in the body and join protein modulators by modifying (for example, replace, lack or add) amino acid residue.In one embodiment, when this polypeptide Eph/ liver is joined protein modulators when being antibody, amino acid residue to be finished can be participate in interactional those residues between Fc domain and the FcRn receptor (referring to, for example include this paper international publication number WO 97/34631 as a reference, U.S. Patent Application Publication No. 2003/0190311 A1 and U.S. Patent Application Publication No. 2004/0191265 A1 in full in).Also can pass through described polypeptide and polymer molecule, for example high molecular weight polyethylene glycol (PEG) connects the polypeptide Eph/ liver that produces half-life prolongation in the body and joins protein modulators.Can utilize or join protein modulators with described polypeptide Eph/ liver and link to each other without the N-or the C-specific conjugated PEG of making of ε amino sites terminal or on lysine residue of multifunction conjunction by PEG and described polypeptide.Can adopt linear or branch polymer is derived to reduce biologic activity forfeiture as far as possible.Can by SDS-PAGE and mass spectrum closely monitoring put together degree, thereby guarantee that PEG molecule and polypeptide Eph/ liver join protein modulators and correctly put together.Can pass through, for example size exclusion chromatography or ion-exchange chromatography are joined protein modulators-PEG conjugate with unreacted PEG and polypeptide Eph/ liver and are separated.

5.1.5 Coded polypeptide Eph/ liver is joined the polynucleotide of protein modulators

Eph/ liver of the present invention is joined protein modulators and comprises the polypeptide that can produce with the polynucleotide of the multi-nucleotide hybrid of coding above 6.1.1-6.1.3 chapters and sections described polypeptide.In one embodiment, antibody of the present invention comprises that Eph receptor regulating liver-QI joins proteic monoclonal antibody, described antibody by can with in one or more test described herein or well known by persons skilled in the art, regulate Eph receptor and/or liver and join the polynucleotide of protein expression and/or the hybridization of active monoclonal antibody coded polynucleotide and produce.In another embodiment, used Eph fragment of the inventive method or liver are joined protein fragments and comprise and can join the polypeptide that the polynucleotide of proteic segmental multi-nucleotide hybrid produce with coding Eph receptor or liver.Hybridization conditions includes but not limited to: rigorous hybridization conditions, in 6 * sodium chloride/sodium citrate (SSC), hybridize for 45 ℃ according to appointment with the bonded DNA of filter membrane, wash one or many at about 50-65 ℃ with 0.2 * SSC/0.1%SDS then, height preciseness condition is hybridized with the bonded DNA of filter membrane in 6 * SSC for for example about 45 ℃, then about 60 ℃ with 0.1 * SSC/0.2%SDS washing one or many, any other preciseness hybridization conditions perhaps well known by persons skilled in the art (referring to, for example, Ausubel, F.M. wait volume, 1989, Current Protocols inMolecular Biology (" up-to-date molecular biosciences method "), the first volume, Green PublishingAssociates, Inc. and John Wiley and Sons, Inc., New York, 6.3.1-6.3.6 page or leaf and 2.10.3 page or leaf).

Eph/ liver of the present invention is joined the polynucleotide that protein modulators comprises the polypeptide described herein of encoding.Can obtain the polynucleotide and the order-checking of coding polypeptide described herein (for example, antibody of the present invention or Eph fragment regulating liver-QI are joined protein fragments) by any method known in the art.For example, the polynucleotide that can join protein modulators from the used polypeptide Eph/ of the oligonucleotide of chemosynthesis assembling code book inventive method liver (for example, Kutmeier etc., 1994, BioTechniques, 17:242 is described), in brief, this method comprises the synthetic overlapping oligonucleotide that contains this peptide sequence each several part of encode, anneals and connects those oligonucleotide, adopts the oligonucleotide of pcr amplification connection then.

Perhaps, can produce because the coded polypeptide Eph/ liver of the inventive method is joined the polynucleotide of protein modulators from the nucleic acid in suitable source.If contain clone's non-availability of the nucleic acid of the specific polypeptide of encoding, but the sequence of this polypeptide is known, then but chemosynthesis or utilization can be carried out pcr amplification with the synthetic primer of this sequence 3 ' and 5 ' end hybridization, perhaps utilizing the specific oligonucleotide probe of this specific gene sequence to clone identifies, this polypeptide Eph/ liver of for example encoding is joined the cDNA clone in the cDNA library of protein modulators, and from suitable source (for example, antibody cDNA library or from expressing any tissue or the cell of this required polypeptide, for example select to be used to the expressing hybridoma of antibody of the present invention or express EphA2 or liver is joined the epithelium of protein A 1 and/or cDNA library or the therefrom isolating nucleic acid that endotheliocyte produces, preferred polyA+RNA) obtain the nucleic acid of this polypeptide of coding.Can adopt any method well known in the art that the amplification of nucleic acid that PCR produces is cloned in the reproducible cloning vehicle then.

In case measured the nucleotide sequence that the used polypeptide Eph/ of the inventive method liver is joined protein modulators, can adopt the method for operation nucleotide sequence well known in the art, recombinant DNA technology for example, direct mutagenesis, PCR etc. (referring to, the described technology of for example following document: Sambrook etc., 1990, MolecularCloning, A Laboratory Manual (" molecular cloning, laboratory manual "), second edition, cold spring harbor laboratory, the cold spring port, volumes such as New York and Ausubel, 1998, Current Protocols in MolecularBiology (" up-to-date molecular biology method "), John Wiley ﹠amp; Sons, New York, these documents are included this paper in as a reference in full) thus operating this nucleotide sequence generation has the different aminoacids polypeptide of sequence, for example produces aminoacid replacement, disappearance and/or insertion.

Can adopt standard technique well known by persons skilled in the art to suddenly change to introduce the nucleotide sequence that coded polypeptide Eph/ liver is joined protein modulators, described technology to comprise that for example direct mutagenesis and PCR-mediated mutagenesis produce aminoacid replacement.In one embodiment, join protein modulators with initial Eph/ liver and compare, described derivant comprises and is less than 15 aminoacid replacement, is less than 10 aminoacid replacement, is less than 5 aminoacid replacement, is less than 4 aminoacid replacement, is less than 3 aminoacid replacement or is less than 2 aminoacid replacement.In a specific embodiment, described derivant has conservative amino acid and replaces at the non essential amino acid residue place of one or more expectations.

The present invention comprises that also utilization contains any Eph receptor or liver is joined protein antibodies contains the aminoacid sequence of sudden change (for example, one or more aminoacid replacement) in framework region or variable region antibody or antibody fragment.In one embodiment, the sudden change in these antibody keeps or has improved affinity and/or the affinity of these antibody to the bonded specific antigen of they institute's specificitys.In another embodiment, the mutation impairing in these antibody or reduced affinity and/or the affinity of these antibody to the bonded specific antigen of they institute's specificitys.Can adopt standard technique well known by persons skilled in the art (for example, immunoassay or ELISA measure) to check polypeptide Eph/ liver to join combination degree between protein modulators and its binding partners.In a specific embodiment, join protein modulators when being antibody when polypeptide Eph/ liver, can suitably check Eph receptor fragments, liver to join protein fragments, Eph receptor fusion protein, liver and join the liver of the Eph receptor of fusion protein, dominant form or dominant form and join albumen and join the proteic situation that combines with Eph receptor or liver.

5.1.6 Polynucleotide Eph/ liver is joined protein modulators

Join the protein modulators except polypeptide Eph/ liver of the present invention, the inventive method can be utilized nucleic acid molecules.In one embodiment, nucleic acid molecules Eph/ liver is joined protein modulators and has reduced and the available endogenic ligand of Eph receptors bind (for example, liver is joined albumen) content.In another embodiment, nucleic acid molecules Eph/ liver is joined protein modulators and has reduced with liver and join the available Eph content receptor of protein binding.The inventive method can adopt and can reduce known in the art any method that Eph receptor and/or liver are joined protein expression, includes but not limited to: antisense (method), RNA disturb and fit technology.Therefore, the Eph/ liver join protein modulators comprise can be used for reducing liver join protein expression or with the available medicine of Eph receptors bind and can be used for reducing the Eph expression of receptor or with endogenous Eph receptors ligand (for example, liver is joined albumen) in conjunction with available medicine.

5.1.6.1 Antisense

(for example the present invention includes the Eph receptor, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver (for example join albumen, liver is joined protein A 1, liver is joined protein A 2, liver is joined protein A 3, liver is joined protein A 4, liver is joined protein A 5, liver is joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) antisense nucleic acid molecule, promptly join the proteic all or part of complementary molecule that phosphorothioate odn is arranged with coding Eph receptor or liver, with double-stranded Eph] receptor or liver join the complementary molecule of coding strand of albumen cDNA molecule or (for example join the complementary molecule of protein mRNA sequence with Eph receptor or liver, can be referring to table 1 and 2, hereinafter, this place discloses the GeneBank nucleotide sequence).In some embodiments, the Eph/ liver to join protein modulators be not the EphA2 antisense nucleic acid molecule.

Antisensenucleic acids can combine with phosphorothioate odn is arranged through hydrogen bond.Antisensenucleic acids can with whole coding strand or only with its part, for example all or part of (or open reading frame) complementation of protein coding region.Antisense nucleic acid molecule can with all or part of antisense of the noncoding region of the nucleotide sequence coded chain of code book invention polypeptide.Noncoding region (" 5 ' and 3 ' untranslated region ") is to be in the coding region flank and can not to translate into amino acid whose 5 ' and 3 ' sequence.

Antisense oligonucleotide can, for example be about 5,10,15,20,25,30,35,40,45 or 50 nucleotide.Can adopt methods known in the art to be connected with enzyme and make up antisensenucleic acids of the present invention by chemosynthesis.For example, can utilize the nucleotide of the nucleotide of natural generation or various modifications come the chemosynthesis antisensenucleic acids (as, antisense oligonucleotide), the nucleotide of described modification is designed for the biological stability that improves this molecule or improves antisense and have and forms double-helical physical stability, the nucleotide that for example can utilize phosphorothioate derivative and acridine to replace between phosphorothioate odn.Perhaps, can utilize with antisense orientation (that is, will be interested target nucleic acid from the RNA of insertion transcribed nucleic acid, promptly liver be joined the antisense orientation of protein A 1) sub-clone to go into the expression of nucleic acids carrier and produce antisensenucleic acids with biological method.

Usually antisense nucleic acid molecule of the present invention is given object or produce in position, make them with the cell mRNA and/or the genomic DNA hybridization of the selected polypeptide of the present invention of coding or combine, transcribe and/or translate by inhibition and suppress its expression.Can be by conventional nucleotide complementation, perhaps by the specificity in the Double helix major groove interact (for example can be example) with the bonded antisense nucleic acid molecule of dna double spiral hybridize, thereby form stable Double helix.The example of the route of administration of antisense nucleic acid molecule of the present invention comprises and is injected directly into tissue site.Perhaps, can modify antisense nucleic acid molecule and make it the cell that targeting is selected, general gives then.For example, with regard to the general administration, can modify antisense molecule, for example by antisense nucleic acid molecule is connected in can with cell surface receptor or bonded peptide of antigen or antibody, make it to combine with the receptor or the antigenic specificity of selected cell surface expression.Also can utilize carrier as herein described that antisense nucleic acid molecule is delivered to cell.For making antisense molecule reach enough intracellular concentrations, the antisense nucleic acid molecule in the vector construct preferably places under the control of strong pol II or pol III promoter.

Antisense nucleic acid molecule of the present invention can be α-end group isomery nucleic acid molecules.Opposite with the β-unit of routine, α-end group isomery nucleic acid molecules can form wherein each chain double-stranded crossbred (Gaultier etc., 1987, Nucleic Acids Res.15:6625) parallel to each other with complementary RNA.Antisense nucleic acid molecule also can comprise 2 '-o-methyl ribonucleotides (Inoue etc., 1987, Nucleic Acids Res.15:6131) or mosaic type RNA-DNA analog (Inoue etc., 1987, FEBS Lett.215:327).

5.1.6.2 RNA disturbs

Some embodiment utilizes RNA to disturb (RNAi) molecule to reduce the Eph receptor and/or liver is joined proteic expression.RNAi is defined as double-stranded RNA (dsRNA) can suppress expression of gene corresponding to himself sequence.RNAi is also referred to as PTGS or PTGS.Because the RNA molecule of finding usually in the kytoplasm of cell is a strand mRNA molecule, cell has the enzyme that can discern and dsRNA be cut into the fragment (approximating double-helical two corners) that contains 21-25 base pair.This segmental antisense strand and sense strand separate enough far away, thereby can hybridize with the complementary sense chain on the endogenous cell mRNA molecule (for example, the people liver is joined protein receptor or liver is joined albumen).This hybridization triggers mRNA is cut into double-stranded region, thereby has destroyed it and translated into the ability of polypeptide.Therefore, introducing can be in particular organization and/or knock out the cell oneself expression of this gene in times selected corresponding to the dsRNA of specific gene.

Can utilize double-stranded RNA to disturb gene expression (Wianny and Zernicka-Goetz, 2000, Nature Cell Biology 2:70-75 in the mammal; This piece document is included this paper in as a reference in full).DsRNA joins the inhibitory RNA or the RNAi of protein A 1 function as liver, thereby produces the identical phenotype (Wianny and Zernicka-Goetz, 2000, NatureCell Biology 2:70-75) of null mutant of joining protein A 1 with liver.The dsDNA that some embodiment utilizes the dsRNA (for example, as hairpin structure) of dsDNA coding to express the RNAi-mediation in cell.

5.1.6.3 Fitly join protein modulators as the Eph/ liver

In concrete embodiment, (for example the invention provides the Eph receptor, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver join the fit of albumen (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3).Known in the art fit be by can with the specific molecular target (for example, Eph receptor as herein described or liver are joined albumen, Eph receptor or liver join protein polypeptide/or Eph receptor or liver join the albumen epi-position) macromole that constitutes of the nucleic acid (for example, RNA, DNA) of combining closely.The concrete fit linear nucleotide sequence that generally is about 15-60 nucleotide that can be described as.Nucleotide chain in fit forms the intramolecular interaction that this molecular folding can be become complex three-dimensional forms, and this 3D shape makes fit and combine closely in surface its target molecule.In view of the super multiformity of ubiquity molecular shape in all possible nucleotide sequence, can obtain the molecular target of wide display, comprise protein and micromolecular fit.Except high specific, fit have high affinity (for example, proteinic affinity being reached picomole to low nanomole level) to its target.Fit chemically stable, can boil or freezing and loss of activity not.Because they are synthetic molecules, are easy to carry out various modifications and optimize its function when concrete the application.For using in the body, can modify fit and greatly reduce their sensitivity enzymatic degradation in the blood.In addition, also can modify fit biodistribution or the blood plasma residence time that changes them.

Can select to join albumen with Eph receptor or liver or its fragment is bonded fit by methods known in the art.For example, it is fit to adopt SELEX (evolution of exponential enrichment part) method (Tuerk and Gold, 1990, Science 249:505-510, this piece document include this paper in as a reference in full) to select.In the SELEX method, produce the big library (for example, 10 of nucleic acid molecules ¹⁵Kind of different molecular) and/or with target molecule (for example, Eph receptor as herein described or liver are joined albumen, Eph receptor or liver join protein polypeptide/or Eph receptor or liver join albumen epi-position or its fragment) screen.Target molecule and nucleotide sequence library are cultivated a period of time.Use fit target molecule and unconjugated molecule in the several method physical separation mixture then, discard unconjugated molecule.Then from target molecule purification to the highest fit of target molecule affinity, the enzyme process amplification with produce substantial enrichment can with the bonded fit recruit library of target molecule.Start selection, distribution and the amplification of a new round then with the library of this enrichment.After 5-15 took turns this selection, distribution and amplification procedure, the library is reduced to can be fit with the minority that target molecule is combined closely.Separate each molecule that obtains in the mixture then, measure their nucleotide sequence, detect and compare their binding affinity and specificity correlation properties.Further refinement is isolating fit to remove any nucleotide (that is, with fit its core land that is truncated to) that is helpless to target combination and/or fit structure then.The summary of fit technology can referring to, for example in full include this paper Jayasena as a reference in, 1999, Clin.Chem.45:1628-1650).

In the specific embodiment, the present invention is fit to have binding specificity as herein described and/or functional activity to antibody of the present invention.Therefore, for example in some embodiments, the present invention relates to that antibody of the present invention (is for example had same or similar binding specificity described herein, to Eph receptor or liver join albumen, Eph receptor or liver join the fragment of protein polypeptide, vertebrates Eph receptor or liver join the epi-position district of protein polypeptide (as, join proteic epi-position district with the Eph receptor or the liver of antibodies of the present invention) binding specificity) fit.In the specific embodiment, the present invention is fit to be joined protein polypeptide with Eph receptor or liver and combines and suppress one or more activity that Eph receptor or liver are joined protein polypeptide.

5.1.7 The vaccine of joining protein modulators as the Eph/ liver

In a specific embodiment, it is that Eph receptor and/or liver are joined protein vaccine that the Eph/ liver is joined protein modulators.Term used herein " Eph receptor vaccine " refers to cause or to mediate any reagent at the immunne response of the cell of overexpression Eph receptor.In some embodiments, Eph receptor vaccine be Eph receptor antigen peptide of the present invention, Eph receptor antigen peptide expression vector (for example, naked nucleic acid or virus or bacteria carrier or cell) (for example, this carrier transmissibility Eph receptor antigen peptide) or used the T cell or the antigen-presenting cell (for example, dendritic cell or macrophage) of Eph receptor antigen peptide sensitization of the present invention.Term used herein " Eph receptor antigen peptide " and " Eph receptor antigen polypeptide " refer to contain the one or more B cell epitopes of Eph receptor or the Eph receptor polypeptides of t cell epitope, or its fragment, analog or derivant.The Eph receptor polypeptides can be from any species.In some embodiments, the Eph receptor polypeptides refers to the ripe form processing of Eph receptor.In other embodiments, the Eph receptor polypeptides refers to the immature form of Eph receptor.The description of Eph receptor vaccine can referring to, the U.S. Provisional Application series number of submitting on May 26th, 2,004 60/556,601 for example, " EphA2 Vaccines " (EphA2 vaccine) by name; The U.S. Provisional Application series number 60/602,588 that on August 18th, 2004 submitted to, " EphA2 Vaccines " (EphA2 vaccine) by name; The U.S. Provisional Application series number 60/615,548 that on October 1st, 2004 submitted to, " EphA2 Vaccines " (EphA2 vaccine) by name; The U.S. Provisional Application series number 60/617,564 that on October 7th, 2004 submitted to, " EphA2 Vaccines " (EphA2 vaccine) by name; With the international publication number PCT/US2004/034693 that submitted on October 15th, 2004, " EphA2 Vaccines " (EphA2 vaccine) by name; Each part application is included this paper in as a reference in full.

In a specific embodiment, it is that a kind of liver is joined protein vaccine that the Eph/ liver is joined protein modulators.Term used herein " liver is joined protein vaccine " refers to cause or to mediate at liver joins any reagent that liver on the protein expression cell is joined proteic immunne response.In some embodiments, it is that liver of the present invention (is for example joined expression vector that protein antigenicity peptide, liver join the protein antigenicity peptide that liver is joined protein vaccine, naked nucleic acid or virus or bacteria carrier or cell) (for example, this carrier transmissibility liver is joined the protein antigenicity peptide) or join the T cell or the antigen-presenting cell (for example, dendritic cell or macrophage) of protein antigenicity peptide sensitization with liver of the present invention.Refer to term used herein " liver is joined the protein antigenicity peptide " and " liver is joined the protein antigenicity polypeptide " contain liver and join the liver of proteic one or more B cell epitope or t cell epitope and join protein polypeptide, or its fragment, analog or derivant.Liver is joined protein polypeptide can be from any species.In some embodiments, liver is joined protein polypeptide and refers to that liver joins proteic ripe form processing.In other embodiments, liver is joined protein polypeptide and refers to that liver joins proteic immature form.

Therefore, Eph/ liver provided by the invention to join protein modulators be Eph receptor vaccine.In a specific embodiment, it is to express to cause or mediate at overexpression Eph receptor or liver to join cellullar immunologic response, humoral response or the Eph receptor of the two of proteic cell or Eph receptor and/or liver that liver is joined the protein antigenicity peptide are joined protein antigenicity peptide expression vector that the Eph/ liver is joined protein modulators.When immunne response was cellullar immunologic response, it can be Tc, Th1 or Th2 immunne response.In one embodiment, described immunne response is the Th2 cellullar immunologic response.In another embodiment, Eph receptor/liver is joined the expressed Eph receptor of protein antigenicity peptide expression vector or liver and joins the protein antigenicity Toplink and cause the immunne response of joining the protein expression cell at the Eph receptor that participates in infecting and/or liver.

In a specific embodiment, it is the microorganism that expression Eph receptor and/or liver are joined the protein antigenicity peptide that Eph receptor and/or liver are joined protein antigenicity peptide expression vector.In another specific embodiment, it is the antibacterial of attenuation that Eph receptor and/or liver are joined protein antigenicity peptide expression vector.The non-limitative example that can be used as the antibacterial of expression vector of the present invention comprises monocyte hyperplasia Li Site bacterium (Listeria monocytogenes), includes but not limited to: B. burgdorferi (Borrelia burgdorferi), Malta Bacillus brucellae (Brucellamelitensis), escherichia coli (Escherichia coli), EIEC (enteroinvasive Escherichia coli), invade lung legionella (Legionella pneumophila), Salmonella typhi (Salmonella typhi), Salmonella typhimurtum (Salmonella typhimurium), Shigella (Shigella spp.), Streptococcus (Streptococcus spp.), Treponoma palladium (Treponemapallidum), Yersinia enterocolitica (Yersinia enterocohtica), monocyte hyperplasia Li Site bacterium, birds mycobacteria (Mycobacterium avium), Mycobacterium bovis (Mycobacteriumbovis), mycobacterium tuberculosis (Mycobacterium tuberculosis), BCG, human-like mycobacteria (Mycoplasma hominis), muricola quintana (Rickettsiae quintana), Cryptococcus histolyticus (Cryptococcus neoformans), Histoplasma capsulatum (Histoplasma capsulatum), Pneumocystis carinii (Pneumocystis carnii), heap type Eimeria (Eimeria acervulina), dog neospora (Neospora caninum), Plasmodium falciparum (Plasmodium falciparum), pig Sarcocystis hominis (Sarcocystis suihominis), Gong ground toxoplasma (Toxoplasma gondii), Amazon leishmania (Leishmania amazonensis), leishmania major (Leishmania major), leishmania mexicana (Leishmania mexacana), Leptomonas karyophilus, plant living infusorian (Phytomonas spp.), Ku Shi trypanosomicide (Trypanasoma cruzi), Encephahtozoon cuniculi, Nosema helminthorum, Unikaryon legeri.In a specific embodiment, it is the Li Site bacteria vaccine that expression Eph receptor and/or liver are joined the protein antigenicity peptide that the Eph/ liver is joined the protein modulators vaccine.In also having an embodiment, the Li Site bacteria vaccine that expression Eph receptor and/or liver are joined the protein antigenicity peptide is an attenuation.In a specific embodiment, it is not the Li Site bacteria vaccine that the Eph/ liver is joined the protein modulators vaccine, is not the EphA2 vaccine, neither Eph receptor vaccine.

In another embodiment, Eph receptor and/or liver to join protein antigenicity peptide expression vector be to express the virus that Eph receptor and/or liver are joined the protein antigenicity peptide.The non-limitative example that can be used as the virus of expression vector of the present invention comprises RNA viruses (for example, single strand RNA virus and diplornavirus), DNA viruses (for example, double-stranded DNA virus), tunicary virus and nonencapsulated virus.Can be used as Eph receptor and/or liver joins other non-limitative example of the virus of protein antigenicity peptide expression vector and comprises retrovirus (including but not limited to slow virus), adenovirus, adeno associated virus or herpes simplex virus.The preferred virus of administration of human object is the virus of attenuation.Can be with virus and mutagenic agent, for example ultraviolet or chemical mutagen contact, in non-permissive host (non-permissive host) repeatedly and/or single goes down to posterity and/or the hereditism changes that virus reduces its virulence and pathogenicity makes it attenuation.

Can prepare microorganism by many technology well known in the art.For example, can select the antibiotic sensitive bacterial strain of microorganism, but the mutation microorganism microorganism of virulence factor can be selected to lack, the new bacterial strain of microorganism of cell wall lipopolysaccharide can be made up with change.In some embodiments, can for example pass through, the DNA sequence that the coding virulence factor was deleted or destroyed to homologous recombination technique and chemical method or transposon mutagenesis makes the microorganism attenuation, and described virulence factor guarantees that microorganism can particularly survive in macrophage and the neutrophil at host cell.The virulence factor of many (but not being whole) these researchs is relevant with (microorganism) survival in macrophage, therefore these factors can be owing to stress, acidization and in macrophage, expressing specially for example, perhaps can utilize these factor inducing specific host cells to reply, for example big pinocytosis (Fields etc., 1986, Proc.Natl.Acad.Sci.USA 83:5189-5193).The virulence factor of antibacterial comprises, for example: cytolysin; Defense peptide tolerance gene seat; DNA K; Pili (fimbriae); GroEL; The inv locus; Lipoprotein; LPS; Lysosome merges inhibition; Macrophage survival genes seat; Oxidative stress response gene seat; The pho locus (as, PhoP and PhoQ); Activatory gene (the pag of pho; As pagB and pagC); The gene (prg) that phoP and phoQ regulate; Porin; Serum tolerance peptide; Virulence plasmid (as spvB, traT and ty2).

Making the other method that also has of microorganism attenuation is to be responsible for the substituent group (substituent) of this microorganism toxicity in the modified microorganism.For example, lipopolysaccharide (LPS) or endotoxin mainly are responsible for the pathology effect of bacterial sepsis.Causing this LPS component of replying is lipid A (LA).The toxic action of eliminating or alleviating LA obtains the antibacterial of attenuation, because 1) danger of suffering a shock of patient's (generations) sepsis reduced and 2) the antibacterial Eph receptor or the liver that can tolerate higher level join protein antigenicity peptide expression vector.

Red antibacterial of class ball (Rhodobacter sphaeroides) (rhodopseudomonas) and the red antibacterial of pod membrane (Rhodobacter capsulatus) respectively contain monophosphoryl lipid A (MLA), and this lipid does not cause the sepsis shock and is the endotoxin antagonist in laboratory animal.Loppnow etc., 1990, Infect.Immun.58:3743-3750; Takayma etc., 1989, Infect.Immun.57:1336-1338.But the gram-negative bacteria of hereditary change except that red antibacterial brings out the probability that sepsis is suffered a shock to produce MLA thereby reduce it.

Another example that changes the LPS of antibacterial is included in and introduces sudden change in the LPS biosynthesis pathway.Identify biosynthetic several enzyme steps of LPS and their genetic loci of control in many antibacterials, be separated to the several mutant bacterial strains that in the LPS approach, contain heredity and enzyme damage.In some embodiments, LPS approach mutant is the firA mutant.FirA is the gene of coding UDP-3-O (R-30 hydroxyl myristoyl)-glycocyamine N-acyltransferase, and this biosynthetic the 3rd step of enzyme adjusting endotoxin (Kelley etc., 1993, J.Biol.Chem.268:19866-19874).

Guarantee the attenuation phenotype and avoid reverting back to not that the method for attenuation phenotype is that engineered in many ways antibacterial makes it attenuation, for example in lipid A generation approach, make a sudden change and making one or more auxotrophic mutations, for example in uracil biosynthesis, purine biosynthesis and arginine biosynthesis, make one or more sudden changes one or more nutrients or metabolite.

Preferably, for example utilize allogeneic gene expression box expression Eph receptor or liver to join the protein antigenicity peptide in the antibacterial in microorganism.The allogeneic gene expression box is made of following orderly element usually: (1) prokaryotic promoter; (2) Shine-Dalgarno sequence; (3) secretion signal (signal peptide); (4) heterologous gene.Be used for the construction of stable integration in the bacterial chromosome, the also optional transcription terminator that contains of allogeneic gene expression box.Though optional, in the allogeneic gene expression box, include transcription terminator and can prevent to regulate the polarization that produces to adjoining gene expression because of read-through transcription as last orderly element.

Introduce the Eph receptor of microorganism or liver and join the prodrug invertase that protein vaccine expression vector preferred design becomes to make microorganism can secrete to produce Eph receptor or liver to join protein peptide and choose wantonly.The inventive method and compositions can be utilized many antibacterial secretion signals well known in the art (peptide).In some embodiments of the present invention, can engineered antibacterial Eph receptor or liver join protein antigenicity peptide expression vector, make it more responsive and/or after giving chemical compound, experience cell death to antibiotic.In other embodiment of the present invention, can engineered antibacterial Eph receptor or liver join protein antigenicity peptide expression vector, make it suicide gene is delivered to and express target Eph receptor or liver is joined proteic cell.These suicide genes comprise the prodrug invertase, for example (gene) of herpes simplex virus thymidine kinase (TK) and antibacterial cytosine deaminase (CD).Nontoxic substrate acycloguanosine and 9-(1, the 3-dihydroxy-2-third oxygen methyl) guanine of TK energy phosphorylation given their toxicity by they being mixed genomic DNA.CD can be converted into 5-uracil (5-FU) with nontoxic 5-cytosine (5-FC), and the latter presents its toxicity by mixing RNA.Other the exemplary example that belongs to prodrug invertase of the present invention comprise the cytochrome p450NADPH oxidoreductase that acts on ametycin and porphyromycin (Murray etc., 1994, J.Pharmacol.Exp.Therapeut.270:645-649).Other available prodrug invertase comprises: carboxypeptidase; β-glucuronidase; Penicillin-V-amidase; Penicillin-G-amidase; Beta-lactamase; β-Pu Tangganmei; Nitroreductase; And Carboxypeptidase A.

Can comprise SecA (Sadaie etc. with the exemplary secretion signal (peptide) of Grain-positive microorganism coupling, 1991, Gene 98:101-105), SecY (Suh etc., 1990, Mol.Microbiol.4:305-314), SecE (Jeong etc., 1993, Mol.Microbiol.10:133-142), FtsY and FfH (PCT/NL96/00278) and PrsA (international publication number WO 94/19471).Can comprise solubility kytoplasm protein with the exemplary secretion signal (peptide) of Grain-negative microorganism coupling, for example the secretion signal of SecB and heatshock protein (peptide); The secretion signal (peptide) of periphery embrane-associated protein SecA; The secretion signal of integral protein SecY, SecE, SecD and SecF (peptide).

Driving Eph receptor or liver join protein antigenicity peptide expression promoter and optional prodrug invertase can be (the wherein peptide or the enzyme continuous expression) of composing type, derivable (wherein peptide or enzyme are only having expression in the presence of the inducing molecule), or (wherein peptide or enzyme are only expressed in some cell type) of cell type specificity control.For example, suitable inducible promoters can be to be responsible for promoter that antibacterial " SOS " replys (Friedberg etc. publish in DNA Repair and Mutagenesis (" DNA repairs and mutation "), the 407-455 page or leaf, Am.Soc.Microbiol.Press, 1995).This promoter can be used many medicines, comprises the chemotherapy alkylating agent, and the mitomycin that is used for human body as approval is induced (Oda etc., 1985, MutationResearch 147:219-229; Nakamura etc., 1987, Mutation Res.192:239-246; Shimda etc., 1994, Carcinogenesis 15:2523-2529).The promoter element that belongs to this group comprises umuC, sulA and other promoter (Shinagawa etc., 1983, Gene 23:167-174; Schnarr etc., 1991, Biochemie 73:423-431).The sulA promoter comprise the ATG of sulA gene and 27 nucleotide subsequently and ATG upstream 70 nucleotide (Cole, 1983, Mol.Gen.Genet.189:400-404).Therefore, for lacking the sequence that starts codon, it can be used for expressing alien gene, produces gene fusion.

In some embodiments, the Eph/ liver is joined the protein modulators vaccine and is not comprised microorganism.

In a specific embodiment, antigenic peptide is not EphA2 ₅₈(IMNDMPIYM; SEQ IDNO:55) or not be EphA2 ₅₅₀(VLAGVGFFI; SEQ ID NO:56).In another specific embodiment, antigenic peptide is not (TLADFDPRV; SEQ ID NO:57), (VLLLVLAGV; SEQID NO:58), (VLAGVGFFI; SEQ ID NO:59), (IMNDMPIYM; SEQ ID NO:60), (SLLGLKDQV; SEQ ID NO:61), (WLVPIGQCL; SEQ ID NO:62), (LLWGCALAA; SEQ ID NO:63), GLTRTSVTV; SEQ ID NO:64), (NLYYAESDL; SEQ ID NO:65) or (KLNVEERSV; SEQ ID NO:66).In also having another specific embodiment, antigenic peptide is not (IMGQFSHHN; SEQ ID NO:67), (YSVCNVMSG; SEQ ID NO:68), (MQNIMNDMP; SEQ ID NO:69), (EAGIMGQFSHHNIIR; SEQ ID NO:70), (PIYMYSVCNVMSG; SEQ IDNO:71) or (DLMQNIMNDMPIYMYS; SEQ ID NO:72).

5.2 Preventative/therapeutic method

The invention provides treatment, control, prevention and/or alleviation Eph receptor and/or liver and join the method for protein expression and/or active unusual (that is rising,, reduction or inappropriate) relevant disease.This disease includes but not limited to: the super proliferative disease of non-tumorigenesis, and it is disclosed for example to include this paper U.S. Patent Application Serial 10/823,254 (on April 12nd, 2004) as a reference in full; Super proliferative disease is for example included this paper U.S. Patent Application Serial 10/823,259 (on April 12nd, 2004) as a reference in full in; The cancer cancer of transfer form (optimum, pernicious and); Autoimmune disease (for example, graft versus host disease; " GVHD "); Inflammatory diseases; With lung Langerhans cell increase disease (" PLCH ").In a specific embodiment, Eph/ liver of the present invention is joined protein modulators can suppress the VEGF generation.In another specific embodiment, the Eph/ liver is joined protein modulators can anticancer propagation.In also having a specific embodiment, the Eph/ liver is joined protein modulators can the anticancer migration.In also having a specific embodiment, the Eph/ liver is joined protein modulators and can invade by anticancer.Available the inventive method treatment, prevention, control and/or other disease of alleviating comprise super proliferative epithelium of non-tumorigenesis and/or epidermis cell disease, include but not limited to: extracellular matrix component (for example, collagen, Dan Baijutang, tenascin and fibronectin) deposition increases and/or angiogenesis (that is, increases) relevant disease unusually.The non-limitative example of this disease comprises sclerosis, fibre modification (for example, liver, kidney, lung, heart, retina and other visceral nerve fiber degeneration), asthma, ischemia, atherosclerosis, diabetic retinopathy, the prematureness retinopathy, vascular restenosis, degeneration of macula (macular degeneration), rheumatoid arthritis, osteoarthritis, infantile hemangioma (infantile hemangioma), verruca vulgaris, Kaposi sarcoma, neurofibromatosis, the latent malnutrition kabner's disease, ankylosing spondylitis, the general lupus, the special syndrome of Lay, xerodermosteosis, endometriosis, preeclampsia, atherosclerosis, coronary heart disease, psoriatic arthropathy and psoriasis, as the U.S. Provisional Application series number of submitting on October 27th, 2,004 60/622,517, its " Modulators of EphA2 andEphrinAl For The Treatment of Fibrosis-Related Disease " by name (the EphA2 regulating liver-QI of treatment fibre modification relevant disease is joined protein A 1 regulator), this application is included this paper in as a reference in full.Available the inventive method treatment, prevention, control and/or other disease of alleviating include but not limited to: pathogen, the for example infection that causes of virus, antibacterial, fungus and protozoon, as the U.S. Provisional Application series number of submitting on October 27th, 2,004 60/622,489, its " Use of Modulators of EphA2 andEphrinA1 For The Treatment of Infections " by name (utilizing the EphA2 regulating liver-QI to join protein A 1 modulators for treatment infects), this application is included this paper in as a reference in full.In one embodiment, this pathogenic infection is to infect in the born of the same parents.In a specific embodiment, intra-cellular pathogens is not a respiratory syncytial virus.The inventive method comprises that one or more Eph/ livers that give effective dose join protein modulators.In another embodiment, this method comprises and unites one or more Eph/ livers that give effective dose to join protein modulators and one or more be not therapeutic or the preventive medicine that the Eph/ liver is joined protein modulators.

The present invention also provides treatment, control, prevention and/or alleviation Eph receptor and/or liver to join protein abnormal expression (promptly, rising, reduction or inappropriate) method of relevant disease, one or more Eph/ livers are joined protein modulators and one or more other therapeutic agents (example of this therapeutic agent vide infra chapters and sections 5.2.2).Be used for the treatment of, control, prevent and/or alleviate Eph receptor and/or liver to join this other therapeutic agent of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease and can join the protein modulators coupling with Eph/ liver of the present invention.

Term " effective dose ", " effective in the treatment " and " effective in the prevention " comprise dosage and frequency that this paper provides.According to each patient's material elements, dosage and frequency are usually also according to the order of severity of the therapeutic that is given or preventive medicine, the super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease and type, route of administration and patient's age, body weight, reaction and pharmacohistory in the past and different.Those skilled in the art are by considering this factor and follow that for example report and Physicians ' Desk Reference (" doctor's desk reference ") in the list of references, dosage of recommending in (the 56th edition, 2002) is selected suitable scheme.The concrete dosage of preventative and curative drug provided by the invention and frequency referring to chapters and sections 4.6.3.

5.2.1 Patient group

The Eph receptor and/or the liver that the present invention includes treatment, control or object of prevention are joined protein abnormal expression (promptly, rising, reduction or inappropriate) relevant disease, or the method for its symptom, described method comprises that giving one or more Eph/ livers of the present invention joins protein modulators.The object preferred mammal, for example non-human primate (as, milch cow, pig, horse, cat, Canis familiaris L., rat) or primates (as, monkey is as macaque or people).In a preferred embodiment, to liking the people.

The inventive method comprises giving just to suffer from or estimating (for example will suffer from, having the patient of hereditary inducement or former ill patient) Eph receptor and/or liver one or more Eph/ livers of the present invention of patient of joining protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease join protein modulators.This patient had treated or had treated the Eph receptor and/or liver is joined protein abnormal expression (that is, rising, reduction or inappropriate) relevant disease, for example joined the protein modulators treatment with non-Eph/ liver.According to the present invention, the Eph/ liver is joined the therapeutic agent that protein modulators can be used as arbitrary line, includes but not limited to the first, second, third and the 4th line therapeutic agent.In addition, according to the present invention, can join non-Eph/ liver and use the Eph/ liver to join protein modulators before any retroaction or tolerance take place in the protein modulators treatment.The present invention includes and give one or more Eph/ livers of the present invention and join protein modulators and prevent Eph receptor and/or liver to join the method for the relevant disease outbreak or the recurrence of protein abnormal expression (that is rising,, reduction or inappropriate).

In one embodiment, the present invention comprises that also method that treatment and control Eph receptor and/or liver join protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease is as the alternative method of treatment at present.In a specific embodiment, proved or provable present treatment for patient's toxicity too big (that is, causing unacceptable or intolerable side effect).In another embodiment, compare with present treatment, the EpM liver is joined protein modulators can reduce side effect.In another embodiment, prove that the patient is to present treatment refractory.One or more Eph/ livers of the patient the present invention that can need in some embodiments, are joined protein modulators, and another kind of therapeutic agent is treated the Eph receptor and/or liver is joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease to substitute.

The present invention also comprise give to or one or more Eph/ livers of the present invention of patient of non-Eph/ liver having been joined protein modulators treatment refractory join protein modulators and treat or alleviate the method that Eph receptor and/or liver are joined the symptom of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.Can adopt any method known in the art to check certain treatment that Eph receptor and/or liver are joined protein abnormal expression (promptly, rising, reduction or inappropriate) in the relevant disease affected cell to or non-Eph/ liver has been joined patient's cell of protein modulators treatment refractory, the effectiveness of epithelial cell and/or endotheliocyte particularly, thereby in vivo or externally determine whether refractory of these symptoms.

5.2.2 Other preventative/curative drug

The invention provides by uniting and give one or more Eph/ livers of the present invention and join protein modulators and one or more therapies and treat, control, prevent and/or alleviate the method that Eph receptor and/or liver are joined the symptom of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.That other therapy is preferably used at present or can be used for treatment, control or prevention Eph receptor and/or liver and join protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In a specific embodiment, the invention provides treatment, control, prevention and/or alleviation Eph receptor and/or liver and join protein abnormal expression (promptly, rising, reduction or inappropriate) method of relevant disease, described method comprises that the Eph/ liver of the object effective dose that needs joins the therapeutic agent except that the Eph/ liver is joined protein modulators of protein modulators and effective dose.Knownly can be used for, be used for or be used for prevention, control, treatment at present and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) any therapeutic agent (for example, preventative or curative drug) of relevant disease or its symptom can join protein modulators with Eph/ liver of the present invention described herein and unite use.Be used for or be used for prevention, treatment, control at present and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) therapeutic agent of relevant disease or its symptom, particularly preventative or information that the therapeutics medicine is relevant can referring to, Gilman etc. for example, Goodman and Gilman:The Pharmacological Basis ofTherapeutics (" therapeutic pharmacological basis "), the tenth edition, McGraw-Hill, New York, 2001; The Merck Manual of Diagnosis and Therapy (" the Merck handbook of diagnosis and treatment), Berkow, volumes such as M.D., the 17 edition, Merck Sharp ﹠amp; Dohme Research Laboratories, Rahway, New Jersey, 1999; With Cecil Textbook of Medicine (" Cecil's medical science teaching material "), the 20 edition, Bennett and Plum compile, W.B.Saunders, Philadelphia, 1996.Therapeutic or preventive medicine include but not limited to: micromolecule, synthetic drug, peptide, polypeptide, protein, nucleic acid (for example, DNA and RNA nucleotide include but not limited to that antisense base sequences, triple helical, RNAi and encoding human learn the nucleotide sequence of reactive protein, polypeptide or peptide), antibody, synthesize or natural inorganic molecule aids drug and synthetic or natural organic molecule.Preventative and example curative drug includes but not limited to: immunomodulator, anti-angiogenic agent, the TNF-alpha-2 antagonists, anti-inflammatory agent (for example, adrenocortical hormone, 17-hydroxy-11-dehydrocorticosterone (as, beclometasone, budesonide, flunisolide, fluticasone, triamcinolone, methyl meticortelone, meticortelone, prednisone, hydrocortisone)), glucocorticoid, steroid, nonsteroid anti-inflammatory drugs (for example, aspirin, ibuprofen, diclofenac and cox 2 inhibitor), anticholinergic agents (for example, ipratropium bromide and oxitropium bromide), sulfasalazine, penicillamine, sulphenone, antihistamine, anti-malaria medicaments (for example, hydroxychloroquine), anti--virus drugs and antibiotic are (for example, actinomycin D (dactinomycin) (was called D actinomycin D (actinomycin) in the past, bleomycin, erythromycin, penicillin, mithramycin and anthramycin (AMC)), anticancer disease is treated agent, antiviral drugs and antifungal drug.

In one embodiment, unite the object that needs Eph/ liver of the present invention join protein modulators and use at present or known therapeutic agent treat, control, prevent and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In another specific embodiment, unite the object that needs Eph/ liver of the present invention and join protein modulators and immunomodulator.In another specific embodiment, unite the object that needs Eph/ liver of the present invention and join protein modulators and anti-angiogenic agent.In another specific embodiment, unite the object that needs Eph/ liver of the present invention and join protein modulators and TNF-alpha-2 antagonists.In also having another specific embodiment, unite the object that needs Eph/ liver of the present invention and join protein modulators and anticancer disease drug.These therapeutic agents can be in turn or the object that needs simultaneously.Specifically, these therapeutic agents can give object with certain in the interbody spacer just at the same time or at a time in proper order, thereby make these therapeutic agents to concur, and then obtain than otherwise giving their bigger benefits.In a specific embodiment, one or more Eph/ livers of the present invention that combination treatment of the present invention comprises effective dose are joined protein modulators and effective dose at least aly has other therapeutic agent of joining protein modulators same function mechanism with Eph/ liver of the present invention.In a specific embodiment, one or more Eph/ livers of the present invention that combination treatment of the present invention comprises effective dose are joined protein modulators and effective dose at least aly has other therapeutic agent (for example, preventative or curative drug) of joining the different mechanism of action of protein modulators with Eph/ liver of the present invention.In some embodiments, thus combination treatment of the present invention by with Eph/ liver of the present invention join protein modulators concur have add and or cooperative effect, and then improved the prevention or the therapeutical effect of one or more antibody of the present invention.In some embodiments, combination treatment of the present invention has reduced described preventative or side effect that curative drug is relevant.In various embodiments, these therapeutic agents at interval less than 1 hour, about 1 hour at interval, about 1 hour-Yue 2 hours at interval, about 2 hours-Yue 3 hours at interval, about 3 hours-Yue 4 hours at interval, about 4 hours-Yue 5 hours at interval, about 5 hours-Yue 6 hours at interval, about 6 hours-Yue 7 hours at interval, about 7 hours-Yue 8 hours at interval, about 8 hours-Yue 9 hours at interval, about 9 hours-Yue 10 hours at interval, about 10 hours-Yue 11 hours at interval, about 11 hours-Yue 12 hours at interval, be no more than 24 hours at interval or being no more than 48 hours gives the patient at interval.In preferred embodiment, give two or more during make a house call same patient (patient visit) and treat agent.

Preventative or curative drug in the combination treatment can give object in same pharmaceutical composition, preferred people's object.Perhaps, the preventative or curative drug of combination treatment can give object simultaneously in the different pharmaceutical compositions.Preventative or curative drug can identical or different route of administration give object.

In a specific embodiment, can give object with containing the pharmaceutical composition that one or more Eph/ livers of the present invention described herein join protein modulators, preferred people prevents, treats, controls and/or alleviates the Eph receptor and/or liver is joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.According to the present invention, pharmaceutical composition of the present invention also can contain except that Eph/ liver of the present invention is joined protein modulators one or more therapeutic agents (for example, preventative or curative drug), these therapeutic agents can be that using at present, already used or knownly to can be used for prevention, treatment or alleviate the Eph receptor and/or liver is joined one or more symptoms of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.

5.2.2.1 Immunomodulator

In some embodiments, the invention provides and contain one or more Eph/ livers of the present invention and join protein modulators and one or more immunomodulators (promptly, the medicine of the immunne response of controlled plant) compositions, join protein abnormal expression (promptly with the Eph receptor and/or the liver of treatment, control, prevention or alleviation object, rising, reduction or inappropriate) method of relevant disease or its symptom, described method comprises and gives described compositions.The present invention also provides the Eph receptor and/or the liver of treatment, control, prevention or alleviation object to join protein abnormal expression (promptly, rising, reduction or inappropriate) method of relevant disease or its symptom, described method comprises uniting and gives the Eph/ liver and join protein modulators and one or more immunomodulators.In a specific embodiment of the present invention, described immunomodulator can suppress or suppress the immunne response of people's object.Immunomodulator well known to those skilled in the art can be used in the inventive method and the compositions.

Any immunomodulator well known to those skilled in the art can be used in the inventive method and the compositions.Immunomodulator can influence one or more aspects or all aspects of the immunne response of object.The each side of immunne response includes but not limited to: inflammatory response, complement cascade reaction, leukocyte and lymphocyte differentiation, propagation and/or effector function, the intercellular communication in mononuclear cell and/or basophilic granulocyte counting and the immune system cell.In some embodiments of the present invention, immunomodulator can be regulated the one side of immunne response.In other embodiments, immunomodulator can be regulated the many aspects of immunne response.In an embodiment of the invention, give the object-immunity regulator to suppress or to reduce one or more aspects of the immunne response ability of object.In a specific embodiment of the present invention, immunomodulator can suppress or suppress the immunne response of object.According to the present invention, immunomodulator be not can with the Eph receptor (for example, EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 or EphB6) or liver join albumen (for example, liver join protein A 1, liver join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver joins protein B 2 or liver is joined protein B 3) the bonded antibody of polypeptid specificity.In some embodiments, immunomodulator is not an anti-angiogenic medicaments.In some embodiments, immunomodulator is not an anti-inflammatory agent.In other embodiments, immunomodulator is not the TNF-alpha-2 antagonists.In some embodiments, immunomodulator is not anticancer disease drug.

The example of immunomodulator includes but not limited to: protein drug, for example cytokine, peptide mimics and antibody (as, people's antibody, humanized antibody, mosaic type antibody, monoclonal antibody, polyclonal antibody, Fv, ScFv, Fab or F (ab) 2 fragments or epi-position binding fragment), nucleic acid molecules (as, antisense nucleic acid molecule and triple helical), micromolecule, organic compound and inorganic compound.Specifically, immunomodulator includes but not limited to: methotrexate, leflunomide (leflunomide), cyclophosphamide, sendoxan, Immuran, cyclosporin A, minocycline, azathioprine, antibiotic (for example, FK506 (tacrolimus)), Methyllprednisolone (MP), corticosteroid, steroid, mycophenolate. (mycophenolatemofetil), rapamycin (sirolimus), bredinin, deoxyspergualin, brequinar (brequinar), malononitriloamindes (as, leflunamide), anti--the TXi Baoshouti regulator, cytokine receptor regulator and mastocyte regulator.

The example of TXi Baoshouti regulator includes but not limited to: anti--TXi Baoshouti antibody (as, anti-CD 4 antibodies (as, cM-T412 (Boeringer), IDEC-CE9.1._. (IDEC and SKB), mAB4162W94, Orthoclone and OKTcdr4a (Janssen-Cilag)), anti-CD 3 antibodies (as, Nuvion (Product Design Labs), OKT3 (Johnson ﹠amp; Johnson), Rituxan (IDEC), anti--CD5 antibody (as, the immunoconjugates that anti--CD5 ricin links to each other), anti--CD7 antibody (as, CHH-380 (Novartis)), anti--CD8 antibody, anti-CD 40 part monoclonal antibody (as, IDEC-131 (IDEC)), anti-CD 52 antibody (as, CAMPATH 1H (Ilex)), anti--CD2 antibody (as, uncommon Puli pearl monoclonal antibody (siplizumab) (MedImmune, Inc., international publication number WO02/098370 and WO 02/069904), anti--CD11a antibody (as, Xanelim (Genentech)) and anti--B7 antibody (as, IDEC-114) (IDEC)); The CTLA4-immunoglobulin; And LFA-3TIP (Biogen, international publication number WO 93/08656 and U.S. Patent number 6,162,432).

The example of cytokine receptor regulator includes but not limited to: soluble cytokine receptor (for example, the ectodomain of TNF-α receptor or its fragment, the ectodomain of the ectodomain of IL-1 beta receptor or its fragment and IL-6 receptor or its fragment), cytokine or its fragment are (for example, interleukin I L-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-23, TNF-α, TNF-β, interferon (IFN)-α, IFN-β, IFN-γ and GM-CSF), the antibacterial agent receptor antibody (for example, anti--the IFN receptor antibody, anti--the IL-2 receptor antibody is (for example, Zenapax (Protein Design Labs)), anti--the IL-3 receptor antibody, anti--the IL-4 receptor antibody, anti--the IL-6 receptor antibody, anti--the IL-10 receptor antibody, anti--the IL-12 receptor antibody, anti--the IL-13 receptor antibody, anti--IL-15 receptor antibody and anti--IL-23 receptor antibody), anti-cytokine antibody (for example, anti--IFN antibody, anti-TNF-Alpha antibodies, anti--IL-1 β antibody, anti--IL-3 antibody, anti--IL-6 antibody, anti--IL-8 antibody (for example, ABX-IL-8 (Abgenix)), anti--IL-12 antibody, anti--IL-13 antibody, anti--IL-15 antibody and anti--IL-23 antibody).

In a specific embodiment, the cytokine receptor regulator is IL-3, IL-4, IL-10 or its fragment.In another embodiment, the cytokine receptor regulator is anti--IL-1 β antibody, anti--IL-6 antibody, anti--IL-12 receptor antibody or anti-TNF-Alpha antibodies.In another embodiment, the cytokine receptor regulator is ectodomain or its fragment of TNF-α receptor.In some embodiments, the cytokine receptor regulator is not the TNF-alpha-2 antagonists.

In one embodiment, the cytokine receptor regulator is the mastocyte regulator.In another embodiment, the cytokine receptor regulator is not the mastocyte regulator.The example of mastocyte regulator includes but not limited to: inhibitor (for example for stem cell factor (c-kit receptors ligand), mAb7H6, mAb 8H7a, pAb 1337, FK506, CsA, dexamethasone (dexamthasone) and fluconcinonide), the c-kit acceptor inhibitor (for example, STI 571 (being called CGP 57148B in the past)), the mast cell protease 1 inhibitor (for example, GW-45, GW-58, wortmannin, LY 294002, press down the plain C of kinases, cytochalasin D, genistein, KT5926, D-82041 DEISENHOFEN and lactoferrin), relaxin (" RLX "), the IgE antagonist (for example, antibody rhuMAb-E25 horse pearl monoclonal antibody (omalizumab) difficult to understand, HMK-12 and 6HD5 and mAB Hu-901), the IL-3 antagonist, the IL-4 antagonist, IL-10 antagonist and TGF-β.

Can select immunomodulator to disturb interaction between t helper cell subgroup (TH1 or TH2) and the B cell, form thereby suppress neutralizing antibody.Can disturb or blocking-up TH (T is auxiliary) the required interaction of cell-stimulating B cell, thereby the antibody that the blocking-up neutralizing antibody produces can be used as the immunomodulator of the inventive method.For example, some interaction (Durie etc. need take place in t cell activation B cell, Immuno1.Today, 15 (9): 406-410 (1994)), for example the CD40 part on the t helper cell combines with CD40 antigen on the B cell, and CD28 on the T cell and/or CTLA4 part combine with B7 antigen on the B cell.Lack this two kinds of interactions, the B cell can not activate and produce neutralizing antibody.

It is the desirable site that blocking immunity is replied that CD40 part (CD40L)-CD40 interacts, because it has extensive activity and be abundant in its signal transduction pathway in t helper cell activation and function.Therefore, in the embodiment of the invention, the interaction of given one or more immunomodulator temporary interruptions CD40L and CD40.This can block the CD40 part on the TH cell and disturb CD40 part and the normal bonded medicine of the CD40 antigen on the B cell on the t helper cell to realize by using.The antibody (anti-CD 40 L) that can select the CD40 part is (available from Bristol-Myers Squibb Co; Referring to, the european patent application of publishing on August 18th, 1,993 555,880 for example) or solubility CD40 molecule, as the immunomodulator of the inventive method.

Can select immunomodulator to suppress TH1 cell and cytotoxic T lymphocyte (" CTL ") interphase interaction, thereby the lethal effect that reduces the CTL-mediation take place.Can select immunomodulator to change (for example, suppressing or compacting) CD4 ⁺And/or CD8 ⁺The propagation of T cell, differentiation, activity and/or function.For example, the specific antibody of T cell can be eliminated or is changed CD4 as immunomodulator ⁺And/or CD8 ⁺The propagation of T cell, differentiation, activity and/or function.

In an embodiment of the invention, can will can reduce or eliminate the T cell according to the inventive method, the immunomodulator of preferred memory T cell is in ill risk or suffers from the object of following disease: IL-9 polypeptide expression and/or active unusual relevant or be the disease, relevant with the abnormal expression of IL-9R or its one or more subunits or be disease, autoimmune disease, inflammatory diseases, proliferative disease or the infection (preferably respiratory tract infection) of feature with it of feature with it.Referring to, for example U.S. Patent number 4,658, and 019.In another embodiment of the present invention, immunomodulator can be in the object of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease risks or suffering from this disease according to the inventive method.In a specific embodiment, can utilize anti--CD8 antibody to reduce or eliminate CD8 ⁺The T cell.

In another embodiment, can reduce or suppress CD4 according to the inventive method ⁺The immunomodulator of one or more biologic activity of the TH0 of t helper cell, TH1 and/or TH2 subgroup (for example, differentiation, propagation and/or effector function) is in the object of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease risks or suffering from this disease.An example of this immunomodulator is IL-4.IL-4 can strengthen the antigenic specificity activity of TH2 cell, but reduce the TH1 cell function (referring to, Yokota etc. for example, 1986 Proc.Natl.Acad.Sci., USA, 83:5894-5898; With U.S. Patent number 5,017,691).Other example that can influence the immunomodulator of t helper cell (specifically being TH1 and/or TH2 cell) biologic activity (for example, differentiation, propagation and/or effector function) includes but not limited to: IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-15, IL-23 and interferon (IFN)-γ.

In another embodiment, being in the immunomodulator of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease risks or suffering from the object of this disease according to the inventive method is the cytokine that can stop antigen presentation.In a specific embodiment, the used immunomodulator of the inventive method is IL-10.IL-10 also can reduce or suppress the effect of the macrophage of participation antibacterial elimination.

Can select immunomodulator reduce or suppress mastocyte activation, threshing, breed and/or ooze out.In some embodiments, immunomodulator can disturb the interaction between mastocyte and the mast cells activation agent (including but not limited to: stem cell factor (c-kit part), IgE, IL-4, environmental stimulus thing and infectious substance).In a specific embodiment, immunomodulator can reduce or suppress mastocyte to the environmental stimulus thing, such as but not limited to the reaction of pollen, dirt, demodicid mite, tobacco smoke and/or house pet soft flocks.In another specific embodiment, immunomodulator can reduce or suppress mastocyte to infectant, for example the reaction of virus, antibacterial and fungus.Can reduce or suppress the mastocyte activation, threshing, the example of the mastocyte regulator of breeding and/or oozing out includes but not limited to: inhibitor (for example for stem cell factor (c-kit receptors ligand), mAb 7H6, mAb 8H7a and pAb 1337 are (referring to Mendiaz etc., 1996, Eur J Biochem293 (3): 842-849), FK506 and CsA (Ito etc., 1999 Arch Dermatol Res291 (5): 275-283), dexamethasone (dexamthasone) and fluconcinonide are (referring to Finooto etc., 1997, J.Clin.Invest.99 (7): 1721-1728)), the c-kit acceptor inhibitor (for example, STI 571 (being called CGP 57148B in the past) is (referring to Heinrich etc., 2000 Blood 96 (3): 925-932)), the mast cell protease 1 inhibitor (for example, GW-45 and GW-58 are (referring to Temkin etc., 2002, JImmunol 169 (5): 2662-2669), wortmannin, LY 294002, press down the plain C of kinases, cytochalasin D is (referring to Vosseller etc., 1997, Mol Biol Cell 1997:909-922), genistein, KT5926, D-82041 DEISENHOFEN is (referring to Nagai etc., 1995, Biochem Biophys ResCommun 208 (2): 576-581) and lactoferrin (referring to He etc., 2003 Biochem Pharmacol65 (6): 1007-1015)), relaxin (" RLX ") is (referring to Bani etc., 2002 IntImmunopharmacol 2 (8): 1195-1294), the IgE antagonist (for example, antibody rhuMAb-E25 horse pearl difficult to understand monoclonal antibody (referring to Finn etc., 2003 J Allergy Clin Immuno 111 (2): 278-284; Corren etc., 2003 J Allergy Clin Immuno 111 (1): 87-90; Busse and Neaville, 2001Curr Opin Allergy Clin Immunol.1 (1): 105-108; Tang and Powell, 2001, Eur JPediatr 160 (12): 696-704), HMK-12 and 6HD5 be (referring to Miyajima etc., 2202 Int ArchAllergy Immuno 128 (1): 24-32), with mAB Hu-901 (referring to van Neerven etc., 2001 IntArch Allergy Immuno 124 (1-3): 400)), IL-3 antagonist, IL-4 antagonist, IL-10 antagonist and TGF-β are (referring to Metcalfe etc., 1995, Exp Dermatol 4 (4 Pt 2): 227-230).

In one embodiment, protein, polypeptide or the peptide (comprising antibody) that are used as immunomodulator can be derived from the species identical with the receptor of described protein, polypeptide or peptide, thereby reduce the probability at the immunne response of those protein, polypeptide or peptide.In another embodiment, when to as if man-hour, be the people's or humanized as described protein, polypeptide or the peptide of immunomodulator.

According to the present invention, can be before giving to join the bonded antibody of protein polypeptide specificity, one or more immunomodulators are in the object of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease risks or suffering from this disease afterwards or simultaneously with Eph receptor or liver.In one embodiment, suffer from the object that Eph receptor and/or liver join protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease risk or suffer from this disease and can join one or more aspects that the bonded antibody of protein polypeptide specificity and one or more immunomodulators reduce or suppress immunne response if those skilled in the art think to need to unite to be in Eph receptor or liver.Can adopt any technology well known to those skilled in the art to detect one or more aspects that concrete object-immunity is replied, thereby determine when and to give described object-immunity regulator.In another embodiment, the average absolute lymphocyte count of keeping object is about 500 cell/mm ³, 600 cell/mm ³, 650 cell/mm ³, 700 cell/mm ³, 750 cell/mm ³, 800 cell/mm ³, 900 cell/mm ³, 1000 cell/mm ³, 1100 cell/mm ³Or 1200 cell/mm ³In another embodiment, to suffer from the absolute lymphocyte count that Eph receptor and/or liver join the risk of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or suffer from the object of this disease be 500 cell/mm if be in ³Or following, 550 cell/mm ³Or following, 600 cell/mm ³Or following, 650 cell/mm ³Or following, 700 cell/mm ³Or following, 750 cell/mm ³Or following or 800 cell/mm ³Or when following, do not give them immunomodulator.

In one embodiment, can unite to be in and suffer from the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) relevant disease risk or the object of suffering from this disease can specificity join antibody and one or more immunomodulators of protein polypeptide in conjunction with Eph receptor or liver, thus temporarily reduce or one or more aspects of inhibition immunne response.This temporary transient reduction or the inhibition of immune one or more aspects can last for hours, a couple of days, several weeks or several months.In one embodiment, the temporary transient inhibition of one or more aspects of immunne response or (for example reduce sustainable several hours, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, 14 hours, 16 hours, 18 hours, 24 hours, 36 hours or 48 hours), several days (for example, 3 days, 4 days, 5 days, 6 days, 7 days or 14 days) or several week (for example, 3 weeks, 4 weeks, 5 week or 6 weeks).One or more aspects of temporary transient reduction or inhibition immunne response can improve with Eph receptor or liver joins the preventative of the bonded antibody of protein polypeptide specificity and/or causes the therapeutic effect.

According to the inventive method, coding can be had the nucleic acid molecules of protein, polypeptide or peptide of immunoregulatory activity or protein, polypeptide or the peptide with immunoregulatory activity and be in the risk of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease or the object of suffering from this disease.In addition, according to the inventive method, derivant, analog or the fragment that coding can be had derivant, analog or the segmental nucleic acid molecules of protein, polypeptide or the peptide of immunoregulatory activity or have protein, polypeptide or a peptide of immunoregulatory activity is in the risk of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease or the object of suffering from this disease.In one embodiment, this derivant, analog and fragment have kept the immunoregulatory activity of total length wild-type protein, polypeptide or peptide.

Immunomodulator can influence one or more or all aspects of the immunne response of object.The each side of immunne response includes but not limited to: inflammatory response, complement cascade reaction, leukocyte and lymphopoiesis, the intercellular communication in mononuclear cell and/or basophilic granulocyte counting and the immune system cell.In some embodiments of the present invention, immunomodulator can be regulated the one side of immunne response.In other embodiments, immunomodulator can be regulated the many aspects of immunne response.In another embodiment of the present invention, give the object-immunity regulator to suppress or to reduce one or more aspects of the immunne response ability of object.

According to the present invention, can give Eph/ liver of the present invention join protein modulators before, one or more immunomodulators are suffered from the object that Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease afterwards or simultaneously.In one embodiment, can suffer from Eph receptor and/or liver if desired joins protein abnormal expression (that is rising,, reduction or inappropriate) one or more immunomodulators of object of relevant disease and reduces or suppress one or more aspects of immunne response.Can adopt any technology well known to those skilled in the art to detect one or more aspects of immunne response, thereby determine when and to give immunomodulator.In another embodiment, can suffer from one or more immunomodulators of object that Eph receptor and/or liver are joined protein abnormal expression (that is, rising, reduction or inappropriate) relevant disease, thereby temporarily reduce or suppress one or more aspects of immunne response.This temporary transient reduction or the inhibition of immune one or more aspects can last for hours, a couple of days, several weeks or several months.The therapeutic effect that Eph/ liver of the present invention is joined protein modulators can be strengthened in one or more aspects of temporary transient reduction or inhibition immunne response.

In other embodiments, but but other immunomodulator of the present composition and method coupling is commercialization buys and the immunomodulator of known its function.These immunomodulators include but not limited to: medicine, for example cytokine, antibody (as, people's antibody, humanized antibody, mosaic type antibody, monoclonal antibody, polyclonal antibody, Fv, scFv, Fab or F (ab) 2 fragments or epi-position binding fragment), inorganic molecule or peptide mimics.Other example of immunomodulator includes but not limited to: anti--the IL-13 monoclonal antibody, anti--the IL-4 monoclonal antibody, anti--the IL-5 monoclonal antibody, anti--IL-2R antibody (for example, anti--Tac monoclonal antibody and BT 536).Anti--the CD4 monoclonal antibody, anti--the CD3 monoclonal antibody, anti--CD3 monoclonal human antibody OKT3, anti--the CD8 monoclonal antibody, anti-CD 40 part monoclonal antibody, anti--the CD2 monoclonal antibody is (for example, the International Patent Publication No. W WO02/070007 of JIUYUE in 2002 publication on the 12nd), the CTLA4-immunoglobulin, cyclophosphamide, cyclosporin A, macrolide antibiotic (for example, FK506 (tacrolimus)), Methyllprednisolone (MP), corticosteroid, mycophenolate. (mycophenolate mofetil), rapamycin (sirolimus), bredinin, deoxyspergualin, brequinar (brequinar), malononitriloamindes. (for example, leflunamide), β 2-agonist, leukotriene antagonist and the medicine that can reduce the IgE level.

In one embodiment, described immunomodulator can reduce the content of IL-9.In another embodiment, described immunomodulator be can with the bonded antibody of IL-9 specificity (for example, monoclonal antibody) or its fragment (referring to, for example on April 12nd, 2004 is by the Application No. 10/823 of Reed submission, 810, its " Methods of Preventing or Treating RespiratoryConditions " by name (method of prevention or treatment respiratory tract disease); The Application No. 10/823,523 that on April 12nd, 2004 was submitted to by Reed, its " Recombinant IL-9 Antibodies andUses Thereof " by name (reorganization IL-9 antibody and application thereof); The U.S. Provisional Application of submitting to by Reed on April 12nd, 2004 number 60/561,845, its " Anti-IL-9 Antibody Formulations andUses Thereof " by name (anti--IL-9 antibody preparation and application thereof), all these applications are included this paper in as a reference in full).Though do not want to be subjected to the constraint of concrete mechanism of action, with in anti--IL-9 antibody capable and IL-9 and have biological action, thus blocking-up or reduce inflammatory cell and raise.

Can adopt any technology well known to those skilled in the art in external and/or body, to measure the immunoregulatory activity of immunomodulator, described technology comprises, for example CTL test, proliferation test, the concrete protein of detection are as the immunoassay (as ELISA) and the FACS of costimulatory molecules and cytokine-expressing.

5.2.2.2 Anti-inflammatory treatment

In some embodiments, the invention provides and contain the compositions that one or more Eph/ livers of the present invention are joined protein modulators and one or more anti-inflammatory agents, join protein abnormal expression (promptly with the Eph receptor and/or the liver of treatment, control, prevention or alleviation object, rising, reduction or inappropriate) method of relevant disease, described method comprises and gives described compositions.In a specific embodiment, this disease is inflammatory diseases (for example a, rheumatoid arthritis).Any anti-inflammatory agent well known to those skilled in the art comprises that the medicine that is used for the treatment of inflammatory diseases can be used for the present composition and method.The non-limitative example of anti-inflammatory agent comprises: nonsteroid anti-inflammatory drugs (NSAID), steroidal antiinflammatory drug, anticholinergic (for example, atropine sulfate, methyl atropine nitrate (atropine methylnitrate), ipratropium bromide (ATROVENT ^TM)), β 2-agonist (for example, albuterol (abuterol) (VENTOLIN ^TMAnd PROVENTIL ^TM), than Toro spy (TORNALATE ^TM), levosalbutamol (XOPONEX ^TM), orciprenaline (ALUPENT ^TM), pirbuterol (MAXAIR ^TM), terbutaline (BRETHAIRE ^TMAnd BRETHINE ^TM), salbutamol (PROVENTIL ^TM, REPETAB S ^TMAnd VOLMAX ^TM), formoterol (FORADIL AEROLIZER ^TM), salmaterol (SEREVENT ^TMWith SEREVENT DISKUS ^TM)) and methylxanthine (for example, theophylline (UNIPHYL ^TM, THEO-DUR ^TM, SLO-BID ^TMAnd TEHO-42 ^TM)).The example of NSAID includes but not limited to: aspirin, ibuprofen, celecoxib (celecoxib) (CELEBREX ^TM), voltaren see diclofenac (VOLTAREN ^TM), etodolac (LODINE ^TM), fenoprofen (NALFON ^TM), indomethacin (INDOCIN ^TM), ketorolac (ketoralac) (TORADOL ^TM), _ promazine (DAYPRO ^TM), nabumetone (RELAFEN ^TM), sulindac (CLINORIL ^TM), Tolmetin (tolmentin) (TOLECTIN ^TM), rofecoxib (rofecoxib) (VIOX ^TM), naproxen (ALEVE ^TM, NAPROSYN ^TM), ketone group cloth coughs up sweet smell (ACTRON ^TM) and nabumetone (RELAFEN ^TM).The function of this NSAID is to suppress cyclo-oxygenase (for example, COX-1 and/or COX-2).The example of steroidal antiinflammatory drug includes but not limited to: glucocorticoid, dexamethasone (DECADRON ^TM), 17-hydroxy-11-dehydrocorticosterone (for example, methyl meticortelone (MEDROL ^TM)), cortisone, hydrocortisone, prednisone (PREDNISONE ^TMAnd DELTASONE ^TM), meticortelone (PRELONE ^TMAnd PEDIAPRED ^TM), triamcinolone, sulfasalazine and class dodecylic acid inhibitor (for example prostaglandin, blood coagulation _ alkane and leukotriene (the common dosage of leukotriene and these medicines can vide infra table 8)).

In some embodiments, anti-inflammatory agent be used to prevent, control, the medicine of treatment and/or relieving asthma or its one or more symptoms.The non-limitative example of this medicine comprises that the adrenal gland can stimulant (catecholamines (as epinephrine, isonorin and neoisuprel) for example; Resorcinol class (for example orciprenaline, terbutaline and fenoterol); With bigcatkin willow alcohols (for example albuterol)), adrenal corticoid, blucocorticoids, 17-hydroxy-11-dehydrocorticosterone (as, beclometasone, budesonide, flunisolide, fluticasone, triamcinolone, methyl meticortelone, meticortelone and prednisone), other steroid, β 2-agonist (for example, albuterol, than Toro spy, fenoterol, isoetharine, orciprenaline, pirbuterol, albuterol, terbutaline, formoterol, salmaterol and albuterol (albutamol), terbutaline (terbutaline)), anticholinergic agents (for example, ipratropium bromide and oxitropium bromide), IL-4 antagonist (comprising antibody), IL-5 antagonist (comprising antibody), IL-13 antagonist (comprising antibody), the PDE4-inhibitor, NF-κ-beta inhibitor, the VLA-4 inhibitor, CpG, anti--CD23, selectin antagonist (TBC 1269), the mast cell protease 1 inhibitor (for example, the trypsinlike enzyme inhibitors of kinases (as, GW-45, GW-58 and genisteine), phosphatidylinositols (phosphatidylinositide)-3 ' (PI3)-inhibitors of kinases (as, press down the plain C of kinases) and other inhibitors of kinases (as, D-82041 DEISENHOFEN) (referring to Temkin etc., 2002 JImmunol 169 (5): 2662-2669; Vosseller etc., 1997 Mol.Biol.Cell 8 (5): 909-922; Nagai etc., 1995 Biochem Biophys Res Commun 208 (2): 576-581)), C3 receptor antagonist (comprising antibody), immunosuppressant (for example, methotrexate and golden salt), mastocyte regulator (for example, sodium cromoglicate (INTAL ^TM) and Nedocromil Na (TILADE ^TM)) and mucolytic thing (for example, acetylcysteine)).In a specific embodiment, anti-inflammatory agent is leukotriene inhibitors (for example, montelukast (montelukast) (SINGULAIR ^TM), zafirlukast (zafirlukast) (ACCOLATE ^TM), pranlukast (pranlukast) (ONON ^TM) or zileuton (Zileuton) (ZYFLO ^TM) (referring to table 8)).

Table 8. is used for the leukotriene inhibitors for the treatment of asthma

The leukotriene modifying agent	Routine dosage every day
The leukotriene modifying agent	Routine dosage every day	Montelukast (SINGULAIR ^TM)	2-5 year, 4mg

	6-14 year, 5mg 15 years old and more than, 10mg
	6-14 year, 5mg 15 years old and more than, 10mg	Zafirlukast (ACCOLATE ^TM)	5-12 every day twice in year, 10mg 12 years old or above every day twice, 20mg
Pranlukast (ONON ^TM)	Only use in the Asia	Zafirlukast (ACCOLATE ^TM)
Pranlukast (ONON ^TM)	Only use in the Asia	Zileuton (ZYFLO ^TM)	12 years old and above every day 4 times, 600mg

In some embodiments, anti-inflammatory agent is the medicine that is used to prevent, control, treat and/or alleviate allergy or one or more allergic symptoms.The non-limitative example of this medicine (for example comprises anti-(allergy) medium (antimediator) medicine, hydryllin, the typical doses of antihistaminic non-limitative example and this medicine sees the following form 9), 17-hydroxy-11-dehydrocorticosterone, decongestant, sympathomimetic drug (for example, alpha-adrenergic medicine and beta-adrenergic medicine), TNX901 (Leung etc., 2003, N EnglJ Med 348 (11): 986-993), the IgE antagonist (for example, antibody rhuMAb-E25 horse pearl difficult to understand monoclonal antibody (referring to Finn etc., 2003 J Allergy Clin Immuno 111 (2): 278-284; Corren etc., 2003J Allergy Clin Immuno 111 (1): 87-90; Busse and Neaville, 2001 Curr OpinAllergy Clin Immuno 1 (1): 105-108; Tang and Powell, 2001, Eur J Pediatr160 (12): 696-704), HMK-12 and 6HD5 be (referring to Miyajima etc., 2202 Int ArchAllergy Immuno 128 (1): 24-32), mAB Hu-901 is (referring to van Neerven etc., 2001 IntArch Allergy Immuno 124 (1-3): 400), theophylline and derivant, glucocorticoid and immunotherapy (for example, long term injections anaphylactogen repeatedly, short term desensitization and venom immunotherapy).

Table 9.H ₁Hydryllin

Chemical classes and representative drugs	Routine dosage every day
Chemical classes and representative drugs	Routine dosage every day	Ethanolamine diphenhydramine (Diphehydramine) clemastine	Per 12 hours 0.34-2.68mg of every 4-6 hour 25-50mg
The ethylenediamine tripelennamine	Every 4-6 hour 25-50mg	Ethanolamine diphenhydramine (Diphehydramine) clemastine	Per 12 hours 0.34-2.68mg of every 4-6 hour 25-50mg
The ethylenediamine tripelennamine	Every 4-6 hour 25-50mg	Alkylamine brompheniramine chlorpheniramine triprolidine (1.25mg/5ml)	Every 4-6 hour 4mg; Or the every 4-6 of the SR form hour 4mg of every 8-12 hour 8-12mg; Or the every 4-6 of the SR form hour 2.5mg of every 8-12 hour 8-12mg
Phenothiazine Pu Luomai piperazine	H.d. 25mg
Phenothiazine Pu Luomai piperazine	H.d. 25mg	Piperazine

Hydroxyzine	Every 6-8 hour 25mg
Hydroxyzine	Every 6-8 hour 25mg	Piperidines astemizole (non-sedating) Azatadine cetirizine Cyproheptadine fexofenadine (non-sedating) loratadine (Loratidine) (non-sedating)	Per 24 hours 10mg of per 12 hours 60mg of 10mg/ days per 12 hours 1-2mg10mg/ days every 6-8 hour 4mg

Anti-inflammatory therapeutics known in the art and their dosage, route of administration and exemplary application, these aspects are described in such as Physician ' s Desk Reference (" doctor's desk reference "), in the list of references of (the 57 edition, 2003).

5.2.2.3 The angiogenesis inhibitor therapeutic agent

In some embodiments, the invention provides and contain the compositions that one or more Eph/ livers of the present invention are joined protein modulators and one or more anti-angiogenic medicaments, join protein abnormal expression (promptly with the Eph receptor and/or the liver of treatment, control, prevention or alleviation object, rising, reduction or inappropriate) method of relevant disease, described method comprises and gives described compositions.Any anti-angiogenic medicaments well known to those skilled in the art can be used for the present composition and method.

Any anti-angiogenic medicaments well known to those skilled in the art can be used for the present composition and method.The non-limitative example of anti-angiogenic medicaments comprises: the protein that can reduce or suppress angiogenesis, polypeptide, peptide, fusion rotein, antibody (as, people's antibody, humanized antibody, mosaic type antibody, monoclonal antibody, polyclonal antibody, Fv, scFv, Fab fragment or F (ab) ₂Fragment or epi-position binding fragment), for example can with the bonded antibody of TNF-alpha specific, nucleic acid molecules (as, antisense nucleic acid molecule and triple helical), organic molecule, inorganic molecule and micromolecule.Specifically, the example of anti-angiogenic medicaments includes but not limited to: endostatin, angiostatin, apomigren, anti--the angiogenic Antithrombin III, terminal and the 40kDa C-terminal fragment of the proteolysis 29kDa N-of fibronectin, the uPA receptor antagonist, the 16kDa proteolysis fragment of prolactin antagonist, the 7.8kDa proteolysis fragment of PF4,24 amino acid fragments of the anti--angiogenic of PF4, be called anti--angiogenesis factor of 13.40, anti--22 amino acid peptide fragments of angiogenic of thrombospondin I, anti--angiogenic 20 amino acid peptide fragments of SPARC, the peptide that contains RGD and NGR, laminin, fibronectin, anti--little peptide of angiogenic of precollagen and EGF, beta 2 integrin alpha _vβ ₃Antagonist, acid fibroblast growth factor (aFGF) antagonist, basic fibroblast growth factor (bFGF) antagonist, VEGF (VEGF) antagonist (for example, anti-VEGF antibodies (as, AVASTIN ^TM(Genentech)), vegf receptor (VEGFR) antagonist (for example, anti-VEGFR antibodies) and the anti-integrin antagonist (for example, with platelet on the glycoprotein iib/iiia receptors bind and stop REOPRO_ (abciximab) that blood clot forms (Centocor)).

The non-limitative example of anti-angiogenic medicaments comprises: the protein that can reduce or suppress angiogenesis, polypeptide, peptide, fusion rotein, antibody (as, people's antibody, humanized antibody, mosaic type antibody, monoclonal antibody, polyclonal antibody, Fv, scFv, Fab fragment or F (ab) ₂Fragment or epi-position binding fragment), for example can with the bonded antibody of TNF-alpha specific, nucleic acid molecules (as, antisense nucleic acid molecule and triple helical), organic molecule, inorganic molecule and micromolecule.Specifically, the example of anti-angiogenic medicaments includes but not limited to: endostatin, angiostatin, apomigren, anti--the angiogenic Antithrombin III, the 29kDa N-end of fibronectin and the proteolysis fragment of 40kDa C-end, the uPA receptor antagonist, the 16kDa proteolysis fragment of prolactin antagonist, the 7.8kDa proteolysis fragment of PF4, anti--24 amino acid fragments of angiogenic of PF4, be called anti--angiogenesis factor of 13.40, anti--22 amino acid peptide fragments of angiogenic of thrombospondin I, anti--angiogenic 20 amino acid peptide fragments of SPARC, the peptide that contains RGD and NGR, laminin, fibronectin, anti--little peptide of angiogenic of precollagen and EGF, beta 2 integrin alpha _vβ ₃Antagonist, acid fibroblast growth factor (aFGF) antagonist, basic fibroblast growth factor (bFGF) antagonist, VEGF (VEGF) antagonist are (for example, anti-VEGF antibodies), vegf receptor (VEGFR) antagonist (for example, anti-VEGFR antibodies).

Beta 2 integrin alpha _Vβ ₃The example of antagonist includes but not limited to: protein drug, for example non-catalytic metalloprotein enzyme fragment, RGD peptide, peptide mimics, fusion rotein, de-connect albumen or derivatives thereof or analog and can and beta 2 integrin alpha _Vβ ₃The bonded antibody of specificity, nucleic acid molecules, organic molecule and inorganic molecule.Energy and beta 2 integrin alpha _Vβ ₃The non-limitative example of the bonded antibody of specificity comprises 11D2 (Searle), LM609 (Scripps) and VITAXIN ^TM(MedImmune, Inc.).Small-molecular peptides simulation (peptidometric) beta 2 integrin alpha _Vβ ₃The non-limitative example of antagonist comprises S836 (Searle) and S448 (Searle).De-connect proteic example and include but not limited to Accutin.The present invention is also included within and uses disclosed beta 2 integrin alpha in following United States Patent (USP) and the international publication in the present composition and the method _Vβ ₃Antagonist: U.S. Patent number 5,149,780; 5,196,511; 5,204,445; 5,262,520; 5,306,620; 5,478,725; 5,498,694; 5,523,209; 5,578,704; 5,589,570; 5,652,109; 5,652,110; 5,693,612; 5,705,481; 5,753,230; 5,767,071; 5,770,565; 5,780,426; 5,817,457; 5,830,678; 5,849,692; 5,955,572; 5,985,278; 6,048,861; 6,090,944; 6,096,707; 6,130,231; 6,153,628; 6,160,099 and 6,171,588; With international publication number WO 95/22543; WO 98/33919; WO 00/78815 and WO 02/070007, each part full patent texts is included this paper in as a reference.Resist in one embodiment ,-angiogenesis drug is VITAXIN ^TM(MedImmune, Inc.) or its Fab.

In the embodiment of the invention, anti--angiogenesis drug is an endostatin.The endostatin of natural generation is made of about 180 aminoacid of the C-terminal of collagen XVIII (accession number of the cDNA of the two kinds of splicing form collagen XVIII that encode is AF18081 and AF18082).In another embodiment of the present invention, anti--angiogenesis drug is plasminogen fragment (coded sequence of plasminogen is seen GenBank accession number NM_000301 and A33096).Natural 4 the kringle domains that comprise plasminogen of angiostatin peptide, kringle1-kringle4.Proved that reorganization kringle1,2 and 3 has anti--angiogenesis characteristic of this native peptides, and kringle 4 do not have this activity (Cao etc., 1996, J.Biol.Chem.271:29461-29467).Therefore, angiostatin comprises at least one, preferably a plurality of kringle domains that are selected from kringle 1, kringle 2 and kringle 3.In a specific embodiment, anti--the angiogenesis peptide is the 40kDa isotype of people's blood vessel inhibin molecule, the 45kDa isotype of people's blood vessel inhibin molecule, the 42kDa isotype of people's blood vessel inhibin molecule or their combination.In another embodiment, anti--angiogenesis drug is kringle 5 domains of plasminogen, it is than the more potent angiogenesis inhibitor of angiostatin (angiostatin comprises kringle domain 1-4).In another embodiment of the present invention, anti--angiogenesis drug is an Antithrombin III.Hereinafter Antithrombin III is called antithrombase, its contain make heparin binding structural domain that this albumen and blood vessel wall adhere to and with the interactional avtive spot ring of thrombin.When antithrombase and heparin adhered to, this albumen can cause that conformation change interacts active ring and thrombin and causes the thrombin hydrolysis to cut described ring.The proteolysis cutting causes the another kind of antithrombase conformation to change, this conformation change (i) has changed between thrombin and the antithrombase interactional interface and (ii) discharged complex (Carrell from heparin, 1999, Science 285:1861-1862, and the list of references of this article).(1999, Science 285:1926-1928) such as O ' Reilly find to have strong anti-angiogenesis activity through the antithrombase of cutting.Therefore, in one embodiment, anti-angiogenic medicaments is the antithrombase of angiogenesis inhibitor form.In another embodiment of the present invention, anti-angiogenic medicaments is the 40kDa and/or the 29kDa proteolysis fragment of fibronectin.

In another embodiment of the present invention, anti-angiogenic medicaments is the receptor antagonist of urokinase-type plasminogen activator (uPA).In a mode of this embodiment, described antagonist be dominant negative mutation type uPA (referring to, Crowley etc. for example, 1993, Proc.Natl.Acad.Sci.USA90:5021-5025).In the another way of this embodiment, described antagonist is peptide antagonists or its fusion rotein (Goodson etc., 1994, Proc.Natl.Acad.Sci.USA 91:7129-7133).Also having in the another way of this embodiment, described antagonist is a solubility dominant negative mutation type uPA receptor (Min etc., 1996, Cancer Res.56:2428-2433).In another embodiment of the present invention, therapeutic molecules of the present invention is to contain have an appointment 120 amino acid whose prolactin antagonist 16kDa N-terminal fragments or its biological active fragment (coded sequence of prolactin antagonist is seen GenBank accession number NM_000948).In another embodiment of the present invention, anti--angiogenesis drug is a 7.8kDa PF4 fragment.In another embodiment of the present invention, therapeutic molecules of the present invention is little peptide, corresponding to little peptide of angiogenesis inhibitor or the beta 2 integrin alpha of angiogenesis inhibitor 20 amino acid peptide fragments, laminin, fibronectin, precollagen or the EGF of anti--angiogenesis 13 amino acid fragments of PF4, the angiogenesis inhibitor 22 amino acid peptide fragments that are called anti--angiogenesis factor of 13.40, thrombospondin I, SPARC _vβ ₃Or the little peptide antagonists of vegf receptor.In another embodiment, this little peptide comprises RGD or NGR motif.In some embodiments, anti-angiogenic medicaments is the TNF-alpha-2 antagonists.Resist in other embodiments ,-angiogenesis drug is not the TNF-alpha-2 antagonists.

According to the inventive method, coding can be had the nucleic acid molecules of protein, polypeptide or the peptide of anti-angiogenesis activity, or protein, polypeptide or peptide with anti-angiogenesis activity are in the risk of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease or the object of suffering from this disease.In addition, according to the inventive method, coding can be had the nucleic acid molecules of derivant, analog, fragment or variant of protein, polypeptide or the peptide of anti-angiogenesis activity, or derivant, analog, fragment or variant with protein, polypeptide or peptide of anti-angiogenesis activity are in the risk of suffering from super proliferative epithelium of non-tumorigenic and/or endotheliocyte disease or the object of suffering from this disease.In one embodiment, this derivant, analog, variant and fragment have kept the anti-angiogenesis activity of total length wild-type protein, polypeptide or peptide.

Can adopt well known or as herein described any technology preparation to can be used as protein, polypeptide or the peptide of anti-angiogenic medicaments.Can adopt well known or engineered protein, polypeptide or the peptide of the techniques described herein, thereby increase the interior half-life of body of this protein, polypeptide or peptide with anti--angiogenic activity.In one embodiment, the anti-angiogenic medicaments that can commercial buy of the present composition and method utilization.Can adopt any technology well known to those skilled in the art in external and/or body, to measure the anti-angiogenesis activity of certain medicine.

5.2.2.4 The TNF-alpha-2 antagonists

The present composition and method can be used any TNF-alpha-2 antagonists well known to those skilled in the art.The non-limitative example of TNF-alpha-2 antagonists comprises: can block, reduce, suppress or in and function, activity and/or the expressed protein of TNF-α, polypeptide, peptide, fusion rotein, antibody (for example, people's antibody, humanized antibody, mosaic type antibody, monoclonal antibody, polyclonal antibody, Fv fragment, ScFv fragment, Fab fragment, F (ab) ₂Fragment and their Fab), for example can with the bonded antibody of TNF-alpha specific, nucleic acid molecules (for example, antisense molecule or triple helical), organic molecule, inorganic molecule and micromolecule.In various embodiments, with contrast, for example phosphate-buffered saline (PBS) is compared, and the TNF-alpha-2 antagonists can make function, the activity of TNF-α and/or express and reduce at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%.

Can include but not limited to the example of the bonded antibody of TNF-alpha specific: sharp former times monoclonal antibody (the infliximab) (REMICADE_ of English; Centacor), D2E7 (Abbott Laboratories/KnollPharmaceuticals Co., Mt.Olive, New Jersey), be also referred to as HUMICADE ^TMCDP571 and CDP-870 (the two all originates from Celltech/Pharmacia, Slough, the U.S.) and TN3-19.12 (Williams etc., 1994, Proc.Natl.Acad.Sci.USA, 91:2762-2766:Thorbecke etc., 1992, Proc.Natl.Acad.Sci.USA, 89:7375-7379).The present invention be also included within the present composition and the method use following U.S. Patent number disclosed can with the bonded antibody of TNF-alpha specific: U.S. Patent number 5,136,021; 5,147,638; 5,223,395; 5,231,024; 5,334,380; 5,360,716; 5,426,181; 5,436,154; 5,610,279; 5,644,034; 5,656,272; 5,658,746; 5,698,195; 5,736,138; 5,741,488; 5,808,029; 5,919,452; 5,958,412; 5,959,087; 5,968,741; 5,994,510; 6,036,978; 6,114,517 and 6,171,787; Each piece full patent texts is included this paper in as a reference.The example of soluble TNF-α receptor includes but not limited to: sTNF-R1 (Amgen), Embrel (etanercept) (ENBREL ^TMImmunex) and rat congener RENBREL ^TM, derived from TNF-α solubility inhibitor (Kohno etc., 1990, the Proc.Natl.Acad.Sci.USA of TNFrI, TNFrII, 87:8331-8335) with TNF-α Inh (Seckinger etc., 1990, Proc.Natl.Acad.Sci.USA, 87:5188-5192).

In one embodiment, the TNF-alpha-2 antagonists that uses in the present composition and the method is soluble TNF-α receptor.In a specific embodiment, the TNF-alpha-2 antagonists that uses in the present composition and the method is Embrel (ENBREL ^TMImmunex) or its fragment, derivant or analog.In another embodiment, the TNF-alpha-2 antagonists that uses in the present composition and the method be can with the bonded antibody of TNF-alpha specific.In a specific embodiment, the TNF-alpha-2 antagonists that uses in the present composition and the method is the sharp former times monoclonal antibody (REMICADE_ of English; Centacor), its derivant.Analog or Fab.

Other TNF-alpha-2 antagonists that the present invention includes includes but not limited to: the IL-10 (Oswald etc. that known energy produces by the activated macrophage blocking-up of interferon gamma TNF-α, 1992, Proc.Natl.Acad.Sci.USA, 89:8676-8680), TNFR-IgG (Ashkenazi etc., 1991, Proc.Natl.Acad.Sci.USA, 88:10535-10539), mice product TBP-1 (Serono/Yeda), vaccine CytoTAb (Protherics), antisense molecule 104838 (ISIS), peptide RDP-58 (SangStat), thalidomide (Celgene), CDC-801 (Celgene), DPC-333 (Dupont), VX-745 (Vertex), AGIX-4207 (AtheroGenics), ITF-2357 (Italfarmaco), NPI-13021-31 (Nereus), SCIO-469 (Scios), TACE targeting thing (Immunix/AHP), CLX-120500 (Calyx), Thiazolopyrim (Dynavax), auranofin (Ridaura) (SmithKline BeechamPharmaceuticals), quinacrine (quinacrine two chloride hydrates), tenidap (tenidap) (Enablex), anti--p38 MAPK preparation of melanin (Large Scale Biological) and Uriach.

According to the inventive method, coding can be had the nucleic acid molecules of the active protein of TNF-alpha-2 antagonists, polypeptide or peptide or have the active protein of TNF-alpha-2 antagonists, polypeptide or peptide and be in trouble inflammatory/or autoimmune disease risk or suffer from the object of this disease.In addition, according to the inventive method, coding can be had the nucleic acid molecules of derivant, analog, fragment or variant of the active protein of TNF-alpha-2 antagonists, polypeptide or peptide or derivant, analog, fragment or variant with the active protein of TNF-alpha-2 antagonists, polypeptide or peptide and be in trouble inflammatory/or autoimmune disease risk or suffer from the object of this disease.In one embodiment, this derivant, analog, variant and fragment have kept the TNF-alpha-2 antagonists activity of total length wild-type protein, polypeptide or peptide.

Can adopt well known or as herein described any technology preparation to can be used as protein, polypeptide or the peptide of TNF-alpha-2 antagonists.Can adopt well known or the active protein of the engineered TNF-of the having alpha-2 antagonists of the techniques described herein, polypeptide or peptide, thereby increase the interior half-life of body of this protein, polypeptide or peptide.In one embodiment, can use in the present composition and the method can medicine that commercial buy and the known TNF-of having alpha-2 antagonists function.Can adopt any technology well known to those skilled in the art in external and/or body, to measure the TNF-alpha-2 antagonists activity of certain medicine.

5.2.2.5 Anticancer disease drug

The present composition and method can be utilized and knownly can be used for, be used for or be used for prevention, treatment, control or alleviate proliferative disease, any therapeutic agent (for example, therapeutic or preventive medicine) of cancer (optimum, pernicious or transitivity) or its one or more symptoms for example.Therapeutic (for example, therapeutic or preventive medicine) includes but not limited to: peptide, polypeptide, fusion rotein, nucleic acid molecules, micromolecule, aids drug, synthetic drug, inorganic molecule and organic molecule.The non-limitative example of cancer treatment method comprises chemotherapy, radiotherapy, hormonotherapy and/or biotherapy/immunotherapy.

In some embodiments, anticancer disease drug is immune regulative medicine, for example chemotherapeutics.In some other embodiment, anticancer disease drug is the immunoregulation medicament except that chemotherapeutics.In other embodiments, anticancer disease drug is not an immunoregulation medicament.In concrete embodiment, anticancer disease drug is anti--angiogenesis drug.In other embodiments, anticancer disease drug is not anti--angiogenesis drug.In the specific embodiment, anticancer disease drug is an anti-inflammatory agent.In other embodiments, anticancer disease drug is not an anti-inflammatory agent.

In the specific embodiment, anticancer disease drug is but is not limited to: acivicin; Aclarubicin; The hydrochloric acid acodazole; Acronine; Adozelesin; Interleukin-2; The hexamethyl pyrimidine; Ambomycin; The acetic acid ametantrone; Aminoglutethimide; Amsacrine; Anastrozole; Anthramycin; Asparaginase; Asperlin; A word used for translation is pricked cytidine; Ah's TEPA; Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene hydrochloride; Two methanesulfonic acid bisnafides; Di 2 ethylhexyl phosphonic acid (for example, Sodium Pamidronate (Aredria), sodium clodronate (sodium clondronate) (Bonefos), zoledronic acid (zoledronic acid) (Zometa), alendronate (Fosamax), etidronic acid salt (etidronate), ibandronate (ibandornate), ineadronic acid disodium (cimadronate), Risedronate (risedromate) and Tiludronate (tiludromate)); Bizelesin; Bleomycin sulfate; Brequinar sodium (brequinarsodium); Bropirimine; Busulfan; Actinomycin C; Clausterone; Caracemide; Carbetimer; Carboplatin; Carmustine; Carubicin hydrochloride; Carzelesin; Cedefingol; Chlorambucil; Cirolemycin; Cisplatin; The sharp guest of carat; The methanesulfonic acid crisnatol; Cyclophosphamide; Cytosine arabinoside; Dacarbazine; Actinomycin D; The hydrochloric acid daunoblastin; Decitabine; Dexormaplatin; Dezaguanine; The methanesulfonic acid Dezaguanine; Diaziquone; Docetaxel; Amycin; Doxorubicin hydrochloride; Droloxifene; Droloxifene citrate; Dromostanolone propionate; Diazomycin; Edatrexate; Eflornithine hydrochloride; The EphA2 inhibitor (for example, can cause EphA2 phosphorylation and EphA2 degraded anti--EphA2 antibody (referring to, include this paper Application No. 60/418,213 as a reference in full in)); Elsamitrucin; Enloplatin; En Pumei; Epoxy third pyridine; Epirubicin hydrochloride; Erbulozole; Esorubicin hydrochloride; Estramustine phosphate sodium; Estramustine phosphate sodium; Etanidazole; Etoposide; The phosphoric acid etoposide; Etoprine; CGS-16949A; Fazarabine; Fenretinide; Floxuridine; Fludarabine phosphate; Fluorouracil; Flurocitabine; Fosquidone; Fostriecin sodium; Gemcitabine (gemcitabine); Gemcitabine hydrochloride; Hydroxyurea; The hydrochloric acid darubicin; Ifosfamide; Ilmofosine; Interleukin I I (comprise recombinant interleukin II, or rIL2); Intederon Alpha-2a; Interferon Alpha-2b; Interferon alfa-n1; Alferon N; Interferon beta-Ia; Interferon gamma Ib; Yi Pu platinum; Irinotecan hydrochloride; Lanreotide acetate; Letrozole; Leuprorelin acetate; Liarozole hydrochloride; Lometrexol sodium; Lomustine; Losoxantrone hydrochloride; Aetinex; Maytansine; Mustine hydrochlcride; Anti--CD2 antibody (for example, Xi Puli pearl monoclonal antibody (MedImmune Inc.; Include this paper international publication number WO 02/098370 as a reference in full in)); Megestrol acetate; Melengestrol acetate; Melphalan; Menogaril; Purinethol; Methotrexate; Methotrexate sodium; Metoprine; Meturedepa; Mitindomide mitocarcin; Mitochromine mitocromine B-35251; Mitogillin; Mitomalcin; Mitomycin; Mitosper; Mitotane; Mitoxantrone hydrochloride; Mycophenolic acid; Nocodazole; Nogalamycin; Ormaplatin; Oxisuran; Paclitaxel; Asparaginase; Peliomycin; Neostigmine bromide; Peplomycin sulfate; Perfosfamide; Pipobroman; A-20968; The hydrochloric acid piroxantrone; Plicamycin; Plomestane; Porfimer sodium; Porfiromycin; Prednimustine; Procarbazine hydrochloride (procarbazine hydrochloride); Puromycin; Puromycin hydrochloride; Pyrazofurin; Riboprine; Rogletimide; Safingol; The hydrochloric acid Safingol; Semustine; Simtrazene; Sparfosate sodium; Sparsomycin; Spirogermanium hydrochloride; Spiromustine; Spiroplatin; Streptonigrin; Streptozocin; Sulofenur; Talisomycin; Tecogalan sodium; Ftorafur; Teloxandrone hydrochloride; Temoporfin; Teniposide; Teroxirone; Testolactone; ITG; Thioguanine; Plug is for group; Tiazofurine; Tirapazamine; FC-1157a; Trestolone; The phosphoric acid triciribine; Trimetrexate; Trimetrexate (trimetrexate glucuronate); Triptorelin; Tubulozole hydrochloride; Uracil mustard; Uredepa; Vapreotide; Verteporfin; Vinblastine Sulfate; Vincristine sulfate; Vindesine; Vindesine sulfate; The sulphuric acid vinepidine; The sulphuric acid vinglycinate; Vinleurosine sulfate; Vinorelbine; Vinrosidine sulfate; The sulphuric acid vinzolidine; Vorozole; Zeniplatin; Zinostatin; Zorubicin hydrochloride.

In the specific embodiment, but coupling antibody of the present invention and radiotherapy comprise the roentgenization destruction of cancer cells that utilizes x-ray, gamma-radiation and other source.In the specific embodiment, radiotherapy gives with external-beam or teletherapy, and wherein said ray is source irradiation from afar directly.In other specific embodiment, radiotherapy gives with internal therapentics or brachytherapy, and wherein radioactive source places in the body near cancerous cell or tumor mass place.

Anticancer Remedies known in the art and their dosage, route of administration and exemplary application, these aspects are described in such as Physician ' s Desk Reference (" doctor's desk reference "), in the list of references of (the 56 edition, 2002).

5.3 The feature of therapeutic or prophylactic use and demonstration

Can in cell culture or laboratory animal, measure the toxicity and the effectiveness of the preventative and/or therapeutic method of the present invention by standard pharmaceutical procedures, for example measure LD ₅₀(dosage that causes the death of 50% (object) colony) and ED ₅₀(to the effective dosage of 50% (object) mass treatment).Dose ratio between toxicity and the treatment effectively is a therapeutic index, and it is expressed as LD ₅₀/ ED ₅₀Ratio.The preferred high preventative and/or curative drug of therapeutic index that shows.Though can use the preventative and/or curative drug that shows toxic and side effects, the position that care should be used to design delivery system is delivered to this drug targeting affected tissue to be reducing the damage possible to uninfluenced cell as far as possible, thereby reduces side effect.

The data that can utilize cell culture test and zooscopy to obtain are formulated the dosage range of the preventative and/or curative drug of human.The dosage of this class medicine preferably is positioned at and comprises the little or avirulent ED of toxicity ₅₀The circulation composition scope in.Dosage can be according to used dosage form and route of administration and is changed in this scope.For the used any medicine of the inventive method, can estimate the treatment effective dose according to cell culture test at first.Can utilize animal model to formulate dosage and comprise the determined IC of cell culture to reach ₅₀The circulating plasma concentration range of (that is, realizing) to the maximum test compounds concentration that suppresses of the half of symptom.Can utilize this information to measure human dosage more accurately.Can pass through, for example high performance liquid chroma-tography detects blood plasma level.

Also can measure the treatment or the prophylactic activity of the used therapeutic agent of the present invention by various experimental animal models.Such as but not limited to, for cancer research, can utilize SCID mouse model or personnel selection EphA2 replace mice EphA2 transgenic mice, have the nude mice of people's xenograft or any animal model of known in the art and following document description (comprising hamster, rabbit etc.): Relevance of TumorModels for Anticancer Drug Development (" the related neoplasms model of anticancer disease drug exploitation "), (1999, Fiebig and Burger compile); Contributions to Oncology (" oncology's works "), (1999, Karger); The Nude Mouse in Oncology Research (" nude mice in the oncology studies ") (1991, Boven and Winograd compile); With Anticancer Drug DevelopmentGuide (" anticancer disease drug development guides "), (1997, Teicher compiles), each part document is included this paper in as a reference in full.

5.3.1 The demonstration that therapeutic is used

Preferably earlier whether have required treatment or prophylactic activity, be applied to human body again in external the inventive method and the compositions of testing in vivo then.For example, can adopt in vitro tests to determine whether to show and to give concrete Therapeutic Method, described in vitro tests comprises the cell in vitro culture experiment, patient's tissue sample is cultivated in this test (comprising), use certain method or otherwise give, observe the effect of this method to tissue sample, for example whether Eph receptor and/or liver join proteic phosphorylation/degraded and improve.The propagation of contact back cell or survival level reduce and show that this curative drug can effectively treat disease of patient.Perhaps, patient's cell be need not cultivate, but curative drug and method screened with tumor cell or malignant clone.Can adopt the survival and/or the growth of many code test assessment cells of this area, for example can be by detecting ³The H-thymus pyrimidine mixes, directly cell counting, detect known, as proto-oncogene (as, fos, myc) variation of transcriptional activity or cell cycle label checks cell proliferation; Can be by trypan blue dyeing assessment cell viability; Can join proteic phosphorylation/degraded raising according to metamorphosis, Eph receptor and/or liver and wait the visually rank differentiation.

Can test treatment and use chemical compound in suitable animal model system, test in human body then, described animal model includes but not limited to: rat, mice, chicken, milch cow, monkey, rabbit, hamster etc., for example above-mentioned animal model.These chemical compounds can be used for suitable clinical trial then.

In addition, can adopt any test assessment well known by persons skilled in the art conjoint therapy described herein to use for the preventative and/or therapeutic of treatment or prophylaxis of cancer.

5.4 Pharmaceutical composition

5.4.1 Gene therapy

In a specific embodiment, the nucleotide sequence that can contain the nucleic acid of code book invention antibody or another kind of preventative or curative drug by the mode of gene therapy is treated, prevents, is controlled and/or alleviates the Eph receptor and/or liver is joined protein abnormal expression (that is raising,, reduction or inappropriate) relevant disease or its one or more symptoms.Gene therapy refer to by give object representation or effable nucleic acid treat.In this embodiment of the present invention, described nucleic acid can produce the preventative or curative drug of its coded antibody of the present invention or mediation prevention or therapeutical effect.

The present invention can adopt the available any gene therapy method in this area.The overview of gene therapy method can be referring to Goldspiel etc., 1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann.Rev.Pharmacol.Toxicol.32:573-596; Mulligan, Science 260:926-932 (1993); Morgan and Anderson, 1993, Ann.Rev.Biochem.62:191-217; May, 1993, TIBTECH 11 (5): 155-215.Volumes such as Ausubel, Current Protocols in Molecular Biology (" up-to-date molecular biology method "), John Wiley ﹠amp; Sons, New York, (1993); Kriegler, Gene Transfer andExpression, A Laboratory Manual (gene transfer and expression, laboratory manual), StocktonPress, the method that adoptable recombinant DNA technology field is known has altogether been described in New York, (1990).

In one embodiment, the inventive method comprises the compositions that contains antibody of the present invention or another kind of preventative or curative drug code nucleic acid, described nucleic acid be can in suitable host, express antibody of the present invention, another kind is preventative or the part of the expression vector of curative drug or its fragment or mosaic type albumen or heavy chain or light chain.Specifically, this nucleic acid has the promoter that links to each other with the antibody coding region operability, preferred allogeneic promoter, described promoter is derivable or composing type, and optional be tissue-specific.In another embodiment, antibody of the present invention in the nucleic acid molecule used therefor or another kind of preventative or the coded sequence of curative drug or the zone that any other required sequence side joint can promote required site allos reorganization in genome, thereby can be at nucleic acid (Koller and the Smithies of intrachromosomal expression encoding antibody, 1989, Proc.Natl.Acad.Sci.USA 86:8932-8935; Ziilstra etc., 1989, Nature 342:435-438).In the specific embodiment, the preventative or curative drug of the antibody of the present invention of expression or other is a single-chain antibody; Perhaps, described nucleotide sequence comprises heavy chain and light chain or its fragment of code book invention antibody, or another kind is preventative or the sequence of curative drug.

Nucleic acid directly can be delivered to the host, object directly be contacted with nucleic acid or the carrier that carries nucleic acid, or can be delivered to the host indirectly, at this moment at first at the described nucleic acid transformant of external use, (with cell) is implanted into object again.These two kinds of methods are called in the body or stripped gene therapy.

In a specific embodiment, directly give nucleotide sequence in the body, they express the generation coded product in vivo.This can realize by many methods known in the art, for example they are configured to the part of suitable nucleic acid expression vector and give, thereby they are entered in the born of the same parents, as utilize the retrovirus of deficiency or attenuation or other viral vector infection (referring to U.S. Patent number 4,980,286), or the direct injection naked DNA, or utilize microparticle bombardment (as, particle gun; Biolistic; Dupont); or with lipid or cell surface receptor or transfection reagent parcel; be wrapped in liposome, microgranule or the microcapsule; or with they with give after the known peptide that can enter nuclear links to each other, with they with give after the part of experience receptor mediated endocytosis effect links to each other (referring to, for example Wu and Wu; 1987, J.Biol.Chem.262:4429-4432) (can be used for the cell type that targeting is expressed these receptors specially).In another embodiment, can form nucleic acid-ligand complex, part wherein contains and short melts that viral peptide destroys endosome in order to avoid lysosome degraded nucleic acid.In also having another embodiment, can make nucleic acid targeting specific cells in vivo by the targeting special receptor, by its picked-up and expression (referring to, international publication number WO92/06180 for example; WO 92/22635; W092/20316; W093/14188 and WO 93/20221).Perhaps, can nucleic acid be introduced in the born of the same parents, mix in the host cell DNA and express (Koller and Smithies, 1989, Proc.Natl.Acad.Sci.USA 86:8932-8935 by allos reorganization; Zijlstra etc., 1989, Nature 342:435-438).

In a specific embodiment, can utilize the viral vector that contains code book invention antibody, another kind of preventative or curative drug or its segmental nucleotide sequence.For example, can utilize retroviral vector (referring to Miller etc., 1993, Meth.Enzymol.217:581-599).These retroviral vectors contain correctly packaging virus genome, are integrated into the required component of host cell DNA.Code book invention antibody or the another kind of nucleotide sequence preventative or curative drug that is used for gene therapy can be cloned into the one or more carriers that help this gene delivery is gone into certain host.The more details of retroviral vector are seen Boesen etc., 1994, and Biotherapy 6:291-302, the document has been described the stem cell that chemotherapy is more tolerated for preparation and with retroviral vector mdr 1 gene delivery has been gone into hematopoietic stem cell.Other list of references of describing the application of retroviral vector in gene therapy is: Clowes etc., 1994, J.Clin.Invest.93:644-651; Klein etc., 1994, Blood83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; Grossman and Wilson, 1993, Curr.Opin.in Genetics and Devel.3:110-114.

Adenovirus is other viral vector that can be used for gene therapy.For gene delivery is gone into airway epithelial cell, adenovirus is attractive especially.But adenovirus natural infection airway epithelial cell causes slight disease at this place.Other target of adenovirus delivery system is liver, central nervous system, endotheliocyte and muscle.The advantage of adenovirus is to infect non-splitted cell.Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3:499-503 provides the summary of adenoviral gene treatment.Bout etc., 1994, Human Gene Therapy 5:3-10 proof can utilize adenovirus vector gene delivery to be given the airway epithelial cell of Rhesus Macacus.In gene therapy, use other example of adenovirus to see Rosenfeld etc., 1991, Science 252:431-434; Rosenfeld etc., 1992, Cell 68:143-155; Mastrangeli etc., 1993, J.Clin.Invest.91:225-234; PCT announces WO94/12649; Wang etc., 1995, Gene Therapy 2:775-783.One specific embodiment has been utilized adenovirus vector.

Also the someone proposes that adeno associated virus (AAV) can be used for gene therapy (Walsh etc., 1993, Proc.Soc.Exp.Biol.Med.204:289-300; With U.S. Patent number 5,436,146).

Another program of gene therapy comprises by such as electroporation, lipofection, the transfection of calcium phosphate mediation or the method for viral infection gene transfer being gone in the cell of tissue culture.Transfer method generally includes selectable marker is transferred in the cell.Then cell is placed selection (pressure) to get off and separate those cells of taking in and just expressing institute's metastatic gene.Then those cell deliveries are sent in the object.

In this embodiment, earlier nucleic acid is introduced cell, then the reconstitution cell that obtains in the body.Can carry out this introducing by any method known in the art, include but not limited to: transfection, electroporation, microinjection, with the gene transfer of the gene transfer of the virus that contains nucleotide sequence or the infection of bacteriophage carrier, cell fusion, chromosome mediation, microcell mediation, spheroplast fusion etc.The inventive method can adopt the many technology that alien gene can be introduced cell known in the art (referring to, for example Loeffler and Behr, 1993, Meth.Enzymol.217:599-618; Cohen etc., 1993, Meth.Enzymol.217:618-644; Clin.Pharma.Ther.29:69-92 (1985)), only otherwise destroy donee's cells and grow required and physiological function.This technology should be able to stably be transferred to cell with nucleic acid, thereby by this nucleic acid of cellular expression, preferably can entail its cell offspring and expression.

Can the reconstitution cell that obtain be delivered to object by the whole bag of tricks known in the art.Reorganization hemocyte (for example, hematopoietic stem cell or CFU-GM) preferably intravenous gives.Can be according to several factors, include but not limited to that required effect and patient's states estimate the cell consumption, those skilled in the art can measure this consumption.

The cell of introducing nucleic acid for gene therapy comprises any ideal, available cell type, includes but not limited to: epithelial cell, endotheliocyte, keratinocyte, fibroblast, muscle cell, hepatocyte; Hemocyte, for example T lymphocyte, bone-marrow-derived lymphocyte, mononuclear cell, macrophage, neutrophil cell, eosinophil, mastocyte, megalokaryocyte, granulocyte; Various stem cell or CFU-GM, particularly hematopoietic stem cell or CFU-GM (for example, from acquisitions such as bone marrow, Cord blood, peripheral blood, fetus livers).In a specific embodiment, the cell that is used for gene therapy is that object is from body.

At the embodiment that reconstitution cell is used for gene therapy, encoding antibody or its segmental nucleotide sequence are introduced cell, thereby can reach this nucleotide sequence by these cells or representative thereafter, give this reconstitution cell then in the body and treat.One specific embodiment is utilized stem cell or CFU-GM.According to this embodiment of the present invention, may utilize any can be at in-vitro separation and the stem cell of keeping and/or group cell (referring to, PCT publication No. WO 94/08598 for example; Stemple and Anderson, 1992, Cell 71:973-985; Rheinwald, 1980, Meth.Cell Bio.21A:229; Pittelkow and Scott, 1986, Mayo Clinic Proc.61:771).

In a specific embodiment, the nucleic acid of introducing for the gene therapy purpose comprises the inducible promoters that links to each other with the coded sequence operability, controls expression of nucleic acid thereby can exist or lack the suitable inducer of transcribing by control.

5.5 Compositions and medication

5.5.1 Pharmaceutical composition

Treatment provided by the invention and prevention method be by give the object effective dose can excitement and/or one or more Eph receptor/livers of antagonism join albumen and regulate their and express and/or active Eph/ liver of the present invention is joined protein modulators; Or provide and contain the pharmaceutical composition that Eph/ liver of the present invention is joined protein modulators and pharmaceutically acceptable carrier.

In one embodiment, the pharmaceutical composition of the present invention Eph/ liver of the present invention that comprises purification is joined protein modulators (for example, Eph/ liver join protein modulators preferably be substantially free of the material that can limit its effect or produce adverse side effect).The preferred animal of described object includes but not limited to for example animal of milch cow, pig, horse, chicken, cat, Canis familiaris L. etc., preferred mammal, and optimum is chosen.

The present composition can comprise the bulk drug compositions that can be used for pharmaceutical compositions (for example, impure or unpasteurized compositions) and can be used for preparing the pharmaceutical composition (that is, being fit to give object or patient's compositions) of unit dosage forms.This compositions comprises the curative drug described herein (for example, the Eph/ liver is joined protein modulators) and the pharmaceutically acceptable carrier for the treatment of effective dose.In some embodiments, the present composition can comprise one or more albumen of the present invention and the pharmaceutically acceptable carrier for the treatment of effective dose.In also having an embodiment, the present composition also comprises other cancer or non-cancer therapeutic agent.In concrete embodiment, the curative drug in the compositions is a purification.

In a specific embodiment, term " pharmaceutically acceptable " expression through federation management office or state government's approval list in American Pharmacopeia or pharmacopeia that other is generally acknowledged in and can be used for animal, more specifically be to be used for the people.Term " carrier " refers to diluent, adjuvant (for example, Freund adjuvant (fully and not exclusively), perhaps more preferably available from California, Emeryville, the MF59C.1 adjuvant of Chiron), excipient or the carrier of following therapeutic agent to give.This pharmaceutical carrier can be a sterile liquid, and for example water and oil comprise the oil that oil, animal, plant or mineral are originated, for example Oleum Arachidis hypogaeae semen, soybean oil, mineral oil, Semen Sesami wet goods.When intravenous gives this pharmaceutical composition, the carrier preferred water.Also can utilize saline solution and glucose and glycerine water solution as liquid-carrier, particularly be as Injectable solution.Suitable drug excipient comprises starch, glucose, lactose, sucrose, gelatin, Fructus Hordei Germinatus, rice, flour, Chalk, silica gel, sodium stearate, glyceryl monostearate, Pulvis Talci, sodium chloride, defatted milk powder, glycerol, propylene glycol, ethylene glycol, water, ethanol etc.If desired, said composition also can contain a small amount of wetting agent or emulsifying agent, or the pH buffer agent.These compositionss can be taked forms such as solution, suspension, emulsion, tablet, pill, capsule, powder, slow releasing preparation.

Each composition of the present composition for example is contained in the sealed container of lined out activity component content usually with unit dosage forms, as in ampoule or the pouch (sachette) with freeze-dried powder or do not have aqueous concentrate separately or mix and use.When giving said composition when infusing, available pharmaceutical grade sterilized water or the brinish infusion bottle of being equipped with disperses.When injecting when giving said composition, can mix each composition with ampoule Injectable sterile water or saline earlier, give again.

The present composition can be formulated as neutrality or salt form.Pharmaceutically acceptable salt comprises to be used such as the salt that forms derived from aniones such as hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid and uses the salt that forms such as derived from cationes such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, hydrated ferric oxide., 2-aminopropane., triethylamine, 2-ethyl amido alcohol, histamine, procaines.

In an embodiment of the present invention, the present composition is the no thermal source preparation that is substantially free of endotoxin and/or relevant heat source substance.Endotoxin comprises and is present in microorganism inside, only the toxin that discharges at microbial destruction or when dead.The thermal source material also comprises the heat stability material (glycoprotein) that can induce heating in antibacterial and other microorganism adventitia.If administration of human, these materials all can cause heating, hypotension and shock.Because its potential illeffects is even must remove the endotoxin of low content in the intravenous administered agents solution.Use for intravenous drug, the upper limit that Food and Drug Admistraton (" FDA ") sets is 5 units (EU) endotoxin/dosage/kg body weight (The United States PharmacopeialConvention during 1 hour, Pharmacopeial Forum (American Pharmacopeia conference, Pharmacopeial Forum), 26 (1): 223, (2000)).When consumptions hundreds of with per kilogram of body weight or thousands of milligrams give human cytokines, for example during monoclonal antibody, even must remove the harmful or dangerous endotoxin of trace.Endotoxin in the described compositions and thermal source level are preferably lower than 10EU/mg or are lower than 5EU/mg or are lower than 1EU/mg or are lower than 0.1EU/mg or are lower than 0.01EU/mg or are lower than 0.001EU/mg.

Available known various delivery systems give curative drug and treat or control the preceding disease of cancer, for example be wrapped in liposome, microgranule, the microcapsule, can express the reconstitution cell of this polypeptide fragment, receptor-mediated endocytosis (referring to, for example Wu and Wu, 1987, J.Biol.Chem., 262:4429-4432), make up nucleic acid as retrovirus or other carrier part, or the like.The method that gives curative drug includes but not limited to: parenteral gives (for example, intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural and mucosa (for example, intranasal, suction and oral route).In a specific embodiment, through intramuscular, intravenous or subcutaneously give curative drug of the present invention.Curative drug can give by any approach easily, for example by transfusion or inject, absorbs by epithelium or mucocutaneous lining (for example, oral mucosa, rectum and mucous membrane of small intestine), and can unite and give other biologic activity medicine.Can whole body or topical.

In a specific embodiment, the zone that may need the curative drug topical administration that the inventive method is used to treat; This can realize in the following manner: regional perfusion, injection, implant, described implant are porose, atresia or spawn, comprise film, as saliva sorrel (sialasticmembrane) or fiber.

In also having another embodiment, available controlled release or slow-released system delivery of therapeutic medicine.Embodiment can utilize pump to realize that controlled release or slow-released system send (referring to Langer, the same; Sefton, 1987, CRC Crit.Ref.Biomed.Eng., 14:20; Buchwald etc., 1980, Surgery, 88:507; Saudek etc., 1989, N.Engl.J.Med., 321:574).Another embodiment utilizes polymeric material to realize that the controlled release of medicine of the present invention or slow release are (referring to Medical Applications ofControlled Release (" medical application of controlled release "), Langer and Wise compile, CRC Press, Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Designand Performance (" controlled drug bioavailability, drug products design and performance "), Smolen and Ball compile, Wiley, New York, (1984); Ranger and Peppas, 1983, J.Macromol.Sci.Rev.Macromol.Chem., 23:61; Also referring to Levy etc., 1985, Science, 228:190; During etc., 1989, Ann.Neurol., 25:351; Howard etc., 1989, J.Neurosurg., 71:105; U.S. Patent number 5,679,377; 5,916,597; 5,912,015; 5,989,463; 5,128,326; International publication number WO 99/15154 and WO 99/20253).The example of used polymer includes but not limited in the slow releasing preparation: poly-(2-hydroxyethyl methacrylate), poly-(methyl methacrylate), poly-(acrylic acid), poly-(ethylene-co-vinyl acetate), poly-(methacrylic acid), poly-Acetic acid, hydroxy-, bimol. cyclic ester (PLG), polyanhydride, poly-(N-vinyl pyrrolidone), poly-(vinyl alcohol), polyacrylamide, poly-(ethylene glycol), polylactide (PLA), poly-(lactide-co-glycolide) are (PLGA) and poe.In one embodiment, used polymer is inertia, does not contain and can leach impurity, stable, the aseptic and biodegradable of preservation in the slow releasing preparation.In also having another embodiment, controlled release or slow-released system can be placed and adjoin treatment target position part, therefore only need give whole-body dose a part (referring to, Goodson for example, publish in MedicalApplications of Controlled Release (" medical application of controlled release "), the same, the 2nd volume, the 115-138 page or leaf, (1984)).

Langer (1990, Science, summary 249:1527-1533) has been discussed controlled release system.Can adopt any technology well known by persons skilled in the art to prepare the slow releasing preparation that contains one or more curative drugs of the present invention.Referring to, for example U.S. Patent number 4,526, and 938; International publication number WO 91/05548 and WO 96/20698; Ning etc., 1996, Radiotherapy ﹠amp; Oncology 39:179-189; Song etc., 1995, PDA Journal of Pharmaceutical Science ﹠amp; Technology 50:372-397; Cleek etc., 1997, Pro.Int ' l.Symp.Control.Rel.Bioact.Mater.24:853-854; Lam etc., 1997, Proc.Int ' l.Symp.Control Rel.Bioact.Mater.24:759-760.

5.5.2 Preparation

Can utilize one or more physiologically acceptable carriers or excipient to prepare pharmaceutical compositions for use of the present invention in a usual manner.

Therefore, medicine that can the inventive method is used and their physiologically acceptable salt and solvate are formulated as and are used for through sucking or be blown into (by oral cavity or nose) or oral, parenteral or mucosa (for example, buccal, vagina, rectum, Sublingual) administration.Also have an embodiment to adopt part or general parenteral.

For oral administration, described pharmaceutical composition can be taked, tablet or the capsule form of for example utilizing pharmaceutically acceptable excipient to prepare by conventional methods, described excipient for example has: adhesive (as, corn starch, polyvinylpyrrolidone or the hydroxypropyl emthylcellulose of gelatinization in advance (pregelatinised)); Filler (as, lactose, microcrystalline Cellulose or calcium hydrogen phosphate); Lubricant (as, magnesium stearate, Pulvis Talci or silicon dioxide); Disintegrating agent (as, potato starch or Explotab); Or wetting agent (as, sodium lauryl sulfate).Can be by method coated tablet well known in the art.The liquid preparation of orally give can be taked following form, for example solution, syrup or suspension, and perhaps the form that they can dryed product exists, and water or the preparation of other suitable carrier re-use.Can utilize pharmaceutically acceptable additive to prepare this liquid preparation by conventional methods, described additive for example has: suspending agent (as, sorbitol syrups, cellulose derivative or hydrogenant edible fat); Emulsifying agent (as, lecithin or arabic gum); Non-aqueous carrier (as, almond oil, grease, ethanol or fractionated vegetable oil); Antiseptic (as, methyl parahydroxybenzoate or propyl ester or sorbic acid).These preparations also can suitably contain buffer salt, flavoring agent, pigment and sweeting agent.

Can suitably prepare the preparation of oral administration and obtain the controlled release of reactive compound.

For the buccal administration, described compositions can be taked the tablet or the lozenge form of usual manner preparation.

For inhalation, can be contained in the aerosol spray form in the compression wrap or in the aerosol apparatus, utilize suitable propellant, for example dichlorodifluoromethane, Arcton 11, dichlorotetra-fluoroethane, carbon dioxide or other suitable gas come routine to send the used curative drug of the present invention.In the situation of pressurized aerosol, can determine measurement unit by the valve that the transmissibility metered amount is provided.Can be formulated as and contain chemical compound and suitable powder base, for example mixture of powders of lactose or starch being used for for example gelatine capsule of inhaler or insufflator and medicine box.

Curative drug can be formulated as by injection, for example be used for parenteral by injecting or infusing continuously.The preparation that is used to inject can be a unit dosage forms, for example is contained in to contain in the ampoule or multi-dose container that has added antiseptic.Described compositions can be taked suspension, solution or the emulsion form such as oiliness or the preparation of aqueous carrier, and can contain formulated (formulatory agent), for example suspending agent, stabilizing agent and/or dispersant.Perhaps, active component can be a powder type, and with suitable carrier, use for example aseptic apirogen water preparation back.

Curative drug also can be mixed with rectal compositions, and for example suppository or enema,retention (retentionenemas) for example can contain, as conventional suppository bases such as cupu oil or other glyceride.

Except other preparation described above, also curative drug can be formulated as durative action preparation.Can give this durative action preparation by implanting (for example, subcutaneous or intramuscular) or intramuscular injection.Therefore, for example available suitable polymerization or hydrophobic material (as, the emulsion of acceptable oil preparation) or ion exchange resin preparation curative drug, or be formulated as and be difficult for molten derivant, as be formulated as and be difficult for molten salt.

The present invention also provides and is packaged in sealed container, for example indicates the ampoule of content or the curative drug in the pouch.In one embodiment, curative drug provides to be contained in the aseptic freeze-dried powder in the sealed container or not have aqueous concentrate, and available, for example water or saline give object after being reconstructed into suitable concn.

In an embodiment of the present invention, one or more Eph receptors known in the art and/or liver are joined protein abnormal expression (promptly, improving, reduce or unusual) the various therapeutic agents of relevant disease are (for example, chemotherapy, biology/immunotherapy and hormonotherapy medicine) preparation and administration, at Physicians ' DeskReference (" doctor's desk reference "), the 56th edition, description is often arranged in (2002).

In other embodiment of the present invention, can be with the radiotherapy medicine, for example radiosiotope is to be contained in liquid or the beverage orally give in the capsule.Also the radiosiotope preparation can be used for intravenous injection.Skilled oncologist can be determined preferred preparation and route of administration.

If desired, these compositionss can be contained in one or more unit dosage forms that contains active component packings or the packaging device.For example, described packing can comprise metal or plastic foil, for example blister package.In packing or the packaging device administration operation instructions can be housed.

5.6 Dosage and frequency

Can join protein abnormal expression (promptly by the prevention of standard clinical method mensuration, treatment, control and/or alleviation Eph receptor and/or liver, rising, reduction or inappropriate) relevant disease, or the present invention of its one or more symptoms is preventative or the effective dose of curative drug.Administration frequency and dosage are also according to the order of severity, route of administration and the patient's age of material elements, disease, disease or the situation of concrete therapeutic agent that each patient gave (for example, concrete one or more therapeutic or preventive medicine), body weight, reaction and medication history and different in the past.For example, can give animal model with described compositions, animal model for example described herein or well known by persons skilled in the art is measured and can effectively be treated, prevents, controls and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) relevant disease, or the present invention of its one or more symptoms is preventative or the consumption of curative drug or compositions.In addition, can choose the employing in vitro tests wantonly and help identify the optimal dose scope.Those skilled in the art can be by considering these factors and following, and for example list of references is reported and Physicians ' DeskReference (" doctor's desk reference "), and the 57th edition, the dosage that recommend (2003) is selected suitable scheme.

Micromolecular exemplary dosage comprise every kilogram of object or example weight be microgram or milligram level consumption micromolecule (for example, about 1 mg/kg-Yue 500 mg/kg, about 100 mg/kg-Yue 5 mg/kg, or about 1 microgram/kilogram-Yue 50 microgram/kilograms).For the antibody that the present invention includes, protein, polypeptide, peptide and fusion rotein, the dosage that gives the patient is normally counted 0.0001mg/kg-100mg/kg with weight in patients.In one embodiment, give patient's dosage between counting between 0.0001mg/kg-20mg/kg, 0.0001mg/kg-10mg/kg, 0.0001mg/kg-5mg/kg, 0.0001-2mg/kg, 0.0001-1mg/kg, 0.0001-0.75mg/kg, 0.0001-0.5mg/kg, 0.0001-0.25mg/kg, 0.0001-0.15mg/kg, 0.0001-0.10mg/kg, 0.001-0.5mg/kg, 0.01-0.25mg/kg or the 0.01-0.10mg/kg with weight in patients.Owing to can produce immunne response to external polypeptide, people's antibody is longer than the antibody of other species usually in the intravital half-life of people.Therefore, people's antibody often can be taked than low dosage and less administration frequency.In addition, can improve picked-up and tissue infiltration minimizing antibody of the present invention or its segmental dosage and the administration frequency of antibody by for example lipid modification.

In a specific embodiment, be prevention, treatment, the Eph receptor and/or the liver of control and/or reduction of patient are joined protein abnormal expression (promptly, raise, reduction or inappropriate) relevant disease, or its one or more symptoms and give antibody of the present invention, polypeptide, peptide, the dosage of agent is treated in compositions or combination, counts 150 μ g/kg or following with weight in patients, 125 μ g/kg or following, 100 μ g/kg or following, 95 μ g/kg or following, 90 μ g/kg or following, 85 μ g/kg or following, 80 μ g/kg or following, 75 μ g/kg or following, 70 μ g/kg or following, 65 μ g/kg or following, 60 μ g/kg or following, 55 μ g/kg or following, 50 μ g/kg or following, 45 μ g/kg or following, 40 μ g/kg or following, 35 μ g/kg or following, 30 μ g/kg or following, 25 μ g/kg or following, 20 μ g/kg or following, 15 μ g/kg or following, 10 μ g/kg or following, 5 μ g/kg or following, 2.5 μ g/kg or following, 2 μ g/kg or following, 1.5 μ g/kg or following, 1 μ g/kg or following, 0.5 μ g/kg or following or 0.5 μ g/kg or following.In another embodiment, be prevention, treatment, the Eph receptor and/or the liver of control and/or reduction of patient are joined protein abnormal expression (promptly, raise, reduction or inappropriate) antibody of the present invention that relevant disease, or its one or more symptoms gives, the dosage of compositions or therapeutic alliance agent is following unit dose: 0.1mg-20mg, 0.1mg-15mg, 0.1mg-12mg, 0.1mg-10mg, 0.1mg-8mg, 0.1mg-7mg, 0.1mg-5mg, 0.1-2.5mg, 0.25mg-20mg, 0.25-15mg, 0.25-12mg, 0.25-10mg, 0.25-8mg, 0.25mg-7mg, 0.25mg-5mg, 0.5mg-2.5mg, 1mg-20mg, 1mg-15mg, 1mg-12mg, 1mg-10mg, 1mg-8mg, 1mg-7mg, 1mg-5mg or 1mg-2.5mg.

In some embodiments, give one or more antibody of the present invention of object portion or many parts of effective doses, compositions or therapeutic alliance agent, the described antibody of effective dose wherein, compositions or therapeutic alliance agent can make endogenic ligand (for example, liver is joined albumen) be reduced by at least 20%-25% with combining of its receptor, at least 25%-30%, at least 30%-35%, at least 35%-40%, at least 40%-45%, at least 45%-50%, at least 50%-55%, at least 55%-60%, at least 60%-65%, at least 65%-70%, at least 70%-75%, at least 75%-80% or nearly at least 85%.In some embodiments, give one or more antibody of the present invention of object portion or many parts of effective doses, compositions or therapeutic alliance agent, with external and/or in vivo test detection and contrast well known in the art, for example PBS compares, the described antibody of effective dose, compositions or therapeutic alliance agent can reduce and/or suppress mastocyte threshing 20%-25% at least, at least 25%-30%, at least 30%-35%, at least 35%-40%, at least 40%-45%, at least 45%-50%, at least 50%-55%, at least 55%-60%, at least 60%-65%, at least 65%-70%, at least 70%-75%, at least 75%-80%, at least 80-85%, at least 85%-90%, at least 90%-95% or 95%-98% at least.In some embodiments, give one or more antibody of the present invention of object portion or many parts of effective doses, compositions or therapeutic alliance agent, with in the external and/or in vivo test well known in the art with contrast, for example PBS compares, the described antibody of effective dose, compositions or therapeutic alliance agent can reduce and/or suppress mastocyte and activate 20%-25% at least, at least 25%-30%, at least 30%-35%, at least 35%-40%, at least 40%-45%, at least 45%-50%, at least 50%-55%, at least 55%-60%, at least 60%-65%, at least 65%-70%, at least 70%-75%, at least 75%-80%, at least 80-85%, at least 85%-90%, at least 90%-95% or 95%-98% at least.In some embodiments, give one or more antibody of the present invention of object portion or many parts of effective doses, compositions or therapeutic alliance agent, with in the external and/or in vivo test well known in the art with contrast, for example PBS compares, the described antibody of effective dose, compositions or therapeutic alliance agent can reduce and/or suppress mastocyte and breed 20%-25% at least, at least 25%-30%, at least 30%-35%, at least 35%-40%, at least 40%-45%, at least 45%-50%, at least 50%-55%, at least 55%-60%, at least 60%-65%, at least 65%-70%, at least 70%-75%, at least 75%-80%, at least 80-85%, at least 85%-90%, at least 90%-95% or 95%-98% at least.In some embodiments, give one or more antibody of the present invention of object portion or many parts of effective doses, compositions or therapeutic alliance agent, with in the external and/or in vivo test well known in the art with contrast, for example PBS compares, the described antibody of effective dose, compositions or therapeutic alliance agent can reduce and/or suppress mastocyte seepage 20%-25% at least, at least 25%-30%, at least 30%-35%, at least 35%-40%, at least 40%-45%, at least 45%-50%, at least 50%-55%, at least 55%-60%, at least 60%-65%, at least 65%-70%, at least 70%-75%, at least 75%-80%, at least 80-85%, at least 85%-90%, at least 90%-95% or 95%-98% at least.

In other embodiments, give object one or more Eph/ livers of the present invention a or many parts of effective doses and (for example join protein modulators, polypeptide or antibody), this effective dose can make the serum titer of antibody of the present invention reach at least 0.1 μ g/ml, at least 0.5 μ g/ml, at least 1 μ g/ml, at least 2 μ g/ml, at least 5 μ g/ml, at least 6 μ g/ml, at least 10 μ g/ml, at least 15 μ g/ml, at least 20 μ g/ml, at least 25 μ g/ml, at least 50 μ g/ml, at least 100 μ g/ml, at least 125 μ g/ml, at least 150 μ g/ml, at least 175 μ g/ml, at least 200 μ g/ml, at least 225 μ g/ml, at least 250 μ g/ml, at least 275 μ g/ml, at least 300 μ g/ml, at least 325 μ g/ml, at least 350 μ g/ml, at least 375 μ g/ml or at least 400 μ g/ml.In also having other embodiment, give one or more antibody of the present invention of object effective dose, thereby the serum titer that makes this antibody reaches at least 0.1 μ g/ml, at least 0.5 μ g/ml, at least 1 μ g/ml, at least 2 μ g/ml, at least 5 μ g/ml, at least 6 μ g/ml, at least 10 μ g/ml, at least 15 μ g/ml, at least 20 μ g/ml, at least 25 μ g/ml, at least 50 μ g/ml, at least 100 μ g/ml, at least 125 μ g/ml, at least 150 μ g/ml, at least 175 μ g/ml, at least 200 μ g/ml, at least 225 μ g/ml, at least 250 μ g/ml, at least 275 μ g/ml, at least 300 μ g/ml, at least 325 μ g/ml, at least 350 μ g/ml, at least 375 μ g/ml or at least 400 μ g/ml, and one or more antibody capables of the present invention that give effective dose subsequently make serum titer maintain at least 0.1 μ g/ml, at least 0.5 μ g/ml, at least 1 μ g/ml, at least 2 μ g/ml, at least 5 μ g/ml, at least 6 μ g/ml, at least 10 μ g/ml, at least 15 μ g/ml, at least 20 μ g/ml, at least 25 μ g/ml, at least 50 μ g/ml, at least 100 μ g/ml, at least 125 μ g/ml, at least 150 μ g/ml, at least 175 μ g/ml, at least 200 μ g/ml, at least 225 μ g/ml, at least 250 μ g/ml, at least 275 μ g/ml, at least 300 μ g/ml, at least 325 μ g/ml, at least 350 μ g/ml, at least 375 μ g/ml or at least 400 μ g/ml.According to these embodiments, can give

object

1,2,3,4,5,6,7,8,9,10,11,12 or more times is with post dose.

In a specific embodiment, the invention provides prevention, treatment, the Eph receptor and/or the liver of control and/or reduction of patient are joined protein abnormal expression (promptly, raise, reduction or inappropriate) method of relevant disease or its one or more symptoms, described method comprises one or more antibody of the present invention of the following dosage of object that needs, therapeutic alliance agent or compositions: at least 10 μ g, at least 15 μ g, at least 20 μ g, at least 25 μ g, at least 30 μ g, at least 35 μ g, at least 40 μ g, at least 45 μ g, at least 50 μ g, at least 55 μ g, at least 60 μ g, at least 65 μ g, at least 70 μ g, at least 75 μ g, at least 80 μ g, at least 85 μ g, at least 90 μ g, at least 95 μ g, at least 100 μ g, at least 105 μ g, at least 110 μ g, at least 115 μ g or at least 120 μ g.In another specific embodiment, the invention provides prevention, treatment, the Eph receptor and/or the liver of control and/or reduction of patient are joined protein abnormal expression (promptly, raise, reduction or inappropriate) method of relevant disease or its one or more symptoms, described method comprises per 3 days 1 time, per 4 days 1 time, per 5 days 1 time, per 6 days 1 time, per 7 days 1 time, per 8 days 1 time, per 10 days 1 time, per 2 weeks 1 time, one or more antibody of the present invention of the following dosage of object that per 3 weeks need for 1 time or 1 time every month, therapeutic alliance agent or compositions: at least 10 μ g, at least 15 μ g, at least 20 μ g, at least 25 μ g, at least 30 μ g, at least 35 μ g, at least 40 μ g, at least 45 μ g, at least 50 μ g, at least 55 μ g, at least 60 μ g, at least 65 μ g, at least 70 μ g, at least 75 μ g, at least 80 μ g, at least 85 μ g, at least 90 μ g, at least 95 μ g, at least 100 μ g, at least 105 μ g, at least 110 μ g, at least 115 μ g or at least 120 μ g.

The Eph receptor and/or the liver that the invention provides prevention, treatment, control and/or reduction of patient are joined protein abnormal expression (promptly, rising, reduction or inappropriate) method of relevant disease or its one or more symptoms, described method comprises: agent is treated in a or prevention of many doses of the object that (a) needs or one or more antibody of the present invention, compositions or the combination of treatment effective dose; After (b) monitoring gives described one or more antibody of some doses, the blood plasma level/concentration of described one or more antibody that give in the described object.In addition, agent is treated in one or more antibody of the present invention, compositions or the combination of prevention that is 1,2,3,4,5,6,7,8,9,10,11 or 12 doses of described some doses or treatment effective dose.

In a specific embodiment, the invention provides prevention, treatment, control and/or alleviation Eph receptor and/or liver are joined protein abnormal expression (promptly, raise, reduction or inappropriate) method of relevant disease or its one or more symptoms, described method comprises: object at least 10 μ g dosage (for example, at least 15 μ g that (a) need, at least 20 μ g, at least 25 μ g, at least 30 μ g, at least 35 μ g, at least 40 μ g, at least 45 μ g, at least 50 μ g, at least 55 μ g, at least 60 μ g, at least 65 μ g, at least 70 μ g, at least 75 μ g, at least 80 μ g, at least 85 μ g, at least 90 μ g, at least 95 μ g or at least 100 μ g) one or more antibody of the present invention; When (b) blood plasma level when one or more antibody that given in the described object is lower than 0.1 μ g/ml, is lower than 0.25 μ g/ml, is lower than 0.5 μ g/ml, is lower than 0.75 μ g/ml or is lower than 1 μ g/ml, give described object a or many parts with post dose.In another embodiment, the invention provides prevention, treatment, control and/or alleviation Eph receptor and/or liver are joined protein abnormal expression (promptly, raise, reduction or inappropriate) method of relevant disease or its one or more symptoms, described method comprises: a or many parts at least 10 μ g dosage (for example, at least 15 μ g of the object that (a) needs, at least 20 μ g, at least 25 μ g, at least 30 μ g, at least 35 μ g, at least 40 μ g, at least 45 μ g, at least 50 μ g, at least 55 μ g, at least 60 μ g, at least 65 μ g, at least 70 μ g, at least 75 μ g, at least 80 μ g, at least 85 μ g, at least 90 μ g, at least 95 μ g or at least 100 μ g) one or more antibody of the present invention; After (b) monitoring gives some doses, the blood plasma level of one or more antibody of the present invention that given in the described object; When (c) blood plasma level when one or more antibody that given in the described object is lower than 0.1 μ g/ml, is lower than 0.25 μ g/ml, is lower than 0.5 μ g/ml, is lower than 0.75 μ g/ml or is lower than 1 μ g/ml, give described object one or more antibody of the present invention with post dose.In one embodiment, described some doses one or more antibody of the present invention that are 1,2,3,4,5,6,7,8,9,10,11 or 12 part of effective dose.

In some embodiments, with Eph receptor of the present invention or liver is joined the protein antigenicity peptide and anti-idiotype antibody is mixed with 1mg/ml, 5mg/ml, 10mg/ml and 25mg/ml and the 5mg/ml that is used for repeatedly subcutaneous administration and intramuscular injection, 10mg/ml and the 80mg/ml that is used for intravenous injection.

Join protein vaccine when being bacterial vaccine when Eph receptor or liver, this vaccine can be formulated as content range between about 1x10 ²The about 1x10 of CFU/ml- ¹²Between the CFU/ml, for example 1 * 10 ²CFU/ml, 5 * 10 ²CFU/ml, 1 * 10 ³CFU/ml, 5 * 10 ³CFU/ml, 1 * 10 ⁴CFU/ml, 5 * 10 ⁴CFU/ml, 1 * 10 ⁵CFU/ml, 5 * 10 ⁵CFU/ml, 1 * 10 ⁶CFU/ml, 5 * 10 ⁶CFU/ml, 1 * 10 ⁷CFU/ml, 5 * 10 ⁷CFU/ml, 1 * 10 ⁸CFU/ml, 5 * 10 ⁸CFU/ml, 1 * 10 ⁹CFU/ml, 5 * 10 ⁹CFU/ml, 1 * 10 ¹⁰CFU/ml, 5 * 10 ¹⁰CFU/ml, 1 * 10 ¹¹CFU/ml, 5 * 10 ¹¹CFU/ml or 1 * 10 ¹²CFU/ml.

Join protein antigenicity peptide or anti-idiotype antibody for Eph receptor regulating liver-QI, the dosage that gives the patient is counted 0.1mg/kg-100mg/kg with weight in patients usually.In one embodiment, the dosage that gives the patient in weight in patients between between the 0.1mg/kg-20mg/kg or in weight in patients between 1mg/kg-10mg/kg.

Join the dosage of protein vaccine for antibacterial Eph receptor regulating liver-QI of the present invention, this dosage is based on colony-forming units (c.f.u).In various embodiments, the normally about 1.0c.f.u./kg-about 1 * 10 of this dosage range ¹⁰C.f.u./kg; About 1.0c.f.u./kg-about 1 * 10 ⁸C.f.u./kg; About 1 * 10 ²C.f.u./kg-about 1 * 10 ⁸C.f.u./kg; With about 1 * 10 ⁴C.f.u./kg-about 1 * 10 ⁸C.f.u./kg.Can obtain effective dose from the dose-response curve extrapolation that the animal model test macro obtains.In some exemplary embodiment, this dosage range is Mus LD ₅₀0.001-10,000 times, Mus LD ₅₀0.01-1,000 times, Mus LD ₅₀0.1-500 doubly, Mus LD ₅₀0.5-250 doubly, Mus LD ₅₀1-100 doubly and Mus LD ₅₀5-50 doubly.In some specific embodiment, this dosage range is Mus LD ₅₀0.00.1 doubly, 0.01 times, 0.1 times, 0.5 times, 1 times, 5 times, 10 times, 50 times, 100 times, 200 times, 500 times, 1,000 times, 5,000 times or 10,000 times.

According to the inventive method, can unite and give except that antibody of the present invention, to be used for or be used at present prevention, treatment, control and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (promptly, rising, reduction or inappropriate) relevant disease or its one or more symptoms therapeutic agent (for example, preventative or curative drug) and one or more antibody of the present invention treat, prevent, control and/or alleviate the Eph receptor and/or liver is joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or its one or more symptoms.In one embodiment, the dosage of the preventative or curative drug that therapeutic alliance of the present invention is used is lower than and is used for or is used for prevention, treatment, control at present and/or alleviates the Eph receptor and/or liver is joined those drug doses of protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease or its one or more symptoms.Be used for prevention, treatment, control and/or alleviation Eph receptor and/or liver at present and join protein abnormal expression (promptly, rising, reduction or inappropriate) recommended dose of medicine of relevant disease or its one or more symptoms can obtain by any document from this area, described document includes but not limited to: volumes such as Hardman, 2001, Goodman ﹠amp; Gilman ' s The Pharmacological Basis Of Basis OfTherapeutics (" therapeutic pharmacological basis "), the tenth edition, Mc-Graw-Hill, New York; Physician ' s Desk Reference (PDR) (" doctor's desk reference "), the 57 edition, 2003, Medical Economics Co., Inc., Montvale, New Jersey; These two parts of documents are included this paper in as a reference in full.

In various embodiments, these therapeutic agents (for example, preventative or curative drug) are at interval less than 5 minutes, at interval less than 30 minutes, 1 hour at interval, about 1 hour at interval, about 1-is about 2 hours at interval, about 2 hours-Yue 3 hours at interval, about 3 hours-Yue 4 hours at interval, about 4 hours-Yue 5 hours at interval, about 5 hours-Yue 6 hours at interval, about 6 hours-Yue 7 hours at interval, about 7 hours-Yue 8 hours at interval, about 8 hours-Yue 9 hours at interval, about 9 hours-Yue 10 hours at interval, about 10 hours-Yue 11 hours at interval, about 11 hours-Yue 12 hours at interval, about 12 hours-18 hours at interval, 18 hours-24 hours at interval, 24 hours-36 hours at interval, 36 hours-48 hours at interval, 48 hours-52 hours at interval, 52 hours-60 hours at interval, 60 hours-72 hours at interval, 72 hours-84 hours at interval, interval 84 hours-96 hours or interval gave in 96 hours-120 hours.In the specific embodiment, during same patient makes a house call, give two or more and treat agent.

In some embodiments, capable of circulationly give one or more Eph/ livers of the present invention and join protein modulators and one or more other therapeutic agents (for example, preventative or curative drug).The circulation therapy is included in and (for example gives first therapeutic agent certain period, the first preventative or curative drug), phase (for example gives second therapeutic agent at a time then, the second preventative or curative drug), phase (for example gives the 3rd therapeutic agent at a time then, preventative or curative drug) or the like, repeat this and give in turn, promptly carry out this and circulate and reduce the effectiveness that one of therapeutic agent is tolerated, avoids or reduces the side effect of one of therapeutic agent and/or improve therapeutic agent.

In some embodiments, can give identical Eph/ liver of the present invention repeatedly and join protein modulators, administration can be at interval at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, 3 months or at least 6 months.In other embodiments, can give repeatedly except that antibody of the present invention same therapeutic agent (for example, preventative or curative drug), administration can be at interval at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, 3 months or at least 6 months.

5.7 Test kit

The invention provides one or more pharmaceutical pack or test kits that Eph/ liver of the present invention is joined the container of protein modulators of having filled are housed.In addition, also can be equipped with in this pharmaceutical pack or the test kit and be used for the treatment of one or more other preventative or curative drug or other related drugs that Eph receptor and/or liver are joined protein abnormal expression (that is rising,, reduction or inappropriate) relevant disease.In some embodiments, described other preventative or curative drug is immunoregulation medicament (for example, anti--Eph receptor antibody or anti--liver are joined protein antibodies).The present invention also provides the pharmaceutical pack or the test kit of the container that one or more one or more compositions of having filled pharmaceutical composition of the present invention are housed.Can choose the announcement of the government that management medicine or biological product production, use or sale are housed in this container wantonly, this announcement has reflected that authorities ratify can produce, use or sell this human medicine.

5.7.1 Diagnosis/prognosis test

The present invention also provide utilize Eph/ liver of the present invention join protein modulators assessment of cancer treatment (based on or do not join protein modulators based on the Eph/ liver) diagnostic method of effect.The increase that Eph receptor and/or liver are joined protein expression generally increases relevant with invasive cancer and transfer.Therefore, according to disease to be treated, Eph receptor and/or liver are joined the protein expression reduction and show that this treatment has reduced the aggressive and/or the metastatic potential of cancer in concrete treatment.In the specific embodiment, diagnostic method of the present invention is provided as the method for picture and location transfer, and utilize away from the tissue at primary tumor position and liquid and diagnose method (and method of utilizing the tissue and the liquid of primary tumor) with prognosis, for example whole blood, expectorant, urine, serum, fine needle extract (that is biological biopsy).In other embodiments, diagnostic method of the present invention provides method and diagnosis and the method for prognosis that shift in-vivo imaging and location.In this embodiment, utilize antibody of the present invention, for example the Eph receptor epitope antibodies that exposes detects the constitutional metastatic tumo(u)r.Antibody of the present invention also can be used for immunohistochemical analysis freezing or fixed cell or tissue test.

Another embodiment provides the test kit that pharmaceutical composition of the present invention or diagnostic reagent are housed.

5.8 Goods

The present invention also comprises the drug products of the Packaging and Labeling of finishing.These goods for example are equipped with suitable unit dosage forms in sealed glass bottle or other container in suitable containers.Drug products can be formulated as in the single dose bottle and contain the 10mM histidine buffering liquid, the sterile liquid of pH6.0 and 150mM sodium chloride.Each 1.0mL solution can contain 100mg protein, 1.6mg histidine and the 8.9mg sodium chloride of water for injection preparation.In manufacturing process, will prepare the pH regulator to 6.0 of buffer with hydrochloric acid.With the dosage form that is suitable for parenteral is example, active component, and it is aseptic for example joining the bonded antibody of the present invention of protein-specific with Eph receptor and/or liver, is suitable for not giving as not containing particulate solution.In other words, the present invention includes aseptic separately parenteral solution and freeze-dried powder, the latter is suitable for rebuilding before injection.Perhaps, unit dosage forms can be the solid that is suitable for oral, transdermal, intranasal or local delivery.

In one embodiment, unit dosage forms is suitable for intravenous, intramuscular, intranasal, oral, part or subcutaneous delivery.Therefore, the present invention includes the solution that is suitable for each route of delivery, preferably aseptic.

As any drug products, can be during storage and transport, to protect the stability of product with packaging material and Vessel Design.In addition, product of the present invention is equipped with and informs how doctor, technical staff or patient suitably prevent or the operation instructions or the out of Memory of treatment suspected diseases.In other words, goods are equipped with and show or advise dosage regimen, include but not limited to that actual dose, monitoring method, total lymphocyte, mast cell counts, T cell counting, IgE produce and the operation instructions of other monitoring information.

Specifically, goods of the present invention provide packaging material, for example box, bottle, test tube, bottle, container, aerosol apparatus, insufflator, intravenous (i.v.) transfusion bag, big envelope etc.; With the medicine that is contained at least a unit dosage forms in the described packaging material, wherein said medicine contains and can join the bonded antibody of protein-specific with Eph receptor and/or liver, the operation instructions that are equipped with in the described packaging material show by giving given dose and adopting specific administration scheme described herein can utilize described antibody to prevent, control, treatment and/or alleviation Eph receptor and/or liver are joined expression and/or active unusual one or more relevant symptoms of relevant disease of protein polypeptide, Eph receptor and/or liver are joined protein expression and/or active unusual relevant disease, or its one or more symptoms.

The present invention also provides packaging material, for example box, bottle, test tube, bottle, container, aerosol apparatus, insufflator, intravenous (i.v.) transfusion bag, big envelope etc.; With each pharmaceutical preparation that is contained at least a unit dosage forms in the described packaging material, wherein a kind of pharmaceutical preparation contains and can join the bonded antibody of protein polypeptide specificity with Eph receptor and/or liver, another kind of pharmaceutical preparation contains and can join the bonded second kind of different antibodies of protein polypeptide specificity with Eph receptor and/or liver, the operation instructions of adorning in the described packaging material show by giving given dose and adopting specific administration scheme described herein to treat with described medicine, prevention and/or alleviate one or more Eph receptors and/or liver join protein expression and/or active unusual (promptly, improve, reduction or inappropriate) relevant disease, or its one or more symptoms.

The present invention also provides packaging material, for example box, bottle, test tube, bottle, container, aerosol apparatus, insufflator, intravenous (i.v.) transfusion bag, big envelope etc.; With each pharmaceutical preparation that is contained at least a unit dosage forms in the described packaging material, wherein a kind of pharmaceutical preparation contains and can join the bonded antibody of protein polypeptide specificity with Eph receptor and/or liver, another kind of pharmaceutical preparation contains except joining preventative or curative drug the bonded antibody of protein polypeptide specificity with Eph receptor and/or liver, the operation instructions that described packaging material are equipped with show by giving given dose and adopting specific administration scheme described herein can utilize described medicine to treat, prevention and/or alleviate one or more Eph receptors and/or liver join protein expression and/or active unusual (promptly, improve, reduction or inappropriate) one or more symptoms of relevant disease, or its one or more symptoms.

Be contained in and be used for prevention, treat and/or alleviate the information material that one or more Eph receptors and/or liver join in the goods of relevant one or more symptoms of protein abnormal expression (that is raising,, reduction or inappropriate) relevant disease and pointed out the retroaction that employing the inventive method can reduce or avoid.The retroaction of adopting the inventive method to reduce or to avoid includes but not limited to: crucial sign unusual (heating, tachycardia, bradycardia (bardycardia), hypertension, hypotension), hematology change (anemia, lymphopenia, leukopenia, thrombocytopenia), have a headache, shiver, dizzy, nauseating, weak, backache, chest pain (chest pressure), diarrhoea, myalgia, pain, scratch where it itches, psoriasis, rhinitis, diaphoresis, injection site reaction and vasodilation.Because can join the bonded antibody of the present invention of protein polypeptide specificity with Eph receptor and/or liver can be inhibitive ability of immunity, immunosuppressive action prolongs may increase infection, comprises the risk of opportunistic infection.Prolonging and keep the risk that immunosuppressant also can cause some types of cancer takes place improves.

In addition, be contained in and be used for preventing, treat, control and/or alleviating one or more Eph receptors and/or liver is joined protein abnormal expression (promptly, raising, reduction or inappropriate) information material in the goods of relevant disease or its one or more symptoms points out that foreign protein also can cause anaphylaxis, comprises anaphylaxis or release of cytokines syndrome.This information material should point out that anaphylaxis can only show slight pruritus erythra, perhaps can be serious disease, for example erythroderma, Stevens Johnson syndrome, vasculitis or anaphylaxis.This information material should point out that also anaphylaxis (anaphylaxis) is serious, is fatal allergy once in a while.When being injected in the body, any extraneous protein can comprise the anaphylaxis of anaphylaxis.Anaphylaxis can be a light symptoms, and for example urticaria or erythra also can be fatal systemic reactions.Usually anaphylaxis can take place in contact (extraneous protein) in back 10 minutes.The patient can experience that paraesthesia, hypotension, edema of throat, the mental status change, facial or pharyngeal angioedema, airway obstruction, bronchospasm, urticaria and scratch where it itches, serum sickness, arthritis, anaphylaxis nephritis, glomerulonephritis, temporal joint inflammation or eosinophil increase.

6. Embodiment

Embodiment 1

The people Anti-Human is anti--the affinity optimization of Eph monoclonal antibody GEA44, and " being tuned to " optimizes the unique combination feature analysis of variant to multiple EphA receptor

Reagent

All chemicals all are AGs.Restriction Enzyme and DNA-modification enzyme and T4 ligase and T7 archaeal dna polymerase be available from New England Biolabs, and Inc. (Beverly, MA).(Carlsbad CA) synthesizes the oligonucleotide of customization by Invitrogen.In human embryo kidney (HEK) (HEK) 293 cells, express people EphA4-Fc fusion rotein that constitutes by people EphA4 ectodomain or the EphA4-His fusion rotein that constitutes by people EphA4 ectodomain, adopt standard method with G albumen affinitive layer purification with histidine-tagged fusion with human IgG1's Fc partial fusion.The Streptavidin magnetic beads available from Dynal (Lake Success, NY).According to manufacturer's operation instructions, (Pierce, Rockford IL) carry out the biotinylation of people EphA4-Fc or EphA4-His to connect sulfo group-NHS-LC-biotinylation test kit with EZ-.

Variable gene is built in the phage expression vector

The people mAb GEA44 (gene) of Fab form is cloned in the M13 phage expression vector.This carrier can under the control of lacZ promoter, express the constant domain of first constant domain that contains people γ 1 heavy chain and human kappa light chain the Fab fragment (Dall ' Acqua etc., 2005, Methods, 36:43-60).As (Wu etc., 2003, Methods Mol Biol., 207:197-212) described by hybridization mutation clone (Kunkel etc., 1987, Methods Enzymol., 154:367-382).

The PCR of GEA44 heavy chain and variable region of light chain: in brief, utilize following range gene specific oligonucleotide primer amplification GEA44 heavy chain and the variable region of light chain of about 0.5pmol:

The GEA44 VL of biological prime ring:

^*5 '-ggtcgttccattttactcccactccGAAATTGTGCTGACTCAGTCTCC-3 ' (5 ' biotinylation);

GEA44VL carries on the back ring:

5’gatgaagacagatggtgcagccacagtacgTTTGATCTCCACCTTGGTCCCTTGG-3’：

The GEA44 VH of biological prime ring:

^*5 ' gctggtggtgccgttctatagccatagcCAGGTGCAGCTGTTGCAGTCTGGAGC-3 ' (5 ' biotinylation);

GEA44VH carries on the back ring:

5’ggaagaccgatgggcccttggtggaggcTGAGGAGACGGTGACCAGGGTGCC3’。

The oligonucleotide GEA44 VH and the VL of biological prime ring contain the leading overlapping sequence of M13 gene (lower case).Oligonucleotide GEA44 VH and VL back of the body ring contain CHl and C κ overlapping sequence (lower case) respectively.Pass through PCR, utilize the GEA44VL/GEA44 VL back of the body ring oligonucleotide combination of the GEA44 VH/GEA44 VH back of the body ring and the biological prime ring of biological prime ring respectively, (originate from MedImmune from the corresponding GEA44 IgG construction that is used for the mammal expression, Inc.) make PCR, the synthetic parent Fab positive control of mutagenesis reaction and VH-GEA44 and the VL-GEA44 heavy chain and the light chain gene (seeing below) of template of being used for.

The Fab template makes up: with sodium hydroxide dissociate double-stranded PCR product and with as (Wu etc., 2003, Methods Mol Biol., 207:197-212; Wu etc., 2003, Methods Mol Biol., after 207:213-233) described Streptavidin bag is removed this biotinylation chain by magnetic beads, by ethanol precipitation from the PCR product purification corresponding to the negative single stranded DNA in GEA44 V district.V with about equimolar amounts _H-GEA44 and V _LThe GEA44 minus strand is mixed with strand M13 ring carrier.These variable region genes are annealed with two regiospecificities of the carrier that respectively contains a palindromic loop.Those rings contain unique XbaI site, when with the restricted cutting of Xba I, can select to contain in the frame respectively the V with people κ constant region and the fusion of people the one γ 1 constant region _LAnd V _HThe carrier of two chains (Wu etc., 2003, Methods Mol Biol., 207:197-212; Wu etc., 2003, Methods Mol Biol. 207:213-233), but has consumed the parent template that digests.Then as described (Wu etc., 2003, Methods Mol Biol. 207:197-212) goes into XL1-indigo plant (antibacterial) with synthetic DNA electroporation, forms plaque or produce the Fab fragment on XL1-cyanobacteria lawn.The Fab clone (referring to Fig. 6) of GEA44 light chain and variable heavy chain variable region is expressed in order-checking, by the combine situation of ELISA screening with the EphA4 receptor, has confirmed the binding characteristic (described test vide infra) of this Fab.

Optimize the affinity of FabGEA44 by the brief randomization (parsimonious randomization) in each CDR district.Utilize each amino acid whose two independent library respectively, each aminoacid of all 6 complementary determining regions (CDR) of random mutagenesis (Wu etc., 2003, Methods Mol Biol., 207:197-212).At 8 aminoacid (NSS) of once hybridizing each cdr amino acid position of utilization coding in the mutagenesis reaction or degenerate primer separately (Wu etc., 2003, MethodsMol Biol., the 207:197-212 of 12 aminoacid (NWS); Dall ' Acqua etc., 2005, Methods 36:43-60), makes up then to produce corresponding C DR library.In brief, each degenerate primer of phosphorylation, then with uridnineization (uridinylated) GEA44 Fab (Fab20 hereinafter referred to as) single stranded DNA template (as Wu etc., 2003, Methods Mol Biol., the described preparation of 207:213-233) is used for annealing reaction with 10: 1 ratios, in 1 hour temperature reduced to 55 ℃ from 95 ℃.T4 ligase and T7 archaeal dna polymerase are added in the annealing reaction (system), will react (system) and cultivate 1.5 hours at 37 ℃.Merge each amino acid whose synthetic product of each CDR, yet NSS and NWS library keep separately screening separately.General then as Wu etc., 2003, Methods Mol Biol., the described synthetic DNA electroporation in CDR library that 1 μ l is merged of 207:213-233 go into XL1-indigo plant (antibacterial), form plaque or generation Fab fragment on XL1-cyanobacteria lawn.

The screening library:

Preliminary screening: basically as Wu etc., 2003, Methods Mol Biol., 207:213-233; Dall ' Acqua etc., 2005, Methods, 36:43-60 is described, Preliminary screening comprises with containing the proteic supernatant of excretory solubility Fab carries out single-point ELISA (SPE), and described Fab albumen is cultivated from 96 deep-well plates and cloned the 1ml inoculum that infects with each reorganization M13 and prepares.In brief, this is caught ELISA and comprises with about 20ng goat Anti-Human Fd antibody (BioDesign Saco, ME) bag is by each dull and stereotyped hole of 96 hole Maxisorp immunity, and 37 ℃ with 3%BSA/PBS sealing 2 hours, room temperature and sample (excretory soluble protein) cultivation 2 hours.Add 200ng/ hole biotinylation people EphA4-Fc or EphA4-His then, room temperature (cultivation) 2 hours.(Pierce IL) cultivated 40 minutes at room temperature and neutral Avidin-horseradish peroxidase (HRP) conjugate then.Utilize tetramethyl benzidine (TMB) substrate to detect the HRP activity, use 0.2M H ₂S0 ₄The quencher reaction.Read dull and stereotyped 450nm value.

The result of Preliminary screening: will show that generally OD 450nm signal cultivates with the 15ml scale than the clone of parent Fab 20 high twices at least again, and in two multiple holes, check once more to confirm positive findings by same ELISA.The multiple clone that checks order then adopts active ELISA (seeing below) to detect assessment and the bonded increase multiple of antigen interested.

Screening once more: the variant (seeing above) of the simple point mutation affinity optimization of identifying for further characterized was former, Fab fragment (the Wu etc. that utilization is expressed from the outer pericentral siphon extract of 15ml inoculum preparation, 2003, Methods Mol Biol. 207:213-233) screens once more.Or rather, adopt two kinds of ELISA:(i) active ELISA, by dull and stereotyped each hole of 96 hole Maxisorp immunity, 37 ℃ with 3%BSA/PBS sealing 2 hours with about 1 μ g people EphA4-His bag.The sample that adds 2-times of serial dilution then, room temperature was cultivated 1 hour.The anti-people κ of room temperature and goat horseradish peroxidase (HRP) conjugate is cultivated then.Detect the HRP activity with tmb substrate, use 0.2M H ₂SO ₄The quencher reaction.Reading 450 dull and stereotyped nm values; (ii) basically as Wu etc., 2003, Methods Mol Biol., 207:213-233 is described to carry out anti-human Fab's quantitative ELISA.In brief, (BD Biosciences, CA) (human IgG Fab 1.00-1.56ng/ml) cultivates for the sample of each hole and 2-times serial dilution or standard substance by flat board with 96-hole Bio bag.Cultivate with the anti-people κ of goat horseradish peroxidase (HRP) conjugate then.Detect the HRP activity with tmb substrate, use 0.2M H ₂SO ₄The quencher reaction.Read dull and stereotyped 450nm value.

Results of screening once more: the described two parts of chapters and sections 3.2.1 once more the ELISA screening make we by standardization Fab clone 20 and the Fab concentration of affinity optimization variant come comparison they each other with the situation that combines of people EphA4.Compare with female monoclonal antibody of mAb GEA44, the affinity of all simple point mutations is optimized variant Fab demonstration and is combined better (see figure 7) with people EphA4.

The structure and the characterized of CDR affinity optimization clone combinatory variants: be the further combinatory variants that improves of engineered combination, combination is compared with female monoclonal antibody 20 by active ELISA (evaluation), and improved all single amino acids of adhesion change the little gathering combinatorial library of (variant) combination results.In brief, all amino acid changes that identify of coding and the amino acid whose degenerate primer of female antibody (seeing Figure 11) on same position have been designed.Annealing reaction comprises all primers, and synthetic (seeing above) subsequently makes up combinatorial library and screening (seeing above) as mentioned above.

Result to the EphA4 Preliminary screening: will show that generally OD 450nm signal cultivates with the 15ml scale than the clone of female monoclonal antibody 20 high twices at least again, and check once more to confirm positive findings by ELISA (above-mentioned) (above-mentioned) in two multiple holes.The multiple clone that checks order then adopts active ELISA (seeing above) to detect the increase multiple of estimating with antigen adhesion interested.Therefrom select in 12 kinds of combinatory variants and order-checking, have 9 kinds to have unique cdr amino acid change combination, thereby make each variant that 1-3 aminoacid difference be arranged on the primary sequence level each other.The combinatory variants of doing further 9 kinds of affinity optimizations of assessment is: 1A4,1B10,1D11,1G11,2C9,3A12,3C6,6B7 and 8B4 (seeing Fig. 5 A and 9).

To EphA4 results of screening once more: analyzed combinatory variants by screening once more as mentioned above, assessed the raising of combinatory variants binding affinity.Compare with Fab20, all variants significantly improve (seeing Fig. 8 and 10) to the affinity of people EphA4.

Screen once more with other EphA receptor: because female antibody mAb GEA44 do not combine with people EphA4, also not with multiple EphA receptors bind, adopt active ELISA (seeing above) and various reorganization EphA receptor protein to carry out the another screening test once more of taking turns.Or rather, with following rEphA albumen bag by Nunc Maxisorp flat board: rhuEphA 1-Fc, rmuEphA2-Fc, rmuEphA3-Fc, rmuEphA4-Fc, rratEphA5-Fc, rmuEphA6-Fc, rmuEphA7-Fc, rEphA8; All be that R﹠amp (is all originated from 0.5 μ g/ hole; D Systems); RhuEphA2-Fc, 0.5 μ g/well; And rhuEphA4-His, (the two all originates from MedImmune, Inc.) in 0.1 μ g/ hole.With dull and stereotyped 2 hours of 3%BSA+0.1% polysorbas20 sealing.In a bread board, test the female antibody of all 9 kinds of affinity optimum organization variants (seeing above) and negative control and Fab20 with one of above-mentioned antigen bag quilt, pericentral siphon Fab sample outside undiluted then, with three parts of diluent titration (in duplicate) in continuous 1: 2, room temperature was cultivated 1 hour.Cultivate with the anti-people κ of goat horseradish peroxidase (HRP) conjugate then.Utilize tmb substrate to detect the HRP activity, use 0.2M H ₂SO ₄The quencher reaction.Read dull and stereotyped 450nm value.By with Fab concentration by corresponding activity data standardization post analysis data (seeing Figure 10 B-10H).

Adhesion is analyzed

The mAb GEA44 affinity optimum organization variant of clone, expression and purification human IgG1 form: utilize the pfu archaeal dna polymerase from the M13 phage vector in respective coding V district through the variable region of 9 kinds of combinatory variants of pcr amplification (Dall ' Acqua etc., 2005, Methods, 36:43-60).Then they are cloned into respectively in the mammalian expression vector of mainly early stage immediately (hCMVie) enhancer of coding human cytomegalic inclusion disease virus, promoter and 5 '-untranslated region (M.Boshart etc., 1985, Cell, 41:521-530).In this system, people γ 1 chain with people κ chain secrete (Johnson etc., 1997, Infect.Dis., 176:1215-1224).The different construction of transient expression in HEK 293 cells, transfection 72 and collection after 144 hours.According to manufacturer's operation instructions (APBiotech, Inc., Piscataway, New Jersey), with excretory soluble human IgG1 in the 1ml HiTrap A albumen post direct purification conditioning culture medium.With human IgG1's (judging that through SDS-PAGE homogeneity is usually＞95%) of phosphate-buffered saline (PBS) dialysis purification, after the quick freezing-70 ℃ of preservations.

Screen affinity optimum organization variant IgG construction once more with other EphA receptor: utilize the IgG purification construction of 9 kinds of combinatory variants, adopt active ELISA (seeing above) and reorganization EphA receptor protein to carry out the another screening test once more of taking turns.Or rather, with following rEphA albumen bag by NuncMaxisorp flat board: rhuEphA1-Fc, 0.5 μ g/ hole; RmuEphA2-Fc, 0.5 μ g/ hole; RmuEphA3-Fc, 0.1 μ g/ hole; RmuEphA4-Fc, 0.1 μ g/ hole; RratEphA5-Fc, 0.5 μ g/ hole; RmuEphA6-Fc, 0.5 μ g/ hole; RmuEphA7-Fc, 0.1 μ g/ hole; REphA8, R﹠amp (is all originated from 0.2 μ g/ hole; D Systems); RhuEphA2-Fc, 0.5 μ g/ hole; And rhuEphA4-His, (the two all originates from MedImmune, Inc.) in 0.1 μ g/ hole.With dull and stereotyped 2 hours of 3%BSA+0.1% polysorbas20 sealing.In a bread board, test all 9 kinds of affinity optimum organization variants (seeing above) and negative control and female antibody mAb GEA44 with one of above-mentioned antigen bag quilt, then since the IgG of 1 μ g/ml purification, with three parts of diluent titration (in duplicate) in continuous 1: 2, room temperature was cultivated 1 hour.Cultivate with the anti-people κ of goat horseradish peroxidase (HRP) conjugate then.Utilize tmb substrate to detect the HRP activity, use 0.2M H ₂SO ₄The quencher reaction.Read dull and stereotyped 450nm value.With Fab concentration according to corresponding activity data standardization post analysis data (seeing Figure 12 A-10J and 14).These methods obtain the binding specificity of the receptor Eph family antibody through specific modification.

Embodiment 2

Adopt method provided herein or other method generation well known by persons skilled in the art antibody, for example RTK classification I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVII, XVIII or XIX at a kind of member in RTK receptor family/classification.Other is known as provided herein or those skilled in the art, but the CDR of randomization antibody produces library (for example, combinatorial library).From this library, deduct the RTK member originally who produces female antibody then.Screen in the subtracted library a plurality of members' the situation that combines in the RTK interested and a class RTK receptor family then.Screen the binding specificity of this subtracted library to RTK interested again, gained antibody has the binding specificity of specific modification to a plurality of members in the class RTK receptor family.

Embodiment 3

Adopt method provided herein or other method well known by persons skilled in the art to produce at, a plurality of members' general specific antibody in RTK classification I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVII, XVIII or the XIX for example.Other is known as provided herein or those skilled in the art, but the CDR of the general specific antibody of randomization produces library (for example, combinatorial library).From this library, do not wish this antibody bonded with it given (or several) RTK member in this classification of deduction then.Screen the binding specificity of the library of this deduction to RTK interested then, gained antibody has the binding specificity of specific modification to a plurality of members in the class RTK receptor family.

Embodiment 4

Adopt method provided herein or other method well known by persons skilled in the art to produce at, a plurality of members' general specific antibody in RTK classification I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVII, XVIII or the XIX for example.Other is known as provided herein or those skilled in the art, but the CDR of the general specific antibody of randomization produces library (for example, combinatorial library).Directly select then in this combinatorial library at as in conjunction with one or more RTK of required target (antibody), gained antibody has the binding specificity of specific modification to a plurality of members in the class RTK receptor family.

Embodiment 5

Adopt method provided herein or other method well known by persons skilled in the art to produce at, a plurality of members' general specific antibody in RTK classification I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, XIV, XV, XVI, XVII, XVIII or the XIX for example.According to the described step of above-mentioned arbitrary embodiment, a step uses CDR library separately to substitute the combinatorial library that relates to, and the antibody of gained has the binding specificity of specific modification to a plurality of members in the class RTK receptor family.

7. Equivalents

Many equivalents of the specific embodiment that those skilled in the art only adopt normal experiment just to know maybe to determine invention described herein.This equivalents will be included in following claims.Special and show separately for all purposes and include this paper in full in as a reference that all lists of references that this paper quotes are all included this paper in as a reference in full for all purposes as every part of independent publication, patent or patent application.

The present invention is not limited to the specific embodiment as herein described.In fact, those skilled in the art are by above describing and accompanying drawing is known improved form various of the present invention except that described herein.This improved form belongs to the scope of additional claims.

Sequence table

＜110〉Med Muniz Co., Ltd (MedImmune)

W. Da Lakua (Dall ' Acqua, William)

M. Dai Mushiluode (Damschroder, Melissa)

M. gold strange (Kinch, Michael)

K. Ka Laisi-Ke Niqi (Carles-Kinch, Kelly)

＜120〉specificity of antibody is regulated in specific modification to the affinity of related antigen

<130>EP700PCT

<150>60/622.711

<151>2004-10-27

<150>60/717.209

<151>2005-09-16

<160>205

<170>PatentIn version 3.3

<210>1

<211>2931

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>1

atggagcggc gctggcccct ggggctaggg ctggtgctgc tgctctgcgc cccgctgccc 60

ccgggggcgc gcgccaagga agttactctg atggacacaa gcaaggcaca gggagagctg 120

ggctggctgc tggatccccc aaaagatggg tggagtgaac agcaacagat actgaatggg 180

acacccctgt acatgtacca ggactgccca atgcaaggac gcagagacac tgaccactgg 240

cttcgctcca attggatcta ccgcggggag gaggcttccc gcgtccacgt ggagctgcag 300

ttcaccgtgc gggactgcaa gagtttccct gggggagccg ggcctctggg ctgcaaggag 360

accttcaacc ttctgtacat ggagagtgac caggatgtgg gcattcagct ccgacggccc 420

ttgttccaga aggtaaccac ggtggctgca gaccagagct tcaccattcg agaccttgcg 480

tctggctccg tgaagctgaa tgtggagcgc tgctctctgg gccgcctgac ccgccgtggc 540

ctctacctcg ctttccacaa cccgggtgcc tgtgtggccc tggtgtctgt ccgggtcttc 600

taccagcgct gtcctgagac cctgaatggc ttggcccaat tcccagacac tctgcctggc 660

cccgctgggt tggtggaagt ggcggggacc tgcttgcccc acgcgcgggc cagccccagg 720

ccctcaggtg caccccgcat gcactgcagc cctgatggcg agtggctggt gcctgtagga 780

cggtgccact gtgagcctgg ctatgaggaa ggtggcagtg gcgaagcatg tgttgcctgc 840

cctagcggct cctaccggat ggacatggac acaccccatt gtctcacgtg cccccagcag 900

agcactgctg agtctgaggg ggccaccatc tgtacctgtg agagcggcca ttacagagct 960

cccggggagg gcccccaggt ggcatgcaca ggtcccccct cggccccccg aaacctgagc 1020

ttctctgcct cagggactca gctctccctg cgttgggaac ccccagcaga tacgggggga 1080

cgccaggatg tcagatacag tgtgaggtgt tcccagtgtc agggcacagc acaggacggg 1140

gggccctgcc agccctgtgg ggtgggcgtg cacttctcgc cgggggcccg ggcgctcacc 1200

acacctgcag tgcatgtcaa tggccttgaa ccttatgcca actacacctt taatgtggaa 1260

gcccaaaatg gagtgtcagg gctgggcagc tctggccatg ccagcacctc agtcagcatc 1320

agcatggggc atgcagagtc actgtcaggc ctgtctctga gactggtgaa gaaagaaccg 1380

aggcaactag agctgacctg ggcggggtcc cggccccgaa gccctggggc gaacctgacc 1440

tatgagctgc acgtgctgaa ccaggatgaa gaacggtacc agatggttct agaacccagg 1500

gtcttgctga cagagctgca gcctgacacc acatacatcg tcagagtccg aatgctgacc 1560

ccactgggtc ctggcccttt ctcccctgat catgagtttc ggaccagccc accagtgtcc 1620

aggggcctga ctggaggaga gattgtagcc gtcatctttg ggctgctgct tggtgcagcc 1680

ttgctgcttg ggattctcgt tttccggtcc aggagagccc agcggcagag gcagcagagg 1740

cagcgtgacc gcgccaccga tgtggatcga gaggacaagc tgtggctgaa gccttatgtg 1800

gacctccagg catacgagga ccctgcacag ggagccttgg actttacccg ggagcttgat 1860

ccagcgtggc tgatggtgga cactgtcata ggagaaggag agtttgggga agtgtatcga 1920

gggaccctga ggctccccag ccaggactgc aagactgtgg ccattaagac cttaaaagac 1980

acatccccag gtggccagtg gtggaacttc cttcgagagg caactatcat gggccagttt 2040

agccacccgc atattctgca tctggaaggc gtcgtcacaa agcgaaagcc gatcatgatc 2100

atcacagaat ttatggagaa tggagccctg gatgccttcc tgagggagcg ggaggaccag 2160

ctggtccctg ggcagctagt ggccatgctg cagggcatag catctggcat gaactacctc 2220

agtaatcaca attatgtcca ccgggacctg gctgccagaa acatcttggt gaatcaaaac 2280

ctgtgctgca aggtgtctga ctttggcctg actcgcctcc tggatgactt tgatggcaca 2340

tacgaaaccc agggaggaaa gatccctatc cgttggacag cccctgaagc cattgcccat 2400

cggatcttca ccacagccag cgatgtgtgg agctttggga ttgtgatgtg ggaggtgctg 2460

agctttgggg acaagcctta tggggagatg agcaatcagg aggttatgaa gagcattgag 2520

gatgggtacc ggttgccccc tcctgtggac tgccctgccc ctctgtatga gctcatgaag 2580

aactgctggg catatgaccg tgcccgccgg ccacacttcc agaagcttca ggcacatctg 2640

gagcaactgc ttgccaaccc ccactccctg cggaccattg ccaactttga ccccagggtg 2700

actcttcgcc tgcccagcct gagtggctca gatgggatcc cgtatcgaac cgtctctgag 2760

tggctcgagt ccatacgcat gaaacgctac atcctgcact tccactcggc tgggetggac 2820

accatggagt gtgtgctgga gctgaccgct gaggacctga cgcagatggg aatcacactg 2880

cccgggcacc agaagcgcat tctttgcagt attcagggat tcaaggactg a 2931

<210>2

<211>976

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(27)...(204)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(333)...(440)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(453)...(535)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(618)...(883)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(911)...(975)

＜223〉SAM domain (invalid α motif)

<400>2

Met Glu Arg Arg Trp Pro Leu Gly Leu Gly Leu Val Leu Leu Leu Cys

1 5 10 15

Ala Pro Leu Pro Pro Gly Ala Arg Ala Lys Glu Val Thr Leu Met Asp

20 25 30

Thr Ser Lys Ala Gln Gly Glu Leu Gly Trp Leu Leu Asp Pro Pro Lys

35 40 45

Asp Gly Trp Ser Glu Gln Gln Gln Ile Leu Asn Gly Thr Pro Leu Tyr

50 55 60

Met Tyr Gln Asp Cys Pro Met Gln Gly Arg Arg Asp Thr Asp His Trp

65 70 75 80

Leu Arg Ser Asn Trp Ile Tyr Arg GIy Glu Glu Ala Ser Arg Val His

85 90 95

Val Glu Leu Gln Phe Thr Val Arg Asp Cys Lys Ser Phe Pro Gly Gly

100 105 110

Ala Gly Pro Leu Gly Cys Lys Glu Thr Phe Asn Leu Leu Tyr Met Glu

115 120 125

Ser Asp Gln Asp Val Gly Ile Gln Leu Arg Arg Pro Leu Phe Gln Lys

130 135 140

Val Thr Thr Val Ala Ala Asp Gln Ser Phe Thr Ile Arg Asp Leu Ala

145 150 155 160

Ser Gly Ser Val Lys Leu Asn Val Glu Arg Cys Ser Leu Gly Arg Leu

165 170 175

Thr Arg Arg Gly Leu Tyr Leu Ala Phe His Asn Pro Gly Ala Cys Val

180 185 190

Ala Leu Val Ser Val Arg Val Phe Tyr Gln Arg Cys Pro Glu Thr Leu

195 200 205

Asn Gly Leu Ala Gln Phe Pro Asp Thr Leu Pro Gly Pro Ala Gly Leu

210 215 220

Val Glu Val Ala Gly Thr Cys Leu Pro His Ala Arg Ala Ser Pro Arg

225 230 235 240

Pro Ser Gly Ala Pro Arg Met His Cys Ser Pro Asp Gly Glu Trp Leu

245 250 255

Val Pro Val Gly Arg Cys His Cys Glu Pro Gly Tyr Glu Glu Gly Gly

260 265 270

Ser Gly Glu Ala Cys Val Ala Cys Pro Ser Gly Ser Tyr Arg Met Asp

275 280 285

Met Asp Thr Pro His Cys Leu Thr Cys Pro Gln Gln Ser Thr Ala Glu

290 295 300

Ser Glu Gly Ala Thr Ile Cys Thr Cys Glu Ser Gly His Tyr Arg Ala

305 310 315 320

Pro Gly Glu Gly Pro Gln Val Ala Cys Thr Gly Pro Pro Ser Ala Pro

325 330 335

Arg Asn Leu Ser Phe Ser Ala Ser Gly Thr Gln Leu Ser Leu Arg Trp

340 345 350

Glu Pro Pro Ala Asp Thr Gly Gly Arg Gln Asp Val Arg Tyr Ser Val

355 360 365

Arg Cys Ser Gln Cys Gln Gly Thr Ala Gln Asp Gly Gly Pro Cys Gln

370 375 380

Pro Cys Gly Val Gly Val His Phe Ser Pro Gly Ala Arg Ala Leu Thr

385 390 395 400

Thr Pro Ala Val His Val Asn Gly Leu Glu Pro Tyr Ala Asn Tyr Thr

405 410 415

Phe Asn Val Glu Ala Gln Asn Gly Val Ser Gly Leu Gly Ser Ser Gly

420 425 430

His Ala Ser Thr Ser Val Ser Ile Ser Met Gly His Ala Glu Ser Leu

435 440 445

Ser Gly Leu Ser Leu Arg Leu Val Lys Lys Glu Pro Arg Gln Leu Glu

450 455 460

Leu Thr Trp Ala Gly Ser Arg Pro Arg Ser Pro Gly Ala Asn Leu Thr

465 470 475 480

Tyr Glu Leu His Val Leu Asn Gln Asp Glu Glu Arg Tyr Gln Met Val

485 490 495

Leu Glu Pro Arg Val Leu Leu Thr Glu Leu Gln Pro Asp Thr Thr Tyr

500 505 510

Ile Val Arg Val Arg Met Leu Thr Pro Leu Gly Pro Gly Pro Phe Ser

515 520 525

Pro Asp His Glu Phe Arg Thr Ser Pro Pro Val Ser Arg Gly Leu Thr

530 535 540

Gly Gly Glu Ile Val Ala Val Ile Phe Gly Leu Leu Leu Gly Ala Ala

545 550 555 560

Leu Leu Leu Gly Ile Leu Val Phe Arg Ser Arg Arg Ala Gln Arg Gln

565 570 575

Arg Gln Gln Arg Gln Arg Asp Arg Ala Thr Asp Val Asp Arg Glu Asp

580 585 590

Lys Leu Trp Leu Lys Pro Tyr Val Asp Leu Gln Ala Tyr Glu Asp Pro

595 600 605

Ala Gln Gly Ala Leu Asp Phe Thr Arg Glu Leu Asp Pro Ala Trp Leu

610 615 620

Met Val Asp Thr Val Ile Gly Glu Gly Glu Phe Gly Glu Val Tyr Arg

625 630 635 640

Gly Thr Leu Arg Leu Pro Ser Gln Asp Cys Lys Thr Val Ala Ile Lys

645 650 655

Thr Leu Lys Asp Thr Ser Pro Gly Gly Gln Trp Trp Asn Phe Leu Arg

660 665 670

Glu Ala Thr Ile Met Gly Gln Phe Ser His Pro His Ile Leu His Leu

675 680 685

Glu Gly Val Val Thr Lys Arg Lys Pro Ile Met Ile Ile Thr Glu Phe

690 695 700

Met Glu Asn Gly Ala Leu Asp Ala Phe Leu Arg Glu Arg Glu Asp Gln

705 710 715 720

Leu Val Pro Gly Gln Leu Val Ala Met Leu Gln Gly Ile Ala Ser Gly

725 730 735

Met Asn Tyr Leu Ser Asn His Asn Tyr Val His Arg Asp Leu Ala Ala

740 745 750

Arg Asn Ile Leu Val Asn Gln Asn Leu Cys Cys Lys Val Ser Asp Phe

755 760 765

Gly Leu Thr Arg Leu Leu Asp Asp Phe Asp Gly Thr Tyr Glu Thr Gln

770 775 780

Gly Gly Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Ala His

785 790 795 800

Arg Ile Phe Thr Thr Ala Ser Asp Val Trp Ser Phe Gly Ile Val Met

805 810 815

Trp Glu Val Leu Ser Phe Gly Asp Lys Pro Tyr Gly Glu Met Ser Asn

820 825 830

Gln Glu Val Met Lys Ser Ile Glu Asp Gly Tyr Arg Leu Pro Pro Pro

835 840 845

Val Asp Cys Pro Ala Pro Leu Tyr Glu Leu Met Lys Asn Cys Trp Ala

850 855 860

Tyr Asp Arg Ala Arg Arg Pro His Phe Gln Lys Leu Gln Ala His Leu

865 870 875 880

Glu Gln Leu Leu Ala Asn Pro His Ser Leu Arg Thr Ile Ala Asn Phe

885 890 895

Asp Pro Arg Val Thr Leu Arg Leu Pro Ser Leu Ser Gly Ser Asp Gly

900 905 910

Ile Pro Tyr Arg Thr Val Ser Glu Trp Leu Glu Ser Ile Arg Met Lys

915 920 925

Arg Tyr Ile Leu His Phe His Ser Ala Gly Leu Asp Thr Met Glu Cys

930 935 940

Val Leu Glu Leu Thr Ala Glu Asp Leu Thr Gln Met Gly Ile Thr Leu

945 950 955 960

Pro Gly His Gln Lys Arg Ile Leu Cys Ser Ile Gln Gly Phe Lys Asp

965 970 975

<210>3

<211>2931

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>3

atggagctcc aggcagcccg cgcctgcttc gccctgctgt ggggctgtgc gctggccgcg 60

gccgcggcgg cgcagggcaa ggaagtggta ctgctggact ttgctgcagc tggaggggag 120

ctcggctggc tcacacaccc gtatggcaaa gggtgggacc tgatgcagaa catcatgaat 180

gacatgccga tctacatgta ctccgtgtgc aacgtgatgt ctggcgacca ggacaactgg 240

ctccgcacca actgggtgta ccgaggagag gctgagcgta tcttcattga gctcaagttt 300

actgtacgtg actgcaacag cttccctggt ggcgccagct cctgcaagga gactttcaac 360

ctctactatg ccgagtcgga cctggactac ggcaccaact tccagaagcg cctgttcacc 420

aagattgaca ccattgcgcc cgatgagatc accgtcagca gcgacttcga ggcacgccac 480

gtgaagctga acgtggagga gcgctccgtg gggccgctca cccgcaaagg cttctacctg 540

gccttccagg atatcggtgc ctgtgtggcg ctgctctccg tccgtgtcta ctacaagaag 600

tgccccgagc tgctgcaggg cctggcccac ttccctgaga ccatcgccgg ctctgatgca 660

ccttccctgg ccactgtggc cggcacctgt gtggaccatg ccgtggtgcc accggggggt 720

gaagagcccc gtatgcactg tgcagtggat ggcgagtggc tggtgcccat tgggcagtgc 780

ctgtgccagg caggctacga gaaggtggag gatgcctgcc aggcctgctc gcctggattt 840

tttaagtttg aggcatctga gagcccctgc ttggagtgcc ctgagcacac gctgccatcc 900

cctgagggtg ccacctcctg cgagtgtgag gaaggcttct tccgggcacc tcaggaccca 960

gcgtcgatgc cttgcacacg acccccctcc gccccacact acctcacagc cgtgggcatg 1020

ggtgccaagg tggagctgcg ctggacgccc cctcaggaca gcgggggccg cgaggacatt 1080

gtctacagcg tcacctgcga acagtgctgg cccgagtctg gggaatgcgg gccgtgtgag 1140

gccagtgtgc gctactcgga gcctcctcac ggactgaccc gcaccagtgt gacagtgagc 1200

gacctggagc cccacatgaa ctacaccttc accgtggagg cccgcaatgg cgtctcaggc 1260

ctggtaacca gccgcagctt ccgtactgcc agtgtcagca tcaaccagac agagcccccc 1320

aaggtgaggc tggagggccg cagcaccacc tcgcttagcg tctcctggag catccccccg 1380

ccgcagcaga gccgagtgtg gaagtacgag gtcacttacc gcaagaaggg agactccaac 1440

agctacaatg tgcgccgcac cgagggtttc tccgtgaccc tggacgacct ggccccagac 1500

accacctacc tggtccaggt gcaggcactg acgcaggagg gccagggggc cggcagcaag 1560

gtgcacgaat tccagacgct gtccccggag ggatctggca acttggcggt gattggcggc 1620

gtggctgtcg gtgtggtcct gcttctggtg ctggcaggag ttggcttctt tatccaccgc 1680

aggaggaaga accagcgtgc ccgccagtcc ccggaggacg tttacttctc caagtcagaa 1740

caactgaagc ccctgaagac atacgtggac ccccacacat atgaggaccc caaccaggct 1800

gtgttgaagt tcactaccga gatccatcca tcctgtgtca ctcggcagaa ggtgatcgga 1860

gcaggagagt ttggggaggt gtacaagggc atgctgaaga catcctcggg gaagaaggag 1920

gtgccggtgg ccatcaagac gctgaaagcc ggctacacag agaagcagcg agtggacttc 1980

ctcggcgagg ccggcatcat gggccagttc agccaccaca acatcatccg cctagagggc 2040

gtcatctcca aatacaagcc catgatgatc atcactgagt acatggagaa tggggccctg 2100

gacaagttcc ttcgggagaa ggatggcgag ttcagcgtgc tgcagctggt gggcatgctg 2160

cggggcatcg cagctggcat gaagtacctg gccaacatga actatgtgca ccgtgacctg 2220

gctgcccgca acatcctcgt caacagcaac ctggtctgca aggtgtctga ctttggcctg 2280

tcccgcgtgc tggaggacga ccccgaggcc acctacacca ccagtggcgg caagatcccc 2340

atccgctgga ccgccccgga ggccatttcc taccggaagt tcacctctgc cagcgacgtg 2400

tggagctttg gcattgtcat gtgggaggtg atgacctatg gcgagcggcc ctactgggag 2460

ttgtccaacc acgaggtgat gaaagccatc aatgatggct tccggctccc cacacccatg 2520

gactgcccct ccgccatcta ccagctcatg atgcagtgct ggcagcagga gcgtgcccgc 2580

cgccccaagt tcgctgacat cgtcagcatc ctggacaagc tcattcgtgc ccctgactcc 2640

ctcaagaccc tggctgactt tgacccccgc gtgtctatcc ggctccccag cacgagcggc 2700

tcggaggggg tgcccttccg cacggtgtcc gagtggctgg agtccatcaa gatgcagcag 2760

tatacggagc acttcatggc ggccggctac actgccatcg agaaggtggt gcagatgacc 2820

aacgacgaca tcaagaggat tggggtgcgg ctgcccggcc accagaagcg catcgcctac 2880

agcctgctgg gactcaagga ccaggtgaac actgtgggga tccccatctg a 2931

<210>4

<211>976

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(28)...(201)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(332)...(424)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(439)...(519)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(607)...(874)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(902)...(968)

＜223〉SAM domain (invalid α motif)

<400>4

Met Glu Leu Gln Ala Ala Arg Ala Cys Phe Ala Leu Leu Trp Gly Cys

1 5 10 15

Ala Leu Ala Ala Ala Ala Ala Ala Gln Gly Lys Glu Val Val Leu Leu

20 25 30

Asp Phe Ala Ala Ala Gly Gly Glu Leu Gly Trp Leu Thr His Pro Tyr

35 40 45

Gly Lys Gly Trp Asp Leu Met Gln Asn Ile Met Asn Asp Met Pro Ile

50 55 60

Tyr Met Tyr Ser Val Cys Asn Val Met Ser Gly Asp Gln Asp Asn Trp

65 70 75 80

Leu Arg Thr Asn Trp Val Tyr Arg Gly Glu Ala Glu Arg Ile Phe Ile

85 90 95

Glu Leu Lys Phe Thr Val Arg Asp Cys Asn Ser Phe Pro Gly Gly Ala

100 105 110

Ser Ser Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Ala Glu Ser Asp Leu

115 120 125

Asp Tyr Gly Thr Asn Phe Gln Lys Arg Leu Phe Thr Lys Ile Asp Thr

130 135 140

Ile Ala Pro Asp Glu Ile Thr Val Ser Ser Asp Phe Glu Ala Arg His

145 150 155 160

Val Lys Leu Asn Val Glu Glu Arg Ser Val Gly Pro Leu Thr Arg Lys

165 170 175

Gly Phe Tyr Leu Ala Phe Gln Asp Ile Gly Ala Cys Val Ala Leu Leu

180 185 190

Ser Val Arg Val Tyr Tyr Lys Lys Cys Pro Glu Leu Leu Gln Gly Leu

195 200 205

Ala His Phe Pro Glu Thr Ile Ala Gly Ser Asp Ala Pro Ser Leu Ala

210 215 220

Thr Val Ala Gly Thr Cys Val Asp His Ala Val Val Pro Pro Gly Gly

225 230 235 240

Glu Glu Pro Arg Met His Cys Ala Val Asp Gly Glu Trp Leu Val Pro

245 250 255

Ile Gly Gln Cys Leu Cys Gln Ala Gly Tyr Glu Lys Val Glu Asp Ala

260 265 270

Cys Gln Ala Cys Ser Pro Gly Phe Phe Lys Phe Glu Ala Ser Glu Ser

275 280 285

Pro Cys Leu Glu Cys Pro Glu His Thr Leu Pro Ser Pro Glu Gly Ala

290 295 300

Thr Ser Cys Glu Cys Glu Glu Gly Phe Phe Arg Ala Pro Gln Asp Pro

305 310 315 320

Ala Ser Met Pro Cys Thr Arg Pro Pro Ser Ala Pro His Tyr Leu Thr

325 330 335

Ala Val Gly Met Gly Ala Lys Val Glu Leu Arg Trp Thr Pro Pro Gln

340 345 350

Asp Ser Gly Gly Arg Glu Asp Ile Val Tyr Ser Val Thr Cys Glu Gln

355 360 365

Cys Trp Pro Glu Ser Gly Glu Cys Gly Pro Cys Glu Ala Ser Val Arg

370 375 380

Tyr Ser Glu Pro Pro His Gly Leu Thr Arg Thr Ser Val Thr Val Ser

385 390 395 400

Asp Leu Glu Pro His Met Asn Tyr Thr Phe Thr Val Glu Ala Arg Asn

405 410 415

Gly Val Ser Gly Leu Val Thr Ser Arg Ser Phe Arg Thr Ala Ser Val

420 425 430

Ser Ile Asn Gln Thr Glu Pro Pro Lys Val Arg Leu Glu Gly Arg Ser

435 440 445

Thr Thr Ser Leu Ser Val Ser Trp Ser Ile Pro Pro Pro Gln Gln Ser

450 455 460

Arg Val Trp Lys Tyr Glu Val Thr Tyr Arg Lys Lys Gly Asp Ser Asn

465 470 475 480

Ser Tyr Asn Val Arg Arg Thr Glu Gly Phe Ser Val Thr Leu Asp Asp

485 490 495

Leu Ala Pro Asp Thr Thr Tyr Leu Val Gln Val Gln Ala Leu Thr Gln

500 505 510

Glu Gly Gln Gly Ala Gly Ser Lys Val His Glu Phe Gln Thr Leu Ser

515 520 525

Pro Glu Gly Ser Gly Asn Leu Ala Val Ile Gly Gly Val Ala Val Gly

530 535 540

Val Val Leu Leu Leu Val Leu Ala Gly Val Gly Phe Phe Ile His Arg

545 550 555 560

Arg Arg Lys Asn Gln Arg Ala Arg Gln Ser Pro Glu Asp Val Tyr Phe

565 570 575

Ser Lys Ser Glu Gln Leu Lys Pro Leu Lys Thr Tyr Val Asp Pro His

580 585 590

Thr Tyr Glu Asp Pro Asn Gln Ala Val Leu Lys Phe Thr Thr Glu Ile

595 600 605

His Pro Ser Cys Val Thr Arg Gln Lys Val Ile Gly Ala Gly Glu Phe

610 615 620

Gly Glu Val Tyr Lys Gly Met Leu Lys Thr Ser Ser Gly Lys Lys Glu

625 630 635 640

Val Pro Val Ala Ile Lys Thr Leu Lys Ala Gly Tyr Thr Glu Lys Gln

645 650 655

Arg Val Asp Phe Leu Gly Glu Ala Gly Ile Met Gly Gln Phe Ser His

660 665 670

His Asn Ile Ile Arg Leu Glu Gly Val Ile Ser Lys Tyr Lys Pro Met

675 680 685

Met Ile Ile Thr Glu Tyr Met Glu Asn Gly Ala Leu Asp Lys Phe Leu

690 695 700

Arg Glu Lys Asp Gly Glu Phe Ser Val Leu Gln Leu Val Gly Met Leu

705 710 715 720

Arg Gly Ile Ala Ala Gly Met Lys Tyr Leu Ala Asn Met Asn Tyr Val

725 730 735

His Arg Asp Leu Ala Ala Arg Asn Ile Leu Val Asn Ser Asn Leu Val

740 745 750

Cys Lys Val Ser Asp Phe Gly Leu Ser Arg Val Leu Glu Asp Asp Pro

755 760 765

Glu Ala Thr Tyr Thr Thr Ser Gly Gly Lys Ile Pro Ile Arg Trp Thr

770 775 780

Ala Pro Glu Ala Ile Ser Tyr Arg Lys Phe Thr Ser Ala Ser Asp Val

785 790 795 800

Trp Ser Phe Gly Ile Val Met Trp Glu Val Met Thr Tyr Gly Glu Arg

805 810 815

Pro Tyr Trp Glu Leu Ser Asn His Glu Val Met Lys Ala Ile Asn Asp

820 825 830

Gly Phe Arg Leu Pro Thr Pro Met Asp Cys Pro Ser Ala Ile Tyr Gln

835 840 845

Leu Met Met Gln Cys Trp Gln Gln Glu Arg Ala Arg Arg Pro Lys Phe

850 855 860

Ala Asp Ile Val Ser Ile Leu Asp Lys Leu Ile Arg Ala Pro Asp Ser

865 870 875 880

Leu Lys Thr Leu Ala Asp Phe Asp Pro Arg Val Ser Ile Arg Leu Pro

885 890 895

Ser Thr Ser Gly Ser Glu Gly Val Pro Phe Arg Thr Val Ser Glu Trp

900 905 910

Leu Glu Ser Ile Lys Met Gln Gln Tyr Thr Glu His Phe Met Ala Ala

915 920 925

Gly Tyr Thr Ala Ile Glu Lys Val Val Gln Met Thr Asn Asp Asp Ile

930 935 940

Lys Arg Ile Gly Val Arg Leu Pro Gly His Gln Lys Arg Ile Ala Tyr

945 950 955 960

Ser Leu Leu Gly Leu Lys Asp Gln Val Asn Thr Val Gly Ile Pro lle

965 970 975

<210>5

<211>2952

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>5

atggattgtc agctctccat cctcctcctt ctcagctgct ctgttctcga cagcttcggg 60

gaactgattc cgcagccttc caatgaagtc aatctactgg attcaaaaac aattcaaggg 120

gagctgggct ggatctctta tccatcacat gggtgggaag agatcagtgg tgtggatgaa 180

cattacacac ccatcaggac ttaccaggtg tgcaatgtca tggaccacag tcaaaacaat 240

tggctgagaa caaactgggt ccccaggaac tcagctcaga agatttatgt ggagctcaag 300

ttcactctac gagactgcaa tagcattcca ttggttttag gaacttgcaa ggagacattc 360

aacctgtact acatggagtc tgatgatgat catggggtga aatttcgaga gcatcagttt 420

acaaagattg acaccattgc agctgatgaa agtttcactc aaatggatct tggggaccgt 480

attctgaagc tcaacactga gattagagaa gtaggtcctg tcaacaagaa gggattttat 540

ttggcatttc aagatgttgg tgcttgtgtt gccttggtgt ctgtgagagt atacttcaaa 600

aagtgcccat ttacagtgaa gaatctggct atgtttccag acacggtacc catggactcc 660

cagtccctgg tggaggttag agggtcttgt gtcaacaatt ctaaggagga agatcctcca 720

aggatgtact gcagtacaga aggcgaatgg cttgtaccca ttggcaagtg ttcctgcaat 780

gctggctatg aagaaagagg ttttatgtgc caagcttgtc gaccaggttt ctacaaggca 840

ttggatggta atatgaagtg tgctaagtgc ccgcctcaca gttctactca ggaagatggt 900

tcaatgaact gcaggtgtga gaataattac ttccgggcag acaaagaccc tccatccatg 960

gcttgtaccc gacctccatc ttcaccaaga aatgttatct ctaatataaa cgagacctca 1020

gttatcctgg actggagttg gcccctggac acaggaggcc ggaaagatgt taccttcaac 1080

atcatatgta aaaaatgtgg gtggaatata aaacagtgtg agccatgcag cccaaatgtc 1140

cgcttcctcc ctcgacagtt tggactcacc aacaccacgg tgacagtgac agaccttctg 1200

gcacatacta actacacctt tgagattgat gccgttaatg gggtgtcaga gctgagctcc 1260

ccaccaagac agtttgctgc ggtcagcatc acaactaatc aggctgctcc atcacctgtc 1320

ctgacgatta agaaagatcg gacctccaga aatagcatct ctttgtcctg gcaagaacct 1380

gaacatccta atgggatcat attggactac gaggtcaaat actatgaaaa gcaggaacaa 1440

gaaacaagtt ataccattct gagggcaaga ggcacaaatg ttaccatcag tagcctcaag 1500

cctgacacta tatacgtatt ccaaatccga gcccgaacag ccgctggata tgggacgaac 1560

agccgcaagt ttgagtttga aactagtcca gactctttct ccatctctgg tgaaagtagc 1620

caagtggtca tgatcgccat ttcagcggca gtagcaatta ttctcctcac tgttgtcatc 1680

tatgttttga ttgggaggtt ctgtggctat aagtcaaaac atggggcaga tgaaaaaaga 1740

cttcattttg gcaatgggca tttaaaactt ccaggtctca ggacttatgt tgacccacat 1800

acatatgaag accctaccca agctgttcat gagtttgcca aggaattgga tgccaccaac 1860

atatccattg ataaagttgt tggagcaggt gaatttggag aggtgtgcag tggtcgctta 1920

aaacttcctt caaaaaaaga gatttcagtg gccattaaga ccctgaaagt tggctacaca 1980

gaaaagcaga ggagagactt cctgggagaa gcaagcatta tgggacagtt tgaccacccc 2040

aatatcattc gactggaagg agttgttacc aaaagtaagc cagttatgat tgtcacagaa 2100

tacatggaga atggttcctt ggatagtttc ctacgtaaac acgatgccca gtttactgtc 2160

attcagctag tggggatgct tcgagggata gcatctggca tgaagtacct gtcagacatg 2220

ggctatgttc accgagacct cgctgctcgg aacatcttga tcaacagtaa cttggtgtgt 2280

aaggtttctg atttcggact ttcgcgtgtc ctggaggatg acccagaagc tgcttataca 2340

acaagaggag ggaagatccc aatcaggtgg acatcaccag aagctatagc ctaccgcaag 2400

ttcacgtcag ccagcgatgt atggagttat gggattgttc tctgggaggt gatgtcttat 2460

ggagagagac catactggga gatgtccaat caggatgtaa ttaaagctgt agatgagggc 2520

tatcgactgc caccccccat ggactgccca gctgccttgt atcagctgat gctggactgc 2580

tggcagaaag acaggaacaa cagacccaag tttgagcaga ttgttagtat tctggacaag 2640

cttatccgga atcccggcag cctgaagatc atcaccagtg cagccgcaag gccatcaaac 2700

cttcttctgg accaaagcaa tgtggatatc actaccttcc gcacaacagg tgactggctt 2760

aatggtgtct ggacagcaca ctgcaaggaa atcttcacgg gtgtggagta cagttcttgt 2820

gacacaatag ccaagatttc cacagatgac atgaaaaagg ttggtgtcac cgtggttggg 2880

ccacagaaga agatcatcag tagcattaaa gctctagaaa cgcaatcaaa gaatggccca 2940

gttcccgtgt aa 2952

<210>6

<211>983

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(28)...(202)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(326)...(421)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(437)...(528)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(615)...(881)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(912)...(973)

＜223〉SAM domain (invalid α motif)

<400>6

Met Asp Cys Gln Leu Ser Ile Leu Leu Leu Leu Ser Cys Ser Val Leu

1 5 10 15

Asp Ser Phe Gly Glu Leu Ile Pro Gln Pro Ser Asn Glu Val Asn Leu

20 25 30

Leu Asp Ser Lys Thr Ile Gln Gly Glu Leu Gly Trp Ile Ser Tyr Pro

35 40 45

Ser His Gly Trp Glu Glu Ile Ser Gly Val Asp Glu His Tyr Thr Pro

50 55 60

Ile Arg Thr Tyr Gln Val Cys Asn Val Met Asp His Ser Gln Asn Asn

65 70 75 80

Trp Leu Arg Thr Asn Trp Val Pro Arg Asn Ser Ala Gln Lys Ile Tyr

85 90 95

Val Glu Leu Lys Phe Thr Leu Arg Asp Cys Asn Ser Ile Pro Leu Val

100 105 110

Leu Gly Thr Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Met Glu Ser Asp

115 120 125

Asp Asp His Gly Val Lys Phe Arg Glu His Gln Phe Thr Lys Ile Asp

130 135 140

Thr Ile Ala Ala Asp Glu Ser Phe Thr Gln Met Asp Leu Gly Asp Arg

145 150 155 160

Ile Leu Lys Leu Asn Thr Glu Ile Arg Glu Val Gly Pro Val Asn Lys

165 170 175

Lys Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys Val Ala Leu

180 185 190

Val Ser Val Arg Val Tyr Phe Lys Lys Cys Pro Phe Thr Val Lys Asn

195 200 205

Leu Ala Met Phe Pro Asp Thr Val Pro Met Asp Ser Gln Ser Leu Val

210 215 220

Glu Val Arg Gly Ser Cys Val Asn Asn Ser Lys Glu Glu Asp Pro Pro

225 230 235 240

Arg Met Tyr Cys Ser Thr Glu Gly Glu Trp Leu Val Pro Ile Gly Lys

245 250 255

Cys Ser Cys Asn Ala Gly Tyr Glu Glu Arg Gly Phe Met Cys Gln Ala

260 265 270

Cys Arg Pro Gly Phe Tyr Lys Ala Leu Asp Gly Asn Met Lys Cys Ala

275 280 285

Lys Cys Pro Pro His Ser Ser Thr Gln Glu Asp Gly Ser Met Asn Cys

290 295 300

Arg Cys Glu Asn Asn Tyr Phe Arg Ala Asp Lys Asp Pro Pro Ser Met

305 310 315 320

Ala Cys Thr Arg Pro Pro Ser Ser Pro Arg Asn Val Ile Ser Asn Ile

325 330 335

Asn Glu Thr Ser Val Ile Leu Asp Trp Ser Trp Pro Leu Asp Thr Gly

340 345 350

Gly Arg Lys Asp Val Thr Phe Asn Ile Ile Cys Lys Lys Cys Gly Trp

355 360 365

Asn Ile Lys Gln Cys Glu Pro Cys Ser Pro Asn Val Arg Phe Leu Pro

370 375 380

Arg Gln Phe Gly Leu Thr Asn Thr Thr Val Thr Val Thr Asp Leu Leu

385 390 395 400

Ala His Thr Asn Tyr Thr Phe Glu Ile Asp Ala Val Asn Gly Val Ser

405 410 415

Glu Leu Ser Ser Pro Pro Arg Gln Phe Ala Ala Val Ser Ile Thr Thr

420 425 430

Asn Gln Ala Ala Pro Ser Pro Val Leu Thr Ile Lys Lys Asp Arg Thr

435 440 445

Ser Arg Asn Ser Ile Ser Leu Ser Trp Gln Glu Pro Glu His Pro Asn

450 455 460

Gly Ile Ile Leu Asp Tyr Glu Val Lys Tyr Tyr Glu Lys Gln Glu Gln

465 470 475 480

Glu Thr Ser Tyr Thr Ile Leu Arg Ala Arg Gly Thr Asn Val Thr Ile

485 490 495

Ser Ser Leu Lys Pro Asp Thr Ile Tyr Val Phe Gln Ile Arg Ala Arg

500 505 510

Thr Ala Ala Gly Tyr Gly Thr Asn Ser Arg Lys Phe Glu Phe Glu Thr

515 520 525

Ser Pro Asp Ser Phe Ser Ile Ser Gly Glu Ser Ser Gln Val Val Met

530 535 540

Ile Ala Ile Ser Ala Ala Val Ala Ile Ile Leu Leu Thr Val Val Ile

545 550 555 560

Tyr Val Leu Ile Gly Arg Phe Cys Gly Tyr Lys Ser Lys His Gly Ala

565 570 575

Asp Glu Lys Arg Leu His Phe Gly Asn Gly His Leu Lys Leu Pro Gly

580 585 590

Leu Arg Thr Tyr Val Asp Pro His Thr Tyr Glu Asp Pro Thr Gln Ala

595 600 605

Val His Glu Phe Ala Lys Glu Leu Asp Ala Thr Asn Ile Ser Ile Asp

610 615 620

Lys Val Val Gly Ala Gly Glu Phe Gly Glu Val Cys Ser Gly Arg Leu

625 630 635 640

Lys Leu Pro Ser Lys Lys Glu Ile Ser Val Ala Ile Lys Thr Leu Lys

645 650 655

Val Gly Tyr Thr Glu Lys Gln Arg Arg Asp Phe Leu Gly Glu Ala Ser

660 665 670

Ile Met Gly Gln Phe Asp His Pro Asn Ile Ile Arg Leu Glu Gly Val

675 680 685

Val Thr Lys Ser Lys Pro Val Met Ile Val Thr Glu Tyr Met Glu Asn

690 695 700

Gly Ser Leu Asp Ser Phe Leu Arg Lys His Asp Ala Gln Phe Thr Val

705 710 715 720

Ile Gln Leu Val Gly Met Leu Arg Gly Ile Ala Ser Gly Met Lys Tyr

725 730 735

Leu Ser Asp Met Gly Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile

740 745 750

Leu Ile Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser

755 760 765

Arg Val Leu Glu Asp Asp Pro Glu Ala Ala Tyr Thr Thr Arg Gly Gly

770 775 780

Lys Ile Pro Ile Arg Trp Thr Ser Pro Glu Ala Ile Ala Tyr Arg Lys

785 790 795 800

Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Leu Trp Glu

805 810 815

Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp Glu Met Ser Asn Gln Asp

820 825 830

Val Ile Lys Ala Val Asp Glu Gly Tyr Arg Leu Pro Pro Pro Met Asp

835 840 845

Cys Pro Ala Ala Leu Tyr Gln Leu Met Leu Asp Cys Trp Gln Lys Asp

850 855 860

Arg Asn Asn Arg Pro Lys Phe Glu Gln Ile Val Ser Ile Leu Asp Lys

865 870 875 880

Leu Ile Arg Asn Pro Gly Ser Leu Lys Ile Ile Thr Ser Ala Ala Ala

885 890 895

Arg Pro Ser Asn Leu Leu Leu Asp Gln Ser Asn Val Asp Ile Thr Thr

900 905 910

Phe Arg Thr Thr Gly Asp Trp Leu Asn Gly Val Trp Thr Ala His Cys

915 920 925

Lys Glu Ile Phe Thr Gly Val Glu Tyr Ser Ser Cys Asp Thr Ile Ala

930 935 940

Lys Ile Ser Thr Asp Asp Met Lys Lys Val Gly Val Thr Val Val Gly

945 950 955 960

Pro Gln Lys Lys Ile Ile Ser Ser Ile Lys Ala Leu Glu Thr Gln Ser

965 970 975

Lys Asn Gly Pro Val Pro Val

980

<210>7

<211>1620

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>7

atggattgtc agctctccat cctcctcctt ctcagctgct ctgttctcga cagcttcggg 60

gaactgattc cgcagccttc caatgaagtc aatctactgg attcaaaaac aattcaaggg 120

gagctgggct ggatctctta tccatcacat gggtgggaag agatcagtgg tgtggatgaa 180

cattacacac ccatcaggac ttaccaggtg tgcaatgtca tggaccacag tcaaaacaat 240

tggctgagaa caaactgggt ccccaggaac tcagctcaga agatttatgt ggagctcaag 300

ttcactctac gagactgcaa tagcattcca ttggttttag gaacttgcaa ggagacattc 360

aacctgtact acatggagtc tgatgatgat catggggtga aatttcgaga gcatcagttt 420

acaaagattg acaccattgc agctgatgaa agtttcactc aaatggatct tggggaccgt 480

attctgaagc tcaacactga gattagagaa gtaggtcctg tcaacaagaa gggattttat 540

ttggcatttc aagatgttgg tgcttgtgtt gccttggtgt ctgtgagagt atacttcaaa 600

aagtgcccat ttacagtgaa gaatctggct atgtttccag acacggtacc catggactcc 660

cagtccctgg tggaggttag agggtcttgt gtcaacaatt ctaaggagga agatcctcca 720

aggatgtact gcagtacaga aggcgaatgg cttgtaccca ttggcaagtg ttcctgcaat 780

gctggctatg aagaaagagg ttttatgtgc caagcttgtc gaccaggttt ctacaaggca 840

ttggatggta atatgaagtg tgctaagtgc ccgcctcaca gttctactca ggaagatggt 900

tcaatgaact gcaggtgtga gaataattac ttccgggcag acaaagaccc tccatccatg 960

gcttgtaccc gacctccatc ttcaccaaga aatgttatct ctaatataaa cgagacctca 1020

gttatcctgg actggagttg gcccctggac acaggaggcc ggaaagatgt taccttcaac 1080

atcatatgta aaaaatgtgg gtggaatata aaacagtgtg agccatgcag cccaaatgtc 1140

cgcttcctcc ctcgacagtt tggactcacc aacaccacgg tgacagtgac agaccttctg 1200

gcacatacta actacacctt tgagattgat gccgttaatg gggtgtcaga gctgagctcc 1260

ccaccaagac agtttgctgc ggtcagcatc acaactaatc aggctgctcc atcacctgtc 1320

ctgacgatta agaaagatcg gacctccaga aatagcatct ctttgtcctg gcaagaacct 1380

gaacatccta atgggatcat attggactac gaggtcaaat actatgaaaa gcaggaacaa 1440

gaaacaagtt ataccattct gagggcaaga ggcacaaatg ttaccatcag tagcctcaag 1500

cctgacacta tatacgtatt ccaaatccga gcccgaacag ccgctggata tgggacgaac 1560

agccgcaagt ttgagtttga aactagtcca gactgtatgt attatttcaa tgcagtctag 1620

<210>8

<211>539

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(29)...(202)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(326)...(421)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(437)...(528)

＜223〉3 type fibronectin domains

<400>8

Met Asp Cys Gln Leu Ser Ile Leu Leu Leu Leu Ser Cys Ser Val Leu

1 5 10 15

Asp Ser Phe Gly Glu Leu Ile Pro Gln Pro Ser Asn Glu Val Asn Leu

20 25 30

Leu Asp Ser Lys Thr Ile Gln Gly Glu Leu Gly Trp Ile Ser Tyr Pro

35 40 45

Ser His Gly Trp Glu Glu Ile Ser Gly Val Asp Glu His Tyr Thr Pro

50 55 60

Ile Arg Thr Tyr Gln Val Cys Asn Val Met Asp His Ser Gln Asn Asn

65 70 75 80

Trp Leu Arg Thr Asn Trp Val Pro Arg Asn Ser Ala Gln Lys Ile Tyr

85 90 95

Val Glu Leu Lys Phe Thr Leu Arg Asp Cys Asn Ser Ile Pro Leu Val

100 105 110

Leu Gly Thr Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Met Glu Ser Asp

115 120 125

Asp Asp His Gly Val Lys Phe Arg Glu His Gln Phe Thr Lys Ile Asp

130 135 140

Thr Ile Ala Ala Asp Glu Ser Phe Thr Gln Met Asp Leu Gly Asp Arg

145 150 155 160

Ile Leu Lys Leu Asn Thr Glu Ile Arg Glu Val Gly Pro Val Asn Lys

165 170 175

Lys Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys Val Ala Leu

180 185 190

Val Ser Val Arg Val Tyr Phe Lys Lys Cys Pro Phe Thr Val Lys Asn

195 200 205

Leu Ala Met Phe Pro Asp Thr Val Pro Met Asp Ser Gln Ser Leu Val

210 215 220

Glu Val Arg Gly Ser Cys Val Asn Asn Ser Lys Glu Glu Asp Pro Pro

225 230 235 240

Arg Met Tyr Cys Ser Thr Glu Gly Glu Trp Leu Val Pro Ile Gly Lys

245 250 255

Cys Ser Cys Asn Ala Gly Tyr Glu Glu Arg Gly Phe Met Cys Gln Ala

260 265 270

Cys Arg Pro Gly Phe Tyr Lys Ala Leu Asp Gly Asn Met Lys Cys Ala

275 280 285

Lys Cys Pro Pro His Ser Ser Thr Gln Glu Asp Gly Ser Met Asn Cys

290 295 300

Arg Cys Glu Asn Asn Tyr Phe Arg Ala Asp Lys Asp Pro Pro Ser Met

305 310 315 320

Ala Cys Thr Arg Pro Pro Ser Ser Pro Arg Asn Val Ile Ser Asn Ile

325 330 335

Asn Glu Thr Ser Val Ile Leu Asp Trp Ser Trp Pro Leu Asp Thr Gly

340 345 350

Gly Arg Lys Asp Val Thr Phe Asn Ile Ile Cys Lys Lys Cys Gly Trp

355 360 365

Asn Ile Lys Gln Cys Glu Pro Cys Ser ProAsn Val Arg Phe Leu Pro

370 375 380

Arg Gln Phe Gly Leu Thr Asn Thr Thr Val Thr Val Thr Asp Leu Leu

385 390 395 400

Ala His Thr Asn Tyr Thr Phe Glu Ile Asp Ala Val Asn Gly Val Ser

405 410 415

Glu Leu Ser Ser Pro ProArg Gln Phe Ala Ala Val Ser Ile Thr Thr

420 425 430

Asn Gln Ala Ala Pro Ser Pro Val Leu Thr Ile Lys Lys Asp Arg Thr

435 440 445

Ser Arg Asn Ser Ile Ser Leu Ser Trp Gln Glu Pro Glu His Pro Asn

450 455 460

Gly Ile Ile Leu Asp Tyr Glu Val Lys Tyr Tyr Glu Lys Gln Glu Gln

465 470 475 480

Glu Thr Ser Tyr Thr Ile Leu Arg Ala Arg Gly ThrAsn Val Thr Ile

485 490 495

Ser Ser Leu Lys Pro Asp Thr Ile Tyr Val Phe Gln Ile Arg Ala Arg

500 505 510

Thr Ala Ala Gly Tyr Gly Thr Asn Ser Arg Lys Phe Glu Phe Glu Thr

515 520 525

Ser Pro Asp Cys Met Tyr Tyr Phe Asn Ala Val

530 535

<210>9

<211>2961

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>9

atggctggga ttttctattt cgccctattt tcgtgtctct tcgggatttg cgacgctgtc 60

acaggttcca gggtataccc cgcgaatgaa gttaccttat tggattccag atctgttcag 120

ggagaacttg ggtggatagc aagccctctg gaaggagggt gggaggaagt gagtatcatg 180

gatgaaaaaa atacaccaat ccgaacctac caagtgtgca atgtgatgga acccagccag 240

aataactggc tacgaactga ttggatcacc cgagaagggg ctcagagggt gtatattgag 300

attaaattca ccttgaggga ctgcaatagt cttccgggcg tcatggggac ttgcaaggag 360

acgtttaacc tgtactacta tgaatcagac aacgacaaag agcgtttcat cagagagaac 420

cagtttgtca aaattgacac cattgctgct gatgagagct tcacccaagt ggacattggt 480

gacagaatca tgaagctgaa caccgagatc cgggatgtag ggccattaag caaaaagggg 540

ttttacctgg cttttcagga tgtgggggcc tgcatcgccc tggtatcagt ccgtgtgttc 600

tataaaaagt gtccactcac agtccgcaat ctggcccagt ttcctgacac catcacaggg 660

gctgatacgt cttccctggt ggaagttcga ggctcctgtg tcaacaactc agaagagaaa 720

gatgtgccaa aaatgtactg tggggcagat ggtgaatggc tggtacccat tggcaactgc 780

ctatgcaacg ctgggcatga ggagcggagc ggagaatgcc aagcttgcaa aattggatat 840

tacaaggctc tctccacgga tgccacctgt gccaagtgcc caccccacag ctactctgtc 900

tgggaaggag ccacctcgtg cacctgtgac cgaggctttt tcagagctga caacgatgct 960

gcctctatgc cctgcacccg tccaccatct gctcccctga acttgatttc aaatgtcaac 1020

gagacatctg tgaacttgga atggagtagc cctcagaata caggtggccg ccaggacatt 1080

tcctataatg tggtatgcaa gaaatgtgga gctggtgacc ccagcaagtg ccgaccctgt 1140

ggaagtgggg tccactacac cccacagcag aatggcttga agaccaccaa agtctccatc 1200

actgacctcc tagctcatac caattacacc tttgaaatct gggctgtgaa tggagtgtcc 1260

aaatataacc ctaacccaga ccaatcagtt tctgtcactg tgaccaccaa ccaagcagca 1320

ccatcatcca ttgctttggt ccaggctaaa gaagtcacaa gatacagtgt ggcactggct 1380

tggctggaac cagatcggcc caatggggta atcctggaat atgaagtcaa gtattatgag 1440

aaggatcaga atgagcgaag ctatcgtata gttcggacag ctgccaggaa cacagatatc 1500

aaaggcctga accctctcac ttcctatgtt ttccacgtgc gagccaggac agcagctggc 1560

tatggagact tcagtgagcc cttggaggtt acaaccaaca cagtgccttc ccggatcatt 1620

ggagatgggg ctaactccac agtccttctg gtctctgtct cgggcagtgt ggtgctggtg 1680

gtaattctca ttgcagcttt tgtcatcagc cggagacgga gtaaatacag taaagccaaa 1740

caagaagcgg atgaagagaa acatttgaat caaggtgtaa gaacatatgt ggaccccttt 1800

acgtacgaag atcccaacca agcagtgcga gagtttgcca aagaaattga cgcatcctgc 1860

attaagattg aaaaagttat aggagttggt gaatttggtg aggtatgcag tgggcgtctc 1920

aaagtgcctg gcaagagaga gatctgtgtg gctatcaaga ctctgaaagc tggttataca 1980

gacaaacaga ggagagactt cctgagtgag gccagcatca tgggacagtt tgaccatccg 2040

aacatcattc acttggaagg cgtggtcact aaatgtaaac cagtaatgat cataacagag 2100

tacatggaga atggctcctt ggatgcattc ctcaggaaaa atgatggcag atttacagtc 2160

attcagctgg tgggcatgct tcgtggcatt gggtctggga tgaagtattt atctgatatg 2220

agctatgtgc atcgtgatct ggccgcacgg aacatcctgg tgaacagcaa cttggtctgc 2280

aaagtgtctg attttggcat gtcccgagtg cttgaggatg atccggaagc agcttacacc 2340

accaggggtg gcaagattcc tatccggtgg actgcgccag aagcaattgc ctatcgtaaa 2400

ttcacatcag caagtgatgt atggagctat ggaatcgtta tgtgggaagt gatgtcgtac 2460

ggggagaggc cctattggga tatgtccaat caagatgtga ttaaagccat tgaggaaggc 2520

tatcggttac cccctccaat ggactgcccc attgcgctcc accagctgat gctagactgc 2580

tggcagaagg agaggagcga caggcctaaa tttgggcaga ttgtcaacat gttggacaaa 2640

ctcatccgca accccaacag cttgaagagg acagggacgg agagctccag acctaacact 2700

gccttgttgg atccaagctc ccctgaattc tctgctgtgg tatcagtggg cgattggctc 2760

caggccatta aaatggaccg gtataaggat aacttcacag ctgctggtta taccacacta 2820

gaggctgtgg tgcacgtgaa ccaggaggac ctggcaagaa ttggtatcac agccatcacg 2880

caccagaata agattttgag cagtgtccag gcaatgcgaa cccaaatgca gcagatgcac 2940

ggcagaatgg ttcccgtctg a 2961

<210>10

<211>986

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(30)...(204)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(329)...(436)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(441)...(532)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(615)...(881)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(915)...(973)

＜223〉SAM domain (invalid α motif)

<400>10

Met Ala Gly Ile Phe Tyr Phe Ala Leu Phe Ser Cys Leu Phe Gly Ile

1 5 10 15

Cys Asp Ala Val Thr Gly Ser Arg Val Tyr Pro Ala Asn Glu Val Thr

20 25 30

Leu Leu Asp Ser Arg Ser Val Gln Gly Glu Leu Gly Trp Ile Ala Ser

35 40 45

Pro Leu Glu Gly Gly Trp Glu Glu Val Ser Ile Met Asp Glu Lys Asn

50 55 60

Thr Pro Ile Arg Thr Tyr Gln Val Cys Asn Val Met Glu Pro Ser Gln

65 70 75 80

Asn Asn Trp Leu Arg Thr Asp Trp Ile Thr Arg Glu Gly Ala Gln Arg

85 90 95

Val Tyr Ile Glu Ile Lys Phe Thr Leu Arg Asp Cys Asn Ser Leu Pro

100 105 110

Gly Val Met Gly Thr Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Tyr Glu

115 120 125

Ser Asp Asn Asp Lys Glu Arg Phe Ile Arg Glu Asn Gln Phe Val Lys

130 135 140

Ile Asp Thr Ile Ala Ala Asp Glu Ser Phe Thr Gln Val Asp Ile Gly

145 150 155 160

Asp Arg Ile Met Lys Leu Asn Thr Glu Ile Arg Asp Val Gly Pro Leu

165 170 175

Ser Lys Lys Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys Ile

180 185 190

Ala Leu Val Ser Val Arg Val Phe Tyr Lys Lys Cys Pro Leu Thr Val

195 200 205

Arg Asn Leu Ala Gln Phe Pro Asp Thr Ile Thr Gly Ala Asp Thr Ser

210 215 220

Ser Leu Val Glu Val Arg Gly Ser Cys Val Asn Asn Ser Glu Glu Lys

225 230 235 240

Asp Val Pro Lys Met Tyr Cys Gly Ala Asp Gly Glu Trp Leu Val Pro

245 250 255

Ile Gly Asn Cys Leu Cys Asn Ala Gly His Glu Glu Arg Ser Gly Glu

260 265 270

Cys Gln Ala Cys Lys Ile Gly Tyr Tyr Lys Ala Leu Ser Thr Asp Ala

275 280 285

Thr Cys Ala Lys Cys Pro Pro His Ser Tyr Ser Val Trp Glu Gly Ala

290 295 300

Thr Ser Cys Thr Cys Asp Arg Gly Phe Phe Arg Ala Asp Asn Asp Ala

305 310 315 320

Ala Ser Met Pro Cys Thr Arg Pro Pro Ser Ala Pro Leu Asn Leu Ile

325 330 335

Ser Asn Val Asn Glu Thr Ser Val Asn Leu Glu Trp Ser Ser Pro Gln

340 345 350

Asn Thr Gly Gly Arg Gln Asp Ile Ser Tyr Asn Val Val Cys Lys Lys

355 360 365

Cys Gly Ala Gly Asp Pro Ser Lys Cys Arg Pro Cys Gly Ser Gly Val

370 375 380

His Tyr Thr Pro Gln Gln Asn Gly Leu Lys Thr Thr Lys Val Ser Ile

385 390 395 400

Thr Asp Leu Leu Ala His Thr Asn Tyr Thr Phe Glu Ile Trp Ala Val

405 410 415

Asn Gly Val Ser Lys Tyr Asn Pro Asn Pro Asp Gln Ser Val Ser Val

420 425 430

Thr Val Thr Thr Asn Gln Ala Ala Pro Ser Ser Ile Ala Leu Val Gln

435 440 445

Ala Lys Glu Val Thr Arg Tyr Ser Val Ala Leu Ala Trp Leu Glu Pro

450 455 460

Asp Arg Pro Asn Gly Val Ile Leu Glu Tyr Glu Val Lys Tyr Tyr Glu

465 470 475 480

Lys Asp Gln Asn Glu Arg Ser Tyr Arg Ile Val Arg Thr Ala Ala Arg

485 490 495

Asn Thr Asp Ile Lys Gly Leu Asn Pro Leu Thr Ser Tyr Val Phe His

500 505 510

Val Arg Ala Arg Thr Ala Ala Gly Tyr Gly Asp Phe Ser Glu Pro Leu

515 520 525

Glu Val Thr Thr Asn Thr Val Pro Ser Arg Ile Ile Gly Asp Gly Ala

530 535 540

Asn Ser Thr Val Leu Leu Val Ser Val Ser Gly Ser Val Val Leu Val

545 550 555 560

Val Ile Leu Ile Ala Ala Phe Val Ile Ser Arg Arg Arg Ser Lys Tyr

565 570 575

Ser Lys Ala Lys Gln Glu Ala Asp Glu Glu Lys His Leu Asn Gln Gly

580 585 590

Val Arg Thr Tyr Val Asp Pro Phe Thr Tyr Glu Asp Pro Asn Gln Ala

595 600 605

Val Arg Glu Phe Ala Lys Glu Ile Asp Ala Ser Cys Ile Lys Ile Glu

610 615 620

Lys Val Ile Gly Val Gly Glu Phe Gly Glu Val Cys Ser Gly Arg Leu

625 630 635 640

Lys Val Pro Gly Lys Arg Glu Ile Cys Val Ala Ile Lys Thr Leu Lys

645 650 655

Ala Gly Tyr Thr Asp Lys Gln Arg Arg Asp Phe Leu Ser Glu Ala Ser

660 665 670

Ile Met Gly Gln Phe Asp His Pro Asn Ile Ile His Leu Glu Gly Val

675 680 685

Val Thr Lys Cys Lys Pro Val Met Ile Ile Thr Glu Tyr Met Glu Asn

690 695 700

Gly Ser Leu Asp Ala Phe Leu Arg Lys Asn Asp Gly Arg Phe Thr Val

705 710 715 720

Ile Gln Leu Val Gly Met Leu Arg Gly Ile Gly Ser Gly Met Lys Tyr

725 730 735

Leu Ser Asp Met Ser Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile

740 745 750

Leu Val Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Met Ser

755 760 765

Arg Val Leu Glu Asp Asp Pro Glu Ala Ala Tyr Thr Thr Arg Gly Gly

770 775 780

Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Ala Tyr Arg Lys

785 790 795 800

Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Met Trp Glu

805 810 815

Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn Gln Asp

820 825 830

Val Ile Lys Ala Ile Glu Glu Gly Tyr Arg Leu Pro Pro Pro Met Asp

835 840 845

Cys Pro Ile Ala Leu His Gln Leu Met Leu Asp Cys Trp Gln Lys Glu

850 855 860

Arg Ser Asp Arg Pro Lys Phe Gly Gln Ile Val Asn Met Leu Asp Lys

865 870 875 880

Leu Ile Arg Asn Pro Asn Ser Leu Lys Arg Thr Gly Thr Glu Ser Ser

885 890 895

Arg Pro Asn Thr Ala Leu Leu Asp Pro Ser Ser Pro Glu Phe Ser Ala

900 905 910

Val Val Ser Val Gly Asp Trp Leu Gln Ala Ile Lys Met Asp Arg Tyr

915 920 925

Lys Asp Asn Phe Thr Ala Ala Gly Tyr Thr Thr Leu Glu Ala Val Val

930 935 940

His Val Asn Gln Glu Asp Leu Ala Arg Ile Gly Ile Thr Ala Ile Thr

945 950 955 960

His Gln Asn Lys Ile Leu Ser Ser Val Gln Ala Met Arg Thr Gln Met

965 970 975

Gln Gln Met His Gly Arg Met Val Pro Val

980 985

<210>11

<211>3114

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>11

atgcggggct cggggccccg gggtgcggga caccggcggc ccccaagcgg cggcggcgac 60

acccccatca ccccagcgtc cctggccggc tgctactctg cacctcgacg ggctcccctc 120

tggacgtgcc ttctcctgtg cgccgcactc cggaccctcc tggccagccc cagcaacgaa 180

gtgaatttat tggattcacg cactgtcatg ggggacctgg gatggattgc ttttccaaaa 240

aatgggtggg aagagattgg tgaagtggat gaaaattatg cccctatcca cacataccaa 300

gtatgcaaag tgatggaaca gaatcagaat aactggcttt tgaccagttg gatctccaat 360

gaaggtgctt ccagaatctt catagaactc aaatttaccc tgcgggactg caacagcctt 420

cctggaggac tggggacctg taaggaaacc tttaatatgt attactttga gtcagatgat 480

cagaatggga gaaacatcaa ggaaaaccaa tacatcaaaa ttgataccat tgctgccgat 540

gaaagcttta cagaacttga tcttggtgac cgtgttatga aactgaatac agaggtcaga 600

gatgtaggac ctctaagcaa aaagggattt tatcttgctt ttcaagatgt tggtgcttgc 660

attgctctgg tttctgtgcg tgtatactat aaagaatgcc cttctgtggt acgacacttg 720

gctgtcttcc ctgacaccat cactggagct gattcttccc aattgctcga agtgtcaggc 780

tcctgtgtca accattctgt gaccgatgaa cctcccaaaa tgcactgcag cgccgaaggg 840

gagtggctgg tgcccatcgg gaaatgcatg tgcaaggcag gatatgaaga gaaaaatggc 900

acctgtcaag tgtgcagacc tgggttcttc aaagcctcac ctcacatcca gagctgcggc 960

aaatgtccac ctcacagtta tacccatgag gaagcttcaa cctcttgtgt ctgtgaaaag 1020

gattatttca ggagagagtc tgatccaccc acaatggcat gcacaagacc cccctctgct 1080

cctcggaatg ccatctcaaa tgttaatgaa actagtgtct ttctggaatg gattccgcct 1140

gctgacactg gtggaaggaa agacgtgtca tattatattg catgcaagaa gtgcaactcc 1200

catgcaggtg tgtgtgagga gtgtggcggt catgtcaggt accttccccg gcaaagcggc 1260

ctgaaaaaca cctctgtcat gatggtggat ctactcgctc acacaaacta tacctttgag 1320

attgaggcag tgaatggagt gtccgacttg agcccaggag cccggcagta tgtgtctgta 1380

aatgtaacca caaatcaagc agctccatct ccagtcacca atgtgaaaaa agggaaaatt 1440

gcaaaaaaca gcatctcttt gtcttggcaa gaaccagatc gtcccaatgg aatcatccta 1500

gagtatgaaa tcaagtattt tgaaaaggac caagagacca gctacacgat tatcaaatct 1560

aaagagacaa ctattactgc agagggcttg aaaccagctt cagtttatgt cttccaaatt 1620

cgagcacgta cagcagcagg ctatggtgtc ttcagtcgaa gatttgagtt tgaaaccacc 1680

ccagtgtttg cagcatccag cgatcaaagc cagattcctg taattgctgt gtctgtgaca 1740

gtgggagtca ttttgttggc agtggttatc ggcgtcctcc tcagtggaag ttgctgcgaa 1800

tgtggctgtg ggagggcttc ttccctgtgc gctgttgccc atccaagcct aatatggcgg 1860

tgtggctaca gcaaagcaaa acaagatcca gaagaggaaa agatgcattt tcataatggg 1920

cacattaaac tgccaggagt aagaacttac attgatccac atacctatga ggatcccaat 1980

caagctgtcc acgaatttgc taaggagata gaagcatcat gtatcaccat tgagagagtt 2040

attggagcag gtgaatttgg tgaagtttgt agtggacgtt tgaaactacc aggaaaaaga 2100

gaattacctg tggctatcaa aacccttaaa gtaggctata ctgaaaagca acgcagagat 2160

ttcctaggtg aagcaagtat catgggacag tttgatcatc ctaacatcat ccatttagaa 2220

ggtgtggtga ccaaaagtaa accagtgatg atcgtgacag agtatatgga gaatggctct 2280

ttagatacat ttttgaagaa aaacgatggg cagttcactg tgattcagct tgttggcatg 2340

ctgagaggta tctctgcagg aatgaagtac ctttctgaca tgggctatgt gcatagagat 2400

cttgctgcca gaaacatctt aatcaacagt aaccttgtgt gcaaagtgtc tgactttgga 2460

ctttcccggg tactggaaga tgatcccgag gcagcctaca ccacaagggg aggaaaaatt 2520

ccaatcagat ggactgcccc agaagcaata gctttccgaa agtttacttc tgccagtgat 2580

gtctggagtt atggaatagt aatgtgggaa gttgtgtctt atggagagag accctactgg 2640

gagatgacca atcaagatgt gattaaagcg gtagaggaag gctatcgtct gccaagcccc 2700

atggattgtc ctgctgctct ctatcagtta atgctggatt gctggcagaa agagcgaaat 2760

agcaggccca agtttgatga aatagtcaac atgttggaca agctgatacg taacccaagt 2820

agtctgaaga cgctggttaa tgcatcctgc agagtatcta atttattggc agaacatagc 2880

ccactaggat ctggggccta cagatcagta ggtgaatggc tagaggcaat caagatgggc 2940

cggtatacag agattttcat ggaaaatgga tacagttcaa tggacgctgt ggctcaggtg 3000

accttggagg atttgagacg gcttggagtg actcttgtcg gtcaccagaa gaagatcatg 3060

aacagccttc aagaaatgaa ggtgcagctg gtaaacggaa tggtgccatt gtaa 3114

<210>12

<211>1037

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(60)...(223)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(358)...(452)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(469)...(559)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(675)...(932)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(968)...(1027)

＜223〉SAM domain (invalid α motif)

<400>12

Met Arg Gly Ser Gly Pro Arg Gly Ala Gly His Arg Arg Pro Pro Ser

1 5 10 15

Gly Gly Gly Asp Thr Pro Ile Thr Pro Ala Ser Leu Ala Gly Cys Tyr

20 25 30

Ser Ala Pro Arg Arg Ala Pro Leu Trp Thr Cys Leu Leu Leu Cys Ala

35 40 45

Ala Leu Arg Thr Leu Leu Ala Ser Pro Ser Asn Glu Val Asn Leu Leu

50 55 60

Asp Ser Arg Thr Val Met Gly Asp Leu Gly Trp Ile Ala Phe Pro Lys

65 70 75 80

Asn Gly Trp Glu Glu Ile Gly Glu Val Asp Glu Asn Tyr Ala Pro Ile

85 90 95

His Thr Tyr Gln Val Cys Lys Val Met Glu Gln Asn Gln Asn Asn Trp

100 105 110

Leu Leu Thr Ser Trp Ile Ser Asn Glu Gly Ala Ser Arg Ile Phe Ile

115 120 125

Glu Leu Lys Phe Thr Leu Arg Asp Cys Asn Ser Leu Pro Gly Gly Leu

130 135 140

Gly Thr Cys Lys Glu Thr Phe Asn Met Tyr Tyr Phe Glu Ser Asp Asp

145 150 155 160

Gln Asn Gly Arg Asn Ile Lys Glu Asn Gln Tyr Ile Lys Ile Asp Thr

165 170 175

Ile Ala Ala Asp Glu Ser Phe Thr Glu Leu Asp Leu Gly Asp Arg Val

180 185 190

Met Lys Leu Asn Thr Glu Val Arg Asp Val Gly Pro Leu Ser Lys Lys

195 200 205

Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys Ile Ala Leu Val

210 215 220

Ser Val Arg Val Tyr Tyr Lys Glu Cys Pro Ser Val Val Arg His Leu

225 230 235 240

Ala Val Phe Pro Asp Thr Ile Thr Gly Ala Asp Ser Ser Gln Leu Leu

245 250 255

Glu Val Ser Gly Ser Cys Val Asn His Ser Val Thr Asp Glu Pro Pro

260 265 270

Lys Met His Cys Ser Ala Glu Gly Glu Trp Leu Val Pro Ile Gly Lys

275 280 285

Cys Met Cys Lys Ala Gly Tyr Glu Glu Lys Asn Gly Thr Cys Gln Val

290 295 300

Cys Arg Pro Gly Phe Phe Lys Ala Ser Pro His Ile Gln Ser Cys Gly

305 310 315 320

Lys Cys Pro Pro His Ser Tyr Thr His Glu Glu Ala Ser Thr Ser Cys

325 330 335

Val Cys Glu Lys Asp Tyr Phe Arg Arg Glu Ser Asp Pro Pro Thr Met

340 345 350

Ala Cys Thr Arg Pro Pro Ser Ala Pro Arg Asn Ala Ile Ser Asn Val

355 360 365

Asn Glu Thr Ser Val Phe Leu Glu Trp Ile Pro Pro Ala Asp Thr Gly

370 375 380

Gly Arg Lys Asp Val Ser Tyr Tyr Ile Ala Cys Lys Lys Cys Asn Ser

385 390 395 400

His Ala Gly Val Cys Glu Glu Cys Gly Gly His Val Arg Tyr Leu Pro

405 410 415

Arg Gln Ser Gly Leu Lys Asn Thr Ser Val Met Met Val Asp Leu Leu

420 425 430

Ala His Thr Asn Tyr Thr Phe Glu Ile Glu Ala Val Asn Gly Val Ser

435 440 445

Asp Leu Ser Pro Gly Ala Arg Gln Tyr Val Ser Val Asn Val Thr Thr

450 455 460

Asn Gln Ala Ala Pro Ser Pro Val Thr Asn Val Lys Lys Gly Lys Ile

465 470 475 480

Ala Lys Asn Ser Ile Ser Leu Ser Trp Gln Glu Pro Asp Arg Pro Asn

485 490 495

Gly Ile Ile Leu Glu Tyr Glu Ile Lys Tyr Phe Glu Lys Asp Gln Glu

500 505 510

Thr Ser Tyr Thr Ile Ile Lys Ser Lys Glu Thr Thr Ile Thr Ala Glu

515 520 525

Gly Leu Lys Pro Ala Ser Val Tyr Val Phe Gln Ile Arg Ala Arg Thr

530 535 540

Ala Ala Gly Tyr Gly Val Phe Ser Arg Arg Phe Glu Phe Glu Thr Thr

545 550 555 560

Pro Val Phe Ala Ala Ser Ser Asp Gln Ser Gln Ile Pro Val Ile Ala

565 570 575

Val Ser Val Thr Val Gly Val Ile Leu Leu Ala Val Val Ile Gly Val

580 585 590

Leu Leu Ser Gly Ser Cys Cys Glu Cys Gly Cys Gly Arg Ala Ser Ser

595 600 605

Leu Cys Ala Val Ala His Pro Ser Leu Ile Trp Arg Cys Gly Tyr Ser

610 615 620

Lys Ala Lys Gln Asp Pro Glu Glu Glu Lys Met His Phe His Asn Gly

625 630 635 640

His Ile Lys Leu Pro Gly Val Arg Thr Tyr Ile Asp Pro His Thr Tyr

645 650 655

Glu Asp Pro Asn Gln Ala Val His Glu Phe Ala Lys Glu Ile Glu Ala

660 665 670

Ser Cys Ile Thr Ile Glu Arg Val Ile Gly Ala Gly Glu Phe Gly Glu

675 680 685

Val Cys Ser Gly Arg Leu Lys Leu Pro Gly Lys Arg Glu Leu Pro Val

690 695 700

Ala lle Lys Thr Leu Lys Val Gly Tyr Thr Glu Lys Gln Arg Arg Asp

705 710 715 720

Phe Leu Gly Glu Ala Ser Ile Met Gly Gln Phe Asp His Pro Asn Ile

725 730 735

Ile His Leu Glu Gly Val Val Thr Lys Ser Lys Pro Val Met Ile Val

740 745 750

Thr Glu Tyr Met Glu Asn Gly Ser Leu Asp Thr Phe Leu Lys Lys Asn

755 760 765

Asp Gly Gln Phe Thr Val Ile Gln Leu Val Gly Met Leu Arg Gly Ile

770 775 780

Ser Ala Gly Met Lys Tyr Leu Ser Asp Met Gly Tyr Val His Arg Asp

785 790 795 800

Leu Ala Ala Arg Asn Ile Leu Ile Asn Ser Asn Leu Val Cys Lys Val

805 810 815

Ser Asp Phe Gly Leu Ser Arg Val Leu Glu Asp Asp Pro Glu Ala Ala

820 825 830

Tyr Thr Thr Arg Gly Gly Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu

835 840 845

Ala Ile Ala Phe Arg Lys Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr

850 855 860

Gly Ile Val Met Trp Glu Val Val Ser Tyr Gly Glu Arg Pro Tyr Trp

870 875 880

Glu Met Thr Asn Gln Asp Val Ile Lys Ala Val Glu Glu Gly Tyr Arg

885 890 895

Leu Pro Ser Pro Met Asp Cys Pro Ala Ala Leu Tyr Gln Leu Met Leu

900 905 910

Asp Cys Trp Gln Lys Glu Arg Asn Ser Arg Pro Lys Phe Asp Glu Ile

915 920 925

Val Asn Met Leu Asp Lys Leu Ile Arg Asn Pro Ser Ser Leu Lys Thr

930 935 940

Leu Val Asn Ala Ser Cys Arg Val Ser Asn Leu Leu Ala Glu His Ser

945 950 955 960

Pro Leu Gly Ser Gly Ala Tyr Arg Ser Val Gly Glu Trp Leu Glu Ala

965 970 975

Ile Lys Met Gly Arg Tyr Thr Glu Ile Phe Met Glu Asn Gly Tyr Ser

980 985 990

Ser Met Asp Ala Val Ala Gln Val Thr Leu Glu Asp Leu Arg Arg Leu

995 1000 1005

Gly Val Thr Leu Val Gly His Gln Lys Lys Ile Met Asn Ser Leu Gln

1010 1015 1020

Glu Met Lys Val Gln Leu Val Asn Gly Met Val Pro Leu

1025 1030 1035

<210>13

<211>3048

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>13

atgcggggct cggggccccg gggtgcggga caccggcggc ccccaagcgg cggcggcgac 60

acccccatca ccccagcgtc cctggccggc tgctactctg cacctcgacg ggctcccctc 120

tggacgtgcc ttctcctgtg cgccgcactc cggaccctcc tggccagccc cagcaacgaa 180

gtgaatttat tggattcacg cactgtcatg ggggacctgg gatggattgc ttttccaaaa 240

aatgggtggg aagagattgg tgaagtggat gaaaattatg cccctatcca cacataccaa 300

gtatgcaaag tgatggaaca gaatcagaat aactggcttt tgaccagttg gatctccaat 360

gaaggtgctt ccagaatctt catagaactc aaatttaccc tgcgggactg caacagcctt 420

cctggaggac tggggacctg taaggaaacc tttaatatgt attactttga gtcagatgat 480

cagaatggga gaaacatcaa ggaaaaccaa tacatcaaaa ttgataccat tgctgccgat 540

gaaagcttta cagaacttga tcttggtgac cgtgttatga aactgaatac agaggtcaga 600

gatgtaggac ctctaagcaa aaagggattt tatcttgctt ttcaagatgt tggtgcttgc 660

attgctctgg tttctgtgcg tgtatactat aaagaatgcc cttctgtggt acgacacttg 720

gctgtcttcc ctgacaccat cactggagct gattcttccc aattgctcga agtgtcaggc 780

tcctgtgtca accattctgt gaccgatgaa cctcccaaaa tgcactgcag cgccgaaggg 840

gagtggctgg tgcccatcgg gaaatgcatg tgcaaggcag gatatgaaga gaaaaatggc 900

acctgtcaag tgtgcagacc tgggttcttc aaagcctcac ctcacatcca gagctgcggc 960

aaatgtccac ctcacagtta tacccatgag gaagcttcaa cctcttgtgt ctgtgaaaag 1020

gattatttca ggagagagtc tgatccaccc acaatggcat gcacaagacc cccctctgct 1080

cctcggaatg ccatctcaaa tgttaatgaa actagtgtct ttctggaatg gattccgcct 1140

gctgacactg gtggaaggaa agacgtgtca tattatattg catgcaagaa gtgcaactcc 1200

catgcaggtg tgtgtgagga gtgtggcggt catgtcaggt accttccccg gcaaagcggc 1260

ctgaaaaaca cctctgtcat gatggtggat ctactcgctc acacaaacta tacctttgag 1320

attgaggcag tgaatggagt gtccgacttg agcccaggag cccggcagta tgtgtctgta 1380

aatgtaacca caaatcaagc agctccatct ccagtcacca atgtgaaaaa agggaaaatt 1440

gcaaaaaaca gcatctcttt gtcttggcaa gaaccagatc gtcccaatgg aatcatccta 1500

gagtatgaaa tcaagtattt tgaaaaggac caagagacca gctacacgat tatcaaatct 1560

aaagagacaa ctattactgc agagggcttg aaaccagctt cagtttatgt cttccaaatt 1620

cgagcacgta cagcagcagg ctatggtgtc ttcagtcgaa gatttgagtt tgaaaccacc 1680

ccagtgtttg cagcatccag cgatcaaagc cagattcctg taattgctgt gtctgtgaca 1740

gtgggagtca ttttgttggc agtggttatc ggcgtcctcc tcagtggaag gcggtgtggc 1800

tacagcaaag caaaacaaga tccagaagag gaaaagatgc attttcataa tgggcacatt 1860

aaactgccag gagtaagaac ttacattgat ccacatacct atgaggatcc caatcaagct 1920

gtccacgaat ttgctaagga gatagaagca tcatgtatca ccattgagag agttattgga 1980

gcaggtgaat ttggtgaagt ttgtagtgga cgtttgaaac taccaggaaa aagagaatta 2040

cctgtggcta tcaaaaccct taaagtaggc tatactgaaa agcaacgcag agatttccta 2100

ggtgaagcaa gtatcatggg acagtttgat catcctaaca tcatccattt agaaggtgtg 2160

gtgaccaaaa gtaaaccagt gatgatcgtg acagagtata tggagaatgg ctctttagat 2220

acatttttga agaaaaacga tgggcagttc actgtgattc agcttgttgg catgctgaga 2280

ggtatctctg caggaatgaa gtacctttct gacatgggct atgtgcatag agatcttgct 2340

gccagaaaca tcttaatcaa cagtaacctt gtgtgcaaag tgtctgactt tggactttcc 2400

cgggtactgg aagatgatcc cgaggcagcc tacaccacaa ggggaggaaa aattccaatc 2460

agatggactg ccccagaagc aatagctttc cgaaagttta cttctgccag tgatgtctgg 2520

agttatggaa tagtaatgtg ggaagttgtg tcttatggag agagacccta ctgggagatg 2580

accaatcaag atgtgattaa agcggtagag gaaggctatc gtctgccaag ccccatggat 2640

tgtcctgctg ctctctatca gttaatgctg gattgctggc agaaagagcg aaatagcagg 2700

cccaagtttg atgaaatagt caacatgttg gacaagctga tacgtaaccc aagtagtctg 2760

aagacgctgg ttaatgcatc ctgcagagta tctaatttat tggcagaaca tagcccacta 2820

ggatctgggg cctacagatc agtaggtgaa tggctagagg caatcaagat gggccggtat 2880

acagagattt tcatggaaaa tggatacagt tcaatggacg ctgtggctca ggtgaccttg 2940

gaggatttga gacggcttgg agtgactctt gtcggtcacc agaagaagat catgaacagc 3000

cttcaagaaa tgaaggtgca gctggtaaac ggaatggtgc cattgtaa 3048

<210>14

<211>1015

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(60)...(233)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(358)...(452)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(469)...(559)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(653)...(910)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(646)...(1005)

＜223〉SAM domain (invalid α motif)

<400>14

Met Arg Gly Ser Gly Pro Arg Gly Ala Gly His Arg Arg Pro Pro Ser

1 5 10 15

Gly Gly Gly Asp Thr Pro Ile Thr Pro Ala Ser Leu Ala Gly Cys Tyr

20 25 30

Ser Ala Pro Arg Arg Ala Pro Leu Trp Thr Cys Leu Leu Leu Cys Ala

35 40 45

Ala Leu Arg Thr Leu Leu Ala Ser Pro Ser Asn Glu Val Asn Leu Leu

50 55 60

Asp Ser Arg Thr Val Met Gly Asp Leu Gly Trp Ile Ala Phe Pro Lys

65 70 75 80

Asn Gly Trp Glu Glu Ile Gly Glu Val Asp Glu Asn Tyr Ala Pro Ile

85 90 95

His Thr Tyr Gln Val Cys Lys Val Met Glu Gln Asn Gln Asn Asn Trp

100 105 110

Leu Leu Thr Ser Trp Ile Ser Asn Glu Gly Ala Ser Arg Ile Phe Ile

115 120 125

Glu Leu Lys Phe Thr Leu Arg Asp Cys Asn Ser Leu Pro Gly Gly Leu

130 135 140

Gly Thr Cys Lys Glu Thr Phe Asn Met Tyr Tyr Phe Glu Ser Asp Asp

145 150 155 160

Gln Asn Gly Arg Asn Ile Lys Glu Asn Gln Tyr Ile Lys Ile Asp Thr

165 170 175

Ile Ala Ala Asp Glu Ser Phe Thr Glu Leu Asp Leu Gly Asp Arg Val

180 185 190

Met Lys Leu Asn Thr Glu Val Arg Asp Val Gly Pro Leu Ser Lys Lys

195 200 205

Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys Ile Ala Leu Val

210 215 220

Ser Val Arg Val Tyr Tyr Lys Glu Cys Pro Ser Val Val Arg His Leu

225 230 235 240

Ala Val Phe Pro Asp Thr Ile Thr Gly Ala Asp Ser Ser Gln Leu Leu

245 250 255

Glu Val Ser Gly Ser Cys Val Asn His Ser Val Thr Asp Glu Pro Pro

260 265 270

Lys Met His Cys Ser Ala Glu Gly Glu Trp Leu Val Pro Ile Gly Lys

275 280 285

Cys Met Cys Lys Ala Gly Tyr Glu Glu Lys Asn Gly Thr Cys Gln Val

290 295 300

Cys Arg Pro Gly Phe Phe Lys Ala Ser Pro His Ile Gln Ser Cys Gly

305 310 315 320

Lys Cys Pro Pro His Ser Tyr Thr His Glu Glu Ala Ser Thr Ser Cys

325 330 335

Val Cys Glu Lys Asp Tyr Phe Arg Arg Glu Ser Asp Pro Pro Thr Met

340 345 350

Ala Cys Thr Arg Pro Pro Ser Ala Pro Arg Asn Ala Ile Ser Asn Val

355 360 365

Asn Glu Thr Ser Val Phe Leu Glu Trp Ile Pro Pro Ala Asp Thr Gly

370 375 380

Gly Arg Lys Asp Val Ser Tyr Tyr Ile Ala Cys Lys Lys Cys Asn Ser

385 390 395 400

His Ala Gly Val Cys Glu Glu Cys Gly Gly His Val Arg Tyr Leu Pro

405 410 415

Arg Gln Ser Gly Leu Lys Asn Thr Ser Val Met Met Val Asp Leu Leu

420 425 430

Ala His Thr Asn Tyr Thr Phe Glu Ile Glu Ala Val Asn Gly Val Ser

435 440 445

Asp Leu Ser Pro Gly Ala Arg Gln Tyr Val Ser Val Asn Val Thr Thr

450 455 460

Asn Gln Ala Ala Pro Ser Pro Val Thr Asn Val Lys Lys Gly Lys Ile

465 470 475 480

Ala Lys Asn Ser Ile Ser Leu Ser Trp Gln Glu Pro Asp Arg Pro Asn

485 490 495

Gly Ile Ile Leu Glu Tyr Glu Ile Lys Tyr Phe Glu Lys Asp Gln Glu

500 505 510

Thr Ser Tyr Thr Ile Ile Lys Ser Lys Glu Thr Thr Ile Thr Ala Glu

515 520 525

Gly Leu Lys Pro Ala Ser Val Tyr Val Phe Gln Ile Arg Ala Arg Thr

530 535 540

Ala Ala Gly Tyr Gly Val Phe Ser Arg Arg Phe Glu Phe Glu Thr Thr

545 550 555 560

Pro Val Phe Ala Ala Ser Ser Asp Gln Ser Gln Ile Pro Val Ile Ala

565 570 575

Val Ser Val Thr Val Gly Val Ile Leu Leu Ala Val Val Ile Gly Val

580 585 590

Leu Leu Ser Gly Arg Arg Cys Gly Tyr Ser Lys Ala Lys Gln Asp Pro

595 600 605

Glu Glu Glu Lys Met His Phe His Asn Gly His Ile Lys Leu Pro Gly

610 615 620

Val Arg Thr Tyr Ile Asp Pro His Thr Tyr Glu Asp Pro Asn Gln Ala

625 630 635 640

Val His Glu Phe Ala Lys Glu Ile Glu Ala Ser Cys Ile Thr Ile Glu

645 650 655

Arg Val Ile Gly Ala GIy Glu Phe Gly Glu Val Cys Ser Gly Arg Leu

660 665 670

Lys Leu Pro Gly Lys Arg Glu Leu Pro Val Ala Ile Lys Thr Leu Lys

675 680 685

Val Gly Tyr Thr Glu Lys Gln Arg Arg Asp Phe Leu Gly Glu Ala Ser

690 695 700

Ile Met Gly Gln Phe Asp His Pro Asn Ile Ile His Leu Glu Gly Val

705 710 715 720

Val Thr Lys Ser Lys Pro Val Met Ile Val Thr Glu Tyr Met Glu Asn

725 730 735

Gly Ser Leu Asp Thr Phe Leu Lys Lys Asn Asp Gly Gln Phe Thr Val

740 745 750

Ile Gln Leu Val Gly Met Leu Arg Gly Ile Ser Ala Gly Met Lys Tyr

755 760 765

Leu Ser Asp Met Gly Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile

770 775 780

Leu Ile Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser

785 790 795 800

Arg Val Leu Glu Asp Asp Pro Glu Ala Ala Tyr Thr Thr Arg Gly Gly

805 810 815

Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Ala Phe Arg Lys

820 825 830

Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Met Trp Glu

835 840 845

Val Val Ser Tyr Gly Glu Arg Pro Tyr Trp Glu Met Thr Asn Gln Asp

850 855 860

Val Ile Lys Ala Val Glu Glu Gly Tyr Arg Leu Pro Ser Pro Met Asp

865 870 875 880

Cys Pro Ala Ala Leu Tyr Gln Leu Met Leu Asp Cys Trp Gln Lys Glu

885 890 895

Arg Asn Ser Arg Pro Lys Phe Asp Glu Ile Val Asn Met Leu Asp Lys

900 905 910

Leu Ile Arg Asn Pro Ser Ser Leu Lys Thr Leu Val Asn Ala Ser Cys

915 920 925

Arg Val Ser Asn Leu Leu Ala Glu His Ser Pro Leu Gly Ser Gly Ala

930 935 940

Tyr Arg Ser Val Gly Glu Trp Leu Glu Ala Ile Lys Met Gly Arg Tyr

945 950 955 960

Thr Glu Ile Phe Met Glu Asn Gly Tyr Ser Ser Met Asp Ala Val Ala

965 970 975

Gln Val Thr Leu Glu Asp Leu Arg Arg Leu Gly Val Thr Leu Val Gly

980 985 990

His Gln Lys Lys Ile Met Asn Ser Leu Gln Glu Met Lys Val Gln Leu

995 1000 1005

Val Asn Gly Met Val Pro Leu

1010 1015

<210>15

<211>2139

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>15

atggccgcga cagaggagcg gagcctgcac aacttctttg ccaatcggga caagaagaag 60

aaggagcaga gcaaccgggc ggcgagttcc gcgggcgcag caggcagcgc ggcgggagca 120

gtggagctcc gcattctaga gggcggcggg gcgggcgcag ggacctggct gggcgaaggc 180

aggaccgcga gtgcggaggc tgcgggccca ggggccacca ccaaggctgt gaagaatgga 240

aaggcttgga gtaaaaagag ccgcgaaggc ggctactgcg ctgagccgct cgctctgctg 300

gtcaagtttg ggcgacccgc gcggaggagg gtcgggctga ctgccgccgc tgagctgtcc 360

ccggacggga gcgcctgtcc acggcactca ccccctccag cggtggaaat gtggagaacc 420

cgagctcgct cttgcgcgcg cgcgctctct ccggcccaag tgaatagtcc tcgcgcaagc 480

gggacactgt ggtggatgca attcccctcg cctccagccg cgaggagctc cccggcgccg 540

caggcagcgt cctcctccga agcagctgca cctgcaactg ggcagcctgg accctcgtgc 600

cctgttcccg ggacctcgcg cagggggcgc cccgggacac cccctgcggg ccgggtggag 660

gaggaagagg aggaggagga agaagacgtg gacaaggacc cccatcctac ccagaacacc 720

tgcctgcgct gccgccactt ctctttaagg gagaggaaaa gagagcctag gagaaccatg 780

gggggctgcg aagtccggga atttcttttg caatttggtt tcttcttgcc tctgctgaca 840

gcgtggccag gcgactgcag tcacgtctcc aacaaccaag ttgtgttgct tgatacaaca 900

actgtactgg gagagctagg atggaaaaca tatccattaa atgggtggga tgccatcact 960

gaaatggatg aacataatag gcccattcac acataccagg tatgtaatgt aatggaacca 1020

aaccaaaaca actggcttcg tacaaactgg atctcccgtg atgcagctca gaaaatttat 1080

gtggaaatga aattcacact aagggattgt aacagcatcc catgggtctt ggggacttgc 1140

aaagaaacat ttaatctgtt ttatatggaa tcagatgagt cccacggaat taaattcaag 1200

ccaaaccagt atacaaagat cgacacaatt gctgctgatg agagttttac ccagatggat 1260

ttgggtgatc gcatcctcaa actcaacact gaaattcgtg aggtggggcc tatagaaagg 1320

aaaggatttt atctggcttt tcaagacatt ggggcgtgca ttgccctggt ttcagtccgt 1380

gttttctaca agaaatgccc cttcactgtt cgtaacttgg ccatgtttcc tgataccatt 1440

ccaagggttg attcctcctc tttggttgaa gtacggggtt cttgtgtgaa gagtgctgaa 1500

gagcgtgaca ctcctaaact gtattgtgga gctgatggag attggctggt tcctcttgga 1560

aggtgcatct gcagtacagg atatgaagaa attgagggtt cttgccatgc ttgcagacca 1620

ggattctata aagcttttgc tgggaacaca aaatgttcta aatgtcctcc acacagttta 1680

acatacatgg aagcaacttc tgtctgtcag tgtgaaaagg gttatttccg agctgaaaaa 1740

gacccacctt ctatggcatg taccaggcca ccttcagctc ctaggaatgt ggtttttaac 1800

atcaatgaaa cagcccttat tttggaatgg agcccaccaa gtgacacagg agggagaaaa 1860

gatctcacat acagtgtaat ctgtaagaaa tgtggcttag acaccagcca gtgtgaggac 1920

tgtggtggag gactccgctt catcccaaga catacaggcc tgatcaacaa ttccgtgata 1980

gtacttgact ttgtgtctca cgtgaattac acctttgaaa tagaagcaat gaatggagtt 2040

tctgagttga gtttttctcc caagccattc acagctatta cagtgaccac ggatcaagat 2100

ggtaagttcc actgctgttc tctcaaaaca gacccataa 2139

<210>16

<211>712

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(293)...(466)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(591)...(691)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(591)...(682)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(594)...(686)

＜223〉tyrosine kinase, catalyst structure domain

<400>16

Met Ala Ala Thr Glu Glu Arg Ser Leu His Asn Phe Phe Ala Asn Arg

1 5 10 15

Asp Lys Lys Lys Lys Glu Gln Ser Asn Arg Ala Ala Ser Ser Ala Gly

20 25 30

Ala Ala Gly Ser Ala Ala Gly Ala Val Glu Leu Arg Ile Leu Glu Gly

35 40 45

Gly Gly Ala Gly Ala Gly Thr Trp Leu Gly Glu Gly Arg Thr Ala Ser

50 55 60

Ala Glu Ala Ala Gly Pro Gly Ala Thr Thr Lys Ala Val Lys Asn Gly

65 70 75 80

Lys Ala Trp Ser Lys Lys Ser Arg Glu Gly Gly Tyr Cys Ala Glu Pro

85 90 95

Leu Ala Leu Leu Val Lys Phe Gly Arg Pro Ala Arg Arg Arg Val Gly

100 105 110

Leu Thr Ala Ala Ala Glu Leu Ser Pro Asp Gly Ser Ala Cys Pro Arg

115 120 125

His Ser Pro Pro Pro Ala Val Glu Met Trp Arg Thr Arg Ala Arg Ser

130 135 140

Cys Ala Arg Ala Leu Ser Pro Ala Gln Val Asn Ser Pro Arg Ala Ser

145 150 155 160

Gly Thr Leu Trp Trp Met Gln Phe Pro Ser Pro Pro Ala Ala Arg Ser

165 170 175

Ser Pro Ala Pro Gln Ala Ala Ser Ser Ser Glu Ala Ala Ala Pro Ala

180 185 190

Thr Gly Gln Pro Gly Pro Ser Cys Pro Val Pro Gly Thr Ser Arg Arg

195 200 205

Gly Arg Pro Gly Thr Pro Pro Ala Gly Arg Val Glu Glu Glu Glu Glu

210 215 220

Glu Glu Glu Glu Asp Val Asp Lys Asp Pro His Pro Thr Gln Asn Thr

225 230 235 240

Cys Leu Arg Cys Arg His Phe Ser Leu Arg Glu Arg Lys Arg Glu Pro

245 250 255

Arg Arg Thr Met Gly Gly Cys Glu Val Arg Glu Phe Leu Leu Gln Phe

260 265 270

Gly Phe Phe Leu Pro Leu Leu Thr Ala Trp Pro Gly Asp Cys Ser His

275 280 285

Val Ser Asn Asn Gln Val Val Leu Leu Asp Thr Thr Thr Val Leu Gly

290 295 300

Glu Leu Gly Trp Lys Thr Tyr Pro Leu Asn Gly Trp Asp Ala Ile Thr

305 310 315 320

Glu Met Asp Glu His Asn Arg Pro Ile His Thr Tyr Gln Val Cys Asn

325 330 335

Val Met Glu Pro Asn Gln Asn Asn Trp Leu Arg Thr Asn Trp Ile Ser

340 345 350

Arg Asp Ala Ala Gln Lys Ile Tyr Val Glu Met Lys Phe Thr Leu Arg

355 360 365

Asp Cys Asn Ser Ile Pro Trp Val Leu Gly Thr Cys Lys Glu Thr Phe

370 375 380

Asn Leu Phe Tyr Met Glu Ser Asp Glu Ser His Gly Ile Lys Phe Lys

385 390 395 400

Pro Asn Gln Tyr Thr Lys Ile Asp Thr Ile Ala Ala Asp Glu Ser Phe

405 410 415

Thr Gln Met Asp Leu Gly Asp Arg Ile Leu Lys Leu Asn Thr Glu Ile

420 425 430

Arg Glu Val Gly Pro Ile Glu Arg Lys Gly Phe Tyr Leu Ala Phe Gln

435 440 445

Asp Ile Gly Ala Cys Ile Ala Leu Val Ser Val Arg Val Phe Tyr Lys

450 455 460

Lys Cys Pro Phe Thr Val Arg Asn Leu Ala Met Phe Pro Asp Thr Ile

465 470 475 480

Pro Arg Val Asp Ser Ser Ser Leu Val Glu Val Arg Gly Ser Cys Val

485 490 495

Lys Ser Ala Glu Glu Arg Asp Thr Pro Lys Leu Tyr Cys Gly Ala Asp

500 505 510

Gly Asp Trp Leu Val Pro Leu Gly Arg Cys Ile Cys Ser Thr Gly Tyr

515 520 525

Glu Glu Ile Glu Gly Ser Cys His Ala Cys Arg Pro Gly Phe Tyr Lys

530 535 540

Ala Phe Ala Gly Asn Thr Lys Cys Ser Lys Cys Pro Pro His Ser Leu

545 550 555 560

Thr Tyr Met Glu Ala Thr Ser Val Cys Gln Cys Glu Lys Gly Tyr Phe

565 570 575

Arg Ala Glu Lys Asp Pro Pro Ser Met Ala Cys Thr Arg Pro Pro Ser

580 585 590

Ala Pro Arg Asn Val Val Phe Asn Ile Asn Glu Thr Ala Leu Ile Leu

595 600 605

Glu Trp Ser Pro Pro Ser Asp Thr Gly Gly Arg Lys Asp Leu Thr Tyr

610 615 620

Ser Val Ile Cys Lys Lys Cys Gly Leu Asp Thr Ser Gln Cys Glu Asp

625 630 635 640

Cys Gly Gly Gly Leu Arg Phe Ile Pro Arg His Thr Gly Leu Ile Asn

645 650 655

Asn Ser Val Ile Val Leu Asp Phe Val Ser His Val Asn Tyr Thr Phe

660 665 670

Glu Ile Glu Ala Met Asn Gly Val Ser Glu Leu Ser Phe Ser Pro Lys

675 680 685

Pro Phe Thr Ala Ile Thr Val Thr Thr Asp Gln Asp Gly Lys Phe His

690 695 700

Cys Cys Ser Leu Lys Thr Asp Pro

705 710

<210>17

<211>2997

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>17

atggtttttc aaactcggta cccttcatgg attattttat gctacatctg gctgctccgc 60

tttgcacaca caggggaggc gcaggctgcg aaggaagtac tactgctgga ttctaaagca 120

caacaaacag agttggagtg gatttcctct ccacccaatg ggtgggaaga aattagtggt 180

ttggatgaga actatacccc gatacgaaca taccaggtgt gccaagtcat ggagcccaac 240

caaaacaact ggctgcggac taactggatt tccaaaggca atgcacaaag gatttttgta 300

gaattgaaat tcaccctgag ggattgtaac agtcttcctg gagtactggg aacttgcaag 360

gaaacattta atttgtacta ttatgaaaca gactatgaca ctggcaggaa tataagagaa 420

aacctctatg taaaaataga caccattgct gcagatgaaa gttttaccca aggtgacctt 480

ggtgaaagaa agatgaagct taacactgag gtgagagaga ttggaccttt gtccaaaaag 540

ggattctatc ttgcctttca ggatgtaggg gcttgcatag ctttggtttc tgtcaaagtg 600

tactacaaga agtgctggtc cattattgag aacttagcta tctttccaga tacagtgact 660

ggttcagaat tttcctcttt agtcgaggtt cgagggacat gtgtcagcag tgcagaggaa 720

gaagcggaaa acgcccccag gatgcactgc agtgcagaag gagaatggtt agtgcccatt 780

ggaaaatgta tctgcaaagc aggctaccag caaaaaggag acacttgtga accctgtggc 840

cgtgggttct acaagtcttc ctctcaagat cttcagtgct ctcgttgtcc aactcacagt 900

ttttctgata aagaaggctc ctccagatgt gaatgtgaag atgggtatta cagggctcca 960

tctgacccac catacgttgc atgcacaagg cctccatctg caccacagaa cctcattttc 1020

aacatcaacc aaaccacagt aagtttggaa tggagtcctc ctgcagacaa tgggggaaga 1080

aacgatgtga cctacagaat attgtgtaag cggtgcagtt gggagcaggg cgaatgtgtt 1140

ccctgtggga gtaacattgg atacatgccc cagcagactg gattagagga taactatgtc 1200

actgtcatgg acctgctagc ccacgctaat tatacttttg aagttgaagc tgtaaatgga 1260

gtttctgact taagccgatc ccagaggctc tttgctgctg tcagtatcac cactggtcaa 1320

gcagctccct cgcaagtgag cggagtaatg aaggagagag tactgcagcg gagtgtcgag 1380

ctttcctggc aggaaccaga gcatcccaat ggagtcatca cagaatatga aatcaagtat 1440

tacgagaaag atcaaaggga acggacctac tcaacagtaa aaaccaagtc tacttcagcc 1500

tccattaata atctgaaacc aggaacagtg tatgttttcc agattcgggc ttttactgct 1560

gctggttatg gaaattacag tcccagactt gatgttgcta cactagagga agctacaggt 1620

aaaatgtttg aagctacagc tgtctccagt gaacagaatc ctgttattat cattgctgtg 1680

gttgctgtag ctgggaccat cattttggtg ttcatggtct ttggcttcat cattgggaga 1740

aggcactgtg gttatagcaa agctgaccaa gaaggcgatg aagagcttta ctttcatttt 1800

aaatttccag gcaccaaaac ctacattgac cctgaaacct atgaggaccc aaatagagct 1860

gtccatcaat tcgccaagga gctagatgcc tcctgtatta aaattgagcg tgtgattggt 1920

gcaggagaat tcggtgaagt ctgcagtggc cgtttgaaac ttccagggaa aagagatgtt 1980

gcagtagcca taaaaaccct gaaagttggt tacacagaaa aacaaaggag agactttttg 2040

tgtgaagcaa gcatcatggg gcagtttgac cacccaaatg ttgtccattt ggaaggggtt 2100

gttacaagag ggaaaccagt catgatagta atagagttca tggaaaatgg agccctagat 2160

gcatttctca ggaaacatga tgggcaattt acagtcattc agttagtagg aatgctgaga 2220

ggaattgctg ctggaatgag atatttggct gatatgggat atgttcacag ggaccttgca 2280

gctcgcaata ttcttgtcaa cagcaatctc gtttgtaaag tgtcagattt tggcctgtcc 2340

cgagttatag aggatgatcc agaagctgtc tatacaacta ctggtggaaa aattccagta 2400

aggtggacag cacccgaagc catccagtac cggaaattca catcagccag tgatgtatgg 2460

agctatggaa tagtcatgtg ggaagttatg tcttatggag aaagacctta ttgggacatg 2520

tcaaatcaag atgttataaa agcaatagaa gaaggttatc gtttaccagc acccatggac 2580

tgcccagctg gccttcacca gctaatgttg gattgttggc aaaaggagcg tgctgaaagg 2640

ccaaaatttg aacagatagt tggaattcta gacaaaatga ttcgaaaccc aaatagtctg 2700

aaaactcccc tgggaacttg tagtaggcca ataagccctc ttctggatca aaacactcct 2760

gatttcacta ccttttgttc agttggagaa tggctacaag ctattaagat ggaaagatat 2820

aaagataatt tcacggcagc tggctacaat tcccttgaat cagtagccag gatgactatt 2880

gaggatgtga tgagtttagg gatcacactg gttggtcatc aaaagaaaat catgagcagc 2940

attcagacta tgagagcaca aatgctacat ttacatggaa ctggcattca agtgtga 2997

<210>18

<211>998

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(32)...(205)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(275)...(324)

＜223〉Tumor Necrosis Factor Receptors (TNFR) domain

<220>

<221>CHAIN

<222>(332)...(427)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(443)...(534)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(627)...(893)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(924)...(985)

＜223〉SAM domain (invalid α motif)

<400>18

Met Val Phe Gln Thr Arg Tyr Pro Ser Trp Ile Ile Leu Cys Tyr Ile

1 5 10 15

Trp Leu Leu Arg Phe Ala His Thr Gly Glu Ala Gln Ala Ala Lys Glu

20 25 30

Val Leu Leu Leu Asp Ser Lys Ala Gln Gln Thr Glu Leu Glu Trp Ile

35 40 45

Ser Ser Pro Pro Asn Gly Trp Glu Glu Ile Ser Gly Leu Asp Glu Asn

50 55 60

Tyr Thr Pro Ile Arg Thr Tyr Gln Val Cys Gln Val Met Glu Pro Asn

65 70 75 80

Gln Asn Asn Trp Leu Arg Thr Asn Trp Ile Ser Lys Gly Asn Ala Gln

85 90 95

Arg Ile Phe Val Glu Leu Lys Phe Thr Leu Arg Asp Cys Asn Ser Leu

100 105 110

Pro Gly Val Leu Gly Thr Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Tyr

115 120 125

Glu Thr Asp Tyr Asp Thr Gly Arg Asn Ile Arg Glu Asn Leu Tyr Val

130 135 140

Lys Ile Asp Thr Ile Ala Ala Asp Glu Ser Phe Thr Gln Gly Asp Leu

145 150 155 160

Gly Glu Arg Lys Met Lys Leu Asn Thr Glu Val Arg Glu Ile Gly Pro

165 170 175

Leu Ser Lys Lys Gly Phe Tyr Leu Ala Phe Gln Asp Val Gly Ala Cys

180 185 190

Ile Ala Leu Val Ser Val Lys Val Tyr Tyr Lys Lys Cys Trp Ser Ile

195 200 205

Ile Glu Asn Leu Ala Ile Phe Pro Asp Thr Val Thr Gly Ser Glu Phe

210 215 220

Ser Ser Leu Val Glu Val Arg Gly Thr Cys Val Ser Ser Ala Glu Glu

225 230 235 240

Glu Ala Glu Asn Ala Pro Arg Met His Cys Ser Ala Glu Gly Glu Trp

245 250 255

Leu Val Pro Ile Gly Lys Cys Ile Cys Lys Ala Gly Tyr Gln Gln Lys

260 265 270

Gly Asp Thr Cys Glu Pro Cys Gly Arg Gly Phe Tyr Lys Ser Ser Ser

275 280 285

Gln Asp Leu Gln Cys Ser Arg Cys Pro Thr His Ser Phe Ser Asp Lys

290 295 300

Glu Gly Ser Ser Arg Cys Glu Cys Glu Asp Gly Tyr Tyr Arg Ala Pro

305 310 315 320

Ser Asp Pro Pro Tyr Val Ala Cys Thr Arg Pro Pro Ser Ala Pro Gln

325 330 335

Asn Leu Ile Phe Asn Ile Asn Gln Thr Thr Val Ser Leu Glu Trp Ser

340 345 350

Pro Pro Ala Asp Asn Gly Gly Arg Asn Asp Val Thr Tyr Arg Ile Leu

355 360 365

Cys Lys Arg Cys Ser Trp Glu Gln Gly Glu Cys Val Pro Cys Gly Ser

370 375 380

Asn Ile Gly Tyr Met Pro Gln Gln Thr Gly Leu Glu Asp Asn Tyr Val

385 390 395 400

Thr Val Met Asp Leu Leu Ala His Ala Asn Tyr Thr Phe Glu Val Glu

405 410 415

Ala Val Asn Gly Val Ser Asp Leu Ser Arg Ser Gln Arg Leu Phe Ala

420 425 430

Ala Val Ser Ile Thr Thr Gly Gln Ala Ala Pro Ser Gln Val Ser Gly

435 440 445

Val Met Lys Glu Arg Val Leu Gln Arg Ser Val Glu Leu Ser Trp Gln

450 455 460

Glu Pro Glu His Pro Asn Gly Val Ile Thr Glu Tyr Glu Ile Lys Tyr

465 470 475 480

Tyr Glu Lys Asp Gln Arg Glu Arg Thr Tyr Ser Thr Val Lys Thr Lys

485 490 495

Ser Thr Ser Ala Ser Ile Asn Asn Leu Lys Pro Gly Thr Val Tyr Val

500 505 510

Phe Gln Ile Arg Ala Phe Thr Ala Ala Gly Tyr Gly Asn Tyr Ser Pro

515 520 525

Arg Leu Asp Val Ala Thr Leu Glu Glu Ala Thr Gly Lys Met Phe Glu

530 535 540

Ala Thr Ala Val Ser Ser Glu Gln Asn Pro Val Ile Ile Ile Ala Val

545 550 555 560

Val Ala Val Ala Gly Thr Ile Ile Leu Val Phe Met Val Phe Gly Phe

565 570 575

Ile Ile Gly Arg Arg His Cys Gly Tyr Ser Lys Ala Asp Gln Glu Gly

580 585 590

Asp Glu Glu Leu Tyr Phe His Phe Lys Phe Pro Gly Thr Lys Thr Tyr

595 600 605

Ile Asp Pro Glu Thr Tyr Glu Asp Pro Asn Arg Ala Val His Gln Phe

610 615 620

Ala Lys Glu Leu Asp Ala Ser Cys Ile Lys Ile Glu Arg Val Ile Gly

625 630 635 640

Ala Gly Glu Phe Gly Glu Val Cys Ser Gly Arg Leu Lys Leu Pro Gly

645 650 655

Lys Arg Asp Val Ala Val Ala Ile Lys Thr Leu Lys Val Gly Tyr Thr

660 665 670

Glu Lys Gln Arg Arg Asp Phe Leu Cys Glu Ala Ser Ile Met Gly Gln

675 680 685

Phe Asp His Pro Asn Val Val His Leu Glu Gly Val Val Thr Arg Gly

690 695 700

Lys Pro Val Met Ile Val Ile Glu Phe Met Glu Asn Gly Ala Leu Asp

705 710 715 720

Ala Phe Leu Arg Lys His Asp Gly Gln Phe Thr Val Ile Gln Leu Val

725 730 735

Gly Met Leu Arg Gly Ile Ala Ala Gly Met Arg Tyr Leu Ala Asp Met

740 745 750

Gly Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile Leu Val Asn Ser

755 760 765

Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Set Arg Val Ile Glu

770 775 780

Asp Asp Pro Glu Ala Val Tyr Thr Thr Thr Gly Gly Lys Ile Pro Val

785 790 795 800

Arg Trp Thr Ala Pro Glu Ala Ile Gln Tyr Arg Lys Phe Thr Ser Ala

805 810 815

Ser Asp Val Trp Ser Tyr Gly Ile Val Met Trp Glu Val Met Ser Tyr

820 825 830

Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn Gln Asp Val Ile Lys Ala

835 840 845

Ile Glu Glu Gly Tyr Arg Leu Pro Ala Pro Met Asp Cys Pro Ala Gly

850 855 860

Leu His Gln Leu Met Leu Asp Cys Trp Gln Lys Glu Arg Ala Glu Arg

865 870 875 880

Pro Lys Phe Glu Gln Ile Val Gly Ile Leu Asp Lys Met Ile Arg Asn

885 890 895

Pro Asn Ser Leu Lys Thr Pro Leu Gly Thr Cys Ser Arg Pro Ile Ser

900 905 910

Pro Leu Leu Asp Gln Asn Thr Pro Asp Phe Thr Thr Phe Cys Ser Val

915 920 925

Gly Glu Trp Leu Gln Ala Ile Lys Met Glu Arg Tyr Lys Asp Asn Phe

930 935 940

Thr Ala Ala Gly Tyr Asn Ser Leu Glu Ser Val Ala Arg Met Thr Ile

945 950 955 960

Glu Asp Val Met Ser Leu Gly Ile Thr Leu Val Gly His Gln Lys Lys

965 970 975

Ile Met Ser Ser Ile Gln Thr Met Arg Ala Gln Met Leu His Leu His

980 985 990

Gly Thr Gly Ile Gln Val

995

<210>19

<211>3018

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>19

atggcccccg cccggggccg cctgccccct gcgctctggg tcgtcacggc cgcggcggcg 60

gcggccacct gcgtgtccgc ggcgcgcggc gaagtgaatt tgctggacac gtcgaccatc 120

cacggggact ggggctggct cacgtatccg gctcatgggt gggactccat caacgaggtg 180

gacgagtcct tccagcccat ccacacgtac caggtttgca acgtcatgag ccccaaccag 240

aacaactggc tgcgcacgag ctgggtcccc cgagacggcg cccggcgcgt ctatgctgag 300

atcaagttta ccctgcgcga ctgcaacagc atgcctggtg tgctgggcac ctgcaaggag 360

accttcaacc tctactacct ggagtcggac cgcgacctgg gggccagcac acaagaaagc 420

cagttcctca aaatcgacac cattgcggcc gacgagagct tcacaggtgc cgaccttggt 480

gtgcggcgtc tcaagctcaa cacggaggtg cgcagtgtgg gtcccctcag caagcgcggc 540

ttctacctgg ccttccagga cataggtgcc tgcctggcca tcctctctct ccgcatctac 600

tataagaagt gccctgccat ggtgcgcaat ctggctgcct tctcggaggc agtgacgggg 660

gccgactcgt cctcactggt ggaggtgagg ggccagtgcg tgcggcactc agaggagcgg 720

gacacaccca agatgtactg cagcgcggag ggcgagtggc tcgtgcccat cggcaaatgc 780

gtgtgcagtg ccggctacga ggagcggcgg gatgcctgtg tggcctgtga gctgggcttc 840

tacaagtcag cccctgggga ccagctgtgt gcccgctgcc ctccccacag ccactccgca 900

gctccagccg cccaagcctg ccactgtgac ctcagctact accgtgcagc cctggacccg 960

ccgtcctcag cctgcacccg gccaccctcg gcaccagtga acctgatctc cagtgtgaat 1020

gggacatcag tgactctgga gtgggcccct cccctggacc caggtggccg cagtgacatc 1080

acctacaatg ccgtgtgccg ccgctgcccc tgggcactga gccgctgcga ggcatgtggg 1140

agcggcaccc gctttgtgcc ccagcagaca agcctggtgc aggccagcct gctggtggcc 1200

aacctgctgg cccacatgaa ctactccttc tggatcgagg ccgtcaatgg cgtgtccgac 1260

ctgagccccg agccccgccg ggccgctgtg gtcaacatca ccacgaacca ggcagccccg 1320

tcccaggtgg tggtgatccg tcaagagcgg gcggggcaga ccagcgtctc gctgctgtgg 1380

caggagcccg agcagccgaa cggcatcatc ctggagtatg agatcaagta ctacgagaag 1440

gacaaggaga tgcagagcta ctccaccctc aaggccgtca ccaccagagc caccgtctcc 1500

ggcctcaagc cgggcacccg ctacgtgttc caggtccgag cccgcacctc agcaggctgt 1560

ggccgcttca gccaggccat ggaggtggag accgggaaac cccggccccg ctatgacacc 1620

aggaccattg tctggatctg cctgacgctc atcacgggcc tggtggtgct tctgctcctg 1680

ctcatctgca agaagaggca ctgtggctac agcaaggcct tccaggactc ggacgaggag 1740

aagatgcact atcagaatgg acaggcaccc ccacctgtct tcctgcctct gcatcacccc 1800

ccgggaaagc tcccagagcc ccagttctat gcggaacccc acacctacga ggagccaggc 1860

cgggcgggcc gcagtttcac tcgggagatc gaggcctcta ggatccacat cgagaaaatc 1920

atcggctctg gagactccgg ggaagtctgc tacgggaggc tgcgggtgcc agggcagcgg 1980

gatgtgcccg tggccatcaa ggccctcaaa gccggctaca cggagagaca gaggcgggac 2040

ttcctgagcg aggcgtccat catggggcaa ttcgaccatc ccaacatcat ccgcctcgag 2100

ggtgtcgtca cccgtggccg cctggcaatg attgtgactg agtacatgga gaacggctct 2160

ctggacacct tcctgaggac ccacgacggg cagttcacca tcatgcagct ggtgggcatg 2220

ctgagaggag tgggtgccgg catgcgctac ctctcagacc tgggctatgt ccaccgagac 2280

ctggccgccc gcaacgtcct ggttgacagc aacctggtct gcaaggtgtc tgacttcggg 2340

ctctcacggg tgctggagga cgacccggat gctgcctaca ccaccacggg cgggaagatc 2400

cccatccgct ggacggcccc agaggccatc gccttccgca ccttctcctc ggccagcgac 2460

gtgtggagct tcggcgtggt catgtgggag gtgctggcct atggggagcg gccctactgg 2520

aacatgacca accgggatgt catcagctct gtggaggagg ggtaccgcct gcccgcaccc 2580

atgggctgcc cccacgccct gcaccagctc atgctcgact gttggcacaa ggaccgggcg 2640

cagcggcctc gcttctccca gattgtcagt gtcctcgatg cgctcatccg cagccctgag 2700

agtctcaggg ccaccgccac agtcagcagg tgcccacccc ctgccttcgt ccggagctgc 2760

tttgacctcc gagggggcag cggtggcggt gggggcctca ccgtggggga ctggctggac 2820

tccatccgca tgggccggta ccgagaccac ttcgctgcgg gcggatactc ctctctgggc 2880

atggtgctac gcatgaacgc ccaggacgtg cgcgccctgg gcatcaccct catgggccac 2940

cagaagaaga tcctgggcag cattcagacc atgcgggccc agctgaccag cacccagggg 3000

ccccgccggc acctctga 3018

<210>20

<211>1005

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(31)...(204)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(191)...(325)

＜223〉be rich in the zone of cysteine

<220>

<221>CHAIN

<222>(329)...(424)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(440)...(531)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(635)...(892)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(934)...(992)

＜223〉SAM domain (invalid α motif)

<400>20

Met Ala Pro Ala Arg Gly Arg Leu Pro Pro Ala Leu Trp Val Val Thr

1 5 10 15

Ala Ala Ala Ala Ala Ala Thr Cys Val Ser Ala Ala Arg Gly Glu Val

20 25 30

Asn Leu Leu Asp Thr Ser Thr Ile His Gly Asp Trp Gly Trp Leu Thr

35 40 45

Tyr Pro Ala His Gly Trp Asp Ser Ile Asn Glu Val Asp Glu Ser Phe

50 55 60

Gln Pro Ile His Thr Tyr Gln Val Cys Asn Val Met Ser Pro Asn Gln

65 70 75 80

Asn Asn Trp Leu Arg Thr Ser Trp Val Pro Arg Asp Gly Ala Arg Arg

85 90 95

Val Tyr Ala Glu Ile Lys Phe Thr Leu Arg Asp Cys Asn Ser Met Pro

100 105 110

Gly Val Leu Gly Thr Cys Lys Glu Thr Phe Asn Leu Tyr Tyr Leu Glu

115 120 125

Ser Asp Arg Asp Leu Gly Ala Ser Thr Gln Glu Ser Gln Phe Leu Lys

130 135 140

Ile Asp Thr Ile Ala Ala Asp Glu Ser Phe Thr Gly Ala Asp Leu Gly

145 150 155 160

Val Arg Arg Leu Lys Leu Asn Thr Glu Val Arg Ser Val Gly Pro Leu

165 170 175

Ser Lys Arg Gly Phe Tyr Leu Ala Phe Gln Asp Ile Gly Ala Cys Leu

180 185 190

Ala Ile Leu Ser Leu Arg Ile Tyr Tyr Lys Lys Cys Pro Ala Met Val

195 200 205

Arg Asn Leu Ala Ala Phe Ser Glu Ala Val Thr Gly Ala Asp Ser Ser

210 215 220

Ser Leu Val Glu Val Arg Gly Gln Cys Val Arg His Ser Glu Glu Arg

225 230 235 240

Asp Thr Pro Lys Met Tyr Cys Ser Ala Glu Gly Glu Trp Leu Val Pro

245 250 255

Ile Gly Lys Cys Val Cys Ser Ala Gly Tyr Glu Glu Arg Arg Asp Ala

260 265 270

Cys Val Ala Cys Glu Leu Gly Phe Tyr Lys Ser Ala Pro Gly Asp Gln

275 280 285

Leu Cys Ala Arg Cys Pro Pro His Ser His Ser Ala Ala Pro Ala Ala

290 295 300

Gln Ala Cys His Cys Asp Leu Ser Tyr Tyr Arg Ala Ala Leu Asp Pro

305 310 315 320

Pro Ser Ser Ala Cys Thr Arg Pro Pro Ser Ala Pro Val Asn Leu Ile

325 330 335

Ser Ser Val Asn Gly Thr Ser Val Thr Leu Glu Trp Ala Pro Pro Leu

340 345 350

Asp Pro Gly Gly Arg Ser Asp Ile Thr Tyr Asn Ala Val Cys Arg Arg

355 360 365

Cys Pro Trp Ala Leu Ser Arg Cys Glu Ala Cys Gly Ser Gly Thr Arg

370 375 380

Phe Val Pro Gln Gln Thr Ser Leu Val Gln Ala Ser Leu Leu Val Ala

385 390 395 400

Asn Leu Leu Ala His Met Asn Tyr Ser Phe Trp Ile Glu Ala Val Asn

405 410 415

Gly Val Ser Asp Leu Ser Pro Glu Pro Arg Arg Ala Ala Val Val Asn

420 425 430

Ile Thr Thr Asn Gln Ala Ala Pro Ser Gln Val Val Val Ile Arg Gln

435 440 445

Glu Arg Ala Gly Gln Thr Ser Val Ser Leu Leu Trp Gln Glu Pro Glu

450 455 460

Gln Pro Asn Gly Ile Ile Leu Glu Tyr Glu Ile Lys Tyr Tyr Glu Lys

465 470 475 480

Asp Lys Glu Met Gln Ser Tyr Ser Thr Leu Lys Ala Val Thr Thr Arg

485 490 495

Ala Thr Val Ser Gly Leu Lys Pro Gly Thr Arg Tyr Val Phe Gln Val

500 505 510

Arg Ala Arg Thr Ser Ala Gly Cys Gly Arg Phe Ser Gln Ala Met Glu

515 520 525

Val Glu Thr Gly Lys Pro Arg Pro Arg Tyr Asp Thr Arg Thr Ile Val

530 535 540

Trp Ile Cys Leu Thr Leu Ile Thr Gly Leu Val Val Leu Leu Leu Leu

545 550 555 560

Leu Ile Cys Lys Lys Arg His Cys Gly Tyr Ser Lys Ala Phe Gln Asp

565 570 575

Ser Asp Glu Glu Lys Met His Tyr Gln Asn Gly Gln Ala Pro Pro Pro

580 585 590

Val Phe Leu Pro Leu His His Pro Pro Gly Lys Leu Pro Glu Pro Gln

595 600 605

Phe Tyr Ala Glu Pro His Thr Tyr Glu Glu Pro Gly Arg Ala Gly Arg

610 615 620

Ser Phe Thr Arg Glu Ile Glu Ala Ser Arg Ile His Ile Glu Lys Ile

625 630 635 640

Ile Gly Ser Gly Asp Ser Gly Glu Val Cys Tyr Gly Arg Leu Arg Val

645 650 655

Pro Gly Gln Arg Asp Val Pro Val Ala Ile Lys Ala Leu Lys Ala Gly

660 665 670

Tyr Thr Glu Arg Gln Arg Arg Asp Phe Leu Ser Glu Ala Ser Ile Met

675 680 685

Gly Gln Phe Asp His Pro Asn Ile Ile Arg Leu Glu Gly Val Val Thr

690 695 700

Arg Gly Arg Leu Ala Met Ile Val Thr Glu Tyr Met Glu Asn Gly Ser

705 710 715 720

Leu Asp Thr Phe Leu Arg Thr His Asp Gly Gln Phe Thr Ile Met Gln

725 730 735

Leu Val Gly Met Leu Arg Gly Val Gly Ala Gly Met Arg Tyr Leu Ser

740 745 750

Asp Leu Gly Tyr Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val

755 760 765

Asp Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser Arg Val

770 775 780

Leu Glu Asp Asp Pro Asp Ala Ala Tyr Thr Thr Thr Gly Gly Lys Ile

785 790 795 800

Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Ala Phe Arg Thr Phe Ser

805 810 815

Ser Ala Ser Asp Val Trp Ser Phe Gly Val Val Met Trp Glu Val Leu

820 825 830

Ala Tyr Gly Glu Arg Pro Tyr Trp Asn Met Thr Asn Arg Asp Val Ile

835 840 845

Ser Ser Val Glu Glu Gly Tyr Arg Leu Pro Ala Pro Met Gly Cys Pro

850 855 860

His Ala Leu His Gln Leu Met Leu Asp Cys Trp His Lys Asp Arg Ala

865 870 875 880

Gln Arg Pro Arg Phe Ser Gln Ile Val Ser Val Leu Asp Ala Leu Ile

885 890 895

Arg Ser Pro Glu Ser Leu Arg Ala Thr Ala Thr Val Ser Arg Cys Pro

900 905 910

Pro Pro Ala Phe Val Arg Ser Cys Phe Asp Leu Arg Gly Gly Ser Gly

915 920 925

Gly Gly Gly Gly Leu Thr Val Gly Asp Trp Leu Asp Ser Ile Arg Met

930 935 940

Gly Arg Tyr Arg Asp His Phe Ala Ala Gly Gly Tyr Ser Ser Leu Gly

945 950 955 960

Met Val Leu Arg Met Asn Ala Gln Asp Val Arg Ala Leu Gly Ile Thr

965 970 975

Leu Met Gly His Gln Lys Lys Ile Leu Gly Ser Ile Gln Thr Met Arg

980 985 990

Ala Gln Leu Thr Ser Thr Gln Gly Pro Arg Arg His Leu

995 1000 1005

<210>21

<211>2955

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>21

atggccctgg attatctact actgctcctc ctggcatccg cagtggctgc gatggaagaa 60

acgttaatgg acaccagaac ggctactgca gagctgggct ggacggccaa tcctgcgtcc 120

gggtgggaag aagtcagtgg ctacgatgaa aacctgaaca ccatccgcac ctaccaggtg 180

tgcaatgtct tcgagcccaa ccagaacaat tggctgctca ccaccttcat caaccggcgg 240

ggggcccatc gcatctacac agagatgcgc ttcactgtga gagactgcag cagcctccct 300

aatgtcccag gatcctgcaa ggagaccttc aacttgtatt actatgagac tgactctgtc 360

attgccacca agaagtcagc cttctggtct gaggccccct acctcaaagt agacaccatt 420

gctgcagatg agagcttctc ccaggtggac tttgggggaa ggctgatgaa ggtaaacaca 480

gaagtcagga gctttgggcc tcttactcgg aatggttttt acctcgcttt tcaggattat 540

ggagcctgta tgtctcttct ttctgtccgt gtcttcttca aaaagtgtcc cagcattgtg 600

caaaattttg cagtgtttcc agagactatg acaggggcag agagcacatc tctggtgatt 660

gctcggggca catgcatccc caacgcagag gaagtggacg tgcccatcaa actctactgc 720

aacggggatg gggaatggat ggtgcctatt gggcgatgca cctgcaagcc tggctatgag 780

cctgagaaca gcgtggcatg caaggcttgc cctgcaggga cattcaaggc cagccaggaa 840

gctgaaggct gctcccactg cccctccaac agccgctccc ctgcagaggc gtctcccatc 900

tgcacctgtc ggaccggtta ttaccgagcg gactttgacc ctccagaagt ggcatgcact 960

agcgtcccat caggtccccg caatgttatc tccatcgtca atgagacgtc catcattctg 1020

gagtggcacc ctccaaggga gacaggtggg cgggatgatg tgacctacaa catcatctgc 1080

aaaaagtgcc gggcagaccg ccggagctgc tcccgctgtg acgacaatgt ggagtttgtg 1140

cccaggcagc tgggcctgac ggagtgccgc gtctccatca gcagcctgtg ggcccacacc 1200

ccctacacct ttgacatcca ggccatcaat ggagtctcca gcaagagtcc cttcccccca 1260

cagcacgtct ctgtcaacat caccacaaac caagccgccc cctccaccgt tcccatcatg 1320

caccaagtca gtgccactat gaggagcatc accttgtcat ggccacagcc ggagcagccc 1380

aatggcatca tcctggacta tgagatccgg tactatgaga aggaacacaa tgagttcaac 1440

tcctccatgg ccaggagtca gaccaacaca gcaaggattg atgggctgcg gcctggcatg 1500

gtatatgtgg tacaggtgcg tgcccgcact gttgctggct acggcaagtt cagtggcaag 1560

atgtgcttcc agactctgac tgacgatgat tacaagtcag agctgaggga gcagctgccc 1620

ctgattgctg gctcggcagc ggccggggtc gtgttcgttg tgtccttggt ggccatctct 1680

atcgtctgta gcaggaaacg ggcttatagc aaagaggctg tgtacagcga taagctccag 1740

cattacagca caggccgagg ctccccaggg atgaagatct acattgaccc cttcacttat 1800

gaggatccca acgaagctgt ccgggagttt gccaaggaga ttgatgtatc ttttgtgaaa 1860

attgaagagg tcatcggagc aggggagttt ggagaagtgt acaaggggcg tttgaaactg 1920

ccaggcaaga gggaaatcta cgtggccatc aagaccctga aggcagggta ctcggagaag 1980

cagcgtcggg actttctgag tgaggcgagc atcatgggcc agttcgacca tcctaacatc 2040

attcgcctgg agggtgtggt caccaagagt cggcctgtca tgatcatcac agagttcatg 2100

gagaatggtg cattggattc tttcctcagg caaaatgacg ggcagttcac cgtgatccag 2160

cttgtgggta tgctcagggg catcgctgct ggcatgaagt acctggctga gatgaattat 2220

gtgcatcggg acctggctgc taggaacatt ctggtcaaca gtaacctggt gtgcaaggtg 2280

tccgactttg gcctctcccg ctacctccag gatgacacct cagatcccac ctacaccagc 2340

tccttgggag ggaagatccc tgtgagatgg acagctccag aggccatcgc ctaccgcaag 2400

ttcacttcag ccagcgacgt ttggagctat gggatcgtca tgtgggaagt catgtcattt 2460

ggagagagac cctattggga tatgtccaac caagatgtca tcaatgccat cgagcaggac 2520

taccggctgc ccccacccat ggactgtcca gctgctctac accagctcat gctggactgt 2580

tggcagaagg accggaacag ccggccccgg tttgcggaga ttgtcaacac cctagataag 2640

atgatccgga acccggcaag tctcaagact gtggcaacca tcaccgccgt gccttcccag 2700

cccctgctcg accgctccat cccagacttc acggccttta ccaccgtgga tgactggctc 2760

agcgccatca aaatggtcca gtacagggac agcttcctca ctgctggctt cacctccctc 2820

cagctggtca cccagatgac atcagaagac ctcctgagaa taggcatcac cttggcaggc 2880

catcagaaga agatcctgaa cagcattcat tctatgaggg tccagataag tcagtcacca 2940

acggcaatgg catga 2955

<210>22

<211>984

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(19)...(196)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(255)...(317)

＜223〉Tumor Necrosis Factor Receptors (TNFR) domain

<220>

<221>CHAIN

<222>(323)...(423)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(437)...(518)

＜223〉III type fibronectin domain

<220>

<221>CHAIN

<222>(613)...(881)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(908)...(973)

＜223〉SAM domain (invalid α motif)

<400>22

Met Ala Leu Asp Tyr Leu Leu Leu Leu Leu Leu Ala Ser Ala Val Ala

1 5 10 15

Ala Met Glu Glu Thr Leu Met Asp Thr Arg Thr Ala Thr Ala Glu Leu

20 25 30

Gly Trp Thr Ala Asn Pro Ala Ser Gly Trp Glu Glu Val Ser Gly Tyr

35 40 45

Asp Glu Asn Leu Asn Thr Ile Arg Thr Tyr Gln Val Cys Asn Val Phe

50 55 60

Glu Pro Asn Gln Asn Asn Trp Leu Leu Thr Thr Phe Ile Asn Arg Arg

65 70 75 80

Gly Ala His Arg Ile Tyr Thr Glu Met Arg Phe Thr Val Arg Asp Cys

85 90 95

Ser Ser Leu Pro Asn Val Pro Gly Ser Cys Lys Glu Thr Phe Asn Leu

100 105 110

Tyr Tyr Tyr Glu Thr Asp Ser Val Ile Ala Thr Lys Lys Ser Ala Phe

115 120 125

Trp Ser Glu Ala Pro Tyr Leu Lys Val Asp Thr Ile Ala Ala Asp Glu

130 135 140

Ser Phe Ser Gln Val Asp Phe Gly Gly Arg Leu Met Lys Val Asn Thr

145 150 155 160

Glu Val Arg Ser Phe Gly Pro Leu Thr Arg Asn Gly Phe Tyr Leu Ala

165 170 175

Phe Gln Asp Tyr Gly Ala Cys Met Ser Leu Leu Ser Val Arg Val Phe

180 185 190

Phe Lys Lys Cys Pro Ser Ile Val Gln Asn Phe Ala Val Phe Pro Glu

195 200 205

Thr Met Thr Gly Ala Glu Ser Thr Ser Leu Val Ile Ala Arg Gly Thr

210 215 220

Cys Ile Pro Asn Ala Glu Glu Val Asp Val Pro Ile Lys Leu Tyr Cys

225 230 235 240

Asn Gly Asp Gly Glu Trp Met Val Pro Ile Gly Arg Cys Thr Cys Lys

245 250 255

Pro Gly Tyr Glu Pro Glu Asn Ser Val Ala Cys Lys Ala Cys Pro Ala

260 265 270

Gly Thr Phe Lys Ala Ser Gln Glu Ala Glu Gly Cys Ser His Cys Pro

275 280 285

Ser Asn Ser Arg Ser Pro Ala Glu Ala Ser Pro Ile Cys Thr Cys Arg

290 295 300

Thr Gly Tyr Tyr Arg Ala Asp Phe Asp Pro Pro Glu Val Ala Cys Thr

305 310 315 320

Ser Val Pro Ser Gly Pro Arg Asn Val Ile Ser Ile Val Asn Glu Thr

325 330 335

Ser Ile Ile Leu Glu Trp His Pro Pro Arg Glu Thr Gly Gly Arg Asp

340 345 350

Asp Val Thr Tyr Asn Ile Ile Cys Lys Lys Cys Arg Ala Asp Arg Arg

355 360 365

Ser Cys Ser Arg Cys Asp Asp Asn Val Glu Phe Val Pro Arg Gln Leu

370 375 380

Gly Leu Thr Glu Cys Arg Val Ser Ile Ser Ser Leu Trp Ala His Thr

385 390 395 400

Pro Tyr Thr Phe Asp Ile Gln Ala Ile Asn Gly Val Ser Ser Lys Ser

405 410 415

Pro Phe Pro Pro Gln His Val Ser Val Asn Ile Thr Thr Asn Gln Ala

420 425 430

Ala Pro Ser Thr Val Pro Ile Met His Gln Val Ser Ala Thr Met Arg

435 440 445

Ser Ile Thr Leu Ser Trp Pro Gln Pro Glu Gln Pro Asn Gly Ile Ile

450 455 460

Leu Asp Tyr Glu Ile Arg Tyr Tyr Glu Lys Glu His Asn Glu Phe Asn

465 470 475 480

Ser Ser Met Ala Arg Ser Gln Thr Asn Thr Ala Arg Ile Asp Gly Leu

485 490 495

Arg Pro Gly Met Val Tyr Val Val Gln Val Arg Ala Arg Thr Val Ala

500 505 510

Gly Tyr Gly Lys Phe Ser Gly Lys Met Cys Phe Gln Thr Leu Thr Asp

515 520 525

Asp Asp Tyr Lys Ser Glu Leu Arg Glu Gln Leu Pro Leu Ile Ala Gly

530 535 540

Ser Ala Ala Ala Gly Val Val Phe Val Val Ser Leu Val Ala Ile Ser

545 550 555 560

Ile Val Cys Ser Arg Lys Arg Ala Tyr Ser Lys Glu Ala Val Tyr Ser

565 570 575

Asp Lys Leu Gln His Tyr Ser Thr Gly Arg Gly Ser Pro Gly Met Lys

580 585 590

Ile Tyr Ile Asp Pro Phe Thr Tyr Glu Asp Pro Asn Glu Ala Val Arg

595 600 605

Glu Phe Ala Lys Glu Ile Asp Val Ser Phe Val Lys Ile Glu Glu Val

610 615 620

Ile Gly Ala Gly Glu Phe Gly Glu Val Tyr Lys Gly Arg Leu Lys Leu

625 630 635 640

Pro Gly Lys Arg Glu Ile Tyr Val Ala Ile Lys Thr Leu Lys Ala Gly

645 650 655

Tyr Ser Glu Lys Gln Arg Arg Asp Phe Leu Ser Glu Ala Ser Ile Met

660 665 670

Gly Gln Phe Asp His Pro Asn Ile Ile Arg Leu Glu Gly Val Val Thr

675 680 685

Lys Ser Arg Pro Val Met Ile Ile Thr Glu Phe Met Glu Asn Gly Ala

690 695 700

Leu Asp Ser Phe Leu Arg Gln Asn Asp Gly Gln Phe Thr Val Ile Gln

705 710 715 720

Leu Val Gly Met Leu Arg Gly Ile Ala Ala Gly Met Lys Tyr Leu Ala

725 730 735

Glu Met Asn Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile Leu Val

740 745 750

Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser Arg Tyr

755 760 765

Leu Gln Asp Asp Thr Ser Asp Pro Thr Tyr Thr Ser Ser Leu Gly Gly

770 775 780

Lys Ile Pro Val Arg Trp Thr Ala Pro Glu Ala Ile Ala Tyr Arg Lys

785 790 795 800

Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Met Trp Glu

805 810 815

Val Met Ser Phe Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn Gln Asp

820 825 830

Val Ile Asn Ala Ile Glu Gln Asp Tyr Arg Leu Pro Pro Pro Met Asp

835 840 845

Cys Pro Ala Ala Leu His Gln Leu Met Leu Asp Cys Trp Gln Lys Asp

850 855 860

Arg Asn Ser Arg Pro Arg Phe Ala Glu Ile Val Asn Thr Leu Asp Lys

865 870 875 880

Met Ile Arg Asn Pro Ala Ser Leu Lys Thr Val Ala Thr Ile Thr Ala

885 890 895

Val Pro Ser Gln Pro Leu Leu Asp Arg Ser Ile Pro Asp Phe Thr Ala

900 905 910

Phe Thr Thr Val Asp Asp Trp Leu Ser Ala Ile Lys Met Val Gln Tyr

915 920 925

Arg Asp Ser Phe Leu Thr Ala Gly Phe Thr Ser Leu Gln Leu Val Thr

930 935 940

Gln Met Thr Ser Glu Asp Leu Leu Arg Ile Gly Ile Thr Leu Ala Gly

945 950 955 960

His Gln Lys Lys Ile Leu Asn Ser Ile His Ser Met Arg Val Gln Ile

965 970 975

Ser Gln Ser Pro Thr Ala Met Ala

980

<210>23

<211>3168

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>23

atggctctgc ggaggctggg ggccgcgctg ctgctgctgc cgctgctcgc cgccgtggaa 60

gaaacgctaa tggactccac tacagcgact gctgagctgg gctggatggt gcatcctcca 120

tcagggtggg aagaggtgag tggctacgat gagaacatga acacgatccg cacgtaccag 180

gtgtgcaacg tgtttgagtc aagccagaac aactggctacggaccaagtt tatccggcgc 240

cgtggcgccc accgcatcca cgtggagatg aagttttcgg tgcgtgactg cagcagcatc 300

cccagcgtgc ctggctcctg caaggagacc ttcaacctct attactatga ggctgacttt 360

gactcggcca ccaagacctt ccccaactgg atggagaatc catgggtgaa ggtggatacc 420

attgcagccg acgagagctt ctcccaggtg gacctgggtg gccgcgtcat gaaaatcaac 480

accgaggtgc ggagcttcgg acctgtgtcc cgcagcggct tctacctggc cttccaggac 540

tatggcggct gcatgtccct catcgccgtg cgtgtcttct accgcaagtg cccccgcatc 600

atccagaatg gcgccatctt ccaggaaacc ctgtcggggg ctgagagcac atcgctggtg 660

gctgcccggg gcagctgcat cgccaatgcg gaagaggtgg atgtacccat caagctctac 720

tgtaacgggg acggcgagtg gctggtgccc atcgggcgct gcatgtgcaa agcaggcttc 780

gaggccgttg agaatggcac cgtctgccga ggttgtccat ctgggacttt caaggccaac 840

caaggggatg aggcctgtac ccactgtccc atcaacagcc ggaccacttc tgaaggggcc 900

accaactgtg tctgccgcaa tggctactac agagcagacc tggaccccct ggacatgccc 960

tgcacaacca tcccctccgc gccccaggct gtgatttcca gtgtcaatga gacctccctc 1020

atgctggagt ggacccctcc ccgcgactcc ggaggccgag aggacctcgt ctacaacatc 1080

atctgcaaga gctgtggctc gggccggggt gcctgcaccc gctgcgggga caatgtacag 1140

tacgcaccac gccagctagg cctgaccgag ccacgcattt acatcagtga cctgctggcc 1200

cacacccagt acaccttcga gatccaggct gtgaacggcg ttactgacca gagccccttc 1260

tcgcctcagt tcgcctctgt gaacatcacc accaaccagg cagctccatc ggcagtgtcc 1320

atcatgcatc aggtgagccg caccgtggac agcattaccc tgtcgtggtc ccagccagac 1380

cagcccaatg gcgtgatcct ggactatgag ctgcagtact atgagaagga gctcagtgag 1440

tacaacgcca cagccataaa aagccccacc aacacggtca ccgtgcaggg cctcaaagcc 1500

ggcgccatct atgtcttcca ggtgcgggca cgcaccgtgg caggctacgg gcgctacagc 1560

ggcaagatgt acttccagac catgacagaa gccgagtacc agacaagcat ccaggagaag 1620

ttgccactca tcatcggctc ctcggccgct ggcctggtct tcctcattgc tgtggttgtc 1680

atcgccatcg tgtgtaacag acgggggttt gagcgtgctg actcggagta cacggacaag 1740

ctgcaacact acaccagtgg ccacatgacc ccaggcatga agatctacat cgatcctttc 1800

acctacgagg accccaacga ggcagtgcgg gagtttgcca aggaaattga catctcctgt 1860

gtcaaaattg agcaggtgat cggagcaggg gagtttggcg aggtctgcag tggccacctg 1920

aagctgccag gcaagagaga gatctttgtg gccatcaaga cgctcaagtc gggctacacg 1980

gagaagcagc gccgggactt cctgagcgaa gcctccatca tgggccagtt cgaccatccc 2040

aacgtcatcc acctggaggg tgtcgtgacc aagagcacac ctgtgatgat catcaccgag 2100

ttcatggaga atggctccct ggactccttt ctccggcaaa acgatgggca gttcacagtc 2160

atccagctgg tgggcatgct tcggggcatc gcagctggca tgaagtacct ggcagacatg 2220

aactatgttc accgtgacct ggctgcccgc aacatcctcg tcaacagcaa cctggtctgc 2280

aaggtgtcgg actttgggct ctcacgcttt ctagaggacg atacctcaga ccccacctac 2340

accagtgccc tgggcggaaa gatccccatc cgctggacag ccccggaagc catccagtac 2400

cggaagttca cctcggccag tgatgtgtgg agctacggca ttgtcatgtg ggaggtgatg 2460

tcctatgggg agcggcccta ctgggacatg accaaccagg atgtaatcaa tgccattgag 2520

caggactatc ggctgccacc gcccatggac tgcccgagcg ccctgcacca actcatgctg 2580

gactgttggc agaaggaccg caaccaccgg cccaagttcg gccaaattgt caacacgcta 2640

gacaagatga tccgcaatcc caacagcctc aaagccatgg cgcccctctc ctctggcatc 2700

aacctgccgc tgctggaccg cacgatcccc gactacacca gctttaacac ggtggacgag 2760

tggctggagg ccatcaagat ggggcagtac aaggagagct tcgccaatgc cggcttcacc 2820

tcctttgacg tcgtgtctca gatgatgatg gaggacattc tccgggttgg ggtcactttg 2880

gctggccacc agaaaaaaat cctgaacagt atccaggtga tgcgggcgca gatgaaccag 2940

attcagtctg tggagggcca gccactcgcc aggaggccac gggccacggg aagaaccaag 3000

cggtgccagc cacgagacgt caccaagaaa acatgcaact caaacgacgg aaaaaaaaag 3060

ggaatgggaa aaaagaaaac agatcctggg agggggcggg aaatacaagg aatatttttt 3120

aaagaggatt ctcataagga aagcaatgac tgttcttgcg ggggataa 3168

<210>24

<211>1055

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(20)...(197)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(332)...(419)

＜223〉III type fibronectin domain

<220>

<221>CHAIN

<222>(439)...(520)

＜223〉III type fibronectin domain

<220>

<221>CHAIN

<222>(615)...(883)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(910)...(977)

＜223〉SAM domain (invalid α motif)

<400>24

Met Ala Leu Arg Arg Leu Gly Ala Ala Leu Leu Leu Leu Pro Leu Leu

1 5 10 15

Ala Ala Val Glu Glu Thr Leu Met Asp Ser Thr Thr Ala Thr Ala Glu

20 25 30

Leu Gly Trp Met Val His Pro Pro Ser Gly Trp Glu Glu Val Ser Gly

35 40 45

Tyr Asp Glu Asn Met Asn Thr Ile Arg Thr Tyr Gln Val Cys Asn Val

50 55 60

Phe Glu Ser Ser Gln Asn Asn Trp Leu Arg Thr Lys Phe Ile Arg Arg

65 70 75 80

Arg Gly Ala His Arg Ile His Val Glu Met Lys Phe Ser Val Arg Asp

85 90 95

Cys Ser Ser Ile Pro Ser Val Pro Gly Ser Cys Lys Glu Thr Phe Asn

100 105 110

Leu Tyr Tyr Tyr Glu Ala Asp Phe Asp Ser Ala Thr Lys Thr Phe Pro

115 120 125

Asn Trp Met Glu Asn Pro Trp Val Lys Val Asp Thr Ile Ala Ala Asp

130 135 140

Glu Ser Phe Ser Gln Val Asp Leu Gly Gly Arg Val Met Lys Ile Asn

145 150 155 160

Thr Glu Val Arg Ser Phe Gly Pro Val Ser Arg Ser Gly Phe Tyr Leu

165 170 175

Ala Phe Gln Asp Tyr Gly Gly Cys Met Ser Leu Ile Ala Val Arg Val

180 185 190

Phe Tyr Arg Lys Cys Pro Arg Ile Ile Gln Asn Gly Ala Ile Phe Gln

195 200 205

Glu Thr Leu Ser Gly Ala Glu Ser Thr Ser Leu Val Ala Ala Arg Gly

210 215 220

Ser Cys Ile Ala Asn Ala Glu Glu Val Asp Val Pro Ile Lys Leu Tyr

225 230 235 240

Cys Asn Gly Asp Gly Glu Trp Leu Val Pro Ile Gly Arg Cys Met Cys

245 250 255

Lys Ala Gly Phe Glu Ala Val Glu Asn Gly Thr Val Cys Arg Gly Cys

260 265 270

Pro Ser Gly Thr Phe Lys Ala Asn Gln Gly Asp Glu Ala Cys Thr His

275 280 285

Cys Pro Ile Asn Ser Arg Thr Thr Ser Glu Gly Ala Thr Asn Cys Val

290 295 300

Cys Arg Asn Gly Tyr Tyr Arg Ala Asp Leu Asp Pro Leu Asp Met Pro

305 310 315 320

Cys Thr Thr Ile Pro Ser Ala Pro Gln Ala Val Ile Ser Ser Val Asn

325 330 335

Glu Thr Ser Leu Met Leu Glu Trp Thr Pro Pro Arg Asp Ser Gly Gly

340 345 350

Arg Glu Asp Leu Val Tyr Asn Ile Ile Cys Lys Ser Cys Gly Ser Gly

355 360 365

Arg Gly Ala Cys Thr Arg Cys Gly Asp Asn Val Gln Tyr Ala Pro Arg

370 375 380

Gln Leu Gly Leu Thr Glu Pro Arg Ile Tyr Ile Ser Asp Leu Leu Ala

385 390 395 400

His Thr Gln Tyr Thr Phe Glu Ile Gln Ala Val Asn Gly Val Thr Asp

405 410 415

Gln Ser Pro Phe Ser Pro Gln Phe Ala Ser Val Asn Ile Thr Thr Asn

420 425 430

Gln Ala Ala Pro Ser Ala Val Ser Ile Met His Gln Val Ser Arg Thr

435 440 445

Val Asp Ser Ile Thr Leu Ser Trp Ser Gln Pro Asp Gln Pro Asn Gly

450 455 460

Val Ile Leu Asp Tyr Glu Leu Gln Tyr Tyr Glu Lys Glu Leu Ser Glu

465 470 475 480

Tyr Asn Ala Thr Ala Ile Lys Ser Pro Thr Asn Thr Val Thr Val Gln

485 490 495

Gly Leu Lys Ala Gly Ala Ile Tyr Val Phe Gln Val Arg Ala Arg Thr

500 505 510

Val Ala Gly Tyr Gly Arg Tyr Ser Gly Lys Met Tyr Phe Gln Thr Met

515 520 525

Thr Glu Ala Glu Tyr Gln Thr Ser Ile Gln Glu Lys Leu Pro Leu Ile

530 535 540

Ile Gly Ser Ser Ala Ala Gly Leu Val Phe Leu Ile Ala Val Val Val

545 550 555 560

Ile Ala Ile Val Cys Asn Arg Arg Gly Phe Glu Arg Ala Asp Ser Glu

565 570 575

Tyr Thr Asp Lys Leu Gln His Tyr Thr Ser Gly His Met Thr Pro Gly

580 585 590

Met Lys Ile Tyr Ile Asp Pro Phe Thr Tyr Glu Asp Pro Asn Glu Ala

595 600 605

Val Arg Glu Phe Ala Lys Glu Ile Asp Ile Ser Cys Val Lys Ile Glu

610 615 620

Gln Val Ile Gly Ala Gly Glu Phe Gly Glu Val Cys Ser Gly His Leu

625 630 635 640

Lys Leu Pro Gly Lys Arg Glu Ile Phe Val Ala Ile Lys Thr Leu Lys

645 650 655

Ser Gly Tyr Thr Glu Lys Gln Arg Arg Asp Phe Leu Ser Glu Ala Ser

660 665 670

Ile Met Gly Gln Phe Asp His Pro Asn Val Ile His Leu Glu Gly Val

675 680 685

Val Thr Lys Ser Thr Pro Val Met Ile Ile Thr Glu Phe Met Glu Asn

690 695 700

Gly Ser Leu Asp Ser Phe Leu Arg Gln Asn Asp Gly Gln Phe Thr Val

705 710 715 720

Ile Gln Leu Val Gly Met Leu Arg Gly Ile Ala Ala Gly Met Lys Tyr

725 730 735

Leu Ala Asp Met Asn Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile

740 745 750

Leu Val Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser

755 760 765

Arg Phe Leu Glu Asp Asp Thr Ser Asp Pro Thr Tyr Thr Ser Ala Leu

770 775 780

Gly Gly Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Gln Tyr

785 790 795 800

Arg Lys Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Met

805 810 815

Trp Glu Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp Asp Met Thr Asn

820 825 830

Gln Asp Val Ile Asn Ala Ile Glu Gln Asp Tyr Arg Leu Pro Pro Pro

835 840 845

Met Asp Cys Pro Ser Ala Leu His Gln Leu Met Leu Asp Cys Trp Gln

850 855 860

Lys Asp Arg Asn His Arg Pro Lys Phe Gly Gln Ile Val Asn Thr Leu

865 870 875 880

Asp Lys Met Ile Arg Asn Pro Asn Ser Leu Lys Ala Met Ala Pro Leu

885 890 895

Ser Ser Gly Ile Asn Leu Pro Leu Leu Asp Arg Thr Ile Pro Asp Tyr

900 905 910

Thr Ser Phe Asn Thr Val Asp Glu Trp Leu Glu Ala Ile Lys Met Gly

915 920 925

Gln Tyr Lys Glu Ser Phe Ala Asn Ala Gly Phe Thr Ser Phe Asp Val

930 935 940

Val Ser Gln Met Met Met Glu Asp Ile Leu Arg Val Gly Val Thr Leu

945 950 955 960

Ala Gly His Gln Lys Lys Ile Leu Asn Ser Ile Gln Val Met Arg Ala

965 970 975

Gln Met Asn Gln Ile Gln Ser Val Glu Gly Gln Pro Leu Ala Arg Arg

980 985 990

Pro Arg Ala Thr Gly Arg Thr Lys Arg Cys Gln Pro Arg Asp Val Thr

995 1000 1005

Lys Lys Thr Cys Asn Ser Asn Asp Gly Lys Lys Lys Gly Met Gly Lys

1010 1015 1020

Lys Lys Thr Asp Pro Gly Arg Gly Arg Glu Ile Gln Gly Ile Phe Phe

1025 1030 1035 1040

Lys Glu Asp Ser His Lys Glu Ser Asn Asp Cys Ser Cys Gly Gly

1045 1050 1055

<210>25

<211>2964

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>25

atggctctgc ggaggctggg ggccgcgctg ctgctgctgc cgctgctcgc cgccgtggaa 60

gaaacgctaa tggactccac tacagcgact gctgagctgg gctggatggt gcatcctcca 120

tcagggtggg aagaggtgag tggctacgat gagaacatga acacgatccg cacgtaccag 180

gtgtgcaacg tgtttgagtc aagccagaac aactggctac ggaccaagtt tatccggcgc 240

cgtggcgccc accgcatcca cgtggagatg aagttttcgg tgcgtgactg cagcagcatc 300

cccagcgtgc ctggctcctg caaggagacc ttcaacctct attactatga ggctgacttt 360

gactcggcca ccaagacctt ccccaactgg atggagaatc catgggtgaa ggtggatacc 420

attgcagccg acgagagctt ctcccaggtg gacctgggtg gccgcgtcat gaaaatcaac 480

accgaggtgc ggagcttcgg acctgtgtcc cgcagcggct tctacctggc cttccaggac 540

tatggcggct gcatgtccct catcgccgtg cgtgtcttct accgcaagtg cccccgcatc 600

atccagaatg gcgccatctt ccaggaaacc ctgtcggggg ctgagagcac atcgctggtg 660

gctgcccggg gcagctgcat cgccaatgcg gaagaggtgg atgtacccat caagctctac 720

tgtaacgggg acggcgagtg gctggtgccc atcgggcgct gcatgtgcaa agcaggcttc 780

gaggccgttg agaatggcac cgtctgccga ggttgtccat ctgggacttt caaggccaac 840

caaggggatg aggcctgtac ccactgtccc atcaacagcc ggaccacttc tgaaggggcc 900

accaactgtg tctgccgcaa tggctactac agagcagacc tggaccccct ggacatgccc 960

tgcacaacca tcccctccgc gccccaggct gtgatttcca gtgtcaatga gacctccctc 1020

atgctggagt ggacccctcc ccgcgactcc ggaggccgag aggacctcgt ctacaacatc 1080

atctgcaaga gctgtggctc gggccggggt gcctgcaccc gctgcgggga caatgtacag 1140

tacgcaccac gccagctagg cctgaccgag ccacgcattt acatcagtga cctgctggcc 1200

cacacccagt acaccttcga gatccaggct gtgaacggcg ttactgacca gagccccttc 1260

tcgcctcagt tcgcctctgt gaacatcacc accaaccagg cagctccatc ggcagtgtcc 1320

atcatgcatc aggtgagccg caccgtggac agcattaccc tgtcgtggtc ccagccggac 1380

cagcccaatg gcgtgatcct ggactatgag ctgcagtact atgagaagga gctcagtgag 1440

tacaacgcca cagccataaa aagccccacc aacacggtca ccgtgcaggg cctcaaagcc 1500

ggcgccatct atgtcttcca ggtgcgggca cgcaccgtgg caggctacgg gcgctacagc 1560

ggcaagatgt acttccagac catgacagaa gccgagtacc agacaagcat ccaggagaag 1620

ttgccactca tcatcggctc ctcggccgct ggcctggtct tcctcattgc tgtggttgtc 1680

atcgccatcg tgtgtaacag aagacggggg tttgagcgtg ctgactcgga gtacacggac 1740

aagctgcaac actacaccag tggccacatg accccaggca tgaagatcta catcgatcct 1800

ttcacctacg aggaccccaa cgaggcagtg cgggagtttg ccaaggaaat tgacatctcc 1860

tgtgtcaaaa ttgagcaggt gatcggagca ggggagtttg gcgaggtctg cagtggccac 1920

ctgaagctgc caggcaagag agagatcttt gtggccatca agacgctcaa gtcgggctac 1980

acggagaagc agcgccggga cttcctgagc gaagcctcca tcatgggcca gttcgaccat 2040

cccaacgtca tccacctgga gggtgtcgtg accaagagca cacctgtgat gatcatcacc 2100

gagttcatgg agaatggctc cctggactcc tttctccggc aaaacgatgg gcagttcaca 2160

gtcatccagc tggtgggcat gcttcggggc atcgcagctg gcatgaagta cctggcagac 2220

atgaactatg ttcaccgtga cctggctgcc cgcaacatcc tcgtcaacag caacctggtc 2280

tgcaaggtgt cggactttgg gctctcacgc tttctagagg acgatacctc agaccccacc 2340

tacaccagtg ccctgggcgg aaagatcccc atccgctgga cagccccgga agccatccag 2400

taccggaagt tcacctcggc cagtgatgtg tggagctacg gcattgtcat gtgggaggtg 2460

atgtcctatg gggagcggcc ctactgggac atgaccaacc aggatgtaat caatgccatt 2520

gagcaggact atcggctgcc accgcccatg gactgcccga gcgccctgca ccaactcatg 2580

ctggactgtt ggcagaagga ccgcaaccac cggcccaagt tcggccaaat tgtcaacacg 2640

ctagacaaga tgatccgcaa tcccaacagc ctcaaagcca tggcgcccct ctcctctggc 2700

atcaacctgc cgctgctgga ccgcacgatc cccgactaca ccagctttaa cacggtggac 2760

gagtggctgg aggccatcaa gatggggcag tacaaggaga gcttcgccaa tgccggcttc 2820

acctcctttg acgtcgtgtc tcagatgatg atggaggaca ttctccgggt tggggtcact 2880

ttggctggcc accagaaaaa aatcctgaac agtatccagg tgatgcgggc gcagatgaac 2940

cagattcagt ctgtggaggt ttga 2964

<210>26

<211>987

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(20)...(197)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(332)...(419)

＜223〉III type fibronectin domain

<220>

<221>CHAIN

<222>(439)...(520)

＜223〉III type fibronectin domain

<220>

<221>CHAIN

<222>(616)...(884)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(911)...(978)

＜223〉SAM domain (invalid α motif)

<400>26

Met Ala Leu Arg Arg Leu Gly Ala Ala Leu Leu Leu Leu Pro Leu Leu

1 5 10 15

Ala Ala Val Glu Glu Thr Leu Met Asp Ser Thr Thr Ala Thr Ala Glu

20 25 30

Leu Gly Trp Met Val His Pro Pro Ser Gly Trp Glu Glu Val Ser Gly

35 40 45

Tyr Asp Glu Asn Met Asn Thr Ile Arg Thr Tyr Gln Val Cys Asn Val

50 55 60

Phe Glu Ser Ser Gln Asn Asn Trp Leu Arg Thr Lys Phe Ile Arg Arg

65 70 75 80

Arg Gly Ala His Arg Ile His Val Glu Met Lys Phe Ser Val Arg Asp

85 90 95

Cys Ser Ser Ile Pro Ser Val Pro Gly Ser Cys Lys Glu Thr Phe Asn

100 105 110

Leu Tyr Tyr Tyr Glu Ala Asp Phe Asp Ser Ala Thr Lys Thr Phe Pro

115 120 125

Asn Trp Met Glu Asn Pro Trp Val Lys Val Asp Thr Ile Ala Ala Asp

130 135 140

Glu Ser Phe Ser Gln Val Asp Leu Gly Gly Arg Val Met Lys Ile Asn

145 150 155 160

Thr Glu Val Arg Ser Phe Gly Pro Val Ser Arg Ser Gly Phe Tyr Leu

165 170 175

Ala Phe Gln Asp Tyr Gly Gly Cys Met Ser Leu Ile Ala Val Arg Val

180 185 190

Phe Tyr Arg Lys Cys Pro Arg Ile Ile Gln Asn Gly Ala Ile Phe Gln

195 200 205

Glu Thr Leu Ser Gly Ala Glu Ser Thr Ser Leu Val Ala Ala Arg Gly

210 215 220

Ser Cys Ile Ala Asn Ala Glu Glu Val Asp Val Pro Ile Lys Leu Tyr

225 230 235 240

Cys Asn Gly Asp Gly Glu Trp Leu Val Pro Ile Gly Arg Cys Met Cys

245 250 255

Lys Ala Gly Phe Glu Ala Val Glu Asn Gly Thr Val Cys Arg Gly Cys

260 265 270

Pro Ser Gly Thr Phe Lys Ala Asn Gln Gly Asp Glu Ala Cys Thr His

275 280 285

Cys Pro Ile Asn Ser Arg Thr Thr Ser Glu Gly Ala Thr Asn Cys Val

290 295 300

Cys Arg Asn Gly Tyr Tyr Arg Ala Asp Leu Asp Pro Leu Asp Met Pro

305 310 315 320

Cys Thr Thr Ile Pro Ser Ala Pro Gln Ala Val Ile Ser Ser Val Asn

325 330 335

Glu Thr Ser Leu Met Leu Glu Trp Thr Pro Pro Arg Asp Ser Gly Gly

340 345 350

Arg Glu Asp Leu Val Tyr Asn Ile Ile Cys Lys Ser Cys Gly Ser Gly

355 360 365

Arg Gly Ala Cys Thr Arg Cys Gly Asp Asn Val Gln Tyr Ala Pro Arg

370 375 380

Gln Leu Gly Leu Thr Glu Pro Arg Ile Tyr Ile Ser Asp Leu Leu Ala

385 390 395 400

His Thr Gln Tyr Thr Phe Glu Ile Gln Ala Val Asn Gly Val Thr Asp

405 410 415

Gln Ser Pro Phe Ser Pro Gln Phe Ala Ser Val Asn Ile Thr Thr Asn

420 425 430

Gln Ala Ala Pro Ser Ala Val Ser Ile Met His Gln Val Ser Arg Thr

435 440 445

Val Asp Ser Ile Thr Leu Ser Trp Ser Gln Pro Asp Gln Pro Asn Gly

450 455 460

Val Ile Leu Asp Tyr Glu Leu Gln Tyr Tyr Glu Lys Glu Leu Ser Glu

465 470 475 480

Tyr Asn Ala Thr Ala Ile Lys Ser Pro Thr Asn Thr Val Thr Val Gln

485 490 495

Gly Leu Lys Ala Gly Ala Ile Tyr Val Phe Gln Val Arg Ala Arg Thr

500 505 510

Val Ala Gly Tyr Gly Arg Tyr Ser Gly Lys Met Tyr Phe Gln Thr Met

515 520 525

Thr Glu Ala Glu Tyr Gln Thr Ser Ile Gln Glu Lys Leu Pro Leu Ile

530 535 540

Ile Gly Ser Ser Ala Ala Gly Leu Val Phe Leu Ile Ala Val Val Val

545 550 555 560

Ile Ala Ile Val Cys Asn Arg Arg Arg Gly Phe Glu Arg Ala Asp Ser

565 570 575

Glu Tyr Thr Asp Lys Leu Gln His Tyr Thr Ser Gly His Met Thr Pro

580 585 590

Gly Met Lys Ile Tyr Ile Asp Pro Phe Thr Tyr Glu Asp Pro Asn Glu

595 600 605

Ala Val Arg Glu Phe Ala Lys Glu Ile Asp Ile Ser Cys Val Lys Ile

610 615 620

Glu Gln Val Ile Gly Ala Gly Glu Phe Gly Glu Val Cys Ser Gly His

625 630 635 640

Leu Lys Leu Pro Gly Lys Arg Glu Ile Phe Val Ala Ile Lys Thr Leu

645 650 655

Lys Ser Gly Tyr Thr Glu Lys Gln Arg Arg Asp Phe Leu Ser Glu Ala

660 665 670

Ser Ile Met Gly Gln Phe Asp His Pro Asn Val Ile His Leu Glu Gly

675 680 685

Val Val Thr Lys Ser Thr Pro Val Met Ile Ile Thr Glu Phe Met Glu

690 695 700

Asn Gly Ser Leu Asp Ser Phe Leu Arg Gln Asn Asp Gly Gln Phe Thr

705 710 715 720

Val Ile Gln Leu Val Gly Met Leu Arg Gly Ile Ala Ala Gly Met Lys

725 730 735

Tyr Leu Ala Asp Met Asn Tyr Val His Arg Asp Leu Ala Ala Arg Asn

740 745 750

Ile Leu Val Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu

755 760 765

Ser Arg Phe Leu Glu Asp Asp Thr Ser Asp Pro Thr Tyr Thr Ser Ala

770 775 780

Leu Gly Gly Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Gln

785 790 795 800

Tyr Arg Lys Phe Thr Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val

805 810 815

Met Trp Glu Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp Asp Met Thr

820 825 830

Asn Gln Asp Val Ile Asn Ala Ile Glu Gln Asp Tyr Arg Leu Pro Pro

835 840 845

Pro Met Asp Cys Pro Ser Ala Leu His Gln Leu Met Leu Asp Cys Trp

850 855 860

Gln Lys Asp Arg Asn His Arg Pro Lys Phe Gly Gln Ile Val Asn Thr

865 870 875 880

Leu Asp Lys Met Ile Arg Asn Pro Asn Ser Leu Lys Ala Met Ala Pro

885 890 895

Leu Ser Ser Gly Ile Asn Leu Pro Leu Leu Asp Arg Thr Ile Pro Asp

900 905 910

Tyr Thr Ser Phe Asn Thr Val Asp Glu Trp Leu Glu Ala Ile Lys Met

915 920 925

Gly Gln Tyr Lys Glu Ser Phe Ala Asn Ala Gly Phe Thr Ser Phe Asp

930 935 940

Val Val Ser Gln Met Met Met Glu Asp Ile Leu Arg Val Gly Val Thr

945 950 955 960

Leu Ala Gly His Gln Lys Lys Ile Leu Asn Ser Ile Gln Val Met Arg

965 970 975

Ala Gln Met Asn Gln Ile Gln Ser Val Glu Val

980 985

<210>27

<211>2997

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>27

atggccagag cccgcccgcc gccgccgccg tcgccgccgc cggggcttct gccgctgctc 60

cctccgctgc tgctgctgcc gctgctgctg ctgcccgccg gctgccgggc gctggaagag 120

accctcatgg acacaaaatg ggtaacatct gagttggcgt ggacatctca tccagaaagt 180

gggtgggaag aggtgagtgg ctacgatgag gccatgaatc ccatccgcac ataccaggtg 240

tgtaatgtgc gcgagtcaag ccagaacaac tggcttcgca cggggttcat ctggcggcgg 300

gatgtgcagc gggtctacgt ggagctcaag ttcactgtgc gtgactgcaa cagcatcccc 360

aacatccccg gctcctgcaa ggagaccttc aacctcttct actacgaggc tgacagcgat 420

gtggcctcag cctcctcccc cttctggatg gagaacccct acgtgaaagt ggacaccatt 480

gcacccgatg agagcttctc gcggctggat gccggccgtg tcaacaccaa ggtgcgcagc 540

tttgggccac tttccaaggc tggcttctac ctggccttcc aggaccaggg cgcctgcatg 600

tcgctcatct ccgtgcgcgc cttctacaag aagtgtgcat ccaccaccgc aggcttcgca 660

ctcttccccg agaccctcac tggggcggag cccacctcgc tggtcattgc tcctggcacc 720

tgcatcccta acgccgtgga ggtgtcggtg ccactcaagc tctactgcaa cggcgatggg 780

gagtggatgg tgcctgtggg tgcctgcacc tgtgccaccg gccatgagcc agctgccaag 840

gagtcccagt gccgcccctg tccccctggg agctacaagg cgaagcaggg agaggggccc 900

tgcctcccat gtccccccaa cagccgtacc acctccccag ccgccagcat ctgcacctgc 960

cacaataact tctaccgtgc agactcggac tctgcggaca gtgcctgtac caccgtgcca 1020

tctccacccc gaggtgtgat ctccaatgtg aatgaaacct cactgatcct cgagtggagt 1080

gagccccggg acctgggtgg ccgggatgac ctcctgtaca atgtcatctg caagaagtgc 1140

catggggctg gaggggcctc agcctgctca cgctgtgatg acaacgtgga gtttgtgcct 1200

cggcagctgg gcctgacgga gcgccgggtc cacatcagcc atctgctggc ccacacgcgc 1260

tacacctttg aggtgcaggc ggtcaacggt gtctcgggca agagccctct gccgcctcgt 1320

tatgcggccg tgaatatcac cacaaaccag gctgccccgt ctgaagtgcc cacactacgc 1380

ctgcacagca gctcaggcag cagcctcacc ctatcctggg cacccccaga gcggcccaac 1440

ggagtcatcc tggactacga gatgaagtac tttgagaaga gcgagggcat cgcctccaca 1500

gtgaccagcc agatgaactc cgtgcagctg gacgggcttc ggcctgacgc ccgctatgtg 1560

gtccaggtcc gtgcccgcac agtagctggc tatgggcagt acagccgccc tgccgagttt 1620

gagaccacaa gtgagagagg ctctggggcc cagcagctcc aggagcagct tcccctcatc 1680

gtgggctccg ctacagctgg gcttgtcttc gtggtggctg tcgtggtcat cgctatcgtc 1740

tgcctcagga agcagcgaca cggctctgat tcggagtaca cggagaagct gcagcagtac 1800

attgctcctg gaatgaaggt ttatattgac ccttttacct acgaggaccc taatgaggct 1860

gttcgggagt ttgccaagga gatcgacgtg tcctgcgtca agatcgagga ggtgatcgga 1920

gctggggaat ttggggaagt gtgccgtggt cgactgaaac agcctggccg ccgagaggtg 1980

tttgtggcca tcaagacgct gaaggtgggc tacaccgaga ggcagcggcg ggacttccta 2040

agcgaggcct ccatcatggg tcagtttgat caccccaata taatccggct cgagggcgtg 2100

gtcaccaaaa gtcggccagt tatgatcctc actgagttca tggaaaactg cgccctggac 2160

tccttcctcc ggctcaacga tgggcagttc acggtcatcc agctggtggg catgttgcgg 2220

ggcattgctg ccggcatgaa gtacctgtcc gagatgaact atgtgcaccg cgacctggct 2280

gctcgcaaca tccttgtcaa cagcaacctg gtctgcaaag tctcagactt tggcctctcc 2340

cgcttcctgg aggatgaccc ctccgatcct acctacacca gttccctggg cgggaagatc 2400

cccatccgct ggactgcccc agaggccata gcctatcgga agttcacttc tgctagtgat 2460

gtctggagct acggaattgt catgtgggag gtcatgagct atggagagcg accctactgg 2520

gacatgagca accaggatgt catcaatgcc gtggagcagg attaccggct gccaccaccc 2580

atggactgtc ccacagcact gcaccagctc atgctggact gctgggtgcg ggaccggaac 2640

ctcaggccca aattctccca gattgtcaat accctggaca agctcatccg caatgctgcc 2700

agcctcaagg tcattgccag cgctcagtct ggcatgtcac agcccctcct ggaccgcacg 2760

gtcccagatt acacaacctt cacgacagtt ggtgattggc tggatgccat caagatgggg 2820

cggtacaagg agagcttcgt cagtgcgggg tttgcatctt ttgacctggt ggcccagatg 2880

acggcagaag acctgctccg tattggggtc accctggccg gccaccagaa gaagatcctg 2940

agcagtatcc aggacatgcg gctgcagatg aaccagacgc tgcctgtgca ggtctga 2997

<210>28

<211>998

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(39)...(212)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(256)...(331)

＜223〉Tumor Necrosis Factor Receptors (TNFR) domain

<220>

<221>CHAIN

<222>(340)...(436)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(473)...(542)

＜223〉III type fibronectin domain

<220>

<221>TRANSMEM

<222>(556)...(582)

＜223〉stride diaphragm area

<220>

<221>CHAIN

<222>(627)...(895)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(922)...(989)

＜223〉SAM domain (invalid α motif)

<400>28

Met Ala Arg Ala Arg Pro Pro Pro Pro Pro Ser Pro Pro Pro Gly Leu

1 5 10 15

Leu Pro Leu Leu Pro Pro Leu Leu Leu Leu Pro Leu Leu Leu Leu Pro

20 25 30

Ala Gly Cys Arg Ala Leu Glu Glu Thr Leu Met Asp Thr Lys Trp Val

35 40 45

Thr Ser Glu Leu Ala Trp Thr Ser His Pro Glu Ser Gly Trp Glu Glu

50 55 60

Val Ser Gly Tyr Asp Glu Ala Met Asn Pro Ile Arg Thr Tyr Gln Val

65 70 75 80

Cys Asn Val Arg Glu Ser Ser Gln Asn Asn Trp Leu Arg Thr Gly Phe

85 90 95

Ile Trp Arg Arg Asp Val Gln Arg Val Tyr Val Glu Leu Lys Phe Thr

100 105 110

Val Arg Asp Cys Asn Ser Ile Pro Asn Ile Pro Gly Ser Cys Lys Glu

115 120 125

Thr Phe Asn Leu Phe Tyr Tyr Glu Ala Asp Ser Asp Val Ala Ser Ala

130 135 140

Ser Ser Pro Phe Trp Met Glu Asn Pro Tyr Val Lys Val Asp Thr Ile

145 150 155 160

Ala Pro Asp Glu Ser Phe Ser Arg Leu Asp Ala Gly Arg Val Asn Thr

165 170 175

Lys Val Arg Ser Phe Gly Pro Leu Ser Lys Ala Gly Phe Tyr Leu Ala

180 185 190

Phe Gln Asp Gln Gly Ala Cys Met Ser Leu Ile Ser Val Arg Ala Phe

195 200 205

Tyr Lys Lys Cys Ala Ser Thr Thr Ala Gly Phe Ala Leu Phe Pro Glu

210 215 220

Thr Leu Thr Gly Ala Glu Pro Thr Ser Leu Val Ile Ala Pro Gly Thr

225 230 235 240

Cys Ile Pro Asn Ala Val Glu Val Ser Val Pro Leu Lys Leu Tyr Cys

245 250 255

Asn Gly Asp Gly Glu Trp Met Val Pro Val Gly Ala Cys Thr Cys Ala

260 265 270

Thr Gly His Glu Pro Ala Ala Lys Glu Ser Gln Cys Arg Pro Cys Pro

275 280 285

Pro Gly Ser Tyr Lys Ala Lys Gln Gly Glu Gly Pro Cys Leu Pro Cys

290 295 300

Pro Pro Asn Ser Arg Thr Thr Ser Pro Ala Ala Ser Ile Cys Thr Cys

305 310 315 320

His Asn Asn Phe Tyr Arg Ala Asp Ser Asp Ser Ala Asp Ser Ala Cys

325 330 335

Thr Thr Val Pro Ser Pro Pro Arg Gly Val Ile Ser Asn Val Asn Glu

340 345 350

Thr Ser Leu Ile Leu Glu Trp Ser Glu Pro Arg Asp Leu Gly Gly Arg

355 360 365

Asp Asp Leu Leu Tyr Asn Val Ile Cys Lys Lys Cys His Gly Ala Gly

370 375 380

Gly Ala Ser Ala Cys Ser Arg Cys Asp Asp Asn Val Glu Phe Val Pro

385 390 395 400

Arg Gln Leu Gly Leu Thr Glu Arg Arg Val His Ile Ser His Leu Leu

405 410 415

Ala His Thr Arg Tyr Thr Phe Glu Val Gln Ala Val Asn Gly Val Ser

420 425 430

Gly Lys Ser Pro Leu Pro Pro Arg Tyr Ala Ala Val Asn Ile Thr Thr

435 440 445

Asn Gln Ala Ala Pro Ser Glu Val Pro Thr Leu Arg Leu His Ser Ser

450 455 460

Ser Gly Ser Ser Leu Thr Leu Ser Trp Ala Pro Pro Glu Arg Pro Asn

465 470 475 480

Gly Val Ile Leu Asp Tyr Glu Met Lys Tyr Phe Glu Lys Ser Glu Gly

485 490 495

Ile Ala Ser Thr Val Thr Ser Gln Met Asn Ser Val Gln Leu Asp Gly

500 505 510

Leu Arg Pro Asp Ala Arg Tyr Val Val Gln Val Arg Ala Arg Thr Val

515 520 525

Ala Gly Tyr Gly Gln Tyr Ser Arg Pro Ala Glu Phe Glu Thr Thr Ser

530 535 540

Glu Arg Gly Ser Gly Ala Gln Gln Leu Gln Glu Gln Leu Pro Leu Ile

545 550 555 560

Val Gly Ser Ala Thr Ala Gly Leu Val Phe Val Val Ala Val Val Val

565 570 575

Ile Ala Ile Val Cys Leu Arg Lys Gln Arg His Gly Ser Asp Ser Glu

580 585 590

Tyr Thr Glu Lys Leu Gln Gln Tyr Ile Ala Pro Gly Met Lys Val Tyr

595 600 605

Ile Asp Pro Phe Thr Tyr Glu Asp Pro Asn Glu Ala Val Arg Glu Phe

610 615 620

Ala Lys Glu Ile Asp Val Ser Cys Val Lys Ile Glu Glu Val Ile Gly

625 630 635 640

Ala Gly Glu Phe Gly Glu Val Cys Arg Gly Arg Leu Lys Gln Pro Gly

645 650 655

Arg Arg Glu Val Phe Val Ala Ile Lys Thr Leu Lys Val Gly Tyr Thr

660 665 670

Glu Arg Gln Arg Arg Asp Phe Leu Ser Glu Ala Ser Ile Met Gly Gln

675 680 685

Phe Asp His Pro Asn Ile Ile Arg Leu Glu Gly Val Val Thr Lys Ser

690 695 700

Arg Pro Val Met Ile Leu Thr Glu Phe Met Glu Asn Cys Ala Leu Asp

705 710 715 720

Ser Phe Leu Arg Leu Asn Asp Gly Gln Phe Thr Val Ile Gln Leu Val

725 730 735

Gly Met Leu Arg Gly Ile Ala Ala Gly Met Lys Tyr Leu Ser Glu Met

740 745 750

Asn Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile Leu Val Asn Ser

755 760 765

Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser Arg Phe Leu Glu

770 775 780

Asp Asp Pro Ser Asp Pro Thr Tyr Thr Ser Ser Leu Gly Gly Lys Ile

785 790 795 800

Pro Ile Arg Trp Thr Ala Pro Glu Ala Ile Ala Tyr Arg Lys Phe Thr

805 810 815

Ser Ala Ser Asp Val Trp Ser Tyr Gly Ile Val Met Trp Glu Val Met

820 825 830

Ser Tyr Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn Gln Asp Val Ile

835 840 845

Asn Ala Val Glu Gln Asp Tyr Arg Leu Pro Pro Pro Met Asp Cys Pro

850 855 860

Thr Ala Leu His Gln Leu Met Leu Asp Cys Trp Val Arg Asp Arg Asn

865 870 875 880

Leu Arg Pro Lys Phe Ser Gln Ile Val Asn Thr Leu Asp Lys Leu Ile

885 890 895

Arg Asn Ala Ala Ser Leu Lys Val Ile Ala Ser Ala Gln Ser Gly Met

900 905 910

Ser Gln Pro Leu Leu Asp Arg Thr Val Pro Asp Tyr Thr Thr Phe Thr

915 920 925

Thr Val Gly Asp Trp Leu Asp Ala Ile Lys Met Gly Arg Tyr Lys Glu

930 935 940

Ser Phe Val Ser Ala Gly Phe Ala Ser Phe Asp Leu Val Ala Gln Met

945 950 955 960

Thr Ala Glu Asp Leu Leu Arg Ile Gly Val Thr Leu Ala Gly His Gln

965 970 975

Lys Lys Ile Leu Ser Ser Ile Gln Asp Met Arg Leu Gln Met Asn Gln

980 985 990

Thr Leu Pro Val Gln Val

995

<210>29

<211>2964

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>29

atggagctcc gggtgctgct ctgctgggct tcgttggccg cagctttgga agagaccctg 60

ctgaacacaa aattggaaac tgctgatctg aagtgggtga cattccctca ggtggacggg 120

cagtgggagg aactgagcgg cctggatgag gaacagcaca gcgtgcgcac ctacgaagtg 180

tgtgacgtgc agcgtgcccc gggccaggcc cactggcttc gcacaggttg ggtcccacgg 240

cggggcgccg tccacgtgta cgccacgctg cgcttcacca tgctcgagtg cctgtccctg 300

cctcgggctg ggcgctcctg caaggagacc ttcaccgtct tctactatga gagcgatgcg 360

gacacggcca cggccctcac gccagcctgg atggagaacc cctacatcaa ggtggacacg 420

gtggccgcgg agcatctcac ccggaagcgc cctggggccg aggccaccgg gaaggtgaat 480

gtcaagacgc tgcgtctggg accgctcagc aaggctggct tctacctggc cttccaggac 540

cagggtgcct gcatggccct gctatccctg cacctcttct acaaaaagtg cgcccagctg 600

actgtgaacc tgactcgatt cccggagact gtgcctcggg agctggttgt gcccgtggcc 660

ggtagctgcg tggtggatgc cgtccccgcc cctggcccca gccccagcct ctactgccgt 720

gaggatggcc agtgggccga acagccggtc acgggctgca gctgtgctcc ggggttcgag 780

gcagctgagg ggaacaccaa gtgccgagcc tgtgcccagg gcaccttcaa gcccctgtca 840

ggagaagggt cctgccagcc atgcccagcc aatagccact ctaacaccat tggatcagcc 900

gtctgccagt gccgcgtcgg gtacttccgg gcacgcacag acccccgggg tgcaccctgc 960

accacccctc cttcggctcc gcggagcgtg gtttcccgcc tgaacggctc ctccctgcac 1020

ctggaatgga gtgcccccct ggagtctggt ggccgagagg acctcaccta cgccctccgc 1080

tgccgggagt gccgacccgg aggctcctgt gcgccctgcg ggggagacct gacttttgac 1140

cccggccccc gggacctggt ggagccctgg gtggtggttc gagggctacg tcctgacttc 1200

acctatacct ttgaggtcac tgcattgaac ggggtatcct ccttagccac ggggcccgtc 1260

ccatttgagc ctgtcaatgt caccactgac cgagaggtac ctcctgcagt gtctgacatc 1320

cgggtgacgc ggtcctcacc cagcagcttg agcctggcct gggctgttcc ccgggcaccc 1380

agtggggctg tgctggacta cgaggtcaaa taccatgaga agggcgccga gggtcccagc 1440

agcgtgcggt tcctgaagac gtcagaaaac cgggcagagc tgcgggggct gaagcgggga 1500

gccagctacc tggtgcaggt acgggcgcgc tctgaggccg gctacgggcc cttcggccag 1560

gaacatcaca gccagaccca actggatgag agcgagggct ggcgggagca gctggccctg 1620

attgcgggca cggcagtcgt gggtgtggtc ctggtcctgg tggtcattgt ggtcgcagtt 1680

ctctgcctca ggaagcagag caatgggaga gaagcagaat attcggacaa acacggacag 1740

tatctcatcg gacatggtac taaggtctac atcgacccct tcacttatga agaccctaat 1800

gaggctgtga gggaatttgc aaaagagatc gatgtctcct acgtcaagat tgaagaggtg 1860

attggtgcag gtgagtttgg cgaggtgtgc cgggggcggc tcaaggcccc agggaagaag 1920

gagagctgtg tggcaatcaa gaccctgaag ggtggctaca cggagcggca gcggcgtgag 1980

tttctgagcg aggcctccat catgggccag ttcgagcacc ccaatatcat ccgcctggag 2040

ggcgtggtca ccaacagcat gcccgtcatg attctcacag agttcatgga gaacggcgcc 2100

ctggactcct tcctgcggct aaacgacgga cagttcacag tcatccagct cgtgggcatg 2160

ctgcggggca tcgcctcggg catgcggtac cttgccgaga tgagctacgt ccaccgagac 2220

ctggctgctc gcaacatcct agtcaacagc aacctcgtct gcaaagtgtc tgactttggc 2280

ctttcccgat tcctggagga gaactcttcc gatcccacct acacgagctc cctgggagga 2340

aagattccca tccgatggac tgccccggag gccattgcct tccggaagtt cacttccgcc 2400

agtgatgcct ggagttacgg gattgtgatg tgggaggtga tgtcatttgg ggagaggccg 2460

tactgggaca tgagcaatca ggacgtgatc aatgccattg aacaggacta ccggctgccc 2520

ccgcccccag actgtcccac ctccctccac cagctcatgc tggactgttg gcagaaagac 2580

cggaatgccc ggccccgctt cccccaggtg gtcagcgccc tggacaagat gatccggaac 2640

cccgccagcc tcaaaatcgt ggcccgggag aatggcgggg cctcacaccc tctcctggac 2700

cagcggcagc ctcactactc agcttttggc tctgtgggcg agtggcttcg ggccatcaaa 2760

atgggaagat acgaagaaag tttcgcagcc gctggctttg gctccttcga gctggtcagc 2820

cagatctctg ctgaggacct gctccgaatc ggagtcactc tggcgggaca ccagaagaaa 2880

atcttggcca gtgtccagca catgaagtcc caggccaagc cgggaacccc gggtgggaca 2940

ggaggaccgg ccccgcagta ctga 2964

<210>30

<211>987

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(29)...(197)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(239)...(321)

＜223〉Tumor Necrosis Factor Receptors (TNFR) domain

<220>

<221>CHAIN

<222>(324)...(429)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(434)...(526)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(609)...(877)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(904)...(971)

＜223〉SAM domain (invalid α motif)

<400> 30

Met Glu Leu Arg Val Leu Leu Cys Trp Ala Ser Leu Ala Ala Ala Leu

1 5 10 15

Glu Glu Thr Leu Leu Asn Thr Lys Leu Glu Thr Ala Asp Leu Lys Trp

20 25 30

Val Thr Phe Pro Gln Val Asp Gly Gln Trp Glu Glu Leu Ser Gly Leu

35 40 45

Asp Glu Glu Gln His Ser Val Arg Thr Tyr Glu Val Cys Asp Val Gln

50 55 60

Arg Ala Pro Gly Gln Ala His Trp Leu Arg Thr Gly Trp Val Pro Arg

65 70 75 80

Arg Gly Ala Val His Val Tyr Ala Thr Leu Arg Phe Thr Met Leu Glu

85 90 95

Cys Leu Ser Leu Pro Arg Ala Gly Arg Ser Cys Lys Glu Thr Phe Thr

100 105 110

Val Phe Tyr Tyr Glu Ser Asp Ala Asp Thr Ala Thr Ala Leu Thr Pro

115 120 125

Ala Trp Met Glu Asn Pro Tyr Ile Lys Val Asp Thr Val Ala Ala Glu

130 135 140

His Leu Thr Arg Lys Arg Pro Gly Ala Glu Ala Thr Gly Lys Val Asn

145 150 155 160

Val Lys Thr Leu Arg Leu Gly Pro Leu Ser Lys Ala Gly Phe Tyr Leu

165 170 175

Ala Phe Gln Asp Gln Gly Ala Cys Met Ala Leu Leu Ser Leu His Leu

180 185 190

Phe Tyr Lys Lys Cys Ala Gln Leu Thr Val Asn Leu Thr Arg Phe Pro

195 200 205

Glu Thr Val Pro Arg Glu Leu Val Val Pro Val Ala Gly Ser Cys Val

210 215 220

Val Asp Ala Val Pro Ala Pro Gly Pro Ser Pro Ser Leu Tyr Cys Arg

225 230 235 240

Glu Asp Gly Gln Trp Ala Glu Gln Pro Val Thr Gly Cys Ser Cys Ala

245 250 255

Pro Gly Phe Glu Ala Ala Glu Gly Asn Thr Lys Cys Arg Ala Cys Ala

260 265 270

Gln Gly Thr Phe Lys Pro Leu Ser Gly Glu Gly Ser Cys Gln Pro Cys

275 280 285

Pro Ala Asn Ser His Ser Asn Thr Ile Gly Ser Ala Val Cys Gln Cys

290 295 300

Arg Val Gly Tyr Phe Arg Ala Arg Thr Asp Pro Arg Gly Ala Pro Cys

305 310 315 320

Thr Thr Pro Pro Ser Ala Pro Arg Ser Val Val Ser Arg Leu Asn Gly

325 330 335

Ser Ser Leu His Leu Glu Trp Ser Ala Pro Leu Glu Ser Gly Gly Arg

340 345 350

Glu Asp Leu Thr Tyr Ala Leu Arg Cys Arg Glu Cys Arg Pro Gly Gly

355 360 365

Ser Cys Ala Pro Cys Gly Gly Asp Leu Thr Phe Asp Pro Gly Pro Arg

370 375 380

Asp Leu Val Glu Pro Trp Val Val Val Arg Gly Leu Arg Pro Asp Phe

385 390 395 400

Thr Tyr Thr Phe Glu Val Thr Ala Leu Asn Gly Val Ser Ser Leu Ala

405 410 415

Thr Gly Pro Val Pro Phe Glu Pro Val Asn Val Thr Thr Asp Arg Glu

420 425 430

Val Pro Pro Ala Val Ser Asp Ile Arg Val Thr Arg Ser Ser Pro Ser

435 440 445

Ser Leu Ser Leu Ala Trp Ala Val Pro Arg Ala Pro Ser Gly Ala Val

450 455 460

Leu Asp Tyr Glu Val Lys Tyr His Glu Lys Gly Ala Glu Gly Pro Ser

465 470 475 480

Ser Val Arg Phe Leu Lys Thr Ser Glu Asn Arg Ala Glu Leu Arg Gly

485 490 495

Leu Lys Arg Gly Ala Ser Tyr Leu Val Gln Val Arg Ala Arg Ser Glu

500 505 510

Ala Gly Tyr Gly Pro Phe Gly Gln Glu His His Ser Gln Thr Gln Leu

515 520 525

Asp Glu Ser Glu Gly Trp Arg Glu Gln Leu Ala Leu Ile Ala Gly Thr

530 535 540

Ala Val Val Gly Val Val Leu Val Leu Val Val Ile Val Val Ala Val

545 550 555 560

Leu Cys Leu Arg Lys Gln Ser Asn Gly Arg Glu Ala Glu Tyr Ser Asp

565 570 575

Lys His Gly Gln Tyr Leu Ile Gly His Gly Thr Lys Val Tyr Ile Asp

580 585 590

Pro Phe Thr Tyr Glu Asp Pro Asn Glu Ala Val Arg Glu Phe Ala Lys

595 600 605

Glu Ile Asp ValSer Tyr Val Lys Ile Glu Glu Val Ile Gly Ala Gly

610 615 620

Glu Phe Gly Glu Val Cys Arg Gly Arg Leu Lys Ala Pro Gly Lys Lys

625 630 635 640

Glu Ser Cys Val Ala Ile Lys Thr Leu Lys Gly Gly Tyr Thr Glu Arg

645 650 655

Gln Arg Arg Glu Phe Leu Ser Glu Ala Ser Ile Met Gly Gln Phe Glu

660 665 670

His Pro Asn Ile Ile Arg Leu Glu Gly Val Val Thr Asn Ser Met Pro

675 680 685

Val Met Ile Leu Thr Glu Phe Met Glu Asn Gly Ala Leu Asp Ser Phe

690 695 700

Leu Arg Leu Asn Asp Gly Gln Phe Thr Val Ile Gln Leu Val Gly Met

705 710 715 720

Leu Arg Gly Ile Ala Ser Gly Met Arg Tyr Leu Ala Glu Met Ser Tyr

725 730 735

Val His Arg Asp Leu Ala Ala Arg Asn Ile Leu Val Asn Ser Asn Leu

740 745 750

Val Cys Lys Val Ser Asp Phe Gly Leu Ser Arg Phe Leu Glu Glu Asn

755 760 765

Ser Ser Asp Pro Thr Tyr Thr Ser Ser Leu Gly Gly Lys Ile Pro Ile

770 775 780

Arg Trp Thr Ala Pro Glu Ala Ile Ala Phe Arg Lys Phe Thr Ser Ala

785 790 795 800

Ser Asp Ala Trp Ser Tyr Gly Ile Val Met Trp Glu Val Met Ser Phe

805 810 815

Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn Gln Asp Val Ile Asn Ala

820 825 830

Ile Glu Gln Asp Tyr Arg Leu Pro Pro Pro Pro Asp Cys Pro Thr Ser

835 840 845

Leu His Gln Leu Met Leu Asp Cys Trp Gln Lys Asp Arg Asn Ala Arg

850 855 860

Pro Arg Phe Pro Gln Val Val Ser Ala Leu Asp Lys Met Ile Arg Asn

865 870 875 880

Pro Ala Ser Leu Lys Ile Val Ala Arg Glu Asn Gly Gly Ala Ser His

885 890 895

Pro Leu Leu Asp Gln Arg Gln Pro His Tyr Ser Ala Phe Gly Ser Val

900 905 910

Gly Glu Trp Leu Arg Ala Ile Lys Met Gly Arg Tyr Glu Glu Ser Phe

915 920 925

Ala Ala Ala Gly Phe Gly Ser Phe Glu Leu Val Ser Gln Ile Ser Ala

930 935 940

Glu Asp Leu Leu Arg Ile Gly Val Thr Leu Ala Gly His Gln Lys Lys

945 950 955 960

Ile Leu Ala Ser Val Gln His Met Lys Ser Gln Ala Lys Pro Gly Thr

965 970 975

Pro Gly Gly Thr Gly Gly Pro Ala Pro Gln Tyr

980 985

<210>31

<211>3021

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>31

atggtgtgta gcctatgggt gctgctcctg gtgtcttcag ttctggctct ggaagaggta 60

ttgctggaca ccaccggaga gacatctgag attggctggc tcacctaccc accagggggg 120

tgggacgagg tgagtgttct ggacgaccag cgacgcctga ctcggacctt tgaggcatgt 180

catgtggcag gggcccctcc aggcaccggg caggacaatt ggttgcagac acactttgtg 240

gagcggcgcg gggcccagag ggcgcacatt cgactccact tctctgtgcg ggcatgctcc 300

agcctgggtg tgagcggcgg cacctgccgg gagaccttca ccctttacta ccgtcaggct 360

gaggagcccg acagccctga cagcgtttcc tcctggcacc tcaaacgctg gaccaaggtg 420

gacacaattg cagcagacga gagctttccc tcctcctcct cctcctcctc ctcttcttcc 480

tctgcagcgt gggctgtggg accccacggg gctgggcagc gggctggact gcaactgaac 540

gtcaaagagc ggagctttgg gcctctcacc caacgcggct tctacgtggc cttccaggac 600

acgggggcct gcctggccct ggtcgctgtc aggctcttct cctacacctg ccctgccgtg 660

ctccgatcct ttgcttcctt tccagagacg caggccagtg gggctggggg ggcctccctg 720

gtggcagctg tgggcacctg tgtggctcat gcagagccag aggaggatgg agtagggggc 780

caggcaggag gcagcccccc caggctgcac tgcaacgggg agggcaagtg gatggtagct 840

gtcgggggct gccgctgcca gcctggatac caaccagcac gaggagacaa ggcctgccaa 900

gcctgcccac gggggctcta taagtcttct gctgggaatg ctccctgctc accatgccct 960

gcccgcagtc acgctcccaa cccagcagcc cccgtttgcc cctgcctgga gggcttctac 1020

cgggccagtt ccgacccacc agaggccccc tgcactggtc ctccatcggc tccccaggag 1080

ctttggtttg aggtgcaagg ctcagcactc atgctacact ggcgcctgcc tcgggagctg 1140

gggggtcgag gggacctgct cttcaatgtc gtgtgcaagg agtgtgaagg ccgccaggaa 1200

cctgccagcg gtggtggggg cacttgtcac cgctgcaggg atgaggtcca cttcgaccct 1260

cgccagagag gcctgactga gagccgagtg ttagtggggg gactccgggc acacgtaccc 1320

tacatcttag aggtgcaggc tgttaatggg gtgtctgagc tcagccctga ccctcctcag 1380

gctgcagcca tcaatgtcag caccagccat gaagtgccct ctgctgtccc tgtggtgcac 1440

caggtgagcc gggcatccaa cagcatcacg gtgtcctggc cgcagcccga ccagaccaat 1500

gggaacatcc tggactatca gctccgctac tatgaccagg cagaagacga atcccactcc 1560

ttcaccctga ccagcgagac caacactgcc accgtgacac agctgagccc tggccacatc 1620

tatggtttcc aggtgcgggc ccggactgct gccggccacg gcccctacgg gggcaaagtc 1680

tatttccaga cacttcctca aggggagctg tcttcccagc ttccggaaag actctccttg 1740

gtgatcggct ccatcctggg ggctttggcc ttcctcctgc tggcagccat caccgtgctg 1800

gcggtcgtct tccagcggaa gcggcgtggg actggctaca cggagcagct gcagcaatac 1860

agcagcccag gactcggggt gaagtattac atcgacccct ccacctacga ggacccctgt 1920

caggccatcc gagaacttgc ccgggaagtc gatcctgctt atatcaagat tgaggaggtc 1980

attgggacag gctcttttgg agaagtgcgc cagggccgcc tgcagccacg gggacggagg 2040

gagcagactg tggccatcca ggccctgtgg gccgggggcg ccgaaagcct gcagatgacc 2100

ttcctgggcc gggccgcagt gctgggtcag ttccagcacc ccaacatcct gcggctggag 2160

ggcgtggtca ccaagagccg acccctcatg gtgctgacgg agttcatgga gcttggcccc 2220

ctggacagct tcctcaggca gcgggagggc cagttcagca gcctgcagct ggtggccatg 2280

cagcggggag tggctgctgc catgcagtac ctgtccagct ttgccttcgt ccatcgctcg 2340

ctgtctgccc acagcgtgct ggtgaatagc cacttggtgt gcaaggtggc ccgtcttggc 2400

cacagtcctc agggcccaag ttgtttgctt cgctgggcag ccccagaggt cattgcacat 2460

ggaaagcata caacatccag tgatgtctgg agctttggga tactcatgtg ggaagtgatg 2520

agttatggag aacggcctta ctgggacatg agtgagcagg aggtactaaa tgcaatagag 2580

caggagttcc ggctgccccc gcctccaggc tgtcctcctg gattacatct acttatgttg 2640

gacacttggc agaaggaccg tgcccggcgg cctcattttg accagctggt ggctgcattt 2700

gacaagatga tccgcaagcc agataccctg caggctggcg gggacccagg ggaaaggcct 2760

tcccaggccc ttctgacccc tgtggccctg gactttcctt gtctggactc accccaggcc 2820

tggctttcag ccattggact ggagtgctac caggacaact tctccaagtt tggcctctgt 2880

accttcagtg atgtggctca gctcagccta gaagacctgc ctgccctggg catcaccctg 2940

gctggccacc agaagaagct gctgcaccac atccagctcc ttcagcaaca cctgaggcag 3000

cagggctcag tggaggtctg a 3021

<210>32

<211>1006

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>BINDING

<222>(23)...(217)

＜223〉liver is joined the protein receptor ligand binding domains

<220>

<221>CHAIN

<222>(473)...(564)

＜223〉3 type fibronectin domains

<220>

<221>CHAIN

<222>(655)...(900)

＜223〉tyrosine kinase, catalyst structure domain

<220>

<221>CHAIN

<222>(931)...(982)

<223>

SAM domain (invalid α motif)

<400>32

Met Val Cys Ser Leu Trp Val Leu Leu Leu Val Ser Ser Val Leu Ala

1 5 10 15

Leu Glu Glu Val Leu Leu Asp Thr Thr Gly Glu Thr Ser Glu Ile Gly

20 25 30

Trp Leu Thr Tyr Pro Pro Gly Gly Trp Asp Glu Val Ser Val Leu Asp

35 40 45

Asp Gln Arg Arg Leu Thr Arg Thr Phe Glu Ala Cys His Val Ala Gly

50 55 60

Ala Pro Pro Gly Thr Gly Gln Asp Asn Trp Leu Gln Thr His Phe Val

65 70 75 80

Glu Arg Arg Gly Ala Gln Arg Ala His Ile Arg Leu His Phe Ser Val

85 90 95

Arg Ala Cys Ser Ser Leu Gly Val Ser Gly Gly Thr Cys Arg Glu Thr

100 105 110

Phe Thr Leu Tyr Tyr Arg Gln Ala Glu Glu Pro Asp Ser Pro Asp Ser

115 120 125

Val Ser Ser Trp His Leu Lys Arg Trp Thr Lys Val Asp Thr Ile Ala

130 135 140

Ala Asp Glu Ser Phe Pro Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser

145 150 155 160

Ser Ala Ala Trp Ala Val Gly Pro His Gly Ala Gly Gln Arg Ala Gly

165 170 175

Leu Gln Leu Asn Val Lys Glu Arg Ser Phe Gly Pro Leu Thr Gln Arg

180 185 190

Gly Phe Tyr Val Ala Phe Gln Asp Thr Gly Ala Cys Leu Ala Leu Val

195 200 205

Ala Val Arg Leu Phe Ser Tyr Thr Cys Pro Ala Val Leu Arg Ser Phe

210 215 220

Ala Ser Phe Pro Glu Thr Gln Ala Ser Gly Ala Gly Gly Ala Ser Leu

225 230 235 240

Val Ala Ala Val Gly Thr Cys Val Ala His Ala Glu Pro Glu Glu Asp

245 250 255

Gly Val Gly Gly Gln Ala Gly Gly Ser Pro Pro Arg Leu His Cys Asn

260 265 270

Gly Glu Gly Lys Trp Met Val Ala Val Gly Gly Cys Arg Cys Gln Pro

275 280 285

Gly Tyr Gln Pro Ala Arg Gly Asp Lys Ala Cys Gln Ala Cys Pro Arg

290 295 300

Gly Leu Tyr Lys Ser Ser Ala Gly Asn Ala Pro Cys Ser Pro Cys Pro

305 310 315 320

Ala Arg Ser His Ala Pro Asn Pro Ala Ala Pro Val Cys Pro Cys Leu

325 330 335

Glu Gly Phe Tyr Arg Ala Ser Ser Asp Pro Pro Glu Ala Pro Cys Thr

340 345 350

Gly Pro Pro Ser Ala Pro Gln Glu Leu Trp Phe Glu Val Gln Gly Ser

355 360 365

Ala Leu Met Leu His Trp Arg Leu Pro Arg Glu Leu Gly Gly Arg Gly

370 375 380

Asp Leu Leu Phe Asn Val Val Cys Lys Glu Cys Glu Gly Arg Gln Glu

385 390 395 400

Pro Ala Ser Gly Gly Gly Gly Thr Cys His Arg Cys Arg Asp Glu Val

405 410 415

His Phe Asp Pro Arg Gln Arg Gly Leu Thr Glu Ser Arg Val Leu Val

420 425 430

Gly Gly Leu Arg Ala His Val Pro Tyr Ile Leu Glu Val Gln Ala Val

435 440 445

Asn Gly Val Ser Glu Leu Ser Pro Asp Pro Pro Gln Ala Ala Ala Ile

450 455 460

Asn Val Ser Thr Ser His Glu Val Pro Ser Ala Val Pro Val Val His

465 470 475 480

Gln Val Ser Arg Ala Ser Asn Ser Ile Thr Val Ser Trp Pro Gln Pro

485 490 495

Asp Gln Thr Asn Gly Asn Ile Leu Asp Tyr Gln Leu Arg Tyr Tyr Asp

500 505 510

Gln Ala Glu Asp Glu Ser His Ser Phe Thr Leu Thr Ser Glu Thr Asn

515 520 525

Thr Ala Thr Val Thr Gln Leu Ser Pro Gly His Ile Tyr Gly Phe Gln

530 535 540

Val Arg Ala Arg Thr Ala Ala Gly His Gly Pro Tyr Gly Gly Lys Val

545 550 555 560

Tyr Phe Gln Thr Leu Pro Gln Gly Glu Leu Ser Ser Gln Leu Pro Glu

565 570 575

Arg Leu Ser Leu Val Ile Gly Ser Ile Leu Gly Ala Leu Ala Phe Leu

580 585 590

Leu Leu Ala Ala Ile Thr Val Leu Ala Val Val Phe Gln Arg Lys Arg

595 600 605

Arg Gly Thr Gly Tyr Thr Glu Gln Leu Gln Gln Tyr Ser Ser Pro Gly

610 615 620

Leu Gly Val Lys Tyr Tyr Ile Asp Pro Ser Thr Tyr Glu Asp Pro Cys

625 630 635 640

Gln Ala Ile Arg Glu Leu Ala Arg Glu Val Asp Pro Ala Tyr Ile Lys

645 650 655

Ile Glu Glu Val Ile Gly Thr Gly Ser Phe Gly Glu Val Arg Gln Gly

660 665 670

Arg Leu Gln Pro Arg Gly Arg Arg Glu Gln Thr Val Ala Ile Gln Ala

675 680 685

Leu Trp Ala Gly Gly Ala Glu Ser Leu Gln Met Thr Phe Leu Gly Arg

690 695 700

Ala Ala Val Leu Gly Gln Phe Gln His Pro Asn Ile Leu Arg Leu Glu

705 710 715 720

Gly Val Val Thr Lys Ser Arg Pro Leu Met Val Leu Thr Glu Phe Met

725 730 735

Glu Leu Gly Pro Leu Asp Ser Phe Leu Arg Gln Arg Glu Gly Gln Phe

740 745 750

Ser Ser Leu Gln Leu Val Ala Met Gln Arg Gly Val Ala Ala Ala Met

755 760 765

Gln Tyr Leu Ser Ser Phe Ala Phe Val His Arg Ser Leu Ser Ala His

770 775 780

Ser Val Leu Val Asn Ser His Leu Val Cys Lys Val Ala Arg Leu Gly

785 790 795 800

His Ser Pro Gln Gly Pro Ser Cys Leu Leu Arg Trp Ala Ala Pro Glu

805 810 815

Val Ile Ala His Gly Lys His Thr Thr Ser Ser Asp Val Trp Ser Phe

820 825 830

Gly Ile Leu Met Trp Glu Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp

835 840 845

Asp Met Ser Glu Gln Glu Val Leu Asn Ala Ile Glu Gln Glu Phe Arg

850 855 860

Leu Pro Pro Pro Pro Gly Cys Pro Pro Gly Leu His Leu Leu Met Leu

865 870 875 880

Asp Thr Trp Gln Lys Asp Arg Ala Arg Arg Pro His Phe Asp Gln Leu

885 890 895

Val Ala Ala Phe Asp Lys Met Ile Arg Lys Pro Asp Thr Leu Gln Ala

900 905 910

Gly Gly Asp Pro Gly Glu Arg Pro Ser Gln Ala Leu Leu Thr Pro Val

915 920 925

Ala Leu Asp Phe Pro Cys Leu Asp Ser Pro Gln Ala Trp Leu Ser Ala

930 935 940

Ile Gly Leu Glu Cys Tyr Gln Asp Asn Phe Ser Lys Phe Gly Leu Cys

945 950 955 960

Thr Phe Ser Asp Val Ala Gln Leu Ser Leu Glu Asp Leu Pro Ala Leu

965 970 975

Gly Ile Thr Leu Ala Gly His Gln Lys Lys Leu Leu His His Ile Gln

980 985 990

Leu Leu Gln Gln His Leu Arg Gln Gln Gly Ser Val Glu Val

995 1000 1005

<210>33

<21l>618

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>33

atggagttcc tctgggcccc tctcttgggt ctgtgctgca gtctggccgc tgctgatcgc 60

cacaccgtct tctggaacag ttcaaatccc aagttccgga atgaggacta caccatacat 120

gtgcagctga atgactacgt ggacatcatc tgtccgcact atgaagatca ctctgtggca 180

gacgctgcca tggagcagta catactgtac ctggtggagc atgaggagta ccagctgtgc 240

cagccccagt ccaaggacca agtccgctgg cagtgcaacc ggcccagtgc caagcatggc 300

ccggagaagc tgtctgagaa gttccagcgc ttcacacctt tcaccctggg caaggagttc 360

aaagaaggac acagctacta ctacatctcc aaacccatcc accagcatga agaccgctgc 420

ttgaggttga aggtgactgt cagtggcaaa atcactcaca gtcctcaggc ccatgacaat 480

ccacaggaga agagacttgc agcagatgac ccagaggtgc gggttctaca tagcatcggt 540

cacagtgctg ccccacgcct cttcccactt gcctggactg tgctgctcct tccacttctg 600

ctgctgcaaa ccccgtga 618

<210>34

<211>205

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>34

Met Glu Phe Leu Trp Ala Pro Leu Leu Gly Leu Cys Cys Ser Leu Ala

1 5 10 15

Ala Ala Asp Arg His Thr Val Phe Trp Asn Ser Ser Asn Pro Lys Phe

20 25 30

Arg Asn Glu Asp Tyr Thr Ile His Val Gln Leu Asn Asp Tyr Val Asp

35 40 45

Ile Ile Cys Pro His Tyr Glu Asp His Ser Val Ala Asp Ala Ala Met

50 55 60

Glu Gln Tyr Ile Leu Tyr Leu Val Glu His Glu Glu Tyr Gln Leu Cys

65 70 75 80

Gln Pro Gln Ser Lys Asp Gln Val Arg Trp Gln Cys Asn Arg Pro Ser

85 90 95

Ala Lys His Gly Pro Glu Lys Leu Ser Glu Lys Phe Gln Arg Phe Thr

100 105 110

Pro Phe Thr Leu Gly Lys Glu Phe Lys Glu Gly His Ser Tyr Tyr Tyr

115 120 125

Ile Ser Lys Pro Ile His Gln His Glu Asp Arg Cys Leu Arg Leu Lys

130 135 140

Val Thr Val Ser Gly Lys Ile Thr His Ser Pro Gln Ala His Asp Asn

145 150 155 160

Pro Gln Glu Lys Arg Leu Ala Ala Asp Asp Pro Glu Val Arg Val Leu

165 170 175

His Ser Ile Gly His Ser Ala Ala Pro Arg Leu Phe Pro Leu Ala Trp

180 185 190

Thr Val Leu Leu Leu Pro Leu Leu Leu Leu Gln Thr Pro

195 200 205

<210>35

<211>552

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>35

atggagttcc tctgggcccc tctcttgggt ctgtgctgca gtctggccgc tgctgatcgc 60

cacaccgtct tctggaacag ttcaaatccc aagttccgga atgaggacta caccatacat 120

gtgcagctga atgactacgt ggacatcatc tgtccgcact atgaagatca ctctgtggca 180

gacgctgcca tggagcagta catactgtac ctggtggagc atgaggagta ccagctgtgc 240

cagccccagt ccaaggacca agtccgctgg cagtgcaacc ggcccagtgc caagcatggc 300

ccggagaagc tgtctgagaa gttccagcgc ttcacacctt tcaccctggg caaggagttc 360

aaagaaggac acagctacta ctacatctct cacagtcctc aggcccatga caatccacag 420

gagaagagac ttgcagcaga tgacccagag gtgcgggttc tacatagcat cggtcacagt 480

gctgccccac gcctcttccc acttgcctgg actgtgctgc tccttccact tctgctgctg 540

caaaccccgt ga 552

<210>36

<211>183

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>36

Met Glu Phe Leu Trp Ala Pro Leu Leu Gly Leu Cys Cys Ser Leu Ala

1 5 10 15

Ala Ala Asp Arg His Thr Val Phe Trp Asn Ser Ser Asn Pro Lys Phe

20 25 30

Arg Asn Glu Asp Tyr Thr Ile His Val Gln Leu Asn Asp Tyr Val Asp

35 40 45

Ile Ile Cys Pro His Tyr Glu Asp His Ser Val Ala Asp Ala Ala Met

50 55 60

Glu Gln Tyr Ile Leu Tyr Leu Val Glu His Glu Glu Tyr Gln Leu Cys

65 70 75 80

Gln Pro Gln Ser Lys Asp Gln Val Arg Trp Gln Cys Asn Arg Pro Ser

85 90 95

Ala Lys His Gly Pro Glu Lys Leu Ser Glu Lys Phe Gln Arg Phe Thr

100 105 110

Pro Phe Thr Leu Gly Lys Glu Phe Lys Glu Gly His Ser Tyr Tyr Tyr

115 120 125

Ile Ser His Ser Pro Gln Ala His Asp Asn Pro Gln Glu Lys Arg Leu

130 135 140

Ala Ala Asp Asp Pro Glu Val Arg Val Leu His Ser Ile Gly His Ser

145 150 155 160

Ala Ala Pro Arg Leu Phe Pro Leu Ala Trp Thr Val Leu Leu Leu Pro

165 170 175

Leu Leu Leu Leu Gln Thr Pro

180

<210>37

<211>642

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>37

atggcgcccg cgcagcgccc gctgctcccg ctgctgctcc tgctgttacc gctgccgccg 60

ccgcccttcg cgcgcgccga ggacgccgcc cgcgccaact cggaccgcta cgccgtctac 120

tggaaccgca gcaaccccag gttccacgca ggcgcggggg acgacggcgg gggctacacg 180

gtggaggtga gcatcaatga ctacctggac atctactgcc cgcactatgg ggcgccgctg 240

ccgccggccg agcgcatgga gcactacgtg ctgtacatgg tcaacggcga gggccacgcc 300

tcctgcgacc accgccagcg cggcttcaag cgctgggagt gcaaccggcc cgcggcgccc 360

ggggggccgc tcaagttctc ggagaagttc cagctcttca cgcccttctc cctgggcttc 420

gagttccggc ccggccacga gtattactac atctctgcca cgcctcccaa tgctgtggac 480

cggccctgcc tgcgactgaa ggtgtacgtg cggccgacca acgagaccct gtacgaggct 540

cctgagccca tcttcaccag caataactcg tgtagcagcc cgggcggctg ccgcctcttc 600

ctcagcacca tccccgtgct ctggaccctc ctgggttcct ag 642

<210>38

<211>213

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>38

Met Ala Pro Ala Gln Arg Pro Leu Leu Pro Leu Leu Leu Leu Leu Leu

1 5 10 15

Pro Leu Pro Pro Pro Pro Phe Ala Arg Ala Glu Asp Ata Ala Arg Ala

20 25 30

Asn Ser Asp Arg Tyr Ala Val Tyr Trp Asn Arg Ser Asn Pro Arg Phe

35 40 45

His Ala G1y Ala Gly Asp Asp Gly Gly Gly Tyr Thr Val Glu Val Ser

50 55 60

Ile Asn Asp Tyr Leu Asp Ile Tyr Cys Pro His Tyr Gly Ala Pro Leu

65 70 75 80

Pro Pro Ala Glu Arg Met Glu His Tyr Val Leu Tyr Met Val Asn Gly

85 90 95

Glu Gly His Ala Ser Cys Asp His Arg Gln Arg Gly Phe Lys Arg Trp

100 105 110

Glu Cys Asn Arg Pro Ala Ala Pro Gly Gly Pro Leu Lys Phe Set Glu

115 120 125

Lys Phe Gln Leu Phe Thr Pro Phe Set Leu Gly Phe Glu Phe Arg Pro

130 135 140

Gly His Glu Tyr Tyr Tyr Ile Set Ala Thr Pro Pro Ash Ala Val Asp

145 150 155 160

Arg Pro Cys Leu Arg Leu Lys Val Tyr Val Arg Pro Thr Asn Glu Thr

165 170 175

Leu Tyr Glu Ala Pro Glu Pro Ile Phe Thr Ser Ash Asn Ser Cys Ser

180 185 190

Set Pro Gly Gly Cys Arg Leu Phe Leu Ser Thr Ile Pro Val Leu Trp

195 200 205

Thr Leu Leu Gly Ser

210

<210>39

<211>717

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>39

atggcggcgg ctccgctgct gctgctgctg ctgctcgtgc ccgtgccgct gctgccgctg 60

ctggcccaag ggcccggagg ggcgctggga aaccggcatg cggtgtactg gaacagctcc 120

aaccagcacc tgcggcgaga gggctacacc gtgcaggtga acgtgaacga ctatctggat 180

atttactgcc cgcactacaa cagctcgggg gtgggccccg gggcgggacc ggggcccgga 240

ggcggggcag agcagtacgt gctgtacatg gtgagccgca acggctaccg cacctgcaac 300

gccagccagg gcttcaagcg ctgggagtgc aaccggccgc acgccccgca cagccccatc 360

aagttctcgg agaagttcca gcgctacagc gccttctctc tgggctacga gttccacgcc 420

ggccacgagt actactacat ctccacgccc actcacaacc tgcactggaa gtgtctgagg 480

atgaaggtgt tcgtctgctg cgcctccaca tcgcactccg gggagaagcc ggtccccact 540

ctcccccagt tcaccatggg ccccaatgtg aagatcaacg tgctggaaga ctttgaggga 600

gagaaccctc aggtgcccaa gcttgagaag agcatcagcg ggaccagccc caaacgggaa 660

cacctgcccc tggccgtggg catcgccttc ttcctcatga cgttcttggc ctcctag 717

<210>40

<211>238

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400> 40

Met Ala Ala Ala Pro Leu Leu Leu Leu Leu Leu Leu Val Pro Val Pro

1 5 10 15

Leu Leu Pro Leu Leu Ala Gln Gly Pro Gly Gly Ala Leu Gly Asn Arg

20 25 30

His Ala Val Tyr Trp Asn Ser Ser Asn Gln His Leu Arg Arg Glu Gly

35 40 45

Tyr Thr Val Gln Val Asn Val Asn Asp Tyr Leu Asp Ile Tyr Cys Pro

50 55 60

His Tyr Asn Ser Ser Gly Val Gly Pro Gly Ala Gly Pro Gly Pro Gly

65 70 75 80

Gly Gly Ala Glu Gln Tyr Val Leu Tyr Met Val Ser Arg Asn Gly Tyr

85 90 95

Arg Thr Cys Asn Ala Ser Gln Gly Phe Lys Arg Trp Glu Cys Asn Arg

100 105 110

Pro His Ala Pro His Ser Pro Ile Lys Phe Ser Glu Lys Phe Gln Arg

115 120 125

Tyr Ser Ala Phe Ser Leu Gly Tyr Glu Phe His Ala Gly His Glu Tyr

130 135 140

Tyr Tyr Ile Ser Thr Pro Thr His Asn Leu His Trp Lys Cys Leu Arg

145 150 155 160

Met Lys Val Phe Val Cys Cys Ala Ser Thr Ser His Ser Gly Glu Lys

165 170 175

Pro Val Pro Thr Leu Pro Gln Phe Thr Met Gly Pro Asn Val Lys Ile

180 185 190

Asn Val Leu Glu Asp Phe Glu Gly Glu Asn Pro Gln Val Pro Lys Leu

195 200 205

Glu Lys Ser Ile Ser Gly Thr Ser Pro Lys Arg Glu His Leu Pro Leu

210 215 220

Ala Val Gly Ile Ala Phe Phe Leu Met Thr Phe Leu Ala Ser

225 230 235

<210>41

<211>606

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>41

atgcggctgc tgcccctgct gcggactgtc ctctgggccg cgttcctcgg ctcccctctg 60

cgcgggggct ccagcctccg ccacgtagtc tactggaact ccagtaaccc caggttgctt 120

cgaggagacg ccgtggtgga gctgggcctc aacgattacc tagacattgt ctgcccccac 180

tacgaaggcc cagggccccc tgagggcccc gagacgtttg ctttgtacat ggtggactgg 240

ccaggctatg agtcctgcca ggcagagggc ccccgggcct acaagcgctg ggtgtgctcc 300

ctgccctttg gccatgttca attctcagag aagattcagc gcttcacacc cttctccctc 360

ggctttgagt tcttacctgg agagacttac tactacatct cggtgcccac tccagagagt 420

tctggccagt gcttgaggct ccaggtgtct gtctgctgca aggagaggaa gtctgagtca 480

gcccatcctg ttgggagccc tggagagagt ggcacatcag ggtggcgagg gggggacact 540

cccagccccc tctgtctctt gctattactg ctgcttctga ttcttcgtct tctgcgaatt 600

ctgtga 606

<210>42

<211>201

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>42

Met Arg Leu Leu Pro Leu Leu Arg Thr Val Leu Trp Ala Ala Phe Leu

1 5 10 15

Gly Ser Pro Leu Arg Gly Gly Ser Ser Leu Arg His Val Val Tyr Trp

20 25 30

Asn Ser Ser Asn Pro Arg Leu Leu Arg Gly Asp Ala Val Val Glu Leu

35 40 45

Gly Leu Asn Asp Tyr Leu Asp Ile Val Cys Pro His Tyr Glu Gly Pro

50 55 60

Gly Pro Pro Glu Gly Pro Glu Thr Phe Ala Leu Tyr Met Val Asp Trp

65 70 75 80

Pro Gly Tyr Glu Ser Cys Gln Ala Glu Gly Pro Arg Ala Tyr Lys Arg

85 90 95

Trp Val Cys Ser Leu Pro Phe Gly His Val Gln Phe Ser Glu Lys Ile

100 105 110

Gln Arg Phe Thr Pro Phe Ser Leu Gly Phe Glu Phe Leu Pro Gly Glu

115 120 125

Thr Tyr Tyr Tyr Ile Ser Val Pro Thr Pro Glu Ser Ser Gly Gln Cys

130 135 140

Leu Arg Leu Gln Val Ser Val Cys Cys Lys Glu Arg Lys Ser Glu Ser

145 150 155 160

Ala His Pro Val Gly Ser Pro Gly Glu Ser Gly Thr Ser Gly Trp Arg

165 170 175

Gly Gly Asp Thr Pro Ser Pro Leu Cys Leu Leu Leu Leu Leu Leu Leu

180 185 190

Leu Ile Leu Arg Leu Leu Arg Ile Leu

195 200

<210>43

<211>624

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>43

atgcggctgc tgcccctgct gcggactgtc ctctgggccg cgttcctcgg ctcccctctg 60

cgcgggggct ccagcctccg ccacgtagtc tactggaact ccagtaaccc caggttgctt 120

cgaggagacg ccgtggtgga gctgggcctc aacgattacc tagacattgt ctgcccccac 180

tacgaaggcc cagggccccc tgagggcccc gagacgtttg ctttgtacat ggtggactgg 240

ccaggctatg agtcctgcca ggcagagggc ccccgggcct acaagcgctg ggtgtgctcc 300

ctgccctttg gccatgttca attctcagag aagattcagc gcttcacacc cttctccctc 360

ggctttgagt tcttacctgg agagacttac tactacatct cggtgcccac tccagagagt 420

tctggccagt gcttgaggct ccaggtgtct gtctgctgca aggagaggag agccagagtc 480

ctcccaagat cccctggagg aggagggatc cctgctgcct gcactggggg tgccaattca 540

gaccgacaag atggagcatt gatgggggag atcagagggt ctgaggtgac tcttgcagga 600

gcctgtcccc tcatcacagg ctaa 624

<210>44

<211>207

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>44

Met Arg Leu Leu Pro Leu Leu Arg Thr Val Leu Trp Ala Ala Phe Leu

1 5 10 15

Gly Ser Pro Leu Arg Gly Gly Ser Ser Leu Arg His Val Val Tyr Trp

20 25 30

Asn Ser Ser Asn Pro Arg Leu Leu Arg Gly Asp Ala Val Val Glu Leu

35 40 45

Gly Leu Asn Asp Tyr Leu Asp Ile Val Cys Pro His Tyr Glu Gly Pro

50 55 60

Gly Pro Pro Glu Gly Pro Glu Thr Phe Ala Leu Tyr Met Val Asp Trp

65 70 75 80

Pro Gly Tyr Glu Ser Cys Gln Ala Glu Gly Pro Arg Ala Tyr Lys Arg

85 90 95

Trp Val Cys Ser Leu Pro Phe Gly His Val Gln Phe Ser Glu Lys Ile

100 105 110

Gln Arg Phe Thr Pro Phe Ser Leu Gly Phe Glu Phe Leu Pro Gly Glu

115 120 125

Thr Tyr Tyr Tyr Ile Ser Val Pro Thr Pro Glu Ser Ser Gly Gln Cys

130 135 140

Leu Arg Leu Gln Val Ser Val Cys Cys Lys Glu Arg Arg Ala Arg Val

145 150 155 160

Leu Pro Arg Ser Pro Gly Gly Gly Gly Ile Pro Ala Ala Cys Thr Gly

165 170 175

Gly Ala Asn Ser Asp Arg Gln Asp Gly Ala Leu Met Gly Glu Ile Arg

180 185 190

Gly Ser Glu Val Thr Leu Ala Gly Ala Cys Pro Leu Ile Thr Gly

195 200 205

<210>45

<211>645

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>45

atgcggctgc tgcccctgct gcggactgtc ctctgggccg cgttcctcgg ctcccctctg 60

cgcgggggct ccagcctccg ccacgtagtc tactggaact ccagtaaccc caggttgctt 120

cgaggagacg ccgtggtgga gctgggcctc aacgattacc tagacattgt ctgcccccac 180

tacgaaggcc cagggccccc tgagggcccc gagacgtttg ctttgtacat ggtggactgg 240

ccaggctatg agtcctgcca ggcagagggc ccccgggcct acaagcgctg ggtgtgctcc 300

ctgccctttg gccatgttca attctcagag aagattcagc gcttcacacc cttctccctc 360

ggctttgagt tcttacctgg agagacttac tactacatct cggtgcccac tccagagagt 420

tctggccagt gcttgaggct ccaggtgtct gtctgctgca aggagaggag accttccctc 480

tcatcccaag gagccagagt cctcccaaga tcccctggag gaggagggat ccctgctgcc 540

tgcactgggg gtgccaattc agaccgacaa gatggagcat tgatggggga gatcagaggg 600

tctgaggtga ctcttgcagg agcctgtccc ctcatcacag gctaa 645

<210>46

<211>214

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>46

Met Arg Leu Leu Pro Leu Leu Arg Thr Val Leu Trp Ala Ala Phe Leu

1 5 10 15

Gly Ser Pro Leu Arg Gly Gly Ser Ser Leu Arg His Val Val Tyr Trp

20 25 30

Asn Ser Ser Asn Pro Arg Leu Leu Arg Gly Asp Ala Val Val Glu Leu

35 40 45

Gly Leu Asn Asp Tyr Leu Asp Ile Val Cys Pro His Tyr Glu Gly Pro

50 55 60

Gly Pro Pro Glu Gly Pro Glu Thr Phe Ala Leu Tyr Met Val Asp Trp

65 70 75 80

Pro Gly Tyr Glu Ser Cys Gln Ala Glu Gly Pro Arg Ala Tyr Lys Arg

85 90 95

Trp Val Cys Ser Leu Pro Phe Gly His Val Gln Phe Ser Glu Lys Ile

100 105 110

Gln Arg Phe Thr Pro Phe Ser Leu Gly Phe Glu Phe Leu Pro Gly Glu

115 120 125

Thr Tyr Tyr Tyr Ile Ser Val Pro Thr Pro Glu Ser Ser Gly Gln Cys

130 135 140

Leu Arg Leu Gln Val Ser Val Cys Cys Lys Glu Arg Arg Pro Ser Leu

145 150 155 160

Ser Ser Gln Gly Ala Arg Val Leu Pro Arg Ser Pro Gly Gly Gly Gly

165 170 175

Ile Pro Ala Ala Cys Thr Gly Gly Ala Asn Ser Asp Arg Gln Asp Gly

180 185 190

Ala Leu Met Gly Glu Ile Arg Gly Ser Glu Val Thr Leu Ala Gly Ala

195 200 205

Cys Pro Leu Ile Thr Gly

210

<210>47

<211>687

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>47

atgttgcacg tggagatgtt gacgctggtg tttctggtgc tctggatgtg tgtgttcagc 60

caggacccgg gctccaaggc cgtcgccgac cgctacgctg tctactggaa cagcagcaac 120

cccagattcc agaggggtga ctaccatatt gatgtctgta tcaatgacta cctggatgtt 180

ttctgccctc actatgagga ctccgtccca gaagataaga ctgagcgcta tgtcctctac 240

atggtgaact ttgatggcta cagtgcctgc gaccacactt ccaaagggtt caagagatgg 300

gaatgtaacc ggcctcactc tccaaatgga ccgctgaagt tctctgaaaa attccagctc 360

ttcactccct tttctctagg atttgaattc aggccaggcc gagaatattt ctacatctcc 420

tctgcaatcc cagataatgg aagaaggtcc tgtctaaagc tcaaagtctt tgtgagacca 480

acaaatagct gtatgaaaac tataggtgtt catgatcgtg ttttcgatgt taacgacaaa 540

gtagaaaatt cattagaacc agcagatgac accgtacatg agtcagccga gccatcccgc 600

ggcgagaacg cggcacaaac accaaggata cccagccgcc ttttggcaat cctactgttc 660

ctcctggcga tgcttttgac attatag 687

<210>48

<211>228

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>48

Met Leu His Val Glu Met Leu Thr Leu Val Phe Leu Val Leu Trp Met

1 5 10 15

Cys Val Phe Ser Gln Asp Pro Gly Ser Lys Ala Val Ala Asp Arg Tyr

20 25 30

Ala Val Tyr Trp Asn Ser Ser Asn Pro Arg Phe Gln Arg Gly Asp Tyr

35 40 45

His Ile Asp Val Cys Ile Asn Asp Tyr Leu Asp Val Phe Cys Pro His

50 55 60

Tyr Glu Asp Ser Val Pro Glu Asp Lys Thr Glu Arg Tyr Val Leu Tyr

65 70 75 80

Met Val Asn Phe Asp Gly Tyr Ser Ala Cys Asp His Thr Ser Lys Gly

85 90 95

Phe Lys Arg Trp Glu Cys Asn Arg Pro His Ser Pro Asn Gly Pro Leu

100 105 110

Lys Phe Ser Glu Lys Phe Gln Leu Phe Thr Pro Phe Ser Leu Gly Phe

115 120 125

Glu Phe Arg Pro Gly Arg Glu Tyr Phe Tyr Ile Ser Ser Ala Ile Pro

130 135 140

Asp Asn Gly Arg Arg Ser Cys Leu Lys Leu Lys Val Phe Val Arg Pro

145 150 155 160

Thr Asn Ser Cys Met Lys Thr Ile Gly Val His Asp Arg Val Phe Asp

165 170 175

Val Asn Asp Lys Val Glu Asn Ser Leu Glu Pro Ala Asp Asp Thr Val

180 185 190

His Glu Ser Ala Glu Pro Ser Arg Gly Glu Asn Ala Ala Gln Thr Pro

195 200 205

Arg Ile Pro Ser Arg Leu Leu Ala Ile Leu Leu Phe Leu Leu Ala Met

210 215 220

Leu Leu Thr Leu

225

<210>49

<211>1041

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>49

atggctcggc ctgggcagcg ttggctcggc aagtggcttg tggcgatggt cgtgtgggcg 60

ctgtgccggc tcgccacacc gctggccaag aacctggagc ccgtatcctg gagctccctc 120

aaccccaagt tcctgagtgg gaagggcttg gtgatctatc cgaaaattgg agacaagctg 180

gacatcatct gcccccgagc agaagcaggg cggccctatg agtactacaa gctgtacctg 240

gtgcggcctg agcaggcagc tgcctgtagc acagttctcg accccaacgt gttggtcacc 300

tgcaataggc cagagcagga aatacgcttt accatcaagt tccaggagtt cagccccaac 360

tacatgggcc tggagttcaa gaagcaccat gattactaca ttacctcaac atccaatgga 420

agcctggagg ggctggaaaa ccgggagggc ggtgtgtgcc gcacacgcac catgaagatc 480

atcatgaagg ttgggcaaga tcccaatgct gtgacgcctg agcagctgac taccagcagg 540

cccagcaagg aggcagacaa cactgtcaag atggccacac aggcccctgg tagtcggggc 600

tccctgggtg actctgatgg caagcatgag actgtgaacc aggaagagaa gagtggccca 660

ggtgcaagtg ggggcagcag cggggaccct gatggcttct tcaactccaa ggtggcattg 720

ttcgcggctg tcggtgccgg ttgcgtcatc ttcctgctca tcatcatctt cctgacggtc 780

ctactactga agctacgcaa gcggcaccgc aagcacacac agcagcgggc ggctgccctc 840

tcgctcagta ccctggccag tcccaagggg ggcagtggca cagcgggcac cgagcccagc 900

gacatcatca ttcccttacg gactacagag aacaactact gcccccacta tgagaaggtg 960

agtggggact acgggcaccc tgtctacatc gtccaagaga tgccgcccca gagcccggcg 1020

aacatctact acaaggtctg a 1041

<210>50

<211>346

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>50

Met Ala Arg Pro Gly Gln Arg Trp Leu Gly Lys Trp Leu Val Ala Met

1 5 10 15

Val Val Trp Ala Leu Cys Arg Leu Ala Thr Pro Leu Ala Lys Asn Leu

20 25 30

Glu Pro Val Ser Trp Ser Ser Leu Asn Pro Lys Phe Leu Ser Gly Lys

35 40 45

Gly Leu Val Ile Tyr Pro Lys Ile Gly Asp Lys Leu Asp Ile Ile Cys

50 55 60

Pro Arg Ala Glu Ala Gly Arg Pro Tyr Glu Tyr Tyr Lys Leu Tyr Leu

65 70 75 80

Val Arg Pro Glu Gln Ala Ala Ala Cys Ser Thr Val Leu Asp Pro Asn

85 90 95

Val Leu Val Thr Cys Asn Arg Pro Glu Gln Glu Ile Arg Phe Thr Ile

100 105 110

Lys Phe Gln Glu Phe Ser Pro Asn Tyr Met Gly Leu Glu Phe Lys Lys

115 120 125

His His Asp Tyr Tyr Ile Thr Ser Thr Ser Asn Gly Ser Leu Glu Gly

130 135 140

Leu Glu Asn Arg Glu Gly Gly Val Cys Arg Thr Arg Thr Met Lys Ile

145 150 155 160

Ile Met Lys Val Gly Gln Asp Pro Asn Ala Val Thr Pro Glu Gln Leu

165 170 175

Thr Thr Ser Arg Pro Ser Lys Glu Ala Asp Asn Thr Val Lys Met Ala

180 185 190

Thr Gln Ala Pro Gly Ser Arg Gly Ser Leu Gly Asp Ser Asp Gly Lys

195 200 205

His Glu Thr Val Asn Gln Glu Glu Lys Ser Gly Pro Gly Ala Ser Gly

210 215 220

Gly Ser Ser Gly Asp Pro Asp Gly Phe Phe Asn Ser Lys Val Ala Leu

225 230 235 240

Phe Ala Ala Val Gly Ala Gly Cys Val Ile Phe Leu Leu Ile Ile Ile

245 250 255

Phe Leu Thr Val Leu Leu Leu Lys Leu Arg Lys Arg His Arg Lys His

260 265 270

Thr Gln Gln Arg Ala Ala Ala Leu Ser Leu Ser Thr Leu Ala Ser Pro

275 280 285

Lys Gly Gly Ser Gly Thr Ala Gly Thr Glu Pro Ser Asp Ile Ile Ile

290 295 300

Pro Leu Arg Thr Thr Glu Asn Asn Tyr Cys Pro His Tyr Glu Lys Val

305 310 315 320

Ser Gly Asp Tyr Gly His Pro Val Tyr Ile Val Gln Glu Met Pro Pro

325 330 335

Gln Ser Pro Ala Asn Ile Tyr Tyr Lys Val

340 345

<210>51

<21l>1002

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>51

atggctgtga gaagggactc cgtgtggaag tactgctggg gtgttttgat ggttttatgc 60

agaactgcga tttccaaatc gatagtttta gagcctatct attggaattc ctcgaactcc 120

aaatttctac ctggacaagg actggtacta tacccacaga taggagacaa attggatatt 180

atttgcccca aagtggactc taaaactgtt ggccagtatg aatattataa agtttatatg 240

gttgataaag accaagcaga cagatgcact attaagaagg aaaatacccc tctcctcaac 300

tgtgccaaac cagaccaaga tatcaaattc accatcaagt ttcaagaatt cagccctaac 360

ctctggggtc tagaatttca gaagaacaaa gattattaca ttatatctac atcaaatggg 420

tctttggagg gcctggataa ccaggaggga ggggtgtgcc agacaagagc catgaagatc 480

ctcatgaaag ttggacaaga tgcaagttct gctggatcaa ccaggaataa agatccaaca 540

agacgtccag aactagaagc tggtacaaat ggaagaagtt cgacaacaag tccctttgta 600

aaaccaaatc caggttctag cacagacggc aacagcgccg gacattcggg gaacaacatc 660

ctcggttccg aagtggcctt atttgcaggg attgcttcag gatgcatcat cttcatcgtc 720

atcatcatca cgctggtggt cctcttgctg aagtaccgga ggagacacag gaagcactcg 780

ccgcagcaca cgaccacgct gtcgctcagc acactggcca cacccaagcg cagcggcaac 840

aacaacggct cagagcccag tgacattatc atcccgctaa ggactgcgga cagcgtcttc 900

tgccctcact acgagaaggt cagcggggac tacgggcacc cggtgtacat cgtccaggag 960

atgcccccgc agagcccggc gaacatttac tacaaggtct ga 1002

<210>52

<211>333

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>52

Met Ala Val Arg Arg Asp Ser Val Trp Lys Tyr Cys Trp Gly Val Leu

1 5 10 15

Met Val Leu Cys Arg Thr Ala Ile Ser Lys Ser Ile Val Leu Glu Pro

20 25 30

Ile Tyr Trp Asn Ser Ser Asn Ser Lys Phe Leu Pro Gly Gln Gly Leu

35 40 45

Val Leu Tyr Pro Gln Ile Gly Asp Lys Leu Asp Ile Ile Cys Pro Lys

50 55 60

Val Asp Ser Lys Thr Val Gly Gln Tyr Glu Tyr Tyr Lys Val Tyr Met

65 70 75 80

Val Asp Lys Asp Gln Ala Asp Arg Cys Thr Ile Lys Lys Glu Asn Thr

85 90 95

Pro Leu Leu Asn Cys Ala Lys Pro Asp Gln Asp Ile Lys Phe Thr Ile

100 105 110

Lys Phe Gln Glu Phe Ser Pro Asn Leu Trp Gly Leu Glu Phe Gln Lys

115 120 125

Asn Lys Asp Tyr Tyr Ile Ile Ser Thr Ser Asn Gly Ser Leu Glu Gly

130 135 140

Leu Asp Asn Gln Glu Gly Gly Val Cys Gln Thr Arg Ala Met Lys Ile

145 150 155 160

Leu Met Lys Val Gly Gln Asp Ala Ser Ser Ala Gly Ser Thr Arg Asn

165 170 175

Lys Asp Pro Thr Arg Arg Pro Glu Leu Glu Ala Gly Thr Asn Gly Arg

180 185 190

Ser Ser Thr Thr Ser Pro Phe Val Lys Pro Asn Pro Gly Ser Ser Thr

195 200 205

Asp Gly Asn Ser Ala Gly His Ser Gly Asn Asn Ile Leu Gly Ser Glu

210 215 220

Val Ala Leu Phe Ala Gly Ile Ala Ser Gly Cys Ile Ile Phe Ile Val

225 230 235 240

Ile Ile Ile Thr Leu Val Val Leu Leu Leu Lys Tyr Arg Arg Arg His

245 250 255

Arg Lys His Ser Pro Gln His Thr Thr Thr Leu Ser Leu Ser Thr Leu

260 265 270

Ala Thr Pro Lys Arg Ser Gly Asn Asn Asn Gly Ser Glu Pro Ser Asp

275 280 285

Ile Ile Ile Pro Leu Arg Thr Ala Asp Ser Val Phe Cys Pro His Tyr

290 295 300

Glu Lys Val Ser Gly Asp Tyr Gly His Pro Val Tyr Ile Val Gln Glu

305 310 315 320

Met Pro Pro Gln Ser Pro Ala Asn Ile Tyr Tyr Lys Val

325 330

<210>53

<211>1023

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>53

atggggcccc cccattctgg gccggggggc gtgcgagtcg gggccctgct gctgctgggg 60

gttttggggc tggtgtctgg gctcagcctg gagcctgtct actggaactc ggcgaataag 120

aggttccagg cagagggtgg ttatgtgctg taccctcaga tcggggaccg gctagacctg 180

ctctgccccc gggcccggcc tcctggccct cactcctctc ctaattatga gttctacaag 240

ctgtacctgg tagggggtgc tcagggccgg cgctgtgagg caccccctgc cccaaacctc 300

cttctcactt gtgatcgccc agacctggat ctccgcttca ccatcaagtt ccaggagtat 360

agccctaatc tctggggcca cgagttccgc tcgcaccacg attactacat cattgccaca 420

tcggatggga cccgggaggg cctggagagc ctgcagggag gtgtgtgcct aaccagaggc 480

atgaaggtgc ttctccgagt gggacaaagt ccccgaggag gggctgtccc ccgaaaacct 540

gtgtctgaaa tgcccatgga aagagaccga ggggcagccc acagcctgga gcctgggaag 600

gagaacctgc caggtgaccc caccagcaat gcaacctccc ggggtgctga aggccccctg 660

ccccctccca gcatgcctgc agtggctggg gcagcagggg ggctggcgct gctcttgctg 720

ggcgtggcag gggctggggg tgccatgtgt tggcggagac ggcgggccaa gccttcggag 780

agtcgccacc ctggtcctgg ctccttcggg aggggagggt ctctgggcct ggggggtgga 840

ggtgggatgg gacctcggga ggctgagcct ggggagctag ggatagctct gcggggtggc 900

ggggctgcag atcccccctt ctgcccccac tatgagaagg tgagtggtga ctatgggcat 960

cctgtgtata tcgtgcagga tgggcccccc cagagccctc caaacatcta ctacaaggta 1020

tga 1023

<210>54

<211>340

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>54

Met Gly Pro Pro His Ser Gly Pro Gly Gly Val Arg Val Gly Ala Leu

1 5 10 15

Leu Leu Leu Gly Val Leu Gly Leu Val Ser Gly Leu Ser Leu Glu Pro

20 25 30

Val Tyr Trp Asn Ser Ala Asn Lys Arg Phe Gln Ala Glu Gly Gly Tyr

35 40 45

Val Leu Tyr Pro Gln Ile Gly Asp Arg Leu Asp Leu Leu Cys Pro Arg

50 55 60

Ala Arg Pro Pro Gly Pro His Ser Ser Pro Asn Tyr Glu Phe Tyr Lys

65 70 75 80

Leu Tyr Leu Val Gly Gly Ala Gln Gly Arg Arg Cys Glu Ala Pro Pro

85 90 95

Ala Pro Asn Leu Leu Leu Thr Cys Asp Arg Pro Asp Leu Asp Leu Arg

100 105 110

Phe Thr Ile Lys Phe Gln Glu Tyr Ser Pro Asn Leu Trp Gly His Glu

115 120 125

Phe Arg Ser His His Asp Tyr Tyr Ile Ile Ala Thr Ser Asp Gly Thr

130 135 140

Arg Glu Gly Leu Glu Ser Leu Gln Gly Gly Val Cys Leu Thr Arg Gly

145 150 155 160

Met Lys Val Leu Leu Arg Val Gly Gln Ser Pro Arg Gly Gly Ala Val

165 170 175

Pro Arg Lys Pro Val Ser Glu Met Pro Met Glu Arg Asp Arg Gly Ala

180 185 190

Ala His Ser Leu Glu Pro Gly Lys Glu Asn Leu Pro Gly Asp Pro Thr

195 200 205

Ser Asn Ala Thr Ser Arg Gly Ala Glu Gly Pro Leu Pro Pro Pro Ser

210 215 220

Met Pro Ala Val Ala Gly Ala Ala Gly Gly Leu Ala Leu Leu Leu Leu

225 230 235 240

Gly Val Ala Gly Ala Gly Gly Ala Met Cys Trp Arg Arg Arg Arg Ala

245 250 255

Lys Pro Ser Glu Ser Arg His Pro Gly Pro Gly Ser Phe Gly Arg Gly

260 265 270

Gly Ser Leu Gly Leu Gly Gly Gly Gly Gly Met Gly Pro Arg Glu Ala

275 280 285

Glu Pro Gly Glu Leu Gly Ile Ala Leu Arg Gly Gly Gly Ala Ala Asp

290 295 300

Pro Pro Phe Cys Pro His Tyr Glu Lys Val Ser Gly Asp Tyr Gly His

305 310 315 320

Pro Val Tyr Ile Val Gln Asp Gly Pro Pro Gln Ser Pro Pro Asn Ile

325 330 335

Tyr Tyr Lys Val

340

<210>55

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>55

Ile Met Asn Asp Met Pro Ile Tyr Met

1 5

<210>56

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>56

Val Leu Ala Gly Val Gly Phe Phe Ile

1 5

<210>57

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>57

Thr Leu Ala Asp Phe Asp Pro Arg Val

1 5

<210>58

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>58

Val Leu Leu Leu Val Leu Ala Gly Val

l 5

<210>59

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>59

Val Leu Ala Gly Val Gly Phe Phe Ile

1 5

<210>60

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>60

Ile Met Asn Asp Met Pro Ile Tyr Met

1 5

<210>61

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>61

Ser Leu Leu Gly Leu Lys Asp Gln Val

1 5

<210>62

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>62

Trp Leu Val Pro Ile Gly Gln Cys Leu

1 5

<210>63

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>63

Leu Leu Trp Gly Cys Ala Leu Ala Ala

1 5

<210>64

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>64

Gly Leu Thr Arg Thr Ser Val Thr Val

1 5

<210>65

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>65

Asn Leu Tyr Tyr Ala Glu Ser Asp Leu

1 5

<210>66

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>66

Lys Leu Asn Val Glu Glu Arg Ser Val

1 5

<210>67

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>67

Ile Met Gly Gln Phe Ser His His Asn

1 5

<210>68

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>68

Tyr Ser Val Cys Asn Val Met Ser Gly

1 5

<210>69

<211>9

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>69

Met Gln Asn Ile Met Asn Asp Met Pro

1 5

<210>70

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>70

Glu Ala Gly Ile Met Gly Gln Phe Ser His His Asn Ile Ile Arg

1 5 10 15

<210>71

<211>13

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>71

Pro Ile Tyr Met Tyr Ser Val Cys Asn Val Met Ser Gly

1 5 10

<210>72

<211>16

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>72

Asp Leu Met Gln Asn Ile Met Asn Asp Met Pro Ile Tyr Met Tyr Ser

1 5 10 15

<210>73

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>73

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>74

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>74

Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>75

<211>14

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>75

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr

1 5 10

<210>76

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>76

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gln

1 5 10 15

<210>77

<211>14

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>77

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Val Asp

1 5 10

<210>78

<211>14

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>78

Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly

1 5 10

<210>79

<211>18

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>79

Lys Glu Ser Gly Ser Val Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser

1 5 10 15

Leu Asp

<210>80

<211>16

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>80

Glu Ser Gly Ser Val Ser Ser Glu Glu Leu Ala Phe Arg Ser Leu Asp

1 5 10 15

<210>81

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>81

Lys Asp Glu Leu

1

<210>82

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>82

Asp Asp Glu Leu

1

<210>83

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>83

Asp Glu Glu Leu

1

<210>84

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>84

Gln Glu Asp Leu

1

<210>85

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>85

Arg Asp Glu Leu

1

<210>86

<211>7

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>86

Pro Lys Lys Lys Arg Lys Val

1 5

<210>87

<211>7

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>87

Pro Gln Lys Lys Ile Lys Ser

1 5

<210>88

<211>5

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>88

Gln Pro Lys Lys Pro

1 5

<210>89

<211>4

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>89

Arg Lys Lys Arg

1

<210>90

<211>5

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>90

Lys Lys Lys Arg Lys

1 5

<210>91

<211>12

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>91

Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala His Gln

1 5 10

<210>92

<211>16

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>92

Arg Gln Ala Arg Arg Asn Arg Arg Arg Arg Trp Arg Glu Arg Gln Arg

1 5 10 15

<210>93

<211>19

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>93

Met Pro Leu Thr Arg Arg Arg Pro Ala Ala Ser Gln Ala Leu Ala Pro

1 5 10 15

Pro Thr Pro

<210>94

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>94

Met Asp Asp Gln Arg Asp Leu Ile Ser Asn Asn Glu Gln Leu Pro

1 5 10 15

<210>95

<211>32

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<220>

<221>VARIANT

<222>(7)...(7)

＜223〉Xaa can be the aminoacid of any natural generation

<220>

<221>VARIANT

<222>(8)...(8)

＜223〉Xaa can be the aminoacid of any natural generation

<220>

<221>VARIANT

<222>(32)...(32)

＜223〉Xaa can be the aminoacid of any natural generation

<400>95

Met Leu Phe Asn Leu Arg Xaa Xaa Leu Asn Asn Ala Ala Phe Arg His

1 5 10 15

Gly His Asn Phe Met Val Arg Asn Phe Arg Cys Gly Gln Pro Leu Xaa

20 25 30

<210>96

<211>3

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>96

Ala Lys Leu

1

<210>97

<211>6

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>97

Ser Asp Tyr Gln Arg Leu

1 5

<210>98

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>98

Gly Cys Val Cys Ser Ser Asn Pro

1 5

<210>99

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>99

Gly Gln Thr Val Thr Thr Pro Leu

1 5

<210>100

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>100

Gly Gln Glu Leu Ser Gln His Glu

1 5

<210>101

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>101

Gly Asn Ser Pro Ser Tyr Asn Pro

1 5

<210>102

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>102

Gly Val Ser Gly Ser Lys Gly Gln

1 5

<210>103

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>103

Gly Gln Thr Ile Thr Thr Pro Leu

1 5

<210>104

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>104

Gly Gln Thr Leu Thr Thr Pro Leu

1 5

<210>105

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>105

Gly Gln Ile Phe Ser Arg Ser Ala

1 5

<210>106

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>106

Gly Gln Ile His Gly Leu Ser Pro

1 5

<210>107

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>107

Gly Ala Arg Ala Ser Val Leu Ser

1 5

<210>108

<211>8

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>108

Gly Cys Thr Leu Ser Ala Glu Glu

1 5

<210>109

<211>16

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>109

Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro

1 5 10 15

<210>110

<211>12

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>110

Ala Ala Val Leu Leu Pro Val Leu Leu Ala Ala Pro

1 5 10

<210>111

<211>15

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>111

Val Thr Val Leu Ala Leu Gly Ala Leu Ala Gly Val Gly Val Gly

1 5 10 15

<210>112

<211>3712

<212>DNA

＜213〉jungle fowl (Gallus gallus)

<400>112

cggctctgac tttgtgttaa cggtttatgg actggttcca aagagctcaa aggtaccaaa 60

acactccaag caacctctga accattcaag caagtagtgt gtgtttattg gatatggtgg 120

agtctacaga gaatcttcat ggattctaat gctgacatca gtgcaagaag agtgtcagga 180

atggattggc tctggctggt ttgcttcttt catctagtca cttcactaga agaaatactt 240

ctggatacaa ctggagaaac ctcagagatt ggctggacct ctcaccctcc tgatgggtgg 300

gaagaagtaa gtgtccggga tgataaggag cgccagatcc gaacctttca agtttgtaac 360

atggatgaac caggtcagaa taactggttg cgtactcact tcatagagcg acgtggagcc 420

caccgagtcc atgtccgcct tcatttctca gtgagggact gtgccagcat gcgtactgtg 480

gcctctactt gcaaagagac tttcacactc tactaccacc agtcagatgt cgacatagcc 540

tctcaggaac tgccagagtg gcatgaaggc ccctggacca aggtggatac tattgcagct 600

gatgaaagct tttcccaggt ggacagaact gggaaggtgg taaggatgaa tgttaaagta 660

cgcagctttg ggccactcac aaagcatggc ttctacctgg ccttccagga ctcaggagcc 720

tgtatgtccc tggtggcagt ccaagtcttt ttctacaagt gtccagctgt ggtgaaagga 780

tttgcctcct tccctgaaac ttttgctgga ggagagagga cctcactggt ggagtcacta 840

gggacgtgtg tagcaaatgc tgaagaggca agcacaactg ggtcatcagg tgttcggttg 900

cactgcaatg gagaaggaga gtggatggtg gccactggac gatgctcttg caaggctggt 960

taccaatctg ttgacaatga gcaagcttgt caagcttgtc ccattggttc ctttaaagca 1020

tctgtgggag atgacccttg ccttctctgc cctgcccaca gccatgctcc actgccactg 1080

ccaggttcca ttgaatgtgt gtgtcagagt cactactacc gatctgcttc tgacaattct 1140

gatgctccct gcactggcat cccctctgct ccccgtgacc tcagttatga aattgttggc 1200

tccaacgtgc tcctgacctg gcgcctcccc aaggacttgg gtggccgcaa ggatgtcttc 1260

ttcaatgtca tctgcaagga atgcccaaca aggtcagcag ggacatgtgt gcgctgtggg 1320

gacaatgtac agtttgaacc acgccaagtg ggcctgacag aaagtcgtgt tcaagtctcc 1380

aacctattgg cccgtgtgca gtacactttt gagatccagg ctgtcaattt ggtgactgag 1440

ttgagttcag aagcacccca gtatgctacc atcaacgtta gcaccagcca gtcagtgccc 1500

tccgcaatcc ctatgatgca tcaggtgagt cgtgctacca gtagcatcac actgtcttgg 1560

cctcagccag accagcccaa tggggttatc ctggattacc agctacggta ctttgacaag 1620

gcagaagatg aggataattc atttactttg actagtgaaa ctaacatggc cactatatta 1680

aatctgagtc caggcaagat ctatgtcttc caagtacgag ctagaacagc agtgggttat 1740

ggcccataca gtggaaagat gtatttccag actttaatgg caggagagca ctcggagatg 1800

gcacaggacc gactgccact tattgtgggc tcagcacttg gtggtctggc attcttggta 1860

attgctgcca ttgccattct tgccatcatc ttcaagagta aaaggcgaga gactccatac 1920

acagaccgcc tgcagcagta tatcagtaca cgaggacttg gagtgaagta ttacattgat 1980

ccttccacgt atgaagatcc caatgaagct attcgagagt ttgccaaaga gatagatgtg 2040

tccttcatca aaattgagga ggtcattgga tcaggagaat ttggagaggt gtgctttggg 2100

cgcctaaaac acccagggaa acgtgaatac acagtagcta ttaaaaccct gaagtcaggt 2160

tatactgatg aacagcgtcg agagttcctg agcgaggcca gcatcatggg gcaatttgag 2220

catcccaatg tcatccacct ggagggcgtg gtcaccaaaa gccgaccagt catgattgtc 2280

acagaattca tggagaatgg atcactggat tccttcctca ggcagaagga gggacagttc 2340

agtgtgttac agctggtggg aatgctacga gggattgcag caggcatgcg ctacctttca 2400

gacatgaact atgtgcatcg tgatctcgca gcacgtaaca tcttagtcaa cagtaacctt 2460

gtatgcaagg tgtcagactt tggtttgtct cgctttctgg aagatgatgc ttcaaatccc 2520

acttatactg gagctctggg ttgcaaaatc cccatccgtt ggactgcccc tgaagctgtc 2580

cagtatcgca agttcacctc ctccagtgat gtctggagct atggcattgt catgtgggag 2640

gtgatgtcct atggtgagag accttactgg gacatgtcca accaggatgt aattaatgcc 2700

attgaccagg actatcgcct gccaccaccc ccagactgcc caactgtttt gcatctgctg 2760

atgcttgact gctggcagaa ggatcgagtc cagagaccaa aatttgaaca aatagtcagt 2820

gccctagata aaatgatccg caagccatct gctctcaaag ccactggcac tgggagcagc 2880

agaccatctc agcctctcct gagcaactcc cctccagatt ttccttcact cagcaatgcc 2940

cacgagtggt tggatgccat caagatgggt cgttacaagg agaattttga ccaggctggt 3000

ctgattacat ttgatgtcat atcacgcatg actctggaag atctccagcg tattggaatc 3060

accctggttg gtcaccagaa aaagattcta aacagcatcc agctcatgaa agttcatttg 3120

aaccagcttg aaccagttga agtgtgatgc tttaagtctc tatttcacca gactcaaatt 3180

ctgaaagagt cctgagggga ttcagaggga ttgtcactgt atgaaaagga aatggcaaga 3240

tgctccttga agacttactg cacctagaga gtagacatta cacattccat tccaccagca 3300

aaaagagaat cttgccatca tttaaaagca gagttaaata gctggtggtt aaatatgact 3360

ggcatcatac actaggagta ggtcagggag ggaaagttat agtaatgcag agtggagctg 3420

gtataatagt ttggacagac cacaagcacc tgctagctct tctccactaa ataaaaaatc 3480

agacaattct ccagtgccat cagcaggctt tatctgtgac tgggaacaaa gaaatcacaa 3540

tttttccaag agagtatcag cacattgtga gagttatcac tcagttggaa atggacatca 3600

cttgctatgc cagatttgtg agaaactgga gttccactga gtgcaccata tgtggtaaac 3660

aataaggtac atcacctcgt aatttttaca gaggttgaga gtaaagggcc ca 3712

<210>113

<211>1002

<212>PRT

＜213〉jungle fowl (Gallus gallus)

<400>113

Met Asp Ser Asn Ala Asp Ile Ser Ala Arg Arg Val Ser Gly Met Asp

1 5 10 15

Trp Leu Trp Leu Val Cys Phe Phe His Leu Val Thr Ser Leu Glu Glu

20 25 30

Ile Leu Leu Asp Thr Thr Gly Glu Thr Ser Glu Ile Gly Trp Thr Ser

35 40 45

His Pro Pro Asp Gly Trp Glu Glu Val Ser Val Arg Asp Asp Lys Glu

50 55 60

Arg Gln Ile Arg Thr Phe Gln Val Cys Asn Met Asp Glu Pro Gly Gln

65 70 75 80

Asn Asn Trp Leu Arg Thr His Phe Ile Glu Arg Arg Gly Ala His Arg

85 90 95

Val His Val Arg Leu His Phe Ser Val Arg Asp Cys Ala Ser Met Arg

100 105 110

Thr Val Ala Ser Thr Cys Lys Glu Thr Phe Thr Leu Tyr Tyr His Gln

115 120 125

Ser Asp Val Asp Ile Ala Ser Gln Glu Leu Pro Glu Trp His Glu Gly

130 135 140

Pro Trp Thr Lys Val Asp Thr Ile Ala Ala Asp Glu Ser Phe Ser Gln

145 150 155 160

Val Asp Arg Thr Gly Lys Val Val Arg Met Asn Val Lys Val Arg Ser

165 170 175

Phe Gly Pro Leu Thr Lys His Gly Phe Tyr Leu Ala Phe Gln Asp Ser

180 185 190

Gly Ala Cys Met Ser Leu Val Ala Val Gln Val Phe Phe Tyr Lys Cys

195 200 205

Pro Ala Val Val Lys Gly Phe Ala Ser Phe Pro Glu Thr Phe Ala Gly

210 215 220

Gly Glu Arg Thr Ser Leu Val Glu Ser Leu Gly Thr Cys Val Ala Asn

225 230 235 240

Ala Glu Glu Ala Ser Thr Thr Gly Ser Ser Gly Val Arg Leu His Cys

245 250 255

Asn Gly Glu Gly Glu Trp Met Val Ala Thr Gly Arg Cys Ser Cys Lys

260 265 270

Ala Gly Tyr Gln Ser Val Asp Asn Glu Gln Ala Cys Gln Ala Cys Pro

275 280 285

Ile Gly Ser Phe Lys Ala Ser Val Gly Asp Asp Pro Cys Leu Leu Cys

290 295 300

Pro Ala His Ser His Ala Pro Leu Pro Leu Pro Gly Ser Ile Glu Cys

305 310 315 320

Val Cys Gln Ser His Tyr Tyr Arg Ser Ala Ser Asp Asn Ser Asp Ala

325 330 335

Pro Cys Thr Gly Ile Pro Ser Ala Pro Arg Asp Leu Ser Tyr Glu Ile

340 345 350

Val Gly Ser Asn Val Leu Leu Thr Trp Arg Leu Pro Lys Asp Leu Gly

355 360 365

Gly Arg Lys Asp Val Phe Phe Asn Val Ile Cys Lys Glu Cys Pro Thr

370 375 380

Arg Ser Ala Gly Thr Cys Val Arg Cys Gly Asp Asn Val Gln Phe Glu

385 390 395 400

Pro Arg Gln Val Gly Leu Thr Glu Ser Arg Val Gln Val Ser Asn Leu

405 410 415

Leu Ala Arg Val Gln Tyr Thr Phe Glu Ile Gln Ala Val Asn Leu Val

420 425 430

Thr Glu Leu Ser Ser Glu Ala Pro Gln Tyr Ala Thr Ile Asn Val Ser

435 440 445

Thr Ser Gln Ser Val Pro Ser Ala Ile Pro Met Met His Gln Val Ser

450 455 460

Arg Ala Thr Ser Ser Ile Thr Leu Ser Trp Pro Gln Pro Asp Gln Pro

465 470 475 480

Asn Gly Val Ile Leu Asp Tyr Gln Leu Arg Tyr Phe Asp Lys Ala Glu

485 490 495

Asp Glu Asp Asn Ser Phe Thr Leu Thr Ser Glu Thr Asn Met Ala Thr

500 505 510

Ile Leu Asn Leu Ser Pro Gly Lys Ile Tyr Val Phe Gln Val Arg Ala

515 520 525

Arg Thr Ala Val Gly Tyr Gly Pro Tyr Ser Gly Lys Met Tyr Phe Gln

530 535 540

Thr Leu Met Ala Gly Glu His Ser Glu Met Ala Gln Asp Arg Leu Pro

545 550 555 560

Leu Ile Val Gly Ser Ala Leu Gly Gly Leu Ala Phe Leu Val Ile Ala

565 570 575

Ala Ile Ala Ile Leu Ala Ile Ile Phe Lys Ser Lys Arg Arg Glu Thr

580 585 590

Pro Tyr Thr Asp Arg Leu Gln Gln Tyr Ile Ser Thr Arg Gly Leu Gly

595 600 605

Val Lys Tyr Tyr Ile Asp Pro Ser Thr Tyr Glu Asp Pro Asn Glu Ala

610 615 620

Ile Arg Glu Phe Ala Lys Glu Ile Asp Val Ser Phe Ile Lys Ile Glu

625 630 635 640

Glu Val Ile Gly Ser Gly Glu Phe Gly Glu Val Cys Phe Gly Arg Leu

645 650 655

Lys His Pro Gly Lys Arg Glu Tyr Thr Val Ala Ile Lys Thr Leu Lys

660 665 670

Ser Gly Tyr Thr Asp Glu Gln Arg Arg Glu Phe Leu Ser Glu Ala Ser

675 680 685

Ile Met Gly Gln Phe Glu His Pro Asn Val Ile His Leu Glu Gly Val

690 695 700

Val Thr Lys Ser Arg Pro Val Met Ile Val Thr Glu Phe Met Glu Asn

705 710 715 720

Gly Ser Leu Asp Ser Phe Leu Arg Gln Lys Glu Gly Gln Phe Ser Val

725 730 735

Leu Gln Leu Val Gly Met Leu Arg Gly Ile Ala Ala Gly Met Arg Tyr

740 745 750

Leu Ser Asp Met Asn Tyr Val His Arg Asp Leu Ala Ala Arg Asn Ile

755 760 765

Leu Val Asn Ser Asn Leu Val Cys Lys Val Ser Asp Phe Gly Leu Ser

770 775 780

Arg Phe Leu Glu Asp Asp Ala Ser Asn Pro Thr Tyr Thr Gly Ala Leu

785 790 795 800

Gly Cys Lys Ile Pro Ile Arg Trp Thr Ala Pro Glu Ala Val Gln Tyr

805 810 815

Arg Lys Phe Thr Ser Ser Ser Asp Val Trp Ser Tyr Gly Ile Val Met

820 825 830

Trp Glu Val Met Ser Tyr Gly Glu Arg Pro Tyr Trp Asp Met Ser Asn

835 840 845

Gln Asp Val Ile Asn Ala Ile Asp Gln Asp Tyr Arg Leu Pro Pro Pro

850 855 860

Pro Asp Cys Pro Thr Val Leu His Leu Leu Met Leu Asp Cys Trp Gln

865 870 875 880

Lys Asp Arg Val Gln Arg Pro Lys Phe Glu Gln Ile Val Ser Ala Leu

885 890 895

Asp Lys Met Ile Arg Lys Pro Ser Ala Leu Lys Ala Thr Gly Thr Gly

900 905 910

Ser Ser Arg Pro Ser Gln Pro Leu Leu Ser Asn Ser Pro Pro Asp Phe

915 920 925

Pro Ser Leu Ser Asn Ala His Glu Trp Leu Asp Ala Ile Lys Met Gly

930 935 940

Arg Tyr Lys Glu Asn Phe Asp Gln Ala Gly Leu Ile Thr Phe Asp Val

945 950 955 960

Ile Ser Arg Met Thr Leu Glu Asp Leu Gln Arg Ile Gly Ile Thr Leu

965 970 975

Val Gly His Gln Lys Lys Ile Leu Asn Ser Ile Gln Leu Met Lys Val

980 985 990

His Leu Asn Gln Leu Glu Pro Val Glu Val

995 1000

<210>114

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>114

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Thr Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>115

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>115

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>116

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>116

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Ser

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>117

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>117

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Pro Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>118

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>118

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>119

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>119

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Pro Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Trp Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>120

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>120

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Thr Thr Val Tyr Gly Asp Asn Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>121

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>121

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Pro Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>122

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>122

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>123

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>123

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Pro Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Pro Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>124

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>124

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>125

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>125

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu lle

35 40 45

Tyr Gly Ala Ser Thr Arg Pro Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>126

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>126

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>127

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>127

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Trp Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>128

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>128

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>129

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>129

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Pro Pro Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>130

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>130

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>131

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>131

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Pro Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>132

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>132

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Arg

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>133

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>133

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Pro Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Leu Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Pro Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>134

<211>121

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>134

Gln Val Gln Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe

50 55 60

Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr

65 70 75 80

Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>135

<211>106

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>135

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Asn

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Val Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Trp Thr

85 90 95

Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210>136

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>136

Ser Tyr Ala Met Ser

1 5

<210>137

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>137

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>138

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>138

Val Arg Thr Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>139

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>139

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Ala

1 5 10

<210>140

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>140

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>141

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>141

Gln Gln Tyr Gly Ser Ser Trp Thr

1 5

<210>142

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>142

Ser Arg Ala Met Ser

1 5

<210>143

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>143

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Ser Thr

1 5 10 15

Gly

<210>144

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>144

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>145

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>145

Arg Ala Ser Gln Ser Val Ser Ser Asn Pro Ala

1 5 10

<210>146

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>146

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>147

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>147

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>148

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>148

Ser Arg Ala Met Ser

1 5

<210>149

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>149

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>150

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>150

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>151

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>151

Arg Ala Ser Gln Ser Val Ser Ser Asn Pro Ala

1 5 10

<210>152

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>152

Gly Ala Ser Thr Trp Ala Thr

1 5

<210>153

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>153

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>154

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>154

Ser Arg Ala Met Ser

1 5

<210>155

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>155

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>156

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>156

Val Arg Thr Thr Val Tyr Gly Asp Asn Met Asp Val

1 5 10

<210>157

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>157

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Pro

1 5 10

<210>158

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>158

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>159

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>159

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>160

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>160

Ser Arg Ala Met Ser

1 5

<210>161

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>161

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>162

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>162

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>163

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>163

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Pro

1 5 10

<210>164

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>164

Gly Ala Ser Thr Arg Pro Thr

1 5

<210>165

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>165

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>166

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>166

Ser Arg Ala Met Ser

1 5

<210>167

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>167

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>168

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>168

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>169

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>169

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Ala

1 5 10

<210>170

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>170

Gly Ala Ser Thr Arg Pro Thr

1 5

<210>171

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>171

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>172

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>172

Ser Arg Ala Met Ser

1 5

<210>173

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>173

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>174

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>174

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>175

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>175

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Ala

1 5 10

<210>176

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>176

Gly Ala Ser Thr Trp Ala Thr

1 5

<210>177

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>177

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>178

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>178

Ser Arg Ala Met Ser

1 5

<210>179

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>179

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>180

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>180

Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>181

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>181

Arg Ala Ser Gln Ser Val Ser Ser Asn Pro Pro

1 5 10

<210>182

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>182

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>183

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>183

Gln Gln Tyr Gly Ser Ser Trp Thr

1 5

<210>184

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>184

Ser Arg Ala Met Ser

1 5

<210>185

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>185

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>186

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>186

Val Arg Phe Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>187

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>187

Arg Ala Ser Gln Ser Val Ser Ser Asn Pro Ala

1 5 10

<210>188

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>188

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>189

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>189

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>190

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>190

Ser Arg Ala Met Ser

1 5

<210>191

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>191

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>192

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>192

Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>193

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>193

Arg Ala Ser Gln Ser Val Ser Ser Asn Pro Ala

1 5 10

<210>194

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>194

Gly Leu Ser Thr Arg Ala Thr

1 5

<210>195

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>195

Gln Gln Tyr Gly Pro Ser Trp Thr

1 5

<210>196

<211>5

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>196

Ser Tyr Ala Met Ser

1 5

<210>197

<211>17

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>197

Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr

1 5 10 15

Gly

<210>198

<211>12

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>198

Val Arg Leu Thr Val Tyr Gly Asp Gly Met Asp Val

1 5 10

<210>199

<211>11

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>199

Arg Ala Ser Gln Ser Val Ser Ser Asn Leu Ala

1 5 10

<210>200

<211>7

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>200

Gly Ala Ser Thr Arg Ala Thr

1 5

<210>201

<211>8

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant C DR

<400>201

Gln Gln Tyr Gly Ser Ser Trp Thr

1 5

<210>202

<211>127

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>202

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser

20 25 30

Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp

35 40 45

Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu

50 55 60

Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser

65 70 75 80

Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Ile Ala Ala Ala Gly Tyr Trp Gly Leu Gly Tyr Asn

100 105 110

Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210>203

<211>381

<212>DNA

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>203

caggtgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggggac cctgtccctc 60

acctgcgctg tctctggtgg ctccatcagc agtagtaact ggtggagttg ggtccgccag 120

cccccaggga aggggctgga gtggattggg gaaatctatc atagtgggag caccaactac 180

aacccgtccc tcaagagtcg agtcaccata tcagtagaca agtccaagaa ccagttctcc 240

ctgaagctga gctctgtgac cgccgcggac acggccgtgt attactgtgc gagggggggt 300

atagcagcag ctggttactg gggcttgggg tacaactggt tcgacccctg gggccaggga 360

accctggtca ccgtctcctc a 381

<210>204

<211>112

<212>PRT

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>204

Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln

1 5 10 15

Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly

20 25 30

Tyr Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu

35 40 45

Leu Ile Tyr Gly Asn Ser Asn Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Asn Ser

85 90 95

Leu Ser Gly Ser Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210>205

<211>336

<212>DNA

＜213〉artificial

<220>

＜223〉recombinant antibodies variable region

<400>205

cagtctgtgt tgacgcagcc gccctcagtg tctggggccc cagggcagag ggtcaccatc 60

tcctgcactg ggagcagctc caacatcggg gcaggttatg atgtacactg gtaccagcag 120

cttccaggaa cagcccccaa actcctcatc tatggtaaca gcaatcggcc ctcaggggtc 180

cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cactgggctc 240

caggctgagg atgaggctga ttattactgc cagtcctatg acaacagcct gagtggttcg 300

gtggttttcg gcggagggac caagctgacc gtccta 336

Claims

1. the specific method of the general specific antibody of specific modification, described general specific antibody combines with at least two member's specificitys of receptor tyrosine kinase (RTK) family, and described method comprises each the aminoacid randomization that makes described general specific antibody CDR; Generation contains the library of described randomization CDR; Screen the clone who in the described library required receptor affinity is changed.

2. the method for claim 1, it is characterized in that described receptor tyrosine kinase family is selected from: I class RTK, II class RTK, III class RTK, IV class RTK, V class RTK, VI class RTK, VII class RTK, VIII class RTK, IX class RTK, X class RTK, XI class RTK, XII class RTK, XIII class RTK, XIV class RTK, XVI class RTK, XVII class RTK, XVIII class RTK and XIX class RTK.

3. the method for claim 1 is characterized in that, described receptor tyrosine kinase family is the Eph receptor family.

4. the method for claim 1 is characterized in that, described library is prokaryote library or eukaryote library.

5. method as claimed in claim 4 is characterized in that, described library is expression library or display libraries.

6. method as claimed in claim 5 is characterized in that, described library is prophage nuclear expression library.

One kind with the bonded antibody of Eph receptor epitope specificity, described epi-position combines with monoclonal antibody GEA44.

8. the bonded antibody of required combination specificity through specific modification and the receptor Eph a plurality of members of family is described in conjunction with as follows: EphA (x)+[EphB (y)] (n ₂); EphA (x)+[EphA (x)] (n ₁); EphB (y)+[EphB (y)] (n ₂); EphB (y)+[EphA (x)] (n ₁) or [EphA (x)] (n ₁EphB)+[(y)] (n ₂), wherein (x) is 1,2,3,4,5,6,7,8 or 10; (y) be 1,3,4,5 or 6; (n ₁) be the multiple of 0-8; (n ₂) be the multiple of 0-5.

9. antibody as claimed in claim 8, prerequisite are that described antibody is not D7, EA2, EA5, B210, B233 or B208.

10. antibody as claimed in claim 8 is characterized in that described antibody is agonistic antibody.

11. antibody as claimed in claim 8 is characterized in that, described antibody is selected from 1A4,1B10,1D11,1G11,2C9,11H1,3A12,3C6,6B7 and 8B4.

12. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least two member's specificitys of receptor Eph family.

13. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least three member's specificitys of receptor Eph family.

14. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least four member's specificitys of receptor Eph family.

15. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least five member's specificitys of receptor Eph family.

16. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least six member's specificitys of receptor Eph family.

17. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least seven member's specificitys of receptor Eph family.

18. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least eight member's specificitys of receptor Eph family.

19. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least nine member's specificitys of receptor Eph family.

20. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten member's specificitys of receptor Eph family.

21. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten member's specificitys of receptor Eph family.

22. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten two member's specificitys of receptor Eph family.

23. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten three member's specificitys of receptor Eph family.

24. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten four member's specificitys of receptor Eph family.

25. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten five member's specificitys of receptor Eph family.

26. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least ten six member's specificitys of receptor Eph family.

27. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least two member's specificitys of receptor EphA family.

28. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least three member's specificitys of receptor EphA family.

29. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least four member's specificitys of receptor EphA family.

30. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least five member's specificitys of receptor EphA family.

31. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least six member's specificitys of receptor EphA family.

32. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least seven member's specificitys of receptor EphA family.

33. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least eight member's specificitys of receptor EphA family.

34. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least nine member's specificitys of receptor EphA family.

35. antibody as claimed in claim 8 is characterized in that, described antibody combines with all member's specificitys of receptor EphA family.

36. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least two member's specificitys of receptor EphB family.

37. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least three member's specificitys of receptor EphB family.

38. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least four member's specificitys of receptor EphB family.

39. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least five member's specificitys of receptor EphB family.

40. antibody as claimed in claim 8 is characterized in that, described antibody combines with at least six member's specificitys of receptor EphB family.

41. antibody as claimed in claim 8 is characterized in that, described antibody combines with all member's specificitys of receptor EphB family.

42. antibody as claimed in claim 8 is characterized in that, described antibody is people's antibody or humanized antibody.

43. antibody as claimed in claim 8, it is characterized in that, described antibody combines with an a kind of Eph receptor-specific with first affinity, compares with described first affinity, with affinity and at least a the 2nd Eph receptors bind that equates, improves and/or reduce.

44. antibody as claimed in claim 43 is characterized in that, to the described affinity reduction of described at least a the 2nd Eph receptor.

45. antibody as claimed in claim 43, it is characterized in that the raising of described affinity and/or reduction are raisings and/or reduce at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 200 times, at least 300 times, at least 400 times, at least 500 times or at least 1000 times.

46. antibody as claimed in claim 43 is characterized in that, the K of described first affinity _DValue is at least about 1 * 10 ⁶M ^-1, at least about 1 * 10 ⁷M ^-1, at least about 1 * 10 ⁸M ^-1, at least about 1 * 10 ⁹M ^-1, at least about 1 * 10 ¹⁰M ^-1, at least about 1 * 10 ¹¹M ^-1, at least about 1 * 10 ¹²M ^-1, at least about 1 * 10 ¹³M ^-1, at least about 1 * 10 ¹⁴M ^-1Or at least about 1 * 10 ¹⁵M ^-1

47. antibody as claimed in claim 43 is characterized in that, the K of described first affinity _DValue is between about 1 * 10 ⁶M ^-1-Yue 1 * 10 ⁷M ^-1Between, between about 1 * 10 ⁷M ^-1-Yue 1 * 10 ⁸M ^-1Between, between about 1 * 10 ⁸M ^-1-Yue 1 * 10 ⁹M ^-1Between, between about 1 * 10 ⁹M ^-1-Yue 1 * 10 ¹⁰M ^-1Between, between about 1 * 10 ¹⁰M ^-1-Yue 1 * 10 ¹¹M ^-1Between, between about 1 * 10 ¹¹M ^-1-Yue 1 * 10 ¹²M ^-1Between, between about 1 * 10 ¹²M ^-1-Yue 1 * 10 ¹³M ^-1Between, between about 1 * 10 ¹³M ^-1-Yue 1 * 10 ¹⁴M ^-1Between or between about 1 * 10 ¹⁴M ^-1-Yue 1 * 10 ¹⁵M ^-1

48. a generation is as the cell line of antibody as described in the claim 8.

49. treat or the Eph receptor of object of prevention or the method that liver is joined the protein abnormal expression relevant disease for one kind, described method comprises needs the Eph/ liver of the object of described treatment or prevention effective dose to join protein modulators.

50. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined protein modulators and regulates that one or more Eph receptors and at least a or multiple liver are joined albumen at least.

51. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined protein modulators and regulates two or more Eph receptor expression at least.

52. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined protein modulators and regulates at least two or more livers and join proteic activity.

53. method as claimed in claim 50 is characterized in that, described Eph receptor is selected from EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, EphB5 and EphB6.

54. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined protein modulators and regulates at least two or more livers and join proteic expression.

55. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined protein modulators and regulates at least two or more livers and join proteic activity.

56. method as claimed in claim 49 is characterized in that, described liver is joined albumen and is selected from liver and joins protein A 1, liver and join protein A 2, liver and join protein A 3, liver and join protein A 4, liver and join that protein A 5, liver are joined protein B 1, liver is joined protein B 2 regulating liver-QI and joins protein B 3.

57. method as claimed in claim 49 is characterized in that, it is antibody as claimed in claim 8 that described Eph/ liver is joined protein modulators.

58. method as claimed in claim 49 is characterized in that, disease to be treated is a cancer.

59. method as claimed in claim 58, it is characterized in that described cancer is hepatocarcinoma, pulmonary carcinoma, renal carcinoma, carcinoma of prostate, cancer of pancreas, carcinoma of testis, colon cancer, gastric cancer, carcinoma of endometrium, ovarian cancer, breast carcinoma, osteocarcinoma, soft tissue cancer, uterus carcinoma, cervical cancer, synovial bursa liquid cancer, carcinoma of parotid gland, esophageal carcinoma, skin carcinoma, rectal cancer and thyroid carcinoma.

60. method as claimed in claim 49, it is characterized in that disease to be treated is selected from: PLCH, GVHD, Primary Congestive DCM (dilated cardiomyopathy), granulomatous myocarditis, chronic pancreatitis, liver cirrhosis, chronic lymphocytic thyroiditis, Alzheimer, acute cholecystitis, Crohn disease, diverticulitis, ulcerative colitis and psoriasis.

61. method as claimed in claim 49 is characterized in that, described Eph/ liver is joined the generation that protein modulators suppresses VEGF.

62. method as claimed in claim 58 is characterized in that, described Eph/ liver is joined protein modulators anticancer propagation.

63. method as claimed in claim 58 is characterized in that, described Eph/ liver is joined the migration of protein modulators anticancer.

64. method as claimed in claim 58 is characterized in that, described Eph/ liver is joined the invasion and attack of protein modulators anticancer.