WO2020093573A1 - Application of ephrina1 protein in preparation of drugs for inhibiting tumor cell invasion and metastasis - Google Patents

Abstract

Disclosed in the present invention is an application of EphrinA1 in development, progression, metastasis, and treatment of tumors and survival prognosis of patients. Disclosed in the present application is that EphrinA1 is involved in growth, invasion and metastasis processes of tumors; the high expression of EphrinA1 in gastric cancer tissues leads to poor prognosis of gastric cancer patients, and targeted knockdown or knockout of the expression of EphrinA1 can significantly inhibit the invasion ability of gastric cancer cells and the metastasis ability in mice. The present invention can effectively inhibit the invasion ability of gastric cancer cells by blocking the function of EphrinA1 by using an antibody targeting EphrinA1. According to the present invention, it is found that EphrinA1 has an important application value in tumor therapy and can be used as a target for antitumor drugs.

Description

Application of EphrinA1 protein in preparing medicine for inhibiting tumor cell invasion and metastasis Technical field

The present invention relates to the use of EphrinA1 protein in the preparation of drugs for inhibiting tumor cell invasion and metastasis

Background technique

The latest global cancer statistics in 2018 estimated the morbidity and mortality of 36 cancers in 185 countries around the world. The report shows that in 2018, new cancer cases worldwide will reach 18.1 million, and deaths will reach 9.6 million. Cancer It is expected to be the leading cause of death in the 21st century. The five types of cancer with the highest incidence in both sexes are lung cancer (accounting for 11.6% of total cancer incidence), female breast cancer (11.6%), colorectal cancer (10.2%), prostate cancer (7.1%) and gastric cancer (5.7 %), The five types of cancer with the highest mortality rates are lung cancer (accounting for 18.4% of total cancer deaths), colorectal cancer (9.2%), gastric cancer (8.2%), liver cancer (8.2%) and breast cancer (6.6%) . This result shows that the global cancer burden is further increasing, and it also shows the importance and urgency of research on the search for key anti-tumor targets and related treatments.

The occurrence and development of tumor is a very complicated biological process. Compared with normal cells, tumor cells have the characteristics of infinite proliferation, abnormal energy metabolism, increased reactive oxygen radicals, tissue infiltration and metastasis, resistance to cell death and so on. At present, most cancers lack early diagnosis methods and effective treatment methods, especially the prognosis of patients with metastases is worse. Cancer metastasis is an extremely complex multi-step biological process, which mainly includes cancer cells detaching from the primary foci, breaking through the basement membrane and entering the blood circulation or lymphatic circulation, passing through blood vessels or lymphatic vessels, and colonizing in specific tissues or organs Formation of tiny metastatic foci, eventually proliferating to form metastatic foci visible to the naked eye. However, so far, the molecular mechanism of cancer development and metastasis is still unclear, and it is very important to find key targets for inhibiting tumor development and metastasis.

The Ephrins (Eph family receptors interacting proteins) family is the largest known ligand of the receptor tyrosine kinase subfamily (RTKs) Eph to date. Ephrin ligands are divided into two subtypes according to the structure: EphrinA subtypes are a total of 5 types, which are membrane proteins fixed on the cell membrane by glycosylphosphatidylinositol (GPI); EphrinB subtypes are transmembrane proteins, there are Eph binding zone and short cytoplasmic zone. According to different homology, Eph receptors are divided into two subfamilies, EphA and EphB. The Ephrin family and its receptor Eph play an important role in the regulation of animal embryonic development and tissue homeostasis. Its abnormal function is closely related to the occurrence and development of central nervous system diseases and cancer.

EphrinA1 (EFNA1) is the first well-defined ligand in this family. It was cloned from human umbilical vein endothelial cells (HUVECs) as a gene induced by tumor necrosis factor (TNFα) in 1990. The chromosome 21 is located at q21-q22 and its molecular weight is about 22KD. The main receptor of EphrinA1 is EphA2, which plays an indispensable role in angiogenesis and other processes. Its abnormal expression promotes tumorigenesis (melanoma, liver cancer, squamous cell carcinoma, colon cancer and gastric cancer, etc.), angiogenesis and Cancer metastasis plays an important role.

EphrinA1 is abnormally expressed in a variety of malignant tumors, and many oncogenic signaling pathways are affected by EphrinA1, such as MAP / ERK and PI3K signaling pathways. Some evidence shows that due to the complexity and cell type dependence of EphrinA1, it plays a role in promoting tumorigenesis in some types of cells or cancer, but may inhibit tumor progression in other types of cells or cancer. . Studies have shown that in breast cancer and glioma, EphrinA1 expression is suppressed. In breast cancer, EphrinA1 is related to the ras / MAPK pathway. The main mechanism is that the low expression of EphrinA1 reduces the phosphorylation of EphA2, resulting in the activation of downstream ras signals, and the activation of ras signals will further increase the expression of EphA2 and inhibit the expression of EphrinA1 Expression, thus forming a feedback loop and promoting tumor progression. In melanoma, bladder cancer, liver cancer, ovarian cancer and other cancers, the expression of EphrinA1 and EphA2 is increased. Studies have shown that high expression of EphrinA1 in ovarian cancer will lead to poor prognosis of patients; in liver cancer, EphrinA1 can regulate alpha-fetoprotein. Promote the proliferation of tumor cells.

At present, there is little research on EphrinA1 in gastric cancer. There is evidence that EphrinA1 is up-regulated in gastric cancer, but its specific mechanism of action is not yet clear. The research on the therapeutic potential of EphrinA1 as gastric cancer has not been reported yet.

As one of the most common malignant tumors in the world, gastric cancer is one of the important factors leading to cancer death. Globally, gastric cancer is the malignant tumor with the fifth highest morbidity and third highest mortality, and China is one of the countries with the highest incidence of gastric cancer. In China, the age-standardized morbidity and mortality of gastric cancer rank second in the age-standardized morbidity and mortality of malignant tumors in China, which has seriously endangered human health. However, because the onset of gastric cancer is hidden and there is no effective means for early diagnosis, most patients are in the middle and late stages when found, so the prognosis is extremely poor, especially for patients with distant metastasis, the 5-year survival rate is only about 5%, which is late One of the main causes of death of gastric cancer patients. Therefore, we urgently need to deeply understand the pathogenesis of gastric cancer development and metastasis, and find key factors that regulate the development and metastasis of gastric cancer cells. EphrinA1 plays an important role in a variety of tumors, suggesting that EphrinA1 may serve as a prognostic factor and therapeutic target for gastric cancer progression and metastasis.

Summary of the invention

The purpose of the present invention is to provide the application of EphrinA1 protein in the preparation of drugs for inhibiting tumor cell invasion and metastasis in view of the deficiencies of the prior art.

The present invention adopts the following technical scheme: the use of EphrinA1 protein in the preparation of a medicament for inhibiting tumor cell invasion and / or metastasis. The drug targets the EphrinA1 protein, inhibits, knocks down or knocks out the expression of EphrinA1.

Further, the drug includes at least one of the following active ingredients: a nanodrug targeting EphrinA1, a CRISPR gene editing plasmid targeting EphrinA1, a siRNA targeting EphrinA1, a shRNA targeting EphrinA1, an LNA targeting EphrinA1, Chemically modified ASO targeting EphrinA1, small molecule inhibitor that blocks EphrinA1 function, polyclonal antibody to EphrinA1, monoclonal antibody to EphrinA1, humanized antibody to EphrinA1, Nanobody to EphrinA1, bispecific antibody, targeting Antibody drug for EphrinA1.

Further, monoclonal antibodies include rabbit, mouse, dog, monkey, camel, chicken, shark, etc., polyclonal antibodies include chicken, rabbit, sheep, camel, etc.

Further, the EphrinA1 protein is knocked down and knocked out by the following means: siRNA, shRNA, gene editing; wherein the gene editing technology includes DNA homologous recombination, TALEN-TALEA targeted gene knockout technology, Cre / Loxp system, FLP-frt system , Inducible Cre / Loxp system such as tetracycline / interferon, CRISPR / Cas9 gene editing technology.

Further, tumors include malignant tumors of the nasal cavity and sinuses, nasopharyngeal cancer, oral cancer, laryngeal cancer, salivary gland tumors, intracranial tumors, thyroid cancer, tongue cancer, lung cancer, esophageal cancer, cardia cancer, breast cancer, mediastinal tumors, Gastric cancer, colorectal cancer, rectal cancer, liver cancer, pancreatic cancer and periampullary cancer, small intestine malignant tumor, kidney cancer, prostate cancer, bladder cancer, cervical cancer, ovarian cancer, skin malignant melanoma, lymphoma, etc.

The beneficial effects of the present invention are: through a series of in vivo and in vitro functional experiments, it has been found that EphrinA1 plays an important role in the development and metastasis of gastric cancer. The high expression of EphrinA1 in gastric cancer is significantly related to the poor prognosis and metastasis of patients, suggesting that EphrinA1 has the potential to become a prognostic indicator for the survival of gastric cancer patients. By inhibiting the expression level of EphrinA1 in cancer cells, it can significantly inhibit the invasion ability and metastasis ability of gastric cancer cells. The antibody blocking function experiment showed that EphrinA1 antibody can effectively inhibit the invasion ability of gastric cancer cells. The present invention shows that EphrinA1 can be used as a new drug target for clinical inhibition of tumor metastasis.

BRIEF DESCRIPTION

Figure 1 is a schematic diagram of EphrinA1 structure;

Figure 2.1 is a graph showing the significantly high expression of EphrinA1 in gastric cancer tissues;

Figure 2.2 is the expression level of EphrinA1 in different gastric cancer cell lines;

Figure 2.3 shows that the high expression of EphrinA1 protein level is significantly associated with gastric cancer metastasis;

Figure 2.4 shows that the high expression of EphrinA1 protein is significantly associated with the poor prognosis of gastric cancer patients;

Figure 3.1 shows the efficiency of Western blot detecting EphrinA1 knockdown;

Figure 3.2 shows the effect of EphrinA1 on cell proliferation and adhesion in MTT and adhesion experiments; n.s., meaningless;

Figure 3.3 shows the effect of knocking down EphrinA1 on the migration and invasion ability of gastric cancer cells; ***, P <0.001;

Figure 4.1 shows the stable knockdown efficiency of EphrinA1 detected by Western blot;

Figure 4.2 shows the effect of stable knockdown of EphrinA1 on the invasion ability of gastric cancer cells; **, P <0.01; *, P <0.05;

Figure 5.1 shows the effect of Western blot detection of EphrinA1 overexpression;

Figure 5.2 shows the effect of overexpression of EphrinA1 on cell proliferation and adhesion ability;

Figure 5.3 shows the effect of overexpression of EphrinA1 on cell migration and invasion ability of gastric cancer cells, ***, P <0.001; **, P <0.01;

Figure 6.1 shows the construction of EphrinA1 knockout cell line using CRISPR / Cas9 gene editing;

Figure 6.2 shows the effect of EphrinA1 knockout on cell proliferation and adhesion ability of gastric cancer cells;

Figure 6.3 shows the effect of EphrinA1 knockout on the migration and invasion ability of gastric cancer cells; ***, P <0.001;

Figure 6.4 shows the effect of EphrinA1 knockout on the lung metastatic ability of gastric cancer cells; ***, P <0.001 (n = 5);

Figure 6.5 is the HE staining of the lungs of mice to detect the effect of EphrinA1 knockout on the lung metastatic ability of gastric cancer cells; ***, P <0.001 (n = 5);

Figure 6.6 shows the effect of EphrinA1 knockout gastric cancer cells on the body weight of mice;

Figure 6.7 shows the effect of EphrinA1 knockout on the tumorigenic ability of gastric cancer cells in mice;

Figure 7.1 is the Western blot test to detect the recognition of EphrinA1 protein by monoclonal antibody;

Figure 7.2 shows the effect of gastric cancer cells with EphrinA1 antibody on cell migration ability across the endothelium.

Figure 8.1 is the expression of EphrinA1 in different cancers in the GEPIA database;

Figure 8.2 shows the correlation between the expression of EphrinA1 in different cancers and prognosis in the GEPIA database.

detailed description

According to the sequence information of EphrinA1 recorded in the NCBI database, it can be determined that EphrinA1 is a gene located on chromosome 1, 1590 bp and 205 aa. As shown in Figure 1.

In this application, through targeted knockdown of EphrinA1, it was found that it has no significant effect on cell proliferation, cell cycle, clonal formation and cell adhesion of gastric cancer cells, but it can significantly inhibit the invasion and metastasis of gastric cancer cells in vitro. Using CRISPR / Cas9 technology to target the EphrinA1 gene shows that after EphrinA1 is deleted, the cell's ability to invade and metastasize is significantly inhibited. Blocking the function of EphrinA1 with antibodies can significantly inhibit the invasion ability of gastric cancer cells. The present invention will be further described below with reference to examples.

Example 1, EphrinA1 is highly expressed in human gastric cancer tissues and gastric cancer cell lines

1. Expression of EphrinA1 in various human tissues and human gastric cancer cell lines

1.1 The tissue was ground to a powder at a very low temperature using a mortar. The isolation and extraction of the total RNA of the powdered tissue was carried out using TRIZOL reagent (purchased from Invitrogen, USA), and was performed according to the standard operation of the reagent instructions.

1.2 Take a PCR tube A and add 800ng of total RNA, make up DEPC water to a total volume of 10μL, and mix. Take another PCR tube B, add 10xRT buffer 2μL, 10x random primer 2μL, dNTP 0.8μL, RNA reverse transcriptase 1μL, DEPC water 4.2μL, mix. Add the mixture of tube B to tube A, mix well, and perform a reverse transcription reaction using a PCR machine (purchased from ABI, USA). The procedure is as follows:

25 ℃	10min
37 ℃	120min
85 ℃	5min

Place the cDNA product at -20 ° C until use.

2. Real-time fluorescence quantitative PCR (qRT-PCR) to detect the expression of EphrinA1 in gastric cancer tissues and their normal tissues

Fluorescence quantitative PCR reaction was carried out using BioFX Rad CFX-Touch fluorescence quantitative PCR instrument. All reactions were repeated three times. Obtain the ΔCt value according to the fluorescence chart given by the instrument, so as to calculate the relative change of the corresponding expression level.

The primers are as follows:

Primer Names	Sequences (5'-3 ')
EphrinA1-qPCRForward	CTACTACATCTCCAAACCCATCC
EphrinA1-qPCR Reverse	CTGGGTCATCTGCTGCAAGTC

GAPDH-qPCRForward	GGAGCGAGATCCCTCCAAAAT
GAPDH-qPCRReverse	GGCTGTTGTCATACTTCTCATGG

3. Tissue chip to detect the expression of EphrinA1 protein level

The expression of EphrinA1 at the protein level was detected by gastric cancer tissue chip. As a result, the protein of EphrinA1 was highly expressed in gastric cancer patients. Kaplan-Meier survival curve analysis analyzed the cohort of gastric cancer patients with 5-year survival information. As a result, the relatively high expression of EphrinA1 was associated with the adverse effects of gastric cancer patients Prognosis is significantly related.

Experimental results

The expression of EphrinA1 in 109 pairs of gastric cancer tissues and their matched normal tissues was analyzed by real-time fluorescence quantitative PCR reaction (qRT-PCR). EphrinA1 was relatively up-regulated in 72.5% of gastric cancer tumor tissues (Figure 2.1 left). In addition, among 11 pairs of age and gender-matched M0 and M1 patient samples, EphrinA1 was significantly overexpressed in M1 samples with metastasis (Figure 2.1 right). In addition, the expression of EphrinA1 in different human gastric cancer cell lines was also detected by qRT-PCR, providing a reference for subsequent functional experiments (Figure 2.2). These results suggest that EphrinA1 may play an important role in the metastasis of gastric cancer. The expression of EphrinA1 at the protein level was detected by gastric cancer tissue chip. As a result, the protein of EphrinA1 was highly expressed in gastric cancer patients (Figure 2.3). Kaplan-Meier survival curve analysis analyzed the cohort of gastric cancer patients with 5-year survival information. The relatively high expression of EphrinA1 was associated with The poor prognosis of patients with gastric cancer was significantly correlated (Figure 2.4).

Example 2, RNA interference technology knocked down the expression of EphrinA1 can significantly inhibit the invasion of gastric cancer cells

1. Cell transfection with siRNA

Through siRNA design software, design and synthesize two specific siRNAs targeting EphrinA1, and silence its expression (purchased from Shanghai, China). Plate the cells in the logarithmic growth phase, and when the cell density reaches about 50%, dilute Lipo RNAi MAX (purchased from Invitrogen, USA) and siRNA with OPTI medium (purchased from Gibco, USA) according to the transfection system in the following table. The diluted siRNA was added to the Lipo RNAi MAX tube, mixed and allowed to stand for 5 minutes, then added to the cell culture fluid, shaken, and the medium was changed after 24.

Component	24-well	6-well
SiRNA-lipid complex perwell	50ul	250ul
Final siRNA used per well	5pmol	25pmol
Final LipoRNAiMAXused perwell	1.5ul	7.5ul

2. Cell proliferation (MTT) experiment

The transfected cells were resuspended in 1640 medium (purchased from Gibco, USA) of 10% FBS (purchased from Israel BI) and counted on a hemocytometer. For the MTT experiment, 1000 cells (100 ul medium) were added to each well in a 96-well plate, and five duplicate wells per group were used. A total of 4 plates were needed to detect the proliferation of cells at different time points (0h, 24h, 48h, 72h). At each time point, add 5 mg / ml MTT (purchased from Sigma) to each well and incubate in a 37 ° C incubator for 4 hours. Use the pipette tip to carefully absorb the solution in the well (be careful not to touch the bottom of the well). Add 150ul of DMSO (purchased Since China National Medicine), mix well. The absorbance value of OD490 / OD570 at each time point was detected and analyzed on the M5 microplate reader.

3. Cell adhesion experiment

3.1 Take 96-well plate for pretreatment. Matrigel (purchased from US BD) coated cell plates, diluted 1:40 with pre-chilled FBS-free 1640 (purchased from Gibco), and coated with 50 μL per well; Fibronectin (purchased from BD) ) Coated cell plates, dilute fibronectin to 0.02 μg / μL with pre-chilled FBS-free 1640, and add 50 μL per well for coating. The 96-well plates coated with matrigel and fibronectin were placed in a 37 ° C cell incubator for 24 hours.

3.2 Aspirate the unsolidified matrigel and fibronectin, add 100 μL of each well, 0.5% BSA (purchased from Shanghai, China) (PBS solution), and block at 37 ° C for 30 min.

3.3 Discard BSA, wash twice with PBS gently, add 100 μL of each well to resuspend the cells in 1640 medium of 2 × 10 ⁴ 1% FBS, and incubate for 30 min in a 37 ° C incubator.

3.4 Discard the supernatant, wash twice with PBS gently, add 100 μL per well, fix with 4% PFA for 30 min, discard PFA (Chinese National Medicine), wash twice with PBS gently.

3.5 Add 100 μL of methylene blue to each well for 30 min, discard the methylene blue staining solution, and wash gently with PBS 4-5 times.

3.6 Prepare lysis solution (mixture of absolute ethanol and 0.1M HCl volume ratio of 1: 1), add 150 μL of lysis solution to each well and mix well. Add 150 μL of lysate to the cell-free wells as a blank control.

3.7 Detect the absorbance value of OD620 on the M5 microplate reader and analyze it.

4. Cell migration and invasion experiments

4.1 Cell migration experiment: The transfected cells were resuspended in the manner of cell passage (1% FBS in 1640 medium to resuspend the cells) and the cell count was performed with a hemacytometer. Add 200 ul of cell suspension (cell number: 5 × 10 ⁴ ) to each well in the upper chamber of transwell, add 700 ul of 1040 FBS 1640 medium in the lower chamber, and place it in the incubator. After the cells migrated for an appropriate time, the transwell was removed and fixed with 4% PFA for 10 minutes. Stain with 0.1% crystal violet for 15 min. PBS washes away excess crystal violet, and carefully wiped the cells of the upper membrane of the transwell chamber with a cotton swab. The cells invading the lower membrane of the transwell were observed under a microscope and photographed and statistically analyzed.

4.2 Cell invasion experiment: 8μm Transwell (24-well, purchased from Corning, USA) was pre-paved with 50ul of 10-fold diluted matrigel (purchased from BD, USA) or 0.5% gelatin (purchased from Shanghai, China). Incubate in a 37 ° C cell incubator for 2h. After resuspending the transfected cells, the subsequent steps are the same as the migration experiment.

Experimental results

The previous results suggest that EphrinA1 is significantly overexpressed in gastric cancer tissues, and its high expression is associated with poor prognosis. So, how does EphrinA1 play a role in the process of gastric cancer, especially the metastasis of gastric cancer? Therefore, we designed two siRNAs that specifically target EphrinA1 and silence EphrinA1 expression. Transfection of siRNA in gastric cancer cell line BGC823 knocked down the expression of EphrinA1, and detected the knockdown efficiency of EphrinA1 by Western blot. The results showed that the siRNA specifically targeting EphrinA1 reduced the level of EphrinA1 to the control group compared with the control group siRNA About 30% (Figure 3.1, si-nc represents control siRNA, si-1 and si-2 represent two siRNAs targeting EphrinA1).

The effect of EphrinA1 knockdown on gastric cancer cell line was detected on gastric cancer cell line BGC823. Because the two important characteristics of tumor cells are the ability to proliferate indefinitely and easily metastasize. We tested the effect of EphrinA1 on the cell proliferation ability and adhesion ability to the matrix of gastric cancer cells through the MTT experiment and the adhesion experiment. The results showed that knockdown of EphrinA1 had no significant effect on the cell proliferation and matrix adhesion ability of gastric cancer cells (Figure 3.2). Cell migration and invasion experiments were used to examine the effect of EphrinA1 on tumor metastasis. Results The knockdown of EphrinA1 can significantly inhibit the cell migration and invasion ability of gastric cancer cells (Figure 3.3). The results suggest that EphrinA1 may affect the occurrence and development of gastric cancer by affecting the invasion ability of gastric cancer cells.

Example 3: Stable knockdown of EphrinA1 can significantly inhibit the invasion ability of gastric cancer cells

1. Lentiviral vector construction

1.1 Design and synthesis of shEphrinA1

Based on the shRNA design principles, using EphrinA1 RNA as the target sequence, two target site sequences for EphrinA1 were designed to synthesize the corresponding forward and reverse sequences (purchased from Shanghai Shengong, China), respectively:

1.2 Annealing:

Take 100pM single-stranded DNA each, add 10x annealing buffer, add ddH2O 50uL. Put in the water that has just been boiled and let it cool slowly to room temperature.

After digestion, linking, identification, sequencing and other steps to construct the shRNA lentiviral expression vector of EphrinA1.

2. Lentivirus packaging

2.1 Spread HEK293T cells into T25 flasks and transfect when the cell density reaches 80-90%.

2.2 Prepare plasmid mix according to the following system

ingredient	Volume (ul)
Lentiviral vector plasmid (1μg / μL)	2.2
Packaging plasmid pVSVG (1μg / μL)	1.1
Packaging plasmid △ 8.91 (1μg / μL)	1.65
P3000	10
OPTI	250

2.3 Mix 15μL Lippo3000 into 250ul OPTI (see lipo3000 plasmid transfection steps for specific transfection method).

2.4 Collect 48h and 72h cell culture solution, filter and aliquot, concentrate, measure titer, and store in -80 ℃ refrigerator.

3. Screening stable cell lines with EphrinA1 knockdown

Plate the cells in the logarithmic growth phase. After the cell density reaches about 80%, discard the medium, wash twice with PBS, and add fresh 1040 FBS 1640 medium. Add the appropriate amount of virus stock solution dropwise to the petri dish, and add 5ug / mL Polybrene to promote the infection efficiency of the virus, mix well, and change the medium after incubating at 37 ℃ for 24 hours. The lentiviral vector carries a puromycin resistance tag, and the cells expressing the lentivirus are selected by applying the puromycin drug to the cells. 48h after infection, add the appropriate amount of puromycin drug for about two weeks. After no drug application for a period of time, the appropriate amount of cells was collected, and qRT-PCR was used to detect the knockdown effect of EphrinA1. If compared with the lentiviral vector of the control group, the expression level of EphrinA1 in the EphrinA1 knockdown group was significantly reduced, indicating that EphrinA1 knockdown was obtained by screening Stable cell line.

Experimental results

EphrinA1 can significantly promote the invasion ability of gastric cancer cells. The previous data suggest that EphrinA1 may play an important role in the metastasis of gastric cancer. We constructed a stable cell line with EphrinA1 knockdown. Western blot experiments showed that the cell line was successfully constructed (Figure 4.1, sh-nc indicates control shRNA, sh-1 and sh-2 indicate two shRNAs targeting EphrinA1). EphrinA1 stable knockdown can significantly inhibit the invasion ability of gastric cancer cells in vitro (Figure 4.2), which is consistent with the clinical expression level of EphrinA1, prognosis and siRNA knockdown experimental results.

Example 4, overexpression of EphrinA1 can significantly promote the invasion ability of gastric cancer cells

1. Construction of pcDNA3.1-EphrinA1 plasmid

Obtain the full-length sequence of EphrinA1 according to the NCBI database, design the full-length primer, obtain the DNA product of EphrinA1 by PCR, and construct the pcDNA3.1 overexpression plasmid containing the full-length of EphrinA1 through the steps of enzyme digestion and linking.

2. Cell transfection plasmid

Plate the cells in the logarithmic growth phase until the cell density reaches about 80%. According to the transfection system in the table below, dilute Lipo3000 (purchased from Invitrogen, USA) and plasmids with OPTI medium, and add the diluted plasmids to Lipo3000 tubes. After mixing, let stand for 5 minutes, then add to the cell culture fluid, shake well, and change the medium after 24.

Component	24-well	6-well
Plasmid-lipid complex per well	50ul	250ul
Final plasmad used perwell	500ng	2500ng
Final P3000used perwell	1ul	5ul
Final Lipo3000used perwell	1.5ul	7.5ul

Experimental results

Knocking down the expression of EphrinA1 in BGC823 cells with relatively abundant EphrinA1 content can significantly inhibit the invasion ability of gastric cancer cells. So, how does over-expression of EphrinA1 affect gastric cancer cells? We selected a cell AGS with relatively low expression of EphrinA1, and examined the effect of overexpression of EphrinA1 on the biological function of gastric cancer cells in human gastric cancer cell line AGS. Western blot tested the overexpression efficiency of EphrinA1. Compared with the empty plasmid as a control, the overexpression effect of EphrinA1 was 5-10 times that of its expression (Figure 5.1). The results show that overexpression of EphrinA1 in AGS cells has no significant effect on cell proliferation and cell adhesion of gastric cancer cells (Figure 5.2), but it can significantly promote the migration and invasion ability of gastric cancer cells (Figure 5.3). These data are consistent with the data of EphrinA1 siRNA knockdown, showing that EphrinA1 regulates the invasion of gastric cancer cells.

Example 5. Using CRISPR / Cas9 gene editing technology to knock out EphrinA1 can significantly inhibit the invasion and metastasis ability of gastric cancer cells

1. CRISPR / Cas9 gene editing targeting EphrinA1

CRISPR / Cas9 gene editing technology targets protein-coding genes, which can cause frameshift mutations and other effects by changing a few bases of the coding gene, knocking out the expression of the encoded protein.

Design and synthesize two sgRNAs specifically targeting EphrinA1, and construct a CRISPR / Cas9-EphrinA1 sgRNA vector. The sequence is as follows:

EphrinA1 sgRNA 1

EphrinA1-1-sense: 5’-ACCGCTGATCGCCACACCGTCTTC-3 ’

EphrinA1-1-antisense: 5’-AACGAAGACGGTGTGGCGATCAGC-3 ’

EphrinA1 sgRNA 2

EphrinA1-2-sense: 5’-ACCGACGGTGTGGCGATCAGCAG-3 ’

EphrinA1-2-antisense: 5’-AACCTGCTGATCGCCACACCGTC-3 ’

According to the method of plasmid transfection, EphrinA1 sgRNA CRISPR / Cas9 vector was transfected into human gastric cancer cell line, through monoclonal screening, and using genomic PCR and sequencing, cDNA PCR and sequencing to verify and identify EphrinA1 knockout cell lines . On the other hand, in order to avoid the off-target effect produced by CRISPR / Cas9, in addition to designing sequence-specific sgRNA, we also performed PCR and sequencing verification based on the potential off-target sites predicted by sgRNA to ensure that no off-target occurred.

2. Mouse lung metastasis experiment

1X10 ⁶ wild-type gastric cancer cells and selected EphrinA1 knockout gastric cancer cells were injected into the mice through the tail vein, and the state and weight change of the mice were observed every week. After 4-5 weeks, the lungs were taken for observation Lung metastasis of tumor cells.

3. Mouse subcutaneous tumor formation experiment

5X10 ⁶ wild-type gastric cancer cells and selected EphrinA1 knockout gastric cancer cells were mixed with matrigel at a ratio of 1: 1, and then injected into the mouse's skin to observe the growth of the tumor. After 10-15 days, subcutaneous tumor Take out the block, weigh it, and observe the changes between the groups.

Experimental results

In order to further explore the biological function of EphrinA1 in gastric cancer, we used CRISPR / Cas9 gene editing technology to design two specific sgRNAs targeting EphrinA1. Through monoclonal screening, sequencing identification and off-target effect identification, we successfully established the knockout EphrinA1 knockout Removed gastric cancer cell lines (Figure 6.1, WT represents wild-type gastric cancer cell lines, and ko1 and ko2 are the two EphrinA1 knockout cell lines selected). Examination of the cell biological functions of gastric cancer cell lines knocked out by EphrinA1 revealed that, compared with normal wild-type gastric cancer cells, EphrinA1 knockout had no significant effect on the proliferation and cell adhesion of gastric cancer cells (Figure 6.2). However, the migration and invasion ability of gastric cancer cell lines knocked out by EphrinA1 was significantly inhibited (Figure 6.3). These data show that the cell biological function of EphrinA1 knockout is highly consistent with the changes in cell biological function caused by EphrinA1 knockdown. At the same time, it also shows that the cell line established by CRISPR / Cas9 technology is a cell line that successfully knocked out EphrinA1.

We injected the constructed EphrinA1 knockout gastric cancer cell line through the tail vein to establish a lung metastasis model in mice, and studied the effect of EphrinA1 on gastric cancer metastasis. Four weeks after the mice were inoculated with gastric cancer cells, the lung metastasis of the mice was evaluated. Observation of the lungs by dissection revealed that wild-type gastric cancer cells in the control group developed severe lung metastases, the volume of the lungs increased significantly, and the weight of the lungs also increased significantly. The lungs contained a large number of tumor cells, forming substantial tumor masses. There is no complete alveolar structure, and the lung metastases of EphrinA1 knockout mice are significantly reduced, the size is more normal, and there is no significant increase in the lung, with a relatively complete lung structure (Figure 6.4). Further HE staining of the lungs also showed that the lungs of the control group produced many large metastases, but only a few micrometastases were observed in the lungs of the EphrinA1 knockout group (Figure 6.5). At the same time, we observe the growth status of the mice every week and measure the body weight of the mice, showing that compared with the mice in the EphrinA1 knockout group, the mice in the control group endangered the health status of the mice due to severe lung metastasis. , So that the body weight of the mice decreased significantly in the later period of metastasis (Figure 6.6). Studies have shown that EphrinA1 knockout gastric cancer cells can significantly reduce the lung metastatic ability of gastric cancer.

We mixed gastric cancer cells with matrigel 1: 1, and then injected them under the skin of mice to build an animal model of tumor formation in vivo. After 10-15 days, the growth of the tumor was observed. The results showed that the wild-type gastric cancer cells in the control group grew into large tumor masses, and the tumor cells of the EphrinA1 knockout gastric cancer cells were significantly reduced in size, even unable to form tumors (Figure 6.7) . This result shows that although it does not affect the growth of gastric cancer cells in vitro, EphrinA1 knockout can significantly inhibit the growth ability of gastric cancer cells in vivo under the action of the complex tumor microenvironment in vivo.

Example 6, using EphrinA1 antibody to block the function of EphrinA1 to inhibit gastric cancer metastasis

1. Construction of EphrinA1 antigen expression plasmid

According to the EphrinA1 gene sequence in the NCBI database, a full-length primer was designed to amplify the full length of the EphrinA1 gene by PCR means. After digestion, ligation, transformation, plasmid extraction and other steps, the full-length EphrinA1 sequence was constructed into the pET-28a vector. The pET-28a-EphrinA1 full-length expression plasmid was obtained. The primers are as follows:

Primer-F: GTCAAAGCTTGCGAGTTCCTCTGGGCCCCTCTCTT

Primer-R: GTCACTCGAGTCACGGGGTTTGCAGCAGCAGAA

2. Protein expression purification

2.1 Transformation plasmid: Take 0.5μL of recombinant plasmid, transform into 100μL ROSETTA competent state, and culture on plate for 12-16h.

2.2 Small amount of induction: pick two single colonies, inoculate each in 5mL LB liquid medium, and culture at 37 ° C with shaking overnight. In the control group, no inducer was added, and in the experimental group, IPTG was added to a final concentration of 1 mmol / l, and the cultivation was continued for 4 hours at 37 ° C. Centrifuge at 12,000rpm for 10min, discard the supernatant, lyse the cells with lysate, add 20-30μl 5 × Loading Buffer boiling water for 10min, take 10ul sample for SDS-PAGE analysis.

2.3 Mass induction: Inoculate 3ml of bacterial solution into 300ml of LB medium containing corresponding antibiotics. The induction method is the same as 2.2.

2.4 Ultrasonic breaking: centrifuge at 5000 rpm for 10 min to collect the cells in 300 ml of bacterial solution after induced expression, and resuspend the cells with 10 ml of 0.01 M PBS (pH 7.4) solution; 100 W ultrasonic for 16 min under ice water bath; centrifuge at 5000 rpm at 4 ° C Separately collect the precipitate and supernatant at 10min, and reserve 20ul of the supernatant for SDS-PAGE electrophoresis detection; resuspend and disperse the precipitate with 10ml of 8M urea solution without imidazole; 100W ultrasound for 10min under ice water bath, 20ul of the sample for electrophoresis detection; 4 ℃ , Centrifuge at 5000rpm for 15min to collect the supernatant.

2.5 Selection of samples: After the detection of protein expression in inclusion bodies, the protein is purified by His-tagged protein.

2.6 Protein dialysis and concentration quantification: improve the purity and concentration of protein through dialysis, and finally take out the concentrated protein sample for electrophoresis detection and protein concentration determination.

3. Polyclonal antibody preparation

3.1 Animal immunization: Take two New Zealand white rabbits and collect some normal sera before antigen injection. Serve as a negative control when antibodies are prepared. The immunogen was diluted with normal saline and then mixed 1: 1 with the corresponding adjuvant. The antigen and adjuvant are completely mixed to form a stable emulsion, and the emulsion is injected subcutaneously and intramuscularly in the posterior thigh using a multi-point injection method on rabbits. Approximately 1/4 of the immunogen is used in each area. In this way, the immunogen can persist to improve the immune response.

3.2 Blood collection: After a week of immunization, blood can be collected from the ear artery to detect antibody titer. The titers of antibodies produced in the first few immunizations are relatively low, and after three immunizations, antibodies of higher titers can be obtained. Carotid artery bleeding can be used for the last blood collection, usually a rabbit can bleed 100-120ml.

3.3 Separation of serum: If collected in a centrifuge tube, place it in a 37 ° C oven for 2h, transfer to 4 ° C for precipitation overnight, and centrifuge the next morning at 10000rcf for 10 minutes. Add NaN3 to the serum to a final concentration of 0.02% and store at -20 ° C after aliquoting.

3.4 Purify antibodies by antigen affinity purification and detect antibody titers.

4. Preparation of monoclonal antibodies

4.1 Animal immunization: According to the conventional protocol, 5 Balb / c mice were immunized with the target protein EphrinA1 protein for a total of 3-4 immunizations. After 7 days of each immunization, the serum of the immunized animal was detected by indirect ELISA to determine the immune response Level.

4.2 Cell fusion and screening: The spleen of the mouse was taken, and the spleen cells and myeloma cells were subjected to two rounds of cell fusion by electrofusion. The supernatant of the fused cells was screened by indirect ELISA, and the supernatant positive for the target protein Ephrin-A1 was selected. Transfer the positive mother clone cells to the 24-well plate to expand the culture. 2ml of supernatant was collected from each expanded culture clone for indirect ELISA detection and FACS detection. Freeze all specific positive cloned cells to avoid loss of clones.

4.3 Subcloning, expanded culture and cryopreservation: the positive dilution of the positive mother clones is performed by limiting dilution to ensure that these positive mother clones are from single mother clone cells. After 3 rounds of subcloning, the success rate of subcloning is generally 80%. The indirect ELISA method was used for subcloning screening. Each mother clone selects 2 stable daughter clones for amplification and cryopreservation.

4.4 Antibody production: Antibody production is performed on monoclonal cells, and each cell obtains 1 to 5 mg of antibody. Antibody was purified by antigen affinity purification method, and purified antibody was stored in phosphate buffered saline (PBS) by dialysis method.

5. EphrinA1 antibody function blocking experiment

The prepared EphrinA1 antibody was applied to normal cultured gastric cancer cell lines to bind the antibody to EphrinA1 antigen, prevent EphrinA1 function on the cell membrane surface, and detect the effect on cell invasion and metastasis ability.

Experimental results

We prepared polyclonal and monoclonal antibodies of EphrinA1 through antibody preparation methods, and confirmed the high titer of polyclonal antibodies by ELISA (Table 1). The serum titer of monoclonal antibodies after mouse immunization (Table 2), The results of hybridoma cell preparation for ascites titer testing (Table 3) and purified monoclonal antibody titer testing (Table 5) were all satisfactory. Ascites and cell supernatant detected the monoclonal antibody subtype as IgG1 and the light chain as k chain (Table 4). Western blot experiments also confirmed that the antibody can recognize EphrinA1 protein (Figure 7.1). Applying the prepared EphrinA1 antibody to gastric cancer cells can inhibit the invasion ability of gastric cancer cells and the ability to migrate across endothelial cells (Figure 7.2, 1A7 and 2D7 represent the names of the two selected hybridoma cells, and the two strains Name of ascites produced by cell preparation and antibody obtained by final purification). The results show that EphrinA1 antibody can effectively recognize and bind EphrinA1 protein, block the function of EphrinA1, and then inhibit the invasion and metastasis of gastric cancer cells, which may become an important method for the treatment of gastric cancer.

Table 1 Purified polyclonal antibody titer detection

Table 2 Serum titer detection after the last immunization of mice

Table 3 Mouse ascites titer test: the ascites titers of two monoclonal antibodies are qualified

Table 4 Mouse ascites subtype detection: monoclonal antibody subtype is IgG1, light chain is k chain

Table 5 Purified monoclonal antibody titer detection

Example 7, EphrinA1 is abnormally expressed in various tumors and is associated with the poor prognosis of patients

Our previous research found that EphrinA1 is abnormally highly expressed in gastric cancer and leads to poor prognosis of patients. The high expression of EphrinA1 can significantly promote the invasion and metastatic ability of gastric cancer cells. In order to further prove the broadness and effectiveness of EphrinA1 as an anti-tumor target, we analyzed the expression and prognosis of EphrinA1 in other cancers.

The GEPIA website contains data from the TCGA and GTEx databases, including differential expression analysis of tumor / normal tissues, analysis of different cancer types or pathological stages, survival analysis, correlation analysis, and dimensionality reduction analysis (URL: http: / /gepia.cancer-pku.cn/). We analyzed the expression of EphrinA1 in different cancers and its correlation with the prognosis of patients on the GEPIA website.

Experimental results:

Analysis of the expression of EphrinA1 on the GEPIA website found that EphrinA1 was found in cervical squamous cell carcinoma (CESC), gallbladder cancer (CHOL), esophageal cancer (ESCA), colon cancer (COAD), liver cancer (LIHC), ovarian cancer (OV), Brain poorly differentiated glioma (LGG), endometrial cancer (UCEC) and other cancers have significantly high expression (Figure 8.1, the ordinate is the value of log2 (TPM + 1)). Analysis of the correlation between the expression of EphrinA1 and the prognosis of patients revealed that high expression in cancers such as cervical squamous cell carcinoma (CESC), esophageal carcinoma (ESCA), ovarian cancer (OV), and poorly differentiated glioma (LGG) can cause patients Poor prognosis (Figure 8.2). The results indicate that EphrinA1 is abnormally expressed in various tumors and is closely related to the prognosis of patients. It can be used as a marker for tumor prognosis and as a target for anti-tumor drugs.

Claims (6)

1. Application of EphrinA1 protein in the preparation of drugs for inhibiting tumor cell invasion and / or metastasis.
2. The use according to claim 1, characterized in that the drug targets the EphrinA1 protein and inhibits, knocks down or knocks out the expression of EphrinA1.
3. The use according to claim 2, characterized in that the drug comprises at least one of the following active ingredients: nanomedicine targeting EphrinA1, CRISPR gene editing plasmid targeting EphrinA1, siRNA targeting EphrinA1, targeting EphrinA1 shRNA, EphrinA1 targeting LNA, chemically modified ASO targeting EphrinA1, small molecule inhibitors that block EphrinA1 function, polyclonal antibodies to EphrinA1, monoclonal antibodies to EphrinA1, humanized antibodies to EphrinA1, EphrinA1 Nanobodies, bispecific antibodies, antibody drugs targeting EphrinA1.
4. The use according to claim 3, wherein the monoclonal antibodies include rabbit, mouse, dog, monkey, camel, chicken, shark, etc., polyclonal antibodies include chicken, rabbit, sheep Source, camel source, etc.
5. The application according to claim 2, characterized in that EphrinA1 protein is knocked down and knocked out by the following means: siRNA, shRNA, gene editing; wherein the gene editing technology includes DNA homologous recombination, TALEN-TALEA targeted gene knockout technology , Cre / Loxp system, FLP-frt system, inducible Cre / Loxp system such as tetracycline / interferon, CRISPR / Cas9 gene editing technology.
6. The use according to claim 1, wherein the tumors include malignant tumors of the nasal cavity and sinuses, nasopharyngeal cancer, oral cancer, laryngeal cancer, salivary gland tumors, intracranial tumors, thyroid cancer, tongue cancer, lung cancer, esophageal cancer, Cardiac cancer, breast cancer, mediastinal cancer, gastric cancer, colorectal cancer, rectal cancer, liver cancer, pancreatic cancer and periampullary cancer, small intestine malignant tumor, kidney cancer, prostate cancer, bladder cancer, cervical cancer, ovarian cancer, skin malignancy Melanoma, lymphoma, etc.

Images