CN101029314A - Corn starch branching enzyme gene siRNA expression carrier - Google Patents
Corn starch branching enzyme gene siRNA expression carrier Download PDFInfo
- Publication number
- CN101029314A CN101029314A CN 200710055297 CN200710055297A CN101029314A CN 101029314 A CN101029314 A CN 101029314A CN 200710055297 CN200710055297 CN 200710055297 CN 200710055297 A CN200710055297 A CN 200710055297A CN 101029314 A CN101029314 A CN 101029314A
- Authority
- CN
- China
- Prior art keywords
- gene
- fragment
- enzyme
- iia
- corn starch
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A corn starch branching enzyme gene siRNA expression carrier is prepared by taking multiple clone site on expression pCAMBIA1301, inserting corn starch branching enzyme seed specific promoter gene between SphI and SalI, inserting SBEIIa antisense fragment between SalI and SacI, cutting hygromix antibiotic resistant gene, inserting SBEIIa positive-sense fragment between SacI and XhoI and inserting green fluorescent protein gene GFP between BglII and BstEII. It can enclose corn starch branching enzyme gene sbeIIa expression, decrease its activity, improve corn straight-chain starch corn yield and cultivate high-straight-chain starch corn. resources.
Description
Technical field
The invention belongs to plant genetic engineering and genetic breeding field.
Background technology
W-Gum is made up of amylose starch and amylopectin, and wherein amylose starch accounts for 24%, and amylose starch accounts for 76%.W-Gum is the essential industry raw material, and is of many uses, relates to industries such as food, medical treatment, weaving, papermaking, packing, oil, environmental protection, optical fiber, electronic chip.
Its molecular structure is depended in the application of starch in different field.The important parameter of starch molecular structure comprises: the ratio of amylose starch and amylopectin; The polymerization degree of amylose starch; Amylopectin branch chain length and distribution or the like, the physics and chemistry and the functional performance of these parameter influence starch processing.Wherein, straight/than being the most important molecular structural parameter of starch molecular structure, general conventional corn starch is straight/than being 1: 3, straight/prop up ratio greater than 1 be high amylose starch.High amylose starch has gelification faster, and the gel-strength height has unique effect as foodstuff additive in the quality of improving food and configuration aspects.Using high amylose starch in the film of many types, is because it has the unique transparency, snappiness, tensile strength and water-repellancy.People are to the environmental protection growing interest at present, renewable, the degradable plastics film of high amylose starch production can reduce industrial gaseous waste and weaken the release of greenhouse gases, be to solve the effective way of serious " white pollution " at present, cause people's interest just day by day.Amylopectin has better stickiness, can increase the volume of puffed food, has the effect that is different from amylose starch as foodstuff additive, has more application in adhesive field.In addition, those inter-levels between amylose starch and amylopectin, physical parameters such as the length of its starch branched chain and branch degree are different, may have different physico-chemical properties, thereby different purposes is arranged.When natural starch does not satisfy a certain functional requirement, just need carry out chemical modification to starch, and these courses of processing can increase expend, the weighting ring environment pollution.The approach that another generation has different physicochemical property starch is exactly the pathways metabolism that changes starch from heredity.Along with the clone of relative enzyme gene in the starch building-up process and the foundation in succession of various plant genetic transformation systems, make and utilize genetic engineering regulation starch building-up process, the modified starch quality becomes possibility, provides effective means for creating novel starch.
The building-up process of corn kernel amylose starch and amylopectin is subjected to the regulation and control of a series of enzymes.Q-enzyme (SBE) is a key enzyme in the starch biosynthetic process, and its catalysis glucose connects with α-(1,6) key, forms branched structure.Corn SBE has three kinds of isozymes: SBE I, SBE IIb mainly exist in endosperm, and SBE IIa mainly exists in blade, also have their fellowship amylopectin synthetic in endosperm.Though SBE IIa and SBE IIb molecular weight be near 80KD, amino acid form and restriction enzyme mapping also similar, because of SBE IIa contains that 49 amino acid whose N ends extend and the difference in basic sequence district and SBE IIb difference to some extent.The difference of structure makes them play not same-action in amylopectin is synthetic just.The substrate of SBE I effect is an amylose starch, and it can make long glycosidic linkage transfer on the amylose starch, but the ability of transferring on the amylopectin is very weak.SBE I is to produce ramose on the side chain more than ten times producing ramose efficient on the straight chain; In contrast, the substrate of SBE II effect is an amylopectin, short glycosidic link is transferred on the amylopectin, and the activity of SBE IIa is much higher than SBE IIb, the sudden change of its encoding gene (corn ae mutant) can make that the content of amylose starch reaches 50% in the corn embryosperm.Corn sbe IIa gene effect to the content of amylose starch under different genetic backgrounds is obviously different, can make the content of amylose starch reach 20% to 70%.
The content ratio of corn amylose starch and amylopectin affects the structure and the characteristics of starch small grain, and then affects quality, the function and application field of starch, and changing starch structure has a lot of potential using values.The starch of high side chain, low straight chain or low side chain, high straight chain all has the wide industrial purposes.The new starch type of utilizing intravital method to produce need not chemistry or enzymatic treatment, as the removal of starch tapping point, the hydrolysis and the chemically modified of sugar chain after the harvesting.Therefore, when breeding of new variety, the importance of person's consideration that this has become the breeding work.
RNA interference effect (RNA interference, RNAi) be meant in biological cell, exogenous or endogenic double-stranded RNA (double-stranded RNA, dsRNA) cause with its homologous mRNA specificity and degrade, thereby suppress the process that its corresponding gene is expressed, be reticent effect (posttranscriptional gene silencing, one of important mechanisms PTGS) after the genetic transcription.
The main process of RNA interferential can be divided into two stages: the fs is an initial period, because picornavirus infection, transposon is transcribed and reasons such as external source quiding gene expression, double-stranded dsRNA appears in the biological cell, dsRNA has the active dsRNA specific nucleic acid of a RNaseIII restriction endonuclease (dsRNAspecific endonuclease a kind of, Dicer) effect down, cut into little intervening rna (the smallinterfering RNA of 21-25nt, or short interfering RNAs, siRNA).Recently discover that siRNA is the important middle effector molecule that RNAi is rely and taken place.It has the singularity structure is that the sequence of siRNA has homology with the said target mrna sequence that acted on; Two strand ends of siRNA are 5 ' end phosphoric acid and 3 ' terminal hydroxy group.In addition, 3 of every strand ' end all has the base of 2-3 outstanding non-matching.
Subordinate phase is the effective stage, thinks that at present there are two kinds of hypothesis patterns in this stage.A kind of hypothesis pattern thinks that siRNA is as go-ahead sequence, with reticent mixture (the RNA induced silencingcomplex of RNA inductive, RISC) inactive precursor combination, the siRNA duplex structure untwists to induce and is formed with active RISC under ATP participates in, active RISC combines with homology target mRNA immediately, cut off homology target mRNA at middle part, make its degraded, thereby reach interference base because of expressional function with siRNA antisense strand pairing region; Another kind of hypothesis pattern is thought degradation property polymerase chain reaction (random degradativePCR) at random, be that the siRNA conduct is at the special primer of target mRNA, at RNA RNA-dependent polysaccharase (RNA-dependent RNA polymerase, RdRp) under the effect be the synthetic dsRNA of template with the said target mrna, under the effect of Dicer enzyme, be degraded then and form new siRNA, new siRNA enters said process again, circulation repeatedly, thereby make the gradual minimizing of said target mrna, present the gene silencing phenomenon.RdRp is general only to play a role to expressed said target mrna, and this specific gene function for monitoring that the specific amplification effect of said target mrna is helped to strengthen RNAi in the RNAi process, each cell only need a small amount of dsRNA to finish to close corresponding gene to express; As seen the RNAi process has the basic motive feature of biocatalytic reaction.
The human full genome plan that participates in along with multinational scientist enters coda, and genome times afterwards comprehensively of attaching most importance to announcement protein structure and function raised the curtain already.Because RNAi can make specific gene mRNA degrade, thereby obtain the mutant strain of specific protein afunction or reduction.Therefore, RNAi presents great application prospect as a kind of new, strong research tool in the functional genomics field, makes RNAi become one of the most attractive topic of current research field.With respect to gene knockout technology (knockout), advantages such as RNAi has fast, operation and sequence-specific be strong effectively, easily, be called as gene inhibition (knock down) technology, be the effective ways of research specific gene function, can substitute the gene knockout technology of complicated operation and expense costliness to a certain extent.In a word, RNAi be a kind of effectively, quick relative cheap gene functional research means with cost, combine with high-throughput genescreen technology such as gene chip, in the genomics functional study, will play an important role, its application prospect is not second to round pcr.
The transformation of starch route of synthesis is an important means of creating new features, new applying starch.Because RNA disturbs (RNA interference, RNAi) technology provides the method that directly effectively artificial controlling gene is expressed, so, application RNA perturbation technique suppresses the expression of starch synthetic key gene, and then the route of synthesis of control starch, realize using gene engineering means modified starch quality, to satisfy the various different demands of industrial production and people's lives, this is that conventional breeding is beyond one's reach, and demonstrates in plant species improvement to have broad application prospects.Chinese Academy of Sciences's Shanghai plant physiology ecological Studies utilized genetic engineering technique antisense Wx gene to be imported the indica hybrid rice emphasis parent of 3 high amylose contents, part transgenic paddy rice T1 and T2 are for the existing decline in various degree of the amylose content in the seed, minimum drops to about 7%, compares with unconverted contrast to have descended 18.39%.
China does not have the amylomaize kind, does not have the plantation and the Starch Production of amylomaize yet.The utilization genetic engineering technique suppresses the expression of a certain specific SBE isozyme, can improve the content of corn amylose starch, produces the kind that the human consumer likes, can obtain huge economic and social benefit.
Summary of the invention
The invention provides a kind of corn starch branching enzyme gene siRNA expression carrier, by utilizing the expression of transgenic technology sealing corn starch branching enzyme gene sbe IIa, reduce the activity of corn starch branching enzyme, improve the corn amylose content, cultivate amylomaize.The technical scheme that the present invention takes is: comprise the following steps:
One, corn clone starch branch enzyme gene sbe IIa fragment
(1) the segmental pcr amplification of starch branch enzyme gene
The extraction of RNA: use TRIzoL test kit (Puli's lema gene technology company limited) to extract total RNA, carry out reverse transcription then and become cDNA from maize leaf and seed.
The reverse transcription reaction system: in the reaction system of 20 μ L, total RNA9.5 μ L, 5 * damping fluid, 4.0 μ L, d NTP (10mM) 2.0 μ L, RNA enzyme inhibitors 0.5 μ L, primer (100pmol/ μ L) 2.0 μ L, ThermoScript II 2.0 μ L.(mentioned reagent is all purchased the company in TaKaRa)
Design of primers: according to GenBank reported sequence (U65948), adopt two pairs of primers of DNAMAN software design, utilize PCR method corn clone starch branch enzyme gene (sbe IIa) fragment (562bp).Primer sequence is as follows:
5′CGTGT?AAAGA?TACGG?ATGGA?C3′
5′ATAGG?CGAGA?ATCCC?ACAT?3′
The PCR reaction system: in the reaction system of 50 μ L, 10 * damping fluid, 5.0 μ L (TaKaRa company), dNTP4.0 μ L (TaKaRa company), each 50pmol/L of primer (the biological company limited in match Parkson), template 0.1 μ g, Taq enzyme 0.3 μ L (TaKaRa company) is with ddH
2O supplies 50 μ L.
The pcr amplification condition: 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 73 ℃ are extended 90s, 35 circulations, last 72 ℃ are extended 10min.
(2) the segmental clone of starch branch enzyme gene, screening and evaluation
The electrophoresis of amplified production is identified: pcr amplification product is through 1% agarose gel electrophoresis.Obtain about 560bp size, high specificity, single amplified band.
The recovery of target DNA fragment: reclaim test kit (V-Gene company) by the dna fragmentation gel and carry out through the method for improvement.The dna fragmentation that reclaims is put-20 ℃ of refrigerators and is preserved.
Target DNA fragment is connected with cloning vector: the PCR product of recovery, the purpose fragment that wherein contains antisense or justice, with the concentration ratio of pMD18-T-vector with 3: 1, with damping fluid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant vectors: contain the pW1 of antisense target gene fragment and contain the pW2 of just target gene fragment.(pMD18-T-vector purchases the company in TaKaRa).
The conversion of recombinant vectors: the method by Maniatis prepares competent cell, will connect product transformed into escherichia coli DH5 α, and ice bath 30min does control tube simultaneously.With 42 ℃ of heat shock 90s, place 2min on ice.Every pipe adds 800 μ L LB liquid nutrient mediums, 37 ℃ of incubation 45min, 140rpm/min.Be coated in contain penbritin (100 μ g/mL), *-select overnight incubation (37 ℃) on the LB culture medium flat plate of gal (Beijing ancient cooking vessel state biotechnology limited liability company), IPTG (Beijing ancient cooking vessel state biotechnology limited liability company).Picking hickie alkaline lysis method of extracting plasmid is identified with digestion with restriction enzyme, obtains recombinant clone.
(3) the starch branch enzyme gene fragments sequence is analyzed
Precious biotech firm finishes by Dalian, nucleic acid sequence analysis DNASIS software, and the sequence of 562bp is as described in the SEQ ID NO.1:
Two, the seed-specific expression promoter of clone's starch branch enzyme gene
Seed-specific expression promoter TSPsbe (934bp) sequence is as described in the SEQ ID NO.2:
Primer sequence is as follows:
Primer1：5′TCT?CTC?CAA?CCC?CTT?CAA?TC?3′；
Primer2：5′GAC?CGC?AAG?AGC?GAA?ATC?3′；
Biological company limited is synthetic by the match Parkson, and this promotor is preserved by this laboratory clone.
Three, clone's green fluorescence protein gene
Go up directly amplification from the p1300 plasmid of transforming (p1300-GFP), and obtain cloning vector (pW3).Plasmid p1300-GFP is preserved by this laboratory.
The green fluorescent protein sequence is as described in the SEQ ID NO.3:
Primer sequence is as follows:
Primer1：5′ATGGTGAGCAAGGGCGAGGAGC3
Primer2：5′TTACTTGTACAGCTCGTCCATGCCGAGA3′
Biological company limited is synthetic by the match Parkson.
Four, make up the siRNA expression vector
(1) the purpose fragment is connected with the reverse of expression vector:
The cloned plasmids (pW1) and the expression plasmid pCAMBIA1301 that will contain the antisense target gene fragment carry out double digestion with Sal I, Sac I respectively, the electrophoretic separation endonuclease bamhi, reclaim the big fragment of target gene fragment and carrier respectively, then with 3: 1 concentration ratio, add and connect liquid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant plasmid (pAsbe IIa);
(2) recombinant plasmid pAsbe IIa is connected with the forward purpose is segmental:
Above-mentioned recombinant plasmid is cut the big fragment of carrier of separating through Sac I, Xho I enzyme; Cloned plasmids (pW2) is cut through Sac I and Xho I enzyme, separates target gene fragment, uses T
4Dna ligase is connected on the recombinant plasmid (pAsbe IIa), gets antisense+just segmental expression plasmid pA-Ssbe IIa.
(3) being connected of seed-specific expression promoter and expression vector pA-Ssbe IIa:
The pCAMBIA1301 plasmid is cut with Sph I, Sal I enzyme, inserted seed-specific expression promoter, obtain pTSPsbe IIa.
(4) replacement of green fluorescent protein GFP and gus gene:
Clone's the recombinant plasmid (pW3) of green fluorescence protein gene is carried out double digestion with Bgl II and BstE II, be connected, obtain final expression plasmid pTSPsbe IIa-GFP with the pTSPsbe IIa carrier of same double digestion.This expression vector is exactly corn starch branching enzyme gene (sbe IIa) the siRNA expression vector that makes up.
(5) conversion of expression vector:
In recombinant plasmid transformed bacillus coli DH 5 alpha competent cell, filter out 3 recombinant clones.Cut evaluation by restriction enzyme Sac I and Sal I enzyme, obtain the special band of a treaty 560bp, electrophoretogram shows that the purpose fragment is inserted into the seed-specific expression promoter downstream of plant expression vector pCAMBIA1301 really, has successfully made up the expression vector pTSPsbe IIa-GFP of siRNA.
The application of corn starch branching enzyme gene siRNA expression carrier of the present invention in cultivating the amylomaize self-mating system.
Corn starch branching enzyme gene (sbe IIa) the siRNA expression vector that the present invention makes up has made full use of the multiple clone site on the expression vector pCAMBIA1301, corn starch branching enzyme seed-specific expression promoter gene is inserted Sph I, between two restriction enzyme sites of Sal I, corn starch branching enzyme gene antisense fragment is inserted above-mentioned promotor downstream Sal I, between the Sac I, behind excision Totomycin antibiotics resistance gene, the just fragment of SBE IIa gene is inserted into Sac I, between the Xho I, at last pTSPsbe IIa is carried out Bgl II and BstE II double digestion, replace gus gene with green fluorescence protein gene (GFP).This carrier has higher operability, practicality in biology field: wherein available restriction enzyme site has Sph I, Sal I, Sac I, Xho I, Bgl II and BstE II, can insert four target gene fragment, can use for general vector construction.Remove hygromycin gene, use green fluorescence protein gene to screen, solve food safety question.
Advantage of the invention and useful effect are to have made up corn starch branching enzyme gene (sbe IIa) siRNA expression vector.Utilize this expression vector, can effectively identify the corn starch branching enzyme gene function, also can efficiently seal the expression of corn starch branching enzyme gene sbe IIa by transgenic technology, reduce the activity of corn starch branching enzyme, improve the corn amylose content, cultivate amylomaize or create new amylomaize germ plasm resource.
Description of drawings
Accompanying drawing is the pTSPsbe IIa-GFP plasmid sketch after making up.
Embodiment
A kind of corn starch branching enzyme gene siRNA expression carrier, utilize the multiple clone site on the expression vector pCAMBIA1301, corn starch branching enzyme seed-specific expression promoter gene is inserted Sph I, between two restriction enzyme sites of Sal I, corn starch branching enzyme gene SBE IIa antisense fragment is inserted above-mentioned promotor downstream Sal I, between the Sac I, behind excision Totomycin antibiotics resistance gene, the just fragment of corn starch branching enzyme gene SBE IIa is inserted into Sac I, between the Xho I, between Bgl II and two restriction enzyme sites of BstE II, insert green fluorescence protein gene GFP.
The construction process of corn starch branching enzyme gene siRNA expression carrier:
One, corn clone starch branch enzyme gene sbe IIa fragment
(1) the segmental pcr amplification of starch branch enzyme gene
The extraction of RNA: use TRIzoL test kit (Puli's lema gene technology company limited) to extract total RNA, carry out reverse transcription then and become cDNA from maize leaf and seed.
The reverse transcription reaction system: in the reaction system of 20 μ L, total RNA9.5 μ L, 5 * damping fluid, 4.0 μ L, d NTP (10mM) 2.0 μ L, RNA enzyme inhibitors 0.5 μ L, primer (100pmol/ μ L) 2.0 μ L, ThermoScript II 2.0 μ L.(mentioned reagent is all purchased the company in TaKaRa)
Design of primers: according to GenBank reported sequence (U65948), adopt two pairs of primers of DNAMAN software design, utilize PCR method corn clone starch branch enzyme gene (sbe IIa) fragment (562bp).Primer sequence is as follows:
5′CGTGT?AAAGA?TACGG?ATGGA?C3′
5′ATAGG?CGAGA?ATCCC?ACAT?3′
The PCR reaction system: in the reaction system of 50 μ L, 10 * damping fluid, 5.0 μ L (TaKaRa company), dNTP4.0 μ L (TaKaRa company), each 50pmol/L of primer (the biological company limited in match Parkson), template 0.1 μ g, Taq enzyme 0.3 μ L (TaKaRa company) is with ddH
2O supplies 50 μ L.
The pcr amplification condition: 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 73 ℃ are extended 90s, 35 circulations, last 72 ℃ are extended 10min.
(2) the segmental clone of starch branch enzyme gene, screening and evaluation
The electrophoresis of amplified production is identified: pcr amplification product is through 1% agarose gel electrophoresis.Obtain about 560bp size, high specificity, single amplified band.
The recovery of target DNA fragment: reclaim test kit (V-Gene company) by the dna fragmentation gel and carry out through the method for improvement.The dna fragmentation that reclaims is put-20 ℃ of refrigerators and is preserved.
Target DNA fragment is connected with cloning vector: the PCR product of recovery, the purpose fragment that wherein contains antisense or justice, with the concentration ratio of pMD18-T-vector with 3: 1, with damping fluid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant vectors: contain the pW1 of antisense target gene fragment and contain the pW2 of just target gene fragment.(pMD18-T-vector purchases the company in TaKaRa).
The conversion of recombinant vectors: the method by Maniatis prepares competent cell, will connect product transformed into escherichia coli DH5 α, and ice bath 30min does control tube simultaneously.With 42 ℃ of heat shock 90s, place 2min on ice.Every pipe adds 800 μ L LB liquid nutrient mediums, 37 ℃ of incubation 45min, 140rpm/min.Be coated in contain penbritin (100 μ g/mL), *-select overnight incubation (37 ℃) on the LB culture medium flat plate of gal (Beijing ancient cooking vessel state biotechnology limited liability company), IPTG (Beijing ancient cooking vessel state biotechnology limited liability company).Picking hickie alkaline lysis method of extracting plasmid is identified with digestion with restriction enzyme, obtains recombinant clone.
(3) the starch branch enzyme gene fragments sequence is analyzed
Precious biotech firm finishes by Dalian, nucleic acid sequence analysis DNASIS software, and the sequence of 562bp is as described in the SEQ ID NO.1:
Two, the seed-specific expression promoter of clone's starch branch enzyme gene
Seed-specific expression promoter TSPsbe (934bp) sequence is as described in the SEQ ID NO.2:
Primer sequence is as follows:
Primer1：5′TCT?CTC?CAA?CCC?CTT?CAA?TC?3′；
Primer2：5′GAC?CGC?AAG?AGC?GAA?ATC?3′；
Biological company limited is synthetic by the match Parkson, and this promotor is preserved by this laboratory clone.
Three, clone's green fluorescence protein gene
Go up directly amplification from the p1300 plasmid of transforming (p1300-GFP), and obtain cloning vector (pW3).Plasmid p1300-GFP is preserved by this laboratory.
The green fluorescent protein sequence is as described in the SEQ ID NO.3:
Primer sequence is as follows:
Primer1：5′ATGGTGAGCAAGGGCGAGGAGC3′
Primer2：5′TTACTTGTACAGCTCGTCCATGCCGAGA3′
Biological company limited is synthetic by the match Parkson.
Four, make up the siRNA expression vector
(1) the purpose fragment is connected with the reverse of expression vector:
The cloned plasmids (pW1) and the expression plasmid pCAMBIA1301 that will contain the antisense target gene fragment carry out double digestion with Sac I, Xho I respectively, the electrophoretic separation endonuclease bamhi, reclaim the big fragment of target gene fragment and carrier respectively, then with 3: 1 concentration ratio, add and connect liquid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant plasmid (pAsbeIIa).This pCAMBIA1301 plasmid is preserved by this laboratory.
(2) recombinant plasmid pAsbe IIa is connected with the forward purpose is segmental:
Above-mentioned recombinant plasmid is cut the big fragment of carrier of separating through Sal I, Sac I enzyme; Cloned plasmids (pW2) is cut through Sal I and Sac I enzyme, separates target gene fragment, uses T
4Dna ligase is connected on the recombinant plasmid (pAsbe IIa), gets antisense+just segmental expression plasmid pA-Ssbe IIa.
(3) being connected of seed-specific expression promoter and expression vector pA-Ssbe IIa:
The pCAMBIA1301 plasmid is cut with Sph I, Sal I enzyme, inserted seed-specific expression promoter, obtain pTSPsbe IIa.
(4) replacement of green fluorescent protein GFP and gus gene:
Clone's the recombinant plasmid (pW3) of green fluorescence protein gene is carried out double digestion with Bgl II and BstE II, be connected, obtain final expression plasmid pTSPsbe IIa-GFP with the pTSPsbe IIa carrier of same double digestion.This expression vector is exactly corn starch branching enzyme gene (sbe IIa) the siRNA expression vector that makes up.
(5) conversion of expression vector:
In recombinant plasmid transformed escherichia coli DH5a competent cell, filter out 3 recombinant clones.Cut evaluation by restriction enzyme Sac I and Sal I enzyme, obtain the special band of a treaty 560bp, electrophoretogram shows that the purpose fragment is inserted into the seed-specific expression promoter downstream of plant expression vector pCAMBIA1301 really, has successfully made up the expression vector pTSPsbe IIa-GFP of siRNA.
Application Example:
Use corn starch branching enzyme gene (sbe IIa) siRNA expression vector and cultivate the amylomaize self-mating system.Utilize pollen-tube pathway method corn starch branching enzyme gene (sbe IIa) siRNA expression vector.Change corn inbred line 7922 over to, cultivate the amylomaize self-mating system.
1, the extraction and the purifying of expression plasmid (pTSPsbe IIa-GFP)
Adopt " alkaline lysis " (in a large number) of improvement to extract expression plasmid (pTSPsbe IIa-GFP).Plasmid DNA after the extraction adopts PEG precipitation classification purifying.Detect the concentration and the purity of plasmid DNA with ultraviolet absorption method.Concentration is 1mg/ml; Purity is OD260/280=1.82; OD260/230=2.1.Place refrigerator stand-by.
2, the plantation of acceptor self-mating system Mo17
The planting seed of acceptor self-mating system 7922 in the experimental plot, according to the general method management, is cultivated into strain.
3, selection of acceptor plant and bagging selfing
Behind recipient plant self-pollination 8h, cut style, DNA is imported drop in otch, bagging drips behind the 1h 1 time again rapidly.Compare by same processing with the equivalent SSC solution that does not contain DNA simultaneously.The date and time of record pollination.
4, management and the results after the importing
Make regular check on the intact situation that imports the fruit ear paper bag,, eliminate immediately as finding early damage.When treating that corn ear is ripe, fruit ear is gathered in the crops respectively, is dried by importing, threshing.
5, the screening of transformation generation and evaluation
(1) Southern of transfer-gen plant hybridization detects
PCR-Southern hybridization positive plant is carried out Southern hybridization to be detected.Get genomic dna through Sph I and Sal I enzymic digestion, behind the DIG mark, carry out Southern hybridization as probe with the pcr amplified fragment (934bp) of plasmid TSPsbe promotor.
(2) Northern of transfer-gen plant hybridization detects
Southern hybridization positive plant is carried out Northern hybridization to be detected.Utilize guanidine isothiocyanate method to extract total RNA of transfer-gen plant and contrast, RNA goes to nitrocellulose filter behind 1% formaldehyde-MOPS agarose gel electrophoresis, probe with the DIG mark is hybridized, and Northern hybridization and detection are undertaken by the test kit explanation of Roche company.
(3) the active detection of the Q-enzyme of transfer-gen plant
Northern hybridization positive plant is carried out the active detection of Q-enzyme.Step is as follows:
At first, extract crude enzyme liquid.Get 5 of the back 20 days corn kernels of pollination, weigh, add 0.05mol/L citric acid solution (pH7.0), in ice bath, grind homogenate, centrifugal 20min under 18000rpm/min then, supernatant liquor is crude enzyme liquid.
Then, measure the Q-enzyme activity.Get 1mL crude enzyme liquid+1mL 0.2mol/L citrate buffer solution (pH7.0)+0.5mL 0.1mol/L EDTA (vibration, make the α-Dian Fenmei inactivation)+0.5mL 0.75% Zulkovsky starch, shake up, in 37 ℃ of water-baths, be incubated 40min and (add 10%TCA 4mL termination reaction, the centrifugal 8min of 3000rpm), add 0.3mL iodine liquid colour developing, behind the 10min at 660nm place photometry density value (O.D), be contrast with zero the time, the Q-enzyme activity is represented with the percentage that O.D660% descends:
Δ O.D660=when O.D660t (during O.D660 zero-)/O.D660 zero time * 100%
The result shows that the branching enzyme activity of transgenic corns significantly decreases compared with the control, has reduced by 88%, 79%, 86%, 72% and 69% respectively.The siRNA expression system that structure is described has been expressed siRNA effectively, thereby has suppressed the translation of endogenous Q-enzyme mRNA, makes the active obviously reduction of Q-enzyme.
(4) detection of transfer-gen plant starch content
Amylose starch and amylopection content are measured the double wave regular way that adopts He Zhaofan (1985).With straight chain, amylopection content sum is total starch content.Method is as follows:
Get the transgenic corns ripe seed and pulverized 60 mesh sieves, use ether defatting, take by weighing that (being accurate to 1mg) adds 0.5mol/L KOH 10mL about degreasing sample 0.1g, in 35 ℃ of water-baths the vibration 15min or in boiling water bath 10min, take out, be settled to 50mL (adopting ethanol to eliminate) with distilled water, leave standstill if any foam.Draw two parts of sample liquid 2.5mL, be sample determination liquid and sample blank liquid, all add 20-30mL distilled water, transfer about pH to 3.5 with 0.1mol/L HCl, in sample determination liquid, add iodine reagent 0.5mL, sample determination liquid and sample blank liquid are settled to 50mL, mixing (adopting ethanol to eliminate) if any foam, leave standstill 20min, with sample blank liquid is contrast, with 1cm or 2cm cuvette, measures optical density(OD) E λ 2, E λ 1, E λ 4, the E λ 3 of λ 2, λ 1, λ 4, λ 3 respectively, obtaining: Δ E is straight=E λ 2-E λ 1, Δ E props up=E λ 4-E λ 3.Look into the dual wavelength typical curve of two kinds of starch respectively, calculate the content of amylose starch and amylopectin in the degreasing sample.
The starch content measurement result of transfer-gen plant shows that total starch content does not change with contrast is basic, but the content of amylose starch is improved, and is up to 55%.
6, the cultivation of transformation generation
Conversion individual plant to the performance high amylose content carries out selfing purifying and economical character evaluation, cultivates into the corn inbred line of high amylose content.
＜110〉Jilin Agriculture University
＜120〉green fluorescence protein gene
<130>gsy200703
<160>3
<170>PatentIn?version?3.2
<210>1
<211>562
<212>DNA
＜213〉starch branch enzyme gene
<400>1
cgtgtaaaga?tacggatgga?cacaccatct?ggtgttaagg?attccattcc?tgcctggatc 60
aagttttctg?tgcaggctcc?aggtgaaata?ccatacaacg?gtatatatta?tgacccacct 120
gaagaggaga?aatatgtatt?caaacaccct?caacctaagc?ggcccaagtc?actgcggata 180
tatgaatcac?atgttggaat?gagtagcccg?gaaccaaaga?taaatacata?tgctaacttc 240
agagatgagg?tgcttccaag?aattaaaaag?cttggataca?atgcagtaca?gataatggca 300
atccaggaac?actcttatta?tgcaagcttt?gggtaccatg?ttacgaattt?ttttgcccca 360
agtagccgtt?ttgggactcc?agaggaccta?aaatctctta?ttgataaagc?gcatgagctt 420
ggcttgctag?tgcttatgga?tattgttcat?agtcattcat?caaataatac?cttggatggt 480
ttgaatggtt?tcgatggcac?cgatacacat?tacttccatg?gtggtccacg?aggccatcat 540
tggatgtggg?attctcgcct?at 562
<210>2
<211>959
<212>DNA
＜213〉seed-specific expression promoter
<400>2
tctctccaac?cccttcaatc?tcgaagggga?tttgagtttc?caaactagat?cctaaaagca 60
agtataataa?ggtgatgtag?gcgagctgta?ggatataaca?catcagattt?gtgatgatat 120
gaaagaaaaa?aatgaagaga?gaatgaaagc?ggactgttgc?tcacggactc?taagatataa 180
tacaagagga?agagatgagc?taagtattaa?acgtataaat?atatttttag?ttagttatat 240
gtgataggac?aatatcataa?aactcacttt?gtgccatatc?gttaaacttg?ctgtagcttc 300
accgttaatc?gataaaaaat?attaaaaaag?catctcccgt?ttgctcgact?gctcgagtgt 360
gcaaaaaaaa?aaaaaaggca?cgacggaccc?gcgcgctgac?gcggtgagcc?gcaagtccgc 420
aacggcgcgg?ccgcgcgcta?ggaaaaaagc?ctcgcccgtg?aagcgaactc?cctctccttc 480
gaccttcgtt?cttccactgc?ggcctgcgcg?acccgtgcag?ctgcgcgctc?cacctggccg 540
cgcctggggc?ccacaccgcc?tggcatctgg?agcattgccc?ccggacttcg?cgcggccgcc 600
cgcagccccg?ctccccaccg?aaaagcgaag?cgcgattgcc?atccccacgc?caccgcgaag 660
cacaaggtcc?ccgccctgca?cgatcagcag?gacctcgcca?cgccgccgct?ggagctgcgc 720
gtgcgcgtgt?gcgcttggac?cgacgcgcaa?cggcctgcct?cgaccgcccg?tgcacgccac 780
tgctcatgca?gccgtccgcc?tcgcccccgc?cccgaactgc?cgaggtcgcg?tgaacgccca 840
ctcccctcac?cgctcgtctc?cgtgctatat?aggcagcccg?cgcccctcct?aattgtagcc 900
ctgcagtcac?ccagagcaga?cccggatttc?gctcttgcgg?tcaatctcta?gaggatccc 959
<210>3
<211>701
<212>DNA
＜213〉green fluorescence protein gene
<400>3
atggtgagca?agggcgagga?gctgttcacc?ggggtggtgc?ccatcctggt?cgagctggac 60
ggcgacgtaa?acggccacaa?gttcagcgtg?tccggcgagg?gcgagggcga?tgccacctac 120
ggcaagctga?ccctgaagtt?catctgcacc?accggcaagc?tgcccgtgcc?ctggcccacc 180
ctcgtgacca?ccttcggcta?cggcctgcag?tgcttcgccc?gctaccccga?ccacatgaag 240
cagcacgact?tcttcaagtc?cgccatgccc?gaaggctacg?tccaggagcg?caccatcttc 300
ttcaaggacg?acggcaacta?caagacccgc?gccgaggtga?agttcgaggg?cgacaccctg 360
gtgaaccgca?tcgagctgaa?gggcatcgac?ttcaaggagg?acggcaacat?cctggggcac 420
aagctggagt?acaactacaa?cagccacaac?gtctatatca?tggccgacaa?gcagaagaac 480
ggcatcaagg?tgaacttcaa?gatccgccac?aacatcgagg?acggcagcgt?gcagctcgcc 540
gaccactacc?agcagaacac?ccccatcggc?gacggccccg?tgctgctgcc?taccagtccg 600
ccctgagcaa?agaccccaac?gagaagcgcg?atcacatggt?cctgctggag?ttcgtgaccg 660
ccgccgggat?cactctcggc?atggacgagc?tgtacaagta?a 701
Claims (6)
1, a kind of corn starch branching enzyme gene siRNA expression carrier, it is characterized in that: utilize the multiple clone site on the expression vector pCAMBIA1301, corn starch branching enzyme seed-specific expression promoter gene is inserted Sph I, between two restriction enzyme sites of Sal I, corn starch branching enzyme gene SBE IIa antisense fragment is inserted above-mentioned promotor downstream Sal I, between the Sac I, behind excision Totomycin antibiotics resistance gene, the just fragment of corn starch branching enzyme gene SBE IIa is inserted into Sac I, between the Xho I, between Bgl II and two restriction enzyme sites of BstE II, insert green fluorescence protein gene GFP.
2, corn starch branching enzyme gene siRNA expression carrier according to claim 1 is characterized in that: the fragment sequence of corn starch branching enzyme gene is as described in the SEQ ID NO.1.
3, corn starch branching enzyme gene siRNA expression carrier according to claim 1 is characterized in that: corn starch branching enzyme seed-specific expression promoter gene order is as described in the SEQ ID NO.2.
4, corn starch branching enzyme gene siRNA expression carrier according to claim 1 is characterized in that: green fluorescence protein gene GFP sequence is as described in the SEQ ID NO.3.
5, the construction process of corn starch branching enzyme gene siRNA expression carrier as claimed in claim 1 comprises the following steps:
One, corn clone starch branch enzyme gene sbe IIa fragment
(1) the segmental pcr amplification of starch branch enzyme gene
The extraction of RNA: use the TRIzoL test kit to extract total RNA, carry out reverse transcription then and become cDNA from maize leaf and seed;
The reverse transcription reaction system: in the reaction system of 20 μ L, total RNA9.5 μ L, 5 * damping fluid, 4.0 μ L, d NTP (10mM) 2.0 μ L, RNA enzyme inhibitors 0.5 μ L, primer (100pmol/ μ L) 2.0 μ L, ThermoScript II 2.0 μ L,
Design of primers: according to GenBank reported sequence (U65948), adopt two pairs of primers of DNAMAN software design, utilize PCR method corn clone starch branch enzyme gene (sbe IIa) fragment (562bp); Primer sequence is as follows:
5′CGTGT?AAAGA?TACGG?ATGGA?C3′
5′ATAGG?CGAGA?ATCCC?ACAT?3′
The PCR reaction system: in the reaction system of 50 μ L, 10 * damping fluid, 5.0 μ L, dNTP 4.0 μ L, each 50pmol/L of primer, template 0.1 μ g, Taq enzyme 0.3 μ L is with ddH
2O supplies 50 μ L;
The pcr amplification condition: 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, 56 ℃ of renaturation 30s, 73 ℃ are extended 90s, 35 circulations, last 72 ℃ are extended 10min;
(2) the segmental clone of starch branch enzyme gene, screening and evaluation
The electrophoresis of amplified production is identified: pcr amplification product is through 1% agarose gel electrophoresis; Obtain about 560bp size, high specificity, single amplified band;
The recovery of target DNA fragment: reclaim test kit by the dna fragmentation gel and carry out through the method for improvement; The dna fragmentation that reclaims is put-20 ℃ of refrigerators and is preserved;
Target DNA fragment is connected with cloning vector: the PCR product of recovery, the purpose fragment that wherein contains antisense or justice, with the concentration ratio of pMD18-T-vector with 3: 1, with damping fluid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant vectors: contain the pW1 of antisense target gene fragment and contain the pW2 of just target gene fragment;
The conversion of recombinant vectors: the method by Maniatis prepares competent cell, will connect product transformed into escherichia coli DH5 α, and ice bath 30min does control tube simultaneously; With 42 ℃ of heat shock 90s, place 2min on ice; Every pipe adds 800 μ L LB liquid nutrient mediums, 37 ℃ of incubation 45min, 140rpm/min.Be coated in contain penbritin (100 μ g/mL), *-select overnight incubation (37 ℃) on the LB culture medium flat plate of gal, IPTG; Picking hickie alkaline lysis method of extracting plasmid is identified with digestion with restriction enzyme, obtains recombinant clone;
(3) the starch branch enzyme gene fragments sequence is analyzed
Nucleic acid sequence analysis DNASIS software, the sequence of 562bp is as described in the SEQ ID NO.1:
Two, the seed-specific expression promoter of clone's starch branch enzyme gene
Seed-specific expression promoter TSPsbe (959bp) sequence is as described in the SEQ ID NO.2:
Primer sequence is as follows:
Primer1：5′TCT?CTC?CAA?CCC?CTT?CAA?TC?3′；
Primer2：5′GAC?CGC?AAG?AGC?GAA?ATC?3′；
Three, clone's green fluorescence protein gene
Go up directly from the p1300 plasmid of transforming (p1300-GFP) and to increase, and obtain cloning vector (pW3), the green fluorescent protein sequence is as described in the SEQ ID NO.3:
Primer sequence is as follows:
Primer1：5′ATGGTGAGCAAGGGCGAGGAGC3′
Primer2：5′TTACTTGTACAGCTCGTCCATGCCGAGA3′；
Four, make up the siRNA expression vector
(1) the purpose fragment is connected with the reverse of expression vector:
The cloned plasmids (pW1) and the expression plasmid pCAMBIA1301 that will contain the antisense target gene fragment carry out double digestion with Sal I, Sac I respectively, the electrophoretic separation endonuclease bamhi, reclaim the big fragment of target gene fragment and carrier respectively, then with 3: 1 concentration ratio, add and connect liquid 4.0 μ L mixings, 16 ℃ of reactions are spent the night, and obtain recombinant plasmid (pAsbe IIa);
(2) recombinant plasmid pAsbe IIa is connected with the forward purpose is segmental:
Above-mentioned recombinant plasmid is cut the big fragment of carrier of separating through Sac I, Xho I enzyme; Cloned plasmids (pW2) is cut through Sac I and Xho I enzyme, separates target gene fragment, uses T
4Dna ligase is connected on the recombinant plasmid (pAsbeIIa), gets antisense+just segmental expression plasmid pA-Ssbe IIa;
(3) being connected of seed-specific expression promoter and expression vector pA-Ssbe IIa:
The pCAMBIA1301 plasmid is cut with Sph I, Sal I enzyme, inserted seed-specific expression promoter, obtain pTSPsbe IIa;
(4) replacement of green fluorescent protein GFP and gus gene:
Clone's the recombinant plasmid (pW3) of green fluorescence protein gene is carried out double digestion with Bgl II and BstE II, be connected, obtain final expression plasmid pTSPsbeIIa-GFP with the pTSPsbe IIa carrier of same double digestion.This expression vector is exactly corn starch branching enzyme gene (sbe IIa) the siRNA expression vector that makes up;
(5) conversion of expression vector:
In recombinant plasmid transformed bacillus coli DH 5 alpha competent cell, filter out 3 recombinant clones; Cut evaluation by restriction enzyme Sac I and Sal I enzyme, obtain the special band of a treaty 560bp, successfully made up the expression vector pTSPsbe IIa-GFP of siRNA.
6, the application of corn starch branching enzyme gene siRNA expression carrier as claimed in claim 1 in cultivating the amylomaize self-mating system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100552971A CN101029314B (en) | 2007-02-02 | 2007-02-02 | Corn starch branching enzyme gene sirna expression carrier |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100552971A CN101029314B (en) | 2007-02-02 | 2007-02-02 | Corn starch branching enzyme gene sirna expression carrier |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101029314A true CN101029314A (en) | 2007-09-05 |
| CN101029314B CN101029314B (en) | 2010-12-01 |
Family
ID=38714864
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100552971A Expired - Fee Related CN101029314B (en) | 2007-02-02 | 2007-02-02 | Corn starch branching enzyme gene sirna expression carrier |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101029314B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101260408B (en) * | 2008-03-27 | 2010-12-22 | 武汉大学 | Construction method and application of two-color fluorescence report carrier |
| CN102212523A (en) * | 2011-05-19 | 2011-10-12 | 中国农业大学 | DNA molecule for expressing hairpin RNA for inhibiting wheat starch branching enzyme IIa (SBEIIa) and application thereof |
| CN111363750A (en) * | 2020-03-20 | 2020-07-03 | 中国农业大学 | Cucumber nitrate transport protein NPF7.2 gene, protein and expression method |
| CN113151318A (en) * | 2021-03-17 | 2021-07-23 | 云南中烟工业有限责任公司 | Tobacco starch branching enzyme gene NtGBE1 and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU1684697A (en) * | 1995-12-20 | 1997-07-14 | E.I. Du Pont De Nemours And Company | Novel starches via modification of expression of starch biosynthetic enzyme genes |
| AUPS219802A0 (en) * | 2002-05-09 | 2002-06-06 | Commonwealth Scientific And Industrial Research Organisation | Barley with altered branching enzyme activity and starch and starch containing products with a reduced amylopectin content |
| CN1886507B (en) * | 2003-10-27 | 2010-12-29 | 联邦科技产业研究组织 | Rice and products thereof having starch with an increased proportion of amylose |
| CN1301328C (en) * | 2004-11-08 | 2007-02-21 | 安徽农业大学 | Method of improving cereal crop seed starch quality using transgene |
-
2007
- 2007-02-02 CN CN2007100552971A patent/CN101029314B/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101260408B (en) * | 2008-03-27 | 2010-12-22 | 武汉大学 | Construction method and application of two-color fluorescence report carrier |
| CN102212523A (en) * | 2011-05-19 | 2011-10-12 | 中国农业大学 | DNA molecule for expressing hairpin RNA for inhibiting wheat starch branching enzyme IIa (SBEIIa) and application thereof |
| CN102212523B (en) * | 2011-05-19 | 2012-08-22 | 中国农业大学 | DNA molecule for expressing hairpin RNA for inhibiting wheat starch branching enzyme IIa (SBEIIa) and application thereof |
| CN111363750A (en) * | 2020-03-20 | 2020-07-03 | 中国农业大学 | Cucumber nitrate transport protein NPF7.2 gene, protein and expression method |
| CN113151318A (en) * | 2021-03-17 | 2021-07-23 | 云南中烟工业有限责任公司 | Tobacco starch branching enzyme gene NtGBE1 and application thereof |
| CN113151318B (en) * | 2021-03-17 | 2022-08-16 | 云南中烟工业有限责任公司 | Tobacco starch branching enzyme gene NtGBE1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101029314B (en) | 2010-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6889301B2 (en) | Plant control elements and their use | |
| CN1886507A (en) | Rice and products thereof having starch with an increased proportion of amylose | |
| CN1310760A (en) | Methods and compositions for expression of transgenes in plants | |
| CN1316005A (en) | Nucleic acid molecule coding for beta-amylase, plants synthesizing modified starch, method of production and applications | |
| CN101029314A (en) | Corn starch branching enzyme gene siRNA expression carrier | |
| Guan et al. | Production of high-amylose maize lines using RNA interference in sbe2a | |
| CN101063139A (en) | Seed specificity highly effective promoter and its application | |
| JP2022089861A (en) | Plant regulatory elements and methods of use thereof | |
| CN101056983A (en) | Promoter molecules for use in plants | |
| CN1671739A (en) | Corn root preferential promoters and uses thereof | |
| CN103981216A (en) | Backbone plasmid vector and application thereof | |
| CN1887903A (en) | Nitrate transport protein of diatom and its coding gene and application | |
| CN1309835C (en) | Plant selectable marker and plant transformation method | |
| Zhao et al. | Influence of cellulase gene expression and cellulolytic activity on cellulose utilization in different Volvariella volvacea strains | |
| CN1715407A (en) | Method for increasing short mosaic disease resistance of corn and its special interference RNA | |
| CN105111295A (en) | Cultivation method of genetically modified WMYB-R wheat resistant to root rot and sheath blight and related biological material thereof | |
| CN1782074A (en) | Method for amplifying rice T-DNA insertion site flanking sequence | |
| CN1821395A (en) | Rice mitogen-activated protein kinase and its coded gene and use | |
| CN101050462A (en) | Induction gene lack of phosphor from Arabidopsis thaliana, coded protein, and application | |
| CN1793371A (en) | APDHI sequence of DNA unwindase gene of kender and its clone and applciation thereof | |
| Wang et al. | Construction of the SHP-GLOX lignin regulation system and its application in rice straw | |
| CN1537861A (en) | Seed specific promoter sequence separated from soya bean and its application | |
| CN105647928B (en) | Potato stu-miR5992a and stu-miR5992b and its application | |
| CN1285721C (en) | Gibberella gene engineering bacterium and its preparation and application | |
| CN1814803A (en) | Bean anthrax bacteria detecting kit and its detecting method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101201 Termination date: 20140202 |