CN101063139B - Seed specific highly effective promoter and its application - Google Patents

Abstract

The invention discloses a special promoter separated from millet, expressing carrier with nucleic acid sequence of SEQ ID No. 1 host with the expressing carrier and appliance of the promoter, which is characterized by the following: utilizing Tail-PCR (colored body step moving method); getting the special promoter from gene group DNA; possessing nucleic acid sequence of SEQ ID No. 1; ;linking downstream of the promoter to non-homologous or homologous gene; constructing plant expressing carrier; transferring host plant; driving the downstream gene to high effective and special express goal protein in the seed; realizing genetic modification of plant; or using as effective tool for studying plant and biological reactor.

Description

A kind of seed-specific efficient promoter and application thereof

Technical field

The present invention relates to biological technical field, specifically, relate to a kind of seed-specific efficient promoter sequence and application thereof that from millet, is separated to.The above-mentioned seed specific promoters that obtains of clone from the millet genomic dna, and connect with different homology, heterologous gene and to make up plant expression vector, transform host plant, the methods and applications of efficient its downstream gene of specifically expressing of render transgenic plant seed.

Background technology

Find that in the process of transgenic plant research and exploitation the expression of exogenous gene amount is on the low side, cause the important factor that can't obtain the ideal transgenic plant and effectively study gene action mechanism often.Because influencing the key of expression amount is the promotor of upstream region of gene, therefore, selecting suitable plant promoter is to strengthen the problem that exogenous gene expression at first will be considered.Transcriptional profile according to promotor can be divided three classes it: constitutive promoter, tissue or organ specific promoters and inducible promoter.According to different purposes, beginning is the above-mentioned three class promotors of utilization extensively in the present plant genetic engineering.For example, CaMV 35S promoter and CsVMV promotor are applied to dicotyledons usually in the constitutive promoter, wherein the CsVMV promotor drives the transcription of foreign genes ability and uses quite [Li Z J of two CaMV 35S promoters in the transgenosis grape, et al.Expression of bifunctional GFP fusion marker underthe control of three constitutive promoter and enhanced derivatives intransgenic grape.Plant Sci, 2001,160:877].The normal use in the monocotyledons from the Ubiqutin promotor of corn with from the Actin1 promotor of paddy rice.Under the control of these constitutive promoters, foreign gene all can continuous expression in all sites and all etap of transgenic plant.But, because constitutive promoter drives expression of gene degree difference, expose some problems in the application gradually: foreign gene is expressed in whole strain plant, produce a large amount of heterologous proteins or meta-bolites at plant interior accumulation, broken the original metabolic balance of plant, some product even poisonous, thereby hindered the normal growth of plant, finally cause death.As utilize constitutive promoter to express viral capsid proteins, just may cause that viral capsid shifts, thereby cause the generation [Robinson DJ.Environmental riskassessment of release of transgenic plants containing virus derived inserts.Transgene Res.1996,5:359.] of the new strain of plant virus system.Remove this, reuse the two or more foreign genes of same promoters driven, may cause gene silencing or suppress phenomenon altogether.

Thereby, utilize specificity promoter that gene is expressed under the privileged site of recipient plant and specified time or specified conditions, and can show the characteristic of growing adjusting, can effectively avoid constitutive promoter to continue to efficiently express waste and the disadvantageous effect that is caused.Tissue or organ specific promoters; inducible promoter promptly belongs to specificity promoter; this class promotor is except that having general promoter structure; the element that also has several control tissue specific expressions simultaneously; usually the general characteristic that also has enhanser and silencer; therefore its expression specificity is with a wide range of applications by the common decision of kind, number and the relative position etc. of these elements.Along with the plant genetic engineering development, the research and the application of tissue or organ specific promoters become one of focus.So-called tissue or organ specific promoters comprise: seed specific promoters [Beachy RN, et al. (1985) Accumulation and assembly ofsoybean β-conglycinin in seeds of transformed petunia plants.The EMBOJournal, 4 (12): 3047-3053], endosperm specificity promoter [V.Colot, et al. (1987) Localization of sequence in wheat endosperm protein gene which confertissue-specific expression in tobacco.The EMBO Journal, 6 (12): 3559-3564], root-specific promoter [Yamamoto YT, et al. (1991) Characterization of cis-acting sequences regulating root-specific geneexpression in tobacco.Plant Cell, 3,371-382], phloem specific promotor [Bostwick DE, et al. (1994) Organization and characterization of cucurbitaphloem lectin genes.Plant Molecular Biology, 26,887-897] or the like.So-called inducible promoter comprises: damage induction type [Farmer EE, et al. (1992) Octadecanidprecursors of jasmonic acid activate synthesis of wound-inducibleproteinase inhinbitors.Plant Cell, 4,129-134], chemical induction [Williams S, et al. (1992) Chemicals regulation of Bacillus thuringiensis δ-endotoxinexpression intransgenic plants.Biol/Technol, 10,540-543.], photoinduction [Sonnewald U, et al. (1992) Expression of mutant patatin protein intransgenic tobacco plant:Role of glycans and intracellar location.PlantCell, 2,345-355.], heat-inducible [Schoffl F, et al. (1989) The function of plantheat shock promoter elements in the regulated expression of chimaericgene in transgenic tobacco.Mol Gen Genet, 217 (2-3), 246-253.] or the like.

Wherein, seed specific promoters, because it is only in the plant seed ripening process, its downstream gene of great expression, and expressed foreign protein mostly concentrates in the seed, and its foreign protein is stored easily transports easily and receives much concern.Therefore, the clone of seed-specific expression promotor and application become the focus of application gradually.

When beginning one's study soybean companion globulin gene, people such as Beachy in 1985 find, β-companion's sphaeroprotein α-subunit gene promotor has very strong space-time adjusting function, and in transgenic plant only at seed maturity later stage great expression downstream gene, and seldom express at other positions of transfer-gen plant.The consequent is that the seed specific promoters in many crops clones out in succession, mainly comprise: with the synthetic relevant seed-specific expression promoter of starch, as the SBE1 promotor is the promotor of starch branching enzyme gene, the may command foreign gene is specifically expressing [Qu L Q in the rice paddy seed scultellum, et al.Evaluation of tissue specificity and expressionstrength of rice seed component gene promoters in transgenic rice.Plant[J] .Biotechnology Journal, 2004,2 (2): 113-125.] or the like; The seed-specific expression promoter relevant with protein synthesis, as relevant with reserve protein in the seed, cotton alpha-globulin (globulin) B gene promoter [Sunilkumar G, et al.Cotton α-globulinpromoter:isolation and functional characterization in transgenic cotton, Arabidopsis, and tobacco[J] .Transgenic Re2search, 2002,11 (4): 347-359.], paddy rice gluten 1 (glutelin-1) gene promoter and zeatin prolamine (Zeatin) promotor [Russell D A, et al.Tissue-specific expression intransgenic maize of four endosperm promoters from maize and rice[J] .Transgenic Research, 1997,6 (2): 157-168.], [the Zhijian T.et al Isolation by improved thermal asymmerricinterlaced PCR characterization of seed-specific 2S albumin gene and itspromoter from grape of 2S white protein (albumin) promotor in the grape, Genome, 2005,48:312-330.], unknown seed albumen USP (unknown seed protein) promotor [Baumlein H in the wild soybean, et al.A novelseed protein gene from Vicia faba is developmentally regulated intransgenic tobacco and Arabidopsis plants[J] .Molecular and GeneralGenetics, 1991,225 (3): 459-467.] and rape napinB protein promoter [Zhang YJ, et al.Identification of seed-specific promoter nap300 and itscomparison with 7S promoter[J] .Progress in Natural Science, 2002,12 (10): 737-741.] etc.; The seed-specific expression promoter relevant with lipogenesis, Rossak etc. are connected the importing Arabidopis thaliana with the FAE1 promotor with the gus gene after, found that, the torpedo embryo transcriptional start that the gus gene was bloomed back 4～5 days at transgenic arabidopsis, reached in 9～11 days in the back of blooming and to transcribe peak [Rossak M, et al.Expression of the FAE1 gene and FAE1promoter activity in developing seeds of Arabidopsis thaliana[J] .PlantMolecular Biology, 2001,46 (6): 717-725.].

Above-mentioned seed specific promoters great majority show as the seed-specific expression activity, and are promptly only specific expressed in recipient plant seed or endosperm, and express hardly in its hetero-organization or expression amount seldom.

So far, the research of all kinds of crop seed specificity promoters has all obtained bigger progress with application; But directly the seed specific promoters that clone or separation obtain from millet yet there are no report at home and abroad, does not also see public use at home.

Summary of the invention

The object of the invention is to provide a kind of seed specific expression promotor, and described promotor comes from the millet genomic dna, its can be in plant seed specifically expressing; Another object of the present invention is to provide the application of this promotor in the plant modification seed, it can drive with, heterologous gene in seed in the efficient specifically expressing.

The present invention utilizes Tail-PCR to clone the nucleotide sequence that obtains from the millet genomic dna, is referred to as pF128, and length is 1053bp, is the double-strandednucleic acid type, and its nucleotide sequence is shown in sequence table SEQ ID No.1.By the retrieval of three big databases, find no the higher sequence of same or similar property.Bioinformatic analysis pF128 sequence is found the relevant cis element of it primary element that possesses eukaryotic promoter and seed specific expression.

The present invention has made up and has contained the plant expression vector that pF128 drives foreign gene.One preferred embodiment in, its expression cassette is to be reached from rouge alkali synthetase (no) gene transcription by pF128 promotor and GUS (beta-Glucuronidase gene) reporter gene to stop the zone formation, selectable marker gene is neomycin phosphotransferase II (NPTII), and described expression vector is recombinant plasmid pBIpF128 preferably.

The present invention obtains foreign gene high efficiency drive is expressed in seed genetically engineered host cell or host tissue and progeny cell thereof with above-mentioned recombinant expression vector transformed host cell or host tissue and the progeny cell thereof that contains described pF128 promoter sequence.

One preferred embodiment in, will contain the expression vector arabidopsis thaliana transformation that described pF128 promoter sequence drives, obtained the gus gene transgenic plant that high efficiency drive is expressed in seed.

Plant seed cell or plant seed itself that moietys such as plant host cell of the present invention or host tissue are plant seed cell or plant seed itself, or their offspring, protein or seed characteristics have changed.

Express the method for seed specific promoters in the plant tissue of the present invention, comprise the steps:

(1) plant expression vector that will contain promotor of the present invention imports vegetable cell;

(2) described plant cell growth being become can seed bearing maturation plant.

The nucleotide sequence of promotor described in the present invention also comprises replacement, lacks or inserts the formed nucleotide sequence with identical function of one or several Nucleotide.Can also be described nucleotide sequence and other promotor fusion sequences.

Other foreign genes described in the present invention are meant any one section nucleotide sequence, and have certain protein of coding or other active substance functions, comprise RNA or dna sequence dna, and this sequence does not combine with the seed specific promoters normal circumstances.This nucleotide sequence comprises and is different from the floristic heterologous nucleic acid sequence of promotor, and from being same as the homologous nucleotide sequence that the promotor floristics obtains, but the promotor of these sequences and wild-type (non-transgenic) plant is irrelevant.

Any carrier that expression vector described in the present invention is meant is well known in the prior art, can express in plant is as pBI121 etc.

That transformation technology described in the present invention is meant is known, can be with any methods for plant transformation of exogenous gene transfered plant cell or plant tissue, as agrobacterium-mediated transformation etc.

Host cell described in the present invention or host tissue and progeny cell are meant all vegetable cells or plant tissue or by the whole strain plant (comprising seed) of these cell or tissue fully-developeds.

Term " nucleotide sequence " refers to contain naturally occurring base, the sequence of the Nucleotide of the key of (side chain) or nucleotide monomer between sugar and the sugar.This sequence also comprises monomer that contains the non-natural existence of bringing into play identity function or the sequence that its part is modified or replaced.

Term " seed specific promoters " is meant that the gene of expressing is being with or without in the plant seed of primary expression and preferentially expresses under promotor control.

Millet seed specific high efficient expression starter of the present invention, it is the millet seed specific promoters that the domestic first time cloning obtains, behind described promoter sequence connection allos or homologous gene, be transformed into and can make allos or homologous gene efficient specifically expressing in plant seed in the plant, avoided goal gene other position continuous expressions with disadvantageous effect.The invention provides a kind of novel method of utilizing described nucleotide sequence driving purposes gene efficient specifically expressing in plant seed, have great application prospect aspect the genetic improvement of plant and the plant bioreactor research.

Seed specific high efficient expression starter of the present invention can also be widely applied to and produce in human food prods, animal-feed, makeup or the medicine.

Description of drawings

Fig. 1: Tail-PCR clone pF128 fragment electrophorogram, 1 is λ/HindIII+EcoRI marker among the figure; 2. negative contrast 3,4,5,6,7,8,9,10. be respectively combination of primers SP4+AD2, SP4+AD3, SP3+AD2, SP3+AD3, SP2+AD2, SP2+AD3, SP1+AD2 and SP1+AD3 clone result;

Fig. 2: pF128 fragment separation electrophoresis figure, 1 is λ/HindIII+EcoRI marker among the figure; 2 are PCR separation pF128 sequence;

Fig. 3: by the plant expression vector construction process of pF128 driving;

Fig. 4: GUS tissue chemical analysis, A: root; B: stem; C: leaf; D: flower; E: solid back 10 days seed; F: solid back 15 days seed; G: solid back 20 days seed; H: the seed that is mature on the whole; I: the transgenic arabidopsis seed that transforms 19Z promotor [Liang Hua etc., corn zein gene promotor pcr amplification and the expression of driving gus gene in the transgene tobacco seed thereof, biotechnology journal, 1996,12 (3): 295-300.]; J: wild-type Arabidopis thaliana seed.

Fig. 5 .1: change pBIpF128 gene Arabidopis thaliana different tissues GUS quantitative fluorescence analysis, wherein, 128-R, the root of transgenic arabidopsis; 128-L, the leaf of transgenic arabidopsis; 128-F, the flower of transgenic arabidopsis; 128-10: solid back 10 days seed; 128-15: solid back 15 days seed; 128-20: solid back 20 days seed; 128-SM: the seed that is mature on the whole.

Fig. 5 .2: transform pBI121 and the comparative analysis of pBIpF128 transgenic arabidopsis GUS fluorescent quantitation, wherein, 1, solid back 10 days seed; 2, solid back 15 days seed; 3, solid back 20 days seed; 4, the seed that is mature on the whole.

Embodiment

Following embodiment is used for further specifying of the present invention, but is not used for limiting the scope of the invention.

The clone of embodiment 1. millet seed specific promoters sequence pF128

After millet 3661 seeds (variety source institute of the Chinese Academy of Agricultural Sciences) surface sterilization, place the culture dish that is covered with moistening filter paper, cultivated 3-5 days for 24-28 ℃, after making it grow young leaflet tablet, collect the fresh and tender seedling of 2g, improve one's methods with CTAB and to extract total DNA, get 2-3 μ lDNA sample, agarose gel electrophoresis detector purity and concentration.

According to known F128 cDNA sequence [Xue J.et al, Cloning andCharacterization of seed-specific Expression f128 Gene in Setariaitalica.Journal of Agricultural Biotechnology, 2004,12 (5): 505-508.], synthetic 3 the nested primer SP1-SP3 of design, according to people's such as Liu Yao-Guang Tail-PCR method, synthesize 4 degenerated primer AD1-AD4 again, primer sequence is as follows:

Sp1：5’-AATTAGGTCTTTGAGGCCATCG-3’

Sp2：5’-CCTTTTTTACCAGACCGCAGC-3’

Sp3：5’-GACACAATCGCCTCAATAGCCT-3’

AD1：5’-NTCGA(G/C)T(A/T)T(G/C)G(A/T)GTT-3’

AD2：5’-NGTCGA(G/C)(A/T)GANA(A/T)GAA-3’

AD3：5’-(A/T)GTGNAG(A/T)ANCANAGA-3’

AD4：5’-AG(A/T)GNAG(A/T)ANCA(A/T)AGG-3’

Carry out Tail-PCR reaction with above primer, reaction conditions is according to people's such as Liu Yao-Guang Tail-PCR method, and slightly does improvement, and the Tail-PCR reacted constituent is as follows:

With special primer SP3 respectively with 4 degenerated primer AD1, AD2, AD3 and AD4 pairing carrying out pcr amplification is got 1 μ l as template after 100 times of the products therefrom dilutions, begins to carry out the pcr amplification second time with special primer SP2 and corresponding degenerated primer; Carry out PCR for the third time according to reason.The Tail-PCR reactions steps is as follows:

After the PCR reaction is finished, agarose gel electrophoresis detects the size and the specificity of amplified fragments, choose correct purpose fragment pS3A2, reclaiming test kit (TIANGEN Biotech (Beijing) Co., Ltd. was epoch biotech firms in former day) with DNA glue reclaims, reclaiming the fragment subclone in sequencing vector pMD18-T (Takara company product), the connection product is transformed into uses CaCl ₂The bacillus coli DH 5 alpha competent cell that method is handled, overnight incubation on the LB solid medium that contains penbritin (final concentration 100 μ g/ml); The white colony of growing on the picking flat board, access contains the LB liquid nutrient medium overnight incubation of penbritin (final concentration 100 μ g/ml), centrifugal collection thalline is pressed alkaline lysis [Sambroook, etal., 1989, Molecular Cloning, a Laboratory Manual, Cold Spring HarborLaboratory, New York, p19-21] extract plasmid, through restriction enzyme HindIII and XbaI double digestion and pcr amplification evaluation positive colony (electrophoresis result is as shown in Figure 1), the name recombinant plasmid is pMDpS3A2.

The separation of embodiment 2. millet seed specific promoters sequence pF128

Designing and synthesizing following two primers, is the needs that separate and make up later on, holds at 5 ' of two primers to have added restriction enzyme HindIII site and restriction enzyme XbaI site respectively:

Primer 1:5 ' TGCTCTAGACCTCTCTTGGATGCTAACACA 3 '

XbaI

Primer 2: 5 ' CCAAGCTTTGTGGAGAAGCAGAGAGAAG 3 '

HindIII

With plasmid DNA pMDpS3A2 is template, carries out the PCR reaction, and reaction system is as follows:

Amplification condition: 95 ℃ of 10min; 95 ℃ of 1min, 58.5 ℃ of 1min, 72 ℃ of 1min, totally 30 circulations; 72 ℃ of 10min.Electrophoresis detection result shows (shown in the accompanying drawing 2), and amplification obtains the dna fragmentation of 1053bp.(day biochemical company limited of root science and technology) reclaims with DNA glue recovery test kit, and reclaiming the fragment subclone in sequencing vector pMD18-T (Takara company product), the connection product is transformed into uses CaCl ₂The bacillus coli DH 5 alpha competent cell that method is handled, overnight incubation on the LB solid medium that contains penbritin (final concentration 100 μ g/ml); The white colony of growing on the picking flat board, access contains the LB liquid nutrient medium overnight incubation of penbritin (final concentration 100 μ g/ml), and centrifugal collection thalline is pressed alkaline lysis [Sambroook, et al., 1989, Molecular Cloning, a LaboratoryManual, Cold Spring Harbor Laboratory, New York, p19-21] extract plasmid, through restriction enzyme HindIII and XbaI double digestion and pcr amplification evaluation positive colony, the name recombinant plasmid is pMDpF128.

The structure of embodiment 3. plant expression vector pBIpF128

Make up flow process as shown in Figure 3, with alkaline lysis method of extracting pMDpF128 plasmid,, obtain the pF128 promoter fragment through HindIII and XbaI double digestion, link to each other with the big fragment of the plant expression vector pBI121 that cuts through same enzyme, will connect product then and be transformed into and use CaCl ₂In the bacillus coli DH 5 alpha competent cell that method is handled, overnight incubation on the LB solid medium that contains kantlex (final concentration 100 μ g/ml); The white colony of growing on the picking flat board, access contains the LB liquid nutrient medium overnight incubation of kantlex (final concentration 100 μ g/ml), centrifugal collection thalline is by alkaline lysis method of extracting plasmid pBIpF128, through restriction enzyme HindIII and XbaI double digestion and pcr amplification evaluation, conclusive evidence pBIpF128 contains the pF128 promoter fragment.

Embodiment 4.pF128 promoter sequence/gus reporter gene expression vector arabidopsis thaliana transformation

The plant expression vector pBIpF128 that utilizes freeze thawing to send out reorganization changes agrobacterium tumefaciens GV3101 over to, method for transformation is with reference to [Hofen R such as Hofen, Willmitzer L, (1988) Storage of competent cells for Agrobacterium transformation.NucleicAcids Research, 16,9877].

The conversion of Arabidopis thaliana is with reference to [Clough SJ such as Clough, Bent AF. (1998) Floral dip:a simplified method for Agrobacterium-mediated transformation ofArabidopsis thaliana.The Plant Journal, 16 (6), 735-743] Floral dip method carry out.Transformation receptor is Arabidopis thaliana (Arabidopsis thaliana.).Agrobacterium GV3101[Van Larebeke N with incubated overnight, Engler G, Holsters M, Van den ElsackerS, Zaenen I, Schilperoort RA, and Schell J (1974) Large plasmid inAgrobacterium tumefaciens essential for crown gall-inducing ability.Nature (London), 252,169-170] (containing pBIpF128) bacterium liquid, be forwarded in the YEB liquid nutrient medium according to the 1:100 ratio, shaking culture is to OD ₆₀₀Value 0.6-0.8; After collecting thalline,, be diluted to OD with infiltrating damping fluid suspension thalline ₆₀₀Value about 0.6 is immersed in the bud that will bloom in the infiltrate that contains agrobatcerium cell 2 minutes, 22--26 ℃ of dark cultivation 24 hours.Then, after plants transformed yielded positive results, collect seed.

The screening and the detection of embodiment 5. transgenic arabidopsis

With the seed of collecting, utilize 2.5% chlorine bleach liquor and 70% ethanol to carry out surface sterilization respectively, be planted in the enterprising row filter of MS substratum that contains final concentration 100 μ g/ml kantlex.Arabidopis thaliana seedling replanting that can normal growth on the kalamycin resistance substratum treats that it yields positive results in flowerpot, collect seed.Screen altogether 58 strains can be on the kalamycin resistance substratum Arabidopis thaliana seedling of normal growth, survive 54 strains after transplanting flowerpot, each plant is got a slice leaf, extracts the total DNA of plant with the SDS improved method, carries out pcr amplification with separating the used primer 1,2 of pF128 promotor, the result shows, in the 54 strain Arabidopis thalianas, there are 48 strains to show as the positive, amplify the pF128 fragment of 1053bp, and order-checking is correct, and remainder fails to amplify this fragment.

Embodiment 6. transgenic arabidopsis GUS active mass chemical stainings are analyzed and quantitative fluorescence analysis

The active histochemical stain analytical procedure of gus gene is according to people such as Bradford [Bradford H M.A rapid and sensitive method for the quantification ofmicrogram quantities of protein utilizing the principle of protein-dyebinding[J] .Anal Biochem., 1976,72:248-254.].(the X-Gluc dye liquor is formed: 1.0mg/ μ lX-Gluc with collecting the different tissues material of transgenic arabidopsis and containing substrate X-Gluc; The 50mmol/L phosphoric acid buffer, pH 7.0; 10mmol/L EDTA, pH 8.0; 0.05mmol/L the Tripotassium iron hexacyanide; 0.05mmol/L yellow prussiate of potash; Methyl alcohol, final concentration 20%; 0.1%Triton X-100.) staining reaction liquid is in 37 ℃ of incubated overnight, carries out histochemical stain and observes, and chlorenchymas such as blade are observed after with 95% ethanol decolorization.Found that, compare, the root of transgenic arabidopsis, stem, leaf, spend blue the appearance all do not arranged, only have the immature seed of the different times of transgenic arabidopsis that blue the appearance arranged, as Fig. 4 with the contrast strain.

The active quantitative fluorescence analysis of gus gene, according to people such as Jefferson [Jefferson RA. (1987) Assaying chimeric genes in plants:The GUS gene fusionsystem.Plant Molecular Biology Repoerter, 5 (4), 387-405], get transgenic plant material (root, leaf, flower, seed) 300-500mg, put into the centrifuge tube of 1.5ml, under the liquid nitrogen condition, after abrasive substance is powder, adds 600 μ l and extract damping fluid, mixing on ice fully vibrates, centrifugal 12600rpm, 4 ℃, 15min, draw supernatant, be GUS enzyme crude extract.Draw 40 μ l GUS enzyme crude extracts and 360 μ l GUS reaction buffers (extracting the MUG that adds 1mM in the damping fluid), abundant mixing, react under 37 ℃,, add and fill 900 μ l reaction terminating liquid (0.2mol/L NaCO in the reaction beginning back different times 100 μ l that take a sample ₃) centrifuge tube in termination reaction, exciting the fluorescent value of measuring each sample under 365nm, emission 455nm, the slit 5nm condition with spectrophotofluorometer.Found that compare with the contrast strain, the root of transgenic arabidopsis, leaf, flower are not found higher GUS enzymic activity, and in the immature seed of the transfer-gen plant of different times, higher GUS enzymic activity is arranged, and along with seed is ripe gradually, the GUS enzymic activity increases gradually, as Fig. 5-1; And with contain constitutive promoter 35S and compare with the contemporaneously immature seed of the transgenic arabidopsis of corn 19KD alcohol soluble protein gene promotor, contain in the immature seed of transgenic arabidopsis of pF128 promotor and shown higher GUS enzymic activity, as Fig. 5-2.

Hence one can see that, and millet seed specific promoters of the present invention has the seed-specific expression activity really.

Sequence table

＜110〉China Agricultural University

＜120〉a kind of seed-specific efficient promoter and application thereof

<130>

<160>1

<170>PatentIn?version?3.3

<210>1

<211>1053

<212>DNA

＜213〉millet (Setaria italica)

<400>1

tgtggagaag?cagagagaag?taacaatttg?gtgggatcaa?gtaaaaaaca?ttgagaaatt 60

actatgatgc?tcttttaatt?atgtataaat?ttatttttta?agcaaaataa?gaaaagaaag 120

taccagtacc?actggtactt?taaaaccatg?gtaacaaagc?tcctgttcct?ggtggttcgc 180

tcccttaatg?ctcgtacgtg?tgccgaatat?tgatggatca?agacgaataa?gattgacatt 240

tcgttcctac?cttatgcact?atgtccatcc?ttcttgtata?atgttcattt?gcccgcgacg 300

agagatgtat?ttagtctata?ctactgttgt?ctcggtatct?cttggataag?tttgtttgca 360

ttgcatgtat?ctcgaatata?ttaaccacct?ctgttgctga?tgtgatctat?gttaacctct 420

attcctagct?ttattatgtt?ttgttttaaa?aaatattgtt?ttgcaaatat?ttgaaaaaat 480

atctccaata?aatgacaact?aaataaatgc?ttatgatagg?tatactttca?taatttttta 540

tagattttat?gatattatat?ccagtaagtg?ctaataagac?tgatggaaat?tgtatccata 600

gaggccatcc?gttgtcataa?atgtgtagca?ccaatcttga?tacatgtcaa?tatagtcagt 660

accaatttca?aaataattat?gcataataaa?tttagatgtt?tgtgaatata?gaagtactat 720

tgctcacacg?tgtgtatcta?ctagtgttga?ttgtgccact?tgtctgtgta?atggtatcat 780

gttttacacc?tgtataacat?gcaacactaa?atttgacatg?tgtctaacat?gcaacactga 840

tatcaacact?tgtccatata?gcctgtcccc?acatcaatcc?ttaccatcaa?ttctgtatcc 900

aatggctaac?atacacaatc?gcaaaatagg?agcggacctt?ccctcatgct?tctatataaa 960

ccgggtacca?ttctcagaaa?actcacatca?aaaccaacat?agttcttgtg?ttagcatcca 1020

agagaggcca?aactacttgt?agatctaata?gcc 1053

Claims (7)

1. a seed specific promoters is characterized in that, described promotor is the nucleotide sequence shown in the SEQ IDNo.1.

2. the expression vector that contains the described promotor of claim 1.

3. method for preparing transgenic plant is characterized in that the method comprising the steps of:

1) the described expression vector of claim 2 is imported vegetable cell,

2) the described plant cell growth of step 1) being become can seed bearing maturation plant.

4. the application of the described promotor of claim 1 in the preparation transgenic plant.

5. application as claimed in claim 4 is characterized in that described plant is an Arabidopis thaliana.

6. the application of the described promotor of claim 1 in producing human food prods, animal-feed, makeup or medicine.

7. the application of the described promotor of claim 1 in the plant modification seed characteristics.

Images