CN100580082C - Lyophylization preparation of recombinant staphylokinase, its preparing method and application - Google Patents
Lyophylization preparation of recombinant staphylokinase, its preparing method and application Download PDFInfo
- Publication number
- CN100580082C CN100580082C CN03119315A CN03119315A CN100580082C CN 100580082 C CN100580082 C CN 100580082C CN 03119315 A CN03119315 A CN 03119315A CN 03119315 A CN03119315 A CN 03119315A CN 100580082 C CN100580082 C CN 100580082C
- Authority
- CN
- China
- Prior art keywords
- lys
- glu
- aaa
- val
- gaa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Abstract
A freeze-dried preparation of recombinant glucokinase in the form free dried powder, injection, lipoplasm, or microcapsule for thrombolytic purpose contains the glucokinase with mutation of amino acids at positions 7, 3 and 43, and one or more of mannitol, phosphate, EDTA and sodium chloride. Its preparing process is also disclosed.
Description
Technical field
The present invention relates to a kind of recombinant staphylokinase freeze-dried preparation, its preparation method and, belong to biological pharmacy technical field as the application of thrombolytic drug.
Background technology
Cardiovascular and cerebrovascular diseases is first killer who endangers people ' s health at present, wherein thrombotic diseases such as Acute Myocardial Infarction be the main diseases that causes patient death because of.Though still there are a lot of problem demanding prompt solutions at present existing clinically commercially available thrombolytic drugs at aspects such as the specificity of its thrombolysis effect, thrombolysis and drug prices.Staphylokinase (Staphylokinase, be called for short SAK) be a kind of protein that produces by streptococcus aureus, molecular weight is 15.5KD, it can combine specifically with Profibrinolysin, form mixture, plasminogen activation makes it to become plasmin, thereby fibrin degradation specifically makes thrombolysis.According to the foreign literature report, the thrombolysis effect of staphylokinase is better than streptokinase and urokinase etc., and is suitable with tissue-type plasminogen activator (t-PA) at least, and side effect is littler, is the most promising a kind of thrombolysis candidate medicine.
Summary of the invention
The object of the present invention is to provide a kind of recombinant staphylokinase of on 7,36,43 amino acids, finishing sudden change, and combine the preparation freeze-dried preparation, use clinically as thrombolytic drug with additive such as N.F,USP MANNITOL.
Technical scheme of the present invention is achieved in that this recombinant staphylokinase freeze-dried preparation, it is characterized in that comprising in the preparation nucleotide sequence and the amino acid sequence coded of following recombinant staphylokinase isolated genes:
TCA?AGT?TCA?TTC?GAC?AAA?GCA?AAA?TAT?AAA?AAA?GGC?GAT?GAC?GCG?AGT?TAT?TTT?GAA?CCA?ACA?GGC
Ser?Ser?Ser?Phe?Asp?Lys?Ala?Lys?Tyr?Lys?Lys?Gly?Asp?Asp?Ala?Ser?Tyr?Phe?Glu?Pro?Thr?Gly
CCG?TAT?TTG?ATG?GTA?AAT?GTG?ACT?GGA?GTT?GAT?GGT?AAA?GGA?AAT?GAA?TTG?CTA?TCC?CCT?CGT?TAT
Pro?Tyr?Leu?Met?Val?Asn?Val?Thr?Gly?Val?Asp?Gly?Lys?Gly?Asn?Glu?Leu?Leu?Ser?Pro?Arg?Tyr
GTC?GAG?TTT?CCT?ATT?AAA?CCT?GGG?ACT?ACA?CTT?ACA?AAA?GAA?AAA?ATT?GAA?TAC?TAT?GTC?GAA?TGG?GCA
Val?Glu?Phe?Pro?Ile?Lys?Pro?Gly?Thr?Thr?Leu?Thr?Lys?Glu?Lys?Ile?Glu?Tyr?Tyr?Val?Glu?Trp?Ala
TTA?GAT?GCG?ACA?GCA?TAT?AAA?GAG?TTT?AGA?GTA?GTT?GAA?TTA?GAT?CCA?AGC?GCA?AAG?ATC?GAA?GTC?ACT
Leu?Asp?Ala?Thr?Ala?Tyr?Lys?Glu?Phe?Arg?Val?Val?Glu?Leu?Asp?Pro?Ser?Ala?Lys?Ile?Glu?Val?Thr
TAT?TAT?GAT?AAG?AAT?AAG?AAA?AAA?GAA?GAA?ACG?AAG?TCT?TTC?CCT?ATA?ACA?GAA?AAA?GGT?TTT?GTT?GTC
Tyr?Tyr?Asp?Lys?Asn?Lys?Lys?Lys?Glu?Glu?Thr?Lys?Ser?Phe?Pro?Ile?Thr?Glu?Lys?Gly?Phe?Val?Val
CCA?GAT?TTA?TCA?GAG?CAT?ATT?AAA?AAC?CCT?GGA?TTC?AAC?TTA?ATT?ACA?AAG?GTT?GTT?ATA?GAA?AAG?AAA
Pro?Asp?Leu?Ser?Glu?His?Ile?Lys?Asn?Pro?Gly?Phe?Asn?Leu?Ile?Thr?Lys?Val?Val?Ile?Glu?Lys?Lys
TAA，
＊＊＊，
Recombination sequence length is 411 bases, and it is codon GCA, 106-108 base codon GGA that recombination sequence is characterized as 19-21 base; The 127-129 base is codon CGT, and corresponding amino acid is Ala, Gly and Arg.
Also comprise in the described recombinant staphylokinase freeze-dried preparation excipient N.F,USP MANNITOL, buffer reagent phosphoric acid salt, EDTA, permeate agent sodium-chlor wherein one or more.
The proportion of composing of described recombinant staphylokinase freeze-dried preparation is: recombinant staphylokinase 10mg, N.F,USP MANNITOL 15mg, Sodium phosphate dibasic 3.4mg, SODIUM PHOSPHATE, MONOBASIC 0.63mg, EDTA 1.0mg, sodium-chlor 8.5mg.
The preparation method of recombinant staphylokinase freeze-dried preparation of the present invention comprises
(1), the structure of recombinant staphylokinase engineering bacteria:
Select the streptococcus aureus strain to carry out the separation of chromosomal DNA, primer is:
F
SAK：5’GGAATTCATATGTCAAGTTCATTCGACAA?3’
R
SAK：5’CGGGATCCTTATTTCTTTTCTATAACAACC?3’
With above-mentioned chromosomal DNA is that template is carried out pcr amplification; Use pBV220 to be expression vector, the e. coli bl21 strain is the host bacterium, utilize the glucokinase gene of restriction enzyme EcoRI and BamHIPCR reaction amplification, simultaneously with identical enzymic digestion expression vector pBV220, electrophoresis reclaims, carrier is connected with gene, Transformed E .coli BL21 competent cell, the picking transformed clone is inoculated in the LB substratum that contains penbritin, the concussion overnight incubation, the plasmid DNA of extraction transformant utilizes EcoRI and BamHI enzyme to cut, enzyme is cut the product reaction product carry out the agarose gel electrophoresis analysis, the recombinant plasmid that filters out the glucokinase gene insertion is as engineering strain;
(2), fermentation
The clone strain that will contain recombinant plasmid is inoculated in the LB substratum that contains penbritin, 30 ℃ of concussion overnight incubation, as primary seed solution; Be inoculated in the concentration of 0.1-0.5% and contain in the penbritin LB substratum, 30 ℃ of concussion overnight incubation are as fermentation seed liquid; Again with LB as nutrient solution, inoculation 5-6% fermentation seed liquid carries out jar to be cultivated, mixing speed 300rpm, air flow 0.8-1.0vvm, oxygen dissolving value generally by the initial reduction gradually of fermentation, get OD
600Induce program to start heating up between the 3-3.5, wait to be warming up to 42 ℃ induce beginning after, portion-wise addition glucose by regulating stirring velocity, remains on more than 40% the DO value to supplement the nutrients, and induces after 5 hours and receives bacterium; The phosphate buffered saline buffer of zymophyte at pH7.6 suspended, under condition of ice bath, ultrasonication;
(3), purifying
The phosphate buffered saline buffer of zymophyte at pH7.6 suspended, under condition of ice bath, ultrasonication; Anion-exchange chromatography post damping fluid balance is passed the anion-exchange chromatography post with the supernatant liquor after the fragmentation, collects and passes the peak; Again the protein liquid of collecting being transferred pH with the 0.1N dilute phosphoric acid is 6.20, Zhiyang ion chromatography column purification, the recombinant staphylokinase protein molecular is adsorbed on the column packing, earlier with the flushing of pH6.20 damping fluid, remove unconjugated albumen, then, with the phosphoric acid salt EDTA pH6.20 buffer solution elution that contains NaCl, collect elution peak; Through S200 gel permeation chromatography purifying, collect elution peak again;
(4), preparation
With containing 0.1mol/L sodium-chlor, 20mmol/L phosphate buffered saline buffer (pH7.4), the solvent of the EDTA of 2mmol/L is diluted to 8.0mg/ml with recombinant staphylokinase, filtering with microporous membrane degerming with 0.22 μ m, adding stablizer and vehicle are 1.5% N.F,USP MANNITOL (weight percent), recombinant staphylokinase is sub-packed in the 10mg/ bottle in the cillin bottle of handling, carries out lyophilize then.
Streptococcus aureus described in preparation method's step (1) of described recombinant staphylokinase is selected good strains in the field for seed and is selected as 1697 strains.
Pcr amplification reaction condition described in preparation method's step (1) of described recombinant staphylokinase be 94 ℃ 40 seconds, 54 ℃ 40 seconds, 72 ℃ 2 minutes, carry out 30 circulations altogether, last circulation was extended 5 minutes for 72 ℃.
Ultrasonication bacterium described in preparation method's step (3) of described recombinant staphylokinase is adopted intermittently broken and remains in the ice bath and carries out, and each 30 seconds, 30 seconds at interval.
Recombinant staphylokinase freeze-dried preparation of the present invention can be made into freeze drying powder preparations form, vein and intramuscular injection pharmaceutical solutions form, Liposomal formulation form, the microcapsule formulation form of thrombolysis clinically as the application of thrombolytic drug.
Recombinant staphylokinase freeze-dried preparation clinical test results of the present invention is analyzed: the thrombolysis potentiality of staphylokinase are estimated in the patient who suffers from AMI and peripheral arterial infraction.In two small-sized pilot scale researches, 10 patients with the coronary artery infraction that vasography confirms give 10mg recombinant staphylokinase through vein, promptly injected 1mg medicine group earlier at 30 minutes, transfusion gives 9mg again, use with acetylsalicylic acid and combination with heparin simultaneously, it is logical fully again to obtain coronary artery in eight patients, and a personal sector is logical again, again perfusion
Postpone to be about 20 minutes.Fibrinogen, plasminogen and α
2The blood plasma level of-antiplasmin remains unchanged, and proves that staphylokinase has the fibrin-specific of height in vivo.In addition, at 13
Among the patient of saturating wall (transmural) myocardial infarction, carried out a bolus contrast agent staphylokinase, with the pilot scale research of acetylsalicylic acid and intravenous injection heparin.First patient has the big area anterior wall infarction, adopts two medicines to roll into a ball the 20mg staphylokinase twice, treatment in 15 minutes at interval, and the result has produced the intracerebral hemorrhage that the non-lethality moderate disables.Therefore, all the other 12 patients have given corresponding medicine and have rolled into a ball injection under the vasography monitoring.The 20mg staphylokinase was injected in 5 minutes and is finished during beginning, and in the expert vasography monitoring of 60 fens clock times thrombolysis process, as the logical again 10mg that then do not append entirely of infraction related arteries, 7 examples (58%) obtain fully again 60 minutes the time logical after administration as a result.All the other 5 examples give second dosage (10mg/5 minute), and the result is three people total reflux in the time of 90 minutes wherein, and total recurrence rate reached 83% in the time of 90 minutes.On the basis of these clinical trials, in 102 routine patients, carried out two medicine staphylokinase 15mg of group administration in 30 minutes (50 routine patient) at interval, to the comparative studies of preposition (front loaded) rt-PA (52 routine patient).As a result, after administration, obtained total reflux 90 minutes the time with staphylokinase treatment patient's 68% and rt-PA treatment patient's 57%.Staphylokinase be scleroproein optionally, and do not cause transformation reactions, but two week of most patient the back produce neutralizing antibodies.The clinical study of these pilot scales shows that it is optionally thrombolytics of the rapid also tool high fiber albumen of a kind of brute force the acute myocardial infarction patient that intravenously gives staphylokinase.Compare with the relevant thrombolysis medicine of present clinical application, staphylokinase has the following advantages: can avoid the activation of general Profibrinolysin; Can not cause that the general blood coagulation system is malfunctioning, reduces hemorrhage syndrome.
26S Proteasome Structure and Function specificity analysis from staphylokinase, because itself is exactly a kind of former nucleoprotein, there are not problems such as processing behind the protein expression and modification, and there is not disulfide linkage to exist with interchain in the molecular chain, this makes that utilizing genetic engineering technique to produce in enormous quantities becomes possibility, thereby can reduce production costs greatly.In recent years, the development of DNA reorganization equimolecular biology techniques utilizes genetically engineered to carry out the means that bio-pharmaceuticals has been ripe and widespread use at present rapidly.
Embodiment
Describe technology contents of the present invention in detail below in conjunction with embodiment:
(1), the structure of recombinant staphylokinase engineering bacteria:
The present invention selects to adopt staphylococcus aureus 1697 (taking from DSMZ of Microbe Inst., Chinese Academy of Sciences) to carry out the separation of chromosomal DNA, the preservation bacterium liquid of getting 1697 strains of 0.5ml streptococcus aureus is inoculated in the 100ml LB substratum, 37 ℃ of concussion overnight incubation, 7000rpm4 ℃ of centrifugal 8 minutes collection thalline, wash thalline once with 20ml TE, the resuspended thalline of 20ml TE, add 120 μ l Proteinase K mixings, the SDS that adds 2.2ml 10% mix with, 37 ℃ of temperature were bathed 1 hour, once (put upside down mixing 1 minute) with isopyknic phenol extracting, with the 3M NaAc (pH5.2) of 0.1 volume, isopyknic Virahol precipitates 2 hours, 12000rpm4 ℃ centrifugal 10 minutes, get precipitation, wash once, be dissolved in the 200 μ l distilled waters with 75% ethanol, get 2 μ l samples and carry out 1% agarose gel electrophoresis, get its OD of an amount of detection simultaneously
260And OD
280, measure its purity and concentration.
Glucokinase gene separates: according to the primer design principle, designed a pair of Oligonucleolide primers, introduced the EcoRI restriction enzyme site, introduced the BamHI restriction enzyme site at 3 ' end at 5 of primer ' end, and regulated distance and based composition between SD sequence and the initiator codon, sequence is:
F
SAK：5’GGAATTCATATGTCAAGTTCATTCGACAA?3’
R
SAK：5’CGGGATCCTTATTTCTTTTCTATAACAACC?3’
Pcr amplification reaction: with above-mentioned chromosomal DNA is template, carries out pcr amplification, and reaction process is: 94 ℃ 40 seconds, 54 ℃ 40 seconds, 72 ℃ 2 minutes, carry out 30 circulations altogether, last circulation was extended 5 minutes for 72 ℃, got amplified production 5 μ l and carried out agarose gel electrophoresis.
The evaluation of glucokinase gene (dna sequence analysis): the distilled water that utilizes sterilization is with one times of PCR product dilution, utilize again that phenol/the chloroform extracting once, alcohol precipitation DNA, and be dissolved in the distilled water of sterilization, making up the order-checking plasmid, concrete grammar is: get an amount of PCR product and pBV220 carrier, respectively with EcoRI and BamHI double digestion, electrophoresis reclaims, and both mix according to a certain percentage, at T
4Connect under the effect of dna ligase, transformed into escherichia coli DH5 α competent cell, extract the plasmid DNA of transformant, analyze with EcoRI and BamHI double digestion, the row agarose gel electrophoresis of going forward side by side detects, and detected result shows have foreign DNA to insert in the recombinant clone, further extract its plasmid DNA, utilize pBV220 sequencing primer and automatic sequence analyser to carry out determined dna sequence.The nucleotide sequence of isolated genes and the aminoacid sequence of supposition are as mentioned above.Analytical results shows that the isolating gene order of the present invention is except that the discrete point mutation, and whole sequence is basic consistent with the SAK of bibliographical information, but because the sudden change of indivedual bases, thereby caused corresponding amino acid whose variation.
The structure of expression plasmid: the present invention uses pBV220 to be expression vector, the e. coli bl21 strain is the host bacterium, utilize the glucokinase gene of restriction enzyme EcoRI and BamHIPCR reaction amplification, simultaneously with identical enzymic digestion expression vector pBV220, electrophoresis reclaims, carrier is connected with gene, transformed into escherichia coli BL21 competent cell, the picking transformed clone is inoculated in the LB substratum that contains penbritin, the concussion overnight incubation, extract the plasmid DNA of transformant, utilize EcoRI and BamHI enzyme to cut, enzyme is cut the product reaction product carry out the agarose gel electrophoresis analysis, the recombinant plasmid that filters out the glucokinase gene insertion is as engineering strain;
(2), fermentative production
The seed preparation: the clone strain that will contain recombinant plasmid is inoculated in the LB substratum that contains penbritin, and 30 ℃ of concussion overnight incubation are as primary seed solution; Be inoculated in the concentration of 0.1-0.5% and contain in the penbritin LB substratum, 30 ℃ of concussion overnight incubation are as fermentation seed liquid; The cell of fermentation seed liquid should be in the logarithmic growth later stage, cell density OD
600Between 2.5-3.0, this moment, cell density was higher, energetic.
Fermentative production: as nutrient solution, inoculation 5-6% fermentation seed liquid carries out jar to be cultivated with LB, and mixing speed 300rpm, air flow 0.8-1.0vvm, oxygen dissolving value generally by 100% initial reduction gradually of fermentation, get OD
600Induce program to start heating up between the 3-3.5, wait to be warming up to 42 ℃ induce beginning after, portion-wise addition glucose is to supplement the nutrients, by regulating stirring velocity, the DO value is remained on more than 40%, induce the expression amount of target protein after 5 hours to reach the highest, therefore generally after inducing 5 hours, receive bacterium.Final OD ferments
600Value is generally between the 11.0-14.0, receives bacterium in centrifugal 15 minutes in 6000rpm below 4 ℃, and with 0.1mol/L NaCl, 20mmol/L phosphoric acid salt and edta buffer liquid (pH7.8) washing bacterial sediment twice claim wet bacterium weight with the zymophyte body and function, and-20 ℃ freezing standby;
(3), purifying
Excusing from death is broken: with zymophyte at phosphoric acid salt and edta buffer liquid (20mM phosphoric acid salt pH7.6,2mMEDTA) suspend, place ice bath, utilize the broken bacterium of Ultrasonic Cell Disruptor, in the shattering process, therefore owing to action of ultrasonic waves produces a large amount of heats, adopt intermittently broken method, and remain in the ice bath and carry out.Each 30 seconds, 30 seconds at interval, cause the albumen inactivation with the rising of anti-crushing liquid temp.Adding 10ml damping fluid ratio with the 1g bacterium is advisable.
Anion-exchange chromatography purifying: anion-exchange chromatography post (O Sepharose FF) the phosphoric acid salt edta buffer liquid balance of pH7.6 20mM, utilize the negative adsorption method of ion-exchange, supernatant after the fragmentation is passed the anion-exchange chromatography post, recombinant staphylokinase albumen is passed, the peak is passed in collection, and most of tropina is adsorbed on the chromatography column.Through behind this step purifying, remove most of foreign protein, the purity of recombinant staphylokinase is improved, thereby reaches the effect of preliminary purification.
The cation-exchange chromatography purifying: will transfer pH with the 0.1N dilute phosphoric acid through the protein liquid that the anion-exchange chromatography purifying is collected is 6.20, the purifying of last sample Zhiyang ion chromatography post (SP Sepharose FF), the recombinant staphylokinase protein molecular is adsorbed on the column packing, phosphoric acid salt EDTA pH6.20 damping fluid with 20mM washes earlier, remove unconjugated albumen, then, phosphoric acid salt EDTApH6.20 buffer solution elution with the NaCl 20mM that contains 0.2M, collect elution peak, the SDS-PAGE detected result shows that the proteic purity of recombinant staphylokinase in the 0.2M NaCl elutriant further increases.
Gel permeation chromatography: the SephacrylS200 that selects Amersham-Pharmacia Biotech company to produce is a gel filter medium.At first with damping fluid (20mM phosphoric acid salt pH7.4,2mM EDTA, 0.1MNaCl) two column volumes of wash-out, with sample on the elutriant of cation seperation column 0.2M NaCl, carry out wash-out then, collect elution peak with 1.2ml/ minute flow velocity, elutriant is carried out SDS-PAGE to be detected, the result shows that recombinant staphylokinase albumen presents single band in the elutriant, and no foreign protein is taken out of existing.
(4), preparation
After the recombinant staphylokinase of chromatography column purifying passes through the SDS-PAGE electrophoresis, with the method that silver dyes its purity is determined, measure protein concentration and calculate total protein content with the Lowry method then.
According to the pharmacological experiment data, concentration is about 0.9～1.7 μ g/ml in the recombinant staphylokinase blood, and dosage also has certain interval range, generally in 0.25～0.4mg/kg body weight.From the angle of clinical application, generally select the at first quick administration 10mg of vein, then according to the variation of the state of an illness and the further needs of treatment, slowly intravenous drip 10mg or no longer administration again.So the embodiment that the present invention provides determines that the packing dosage of recombinant staphylokinase is the 10mg/ bottle.
Composition in every vial formulation is:
Recombinant staphylokinase 10mg
N.F,USP MANNITOL 15mg
Sodium phosphate dibasic 3.4mg
SODIUM PHOSPHATE, MONOBASIC 0.63mg
EDTA?1.0mg
Sodium-chlor 8.5mg
Formulation method comprises:
With containing 0.1mol/L sodium-chlor, 20mmol/L phosphate buffered saline buffer (pH7.4), the solvent of the EDTA of 2mmol/L is diluted to 8.0mg/ml with recombinant staphylokinase, and with the filtering with microporous membrane degerming of 0.22 μ m, adding stablizer and vehicle are 1.5% N.F,USP MANNITOL (weight percent).Recombinant staphylokinase is sub-packed in the 10mg/ bottle in the cillin bottle of handling, carries out lyophilize then.Adopt vacuum seal after the freeze-drying, add the plastic-aluminum enclosing cover ,-20 ℃ of preservations.
0.1mol/L the N.F,USP MANNITOL of sodium chloride solution and 1.5% is close with blood of human body osmotic pressure, phosphate buffered saline buffer is near the potential of hydrogen of blood of human body, and the EDTA of trace is suppressed at the remaining protease activity of possibility denier in the purge process.
Determining according to preparation freeze-drying aftershaping outward appearance of N.F,USP MANNITOL consumption utilizes 20% formula mannitol injection liquid to originate for auxiliary material, adds freeze-drying behind 2%, 4%, 6% and 10% 20% formula mannitol injection liquid respectively in recombinant staphylokinase stoste.The thrombolysis activity of preparation does not have significant difference after the freeze-drying, but mannitol content is when being lower than cumulative volume 1.2%, and preparations shaping is relatively poor, is higher than 1.2% and does not see difference, so select 1.5% mannitol concentration for use.
Human serum albumin is a stablizer main in finished product freeze-drying and the storage process, human serum albumin of too much planting different concns on probation reaches and does not add human serum albumin in the preparation manufacture, with thrombolysis activity after the freeze-drying and preparations shaping outward appearance is index, the tentative experiment observations is thought, do not add and add the human serum albumin of different concns, outward appearance after the preparation freeze-drying there is not influence, thrombolysis activity unknown significance difference.Because also there are some problems in blood products management at present, still there is risk in the biological products in blood source in quality control simultaneously.So comprehensive above consideration the present invention abandons end user's seralbumin, for the freeze-dried preparation that does not contain human serum albumin, has observed one-year age, its thrombolysis activity does not have to change substantially.
The recombinant staphylokinase sequence table
＜110〉Hebei Yiling Medicine Inst. Co., Ltd
＜120〉a kind of recombinant staphylokinase freeze-dried preparation and application
<160>2
<210>1
<211>411
<212>DNA
＜213〉recombinant staphylokinase (recombinant stephylokinase)
<220>
<221>mutation，Old_sequence
<222>(19)...(21)，(115)...(118)，(127)...(129)
＜223〉n=A or C or T or G
<400>1
TCA?AGT?TCA?TTC?GAC?AAA?GCA?AAA?TAT?AAA?AAA?GGC?GAT?GAC?GCG?AGT
Ser?Ser?Ser?Phe?Asp?Lys?Ala?Lys?Tyr?Lys?Lys?Gly?Asp?Asp?Ala?Ser
1 5 10 15
TAT?TTT?GAA?CCA?ACA?GGC?CCG?TAT?TTG?ATG?GTA?AAT?GTG?ACT?GGA?GTT
Tyr?Phe?Glu?Pro?Thr?Gly?Pro?Tyr?Leu?Met?Val?Asn?Val?Thr?Gly?Val
20 25 30
GAT?GGT?AAA?GGA?AAT?GAA?TTG?CTA?TCC?CCT?CGT?TAT?GTC?GAG?TTT?CCT
Asp?Gly?Lys?Gly?Asn?Glu?Leu?Leu?Ser?Pro?Arg?Tyr?Val?Glu?Phe?Pro
35 40 45
ATT?AAA?CCT?GGG?ACT?ACA?CTT?ACA?AAA?GAA?AAA?ATT?GAA?TAC?TAT?GTC
Ile?Lys?Pro?Gly?Thr?Thr?Leu?Thr?Lys?Glu?Lys?Ile?Glu?Tyr?Tyr?Val
50 55 60
GAA?TGG?GCA?TTA?GAT?GCG?ACA?GCA?TAT?AAA?GAG?TTT?AGA?GTA?GTT?GAA
Glu?Trp?Ala?Leu?Asp?Ala?Thr?Ala?Tyr?Lys?Glu?Phe?Arg?Val?Val?Glu
65 70 75 80
TTA?GAT?CCA?AGC?GCA?AAG?ATC?GAA?GTC?ACT?TAT?TAT?GAT?AAG?AAT?AAG
Leu?Asp?Pro?Ser?Ala?Lys?Ile?Glu?Val?Thr?Tyr?Tyr?Asp?Lys?Asn?Lys
85 90 95
AAA?AAA?GAA?GAA?ACG?AAG?TCT?TTC?CCT?ATA?ACA?GAA?AAA?GGT?TTT?GTT
Lys?Lys?Glu?Glu?Thr?Lys?Ser?Phe?Pro?Ile?Thr?Glu?Lys?Gly?Phe?Val
100 105 110
GTC?CCA?GAT?TTA?TCA?GAG?CAT?ATT?AAA?AAC?CCT?GGA?TTC?AAC?TTA?ATT
Val?Pro?Asp?Leu?Ser?Glu?His?Ile?Lys?Asn?Pro?Gly?Phe?Asn?Leu?Ile
115 120 125
ACA?AAG?GTT?GTT?ATA?GAA?AAG?AAA?TAA
Thr?Lys?Val?Val?Ile?Glu?Lys?Lys?***
130 135
<210>2
<211>136
<212>PRT
＜213〉recombinant staphylokinase (recombinant stephylokinase)
<220>
<221>CONFLICT，VARIANT，CHAIN，SITE
<222>(7，36，43)
<400>2
Ser?Ser?Ser?Phe?Asp?Lys?Ala?Lys?Tyr?Lys?Lys?Gly?Asp?Asp?Ala?Ser
1 5 10 15
Tyr?Phe?Glu?Pro?Thr?Gly?Pro?Tyr?Leu?Met?Val?Asn?Val?Thr?Gly?Val
20 25 30
Asp?Gly?Lys?Gly?Asn?Glu?Leu?Leu?Ser?Pro?Arg?Tyr?Val?Glu?Phe?Pro
35 40 45
Ile?Lys?Pro?Gly?Thr?Thr?Leu?Thr?Lys?Glu?Lys?Ile?Glu?Tyr?Tyr?Val
50 55 60
Glu?Trp?Ala?Leu?Asp?Ala?Thr?Ala?Tyr?Lys?Glu?Phe?Arg?Val?Val?Glu
65 70 75 80
Leu?Asp?Pro?Ser?Ala?Lys?Ile?Glu?Val?Thr?Tyr?Tyr?Asp?Lys?Asn?Lys
85 90 95
Val?Pro?Asp?Leu?Ser?Glu?His?Ile?Lys?Asn?Pro?Gly?Phe?Asn?Leu?Ile
115 120 125
Thr?Lys?Val?Val?Ile?Glu?Lys?Lys?***
130 135
Claims (7)
1, a kind of recombinant staphylokinase freeze-dried preparation, it is characterized in that comprising in the preparation recombinant staphylokinase 10mg, excipient N.F,USP MANNITOL 15mg, buffer reagent Sodium phosphate dibasic 3.4mg, SODIUM PHOSPHATE, MONOBASIC 0.63mgEDTA 1.0mg, permeate agent sodium-chlor 8.5mg, wherein the aminoacid sequence of recombinant staphylokinase is as follows:
Ser?Ser?Ser?Phe?Asp?Lys?Ala?Lys?Tyr?Lys?Lys?Gly?Asp?Asp?Ala?Ser?Tyr?Phe?Glu?Pro?Thr?Gly
Pro?Tyr?Leu?Met?Val?Asn?Val?Thr?Gly?Val?Asp?Gly?Lys?Gly?Asn?Glu?Leu?Leu?Ser?Pro?Arg?Tyr
Val?Glu?Phe?Pro?Ile?Lys?Pro?Gly?Thr?Thr?Leu?Thr?Lys?Glu?Lys?Ile?Glu?Tyr?Tyr?Val?Glu?Trp?Ala
Leu?Asp?Ala?Thr?Ala?Tyr?Lys?Glu?Phe?Arg?Val?Val?Glu?Leu?Asp?Pro?Ser?Ala?Lys?Ile?Glu?Val?Thr
Tyr?Tyr?Asp?Lys?Asn?Lys?Lys?Lys?Glu?Glu?Thr?Lys?Ser?Phe?Pro?Ile?Thr?Glu?Lys?Gly?Phe?Val?Val
Pro?Asp?Leu?Ser?Glu?His?Ile?Lys?Asn?Pro?Gly?Phe?Asn?Leu?Ile?Thr?Lys?Val?Val?Ile?Glu?Lys?Lys
* *; Number the 7th, the 36th, 43 amino acids are Ala, Gly and Arg.
2, recombinant staphylokinase freeze-dried preparation according to claim 1 is characterized in that the nucleotide sequence of described aminoacid sequence staphylokinase is as follows:
TCA?AGT?TCA?TTC?GAC?AAA?GCA?AAA?TAT?AAA?AAA?GGC?GAT?GAC?GCG?AGT?TAT?TTT?GAA?CCA?ACA?GGC
CCG?TAT?TTG?ATG?GTA?AAT?GTG?ACT?GGA?GTT?GAT?GGT?AAA?GGA?AAT?GAA?TTG?CTA?TCC?CCT?CGT?TAT
GTC?GAG?TTT?CCT?ATT?AAA?CCT?GGG?ACT?ACA?CTT?ACA?AAA?GAA?AAA?ATT?GAA?TAC?TAT?GTC?GAA?TGG?GCA
TTA?GAT?GCG?ACA?GCA?TAT?AAA?GAG?TTT?AGA?GTA?GTT?GAA?TTA?GAT?CCA?AGC?GCA?AAG?ATC?GAA?GTC?ACT
TAT?TAT?GAT?AAG?AAT?AAG?AAA?AAA?GAA?GAA?ACG?AAG?TCT?TTC?CCT?ATA?ACA?GAA?AAA?GGT?TTT?GTT?GTC
CCA?GAT?TTA?TCA?GAG?CAT?ATT?AAA?AAC?CCT?GGA?TTC?AAC?TTA?ATT?ACA?AAG?GTT?GTT?ATA?GAA?AAG?AAA
TAA，
Recombination sequence length is 411 bases, and it is that codon GCA, a 106-108 base are codon GGA that recombination sequence is characterized as 19-21 base; The 127-129 base is codon CGT.
3, the preparation method of recombinant staphylokinase freeze-dried preparation comprises:
(1), the structure of recombinant staphylokinase engineering bacteria:
Select the streptococcus aureus strain to carry out the separation of chromosomal DNA, glucokinase gene separates primer and is:
F
SAK：5’GGAATTCATATGTCAAGTTCATTCGACAA 3’
R
SAK：5’CGGGATCCTTATTTCTTTTCTATAACAACC?3’
With above-mentioned chromosomal DNA is that template is carried out pcr amplification; Use pBV220 to be expression vector, the e. coli bl21 strain is the host bacterium, utilize the glucokinase gene of restriction enzyme EcoRI and BamHIPCR reaction amplification, simultaneously with identical enzymic digestion expression vector pBV220, electrophoresis reclaims, carrier is connected with gene, transformed into escherichia coli BL21 competent cell, the picking transformed clone is inoculated in the LB substratum that contains penbritin, the concussion overnight incubation, the plasmid DNA of extraction transformant utilizes EcoRI and BamHI enzyme to cut, enzyme is cut the product reaction product carry out the agarose gel electrophoresis analysis, the recombinant plasmid that filters out the glucokinase gene insertion is as engineering strain;
(2), fermentation
The clone strain that will contain recombinant plasmid is inoculated in the LB substratum that contains penbritin, and 30 ℃ of concussion overnight incubation are as primary seed solution; Be inoculated in the concentration of 0.1-0.5% and contain in the penbritin LB substratum, 30 ℃ of concussion overnight incubation are as fermentation seed liquid; Again with LB as nutrient solution, inoculation 5-6% fermentation seed liquid carries out jar to be cultivated, mixing speed 300rpm, air flow 0.8-1.0vvm, oxygen dissolving value generally by the initial reduction gradually of fermentation, get OD
600Induce program to starting between the 3-3.5 to heat up, wait to be warming up to 42 ℃ induce beginning after, portion-wise addition glucose is to supplement the nutrients, by regulating stirring velocity, the DO value is remained on more than 40%, induce after 5 hours in centrifugal receipts bacterium below 4 ℃, with the washing precipitation of zymophyte body and function damping fluid ,-20 ℃ freezing standby;
(3), purifying
The phosphate buffered saline buffer of zymophyte at pH7.6 suspended, under condition of ice bath, ultrasonication; Anion-exchange chromatography post damping fluid balance is passed the anion-exchange chromatography post with the supernatant liquor after the fragmentation, collects and passes the peak; Again the protein liquid of collecting being transferred pH with the 0.1N dilute phosphoric acid is 6.20, Zhiyang ion chromatography column purification, the recombinant staphylokinase protein molecular is adsorbed on the column packing, earlier with the flushing of pH6.20 damping fluid, remove unconjugated albumen, then, with the phosphoric acid salt EDTApH6.20 buffer solution elution that contains NaCl, collect elution peak; Through S200 gel permeation chromatography purifying, collect elution peak again;
(4), preparation
With containing 0.1mol/L sodium-chlor, 20mmol/L phosphate buffered saline buffer (pH7.4), the solvent of the EDTA of 2mmol/L is diluted to 8.0mg/ml with recombinant staphylokinase, filtering with microporous membrane degerming with 0.22 μ m, adding stablizer and vehicle are 1.5% N.F,USP MANNITOL (weight percent), recombinant staphylokinase is sub-packed in the 10mg/ bottle in the cillin bottle of handling, carries out lyophilize then.
4, the preparation method of recombinant staphylokinase according to claim 3 is characterized in that the streptococcus aureus described in the step (1) is selected good strains in the field for seed to be selected as 1697 strains.
5, the preparation method of recombinant staphylokinase freeze-dried preparation according to claim 3, the pcr amplification reaction condition described in the step (1) that it is characterized in that be 94 ℃ 40 seconds, 54 ℃ 40 seconds, 72 ℃ 2 minutes, carry out 30 circulations altogether, last circulation was extended 5 minutes for 72 ℃.
6, the preparation method of recombinant staphylokinase freeze-dried preparation according to claim 3 is characterized in that the ultrasonication bacterium described in the step (3), adopts intermittently broken and remains in the ice bath and carry out, and each 30 seconds, 30 seconds at interval.
7, the application of the described recombinant staphylokinase freeze-dried preparation of claim 1 in the preparation thrombolytic drug is characterized in that can be made into freeze drying powder preparations form, vein and the intramuscular injection pharmaceutical solutions form of thrombolysis clinically.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN03119315A CN100580082C (en) | 2003-03-14 | 2003-03-14 | Lyophylization preparation of recombinant staphylokinase, its preparing method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN03119315A CN100580082C (en) | 2003-03-14 | 2003-03-14 | Lyophylization preparation of recombinant staphylokinase, its preparing method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1446912A CN1446912A (en) | 2003-10-08 |
| CN100580082C true CN100580082C (en) | 2010-01-13 |
Family
ID=28050538
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN03119315A Expired - Lifetime CN100580082C (en) | 2003-03-14 | 2003-03-14 | Lyophylization preparation of recombinant staphylokinase, its preparing method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100580082C (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100445390C (en) * | 2005-10-14 | 2008-12-24 | 中国人民解放军军事医学科学院基础医学研究所 | High activity, low antigen glucokinase derivant and preparation method |
| CN100445389C (en) * | 2005-10-14 | 2008-12-24 | 中国人民解放军军事医学科学院基础医学研究所 | Low antigen recombination glucokinase mutant and its preparation method |
| CN101112358B (en) * | 2006-07-26 | 2011-04-20 | 中国科学院上海生命科学研究院 | Staphylokinase intramuscular injection and method for preparing the same |
| CN105727267B (en) * | 2016-02-05 | 2020-05-26 | 苏州康聚生物科技有限公司 | Recombinant human hyaluronidase freeze-dried preparation and preparation method and application thereof |
-
2003
- 2003-03-14 CN CN03119315A patent/CN100580082C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1446912A (en) | 2003-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0217379B1 (en) | Thrombolytic composition and a process for production thereof | |
| US5646127A (en) | Treatment of cardiac ischemia by administration of a fraction of partially depolymerized DNA | |
| NL8601354A (en) | NEW COMPOSITION. | |
| GB2176702A (en) | Tissue plasminogen activator | |
| CN100580082C (en) | Lyophylization preparation of recombinant staphylokinase, its preparing method and application | |
| CN101015686B (en) | Thrombolytic medicine synergist and its preparing process | |
| CN107760660B (en) | Tissue type plasminogen activator mutant and application thereof | |
| CN109679941B (en) | Cordyceps militaris fibrinolytic enzyme and preparation method and application thereof | |
| CN101693888A (en) | Yellow mealworm plasmin and preparation method and applications thereof | |
| Zhang et al. | Recombinant streptokinase production by fed-batch cultivation of Escherichia coli | |
| JP6375112B2 (en) | Pharmaceutical composition of tenecteplase | |
| KR100508043B1 (en) | Method for the production of rDSPAα1 | |
| CN1332033C (en) | Plasmid for expressing recombination human tPA and its construction method | |
| CN1850976B (en) | Glucose kinase derivant and its preparing method | |
| CN101139578B (en) | Double-functional staphylokinase mutant having platelet aggregation resistance and fibrinolytic activity, application and preparation method thereof | |
| RU2247777C2 (en) | Plasminogen urokinase type modified activator, dna sequence, recombinant plasmid, strain-producer, method for preparing plasminogen urokinase type modified activator and pharmaceutical composition eliciting thrombolytic effect | |
| CN104479025A (en) | Construction, expression and purification and functional identification of tissue plasminogen activator | |
| CN101314769B (en) | Staphylokinase and expression vector thereof | |
| JPH05500809A (en) | Novel proteins and their production | |
| RU2127758C1 (en) | Method of recombinant streptokinase preparing | |
| CN103690949A (en) | Endomucin antibody medicament for prompting bone marrow regeneration | |
| CN102212512A (en) | Pegylated staphylokinase mutant, and preparation method and application thereof | |
| CN1332020C (en) | Engineering bacteria strain for producing recombination buman tPA and its preparation method | |
| CN116057071B (en) | Novel mutant of recombinant ganoderma lucidum immunomodulatory protein and application thereof | |
| CN100469871C (en) | Low pyrogen staphylokinase and its preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: BEIJING YILING BIOPHARMACEUTICAL CO., LTD. Free format text: FORMER OWNER: YILING MEDICINE INST. CO., LTD., HEBEI Effective date: 20121128 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 050091 SHIJIAZHUANG, HEBEI PROVINCE TO: 101500 MIYUN, BEIJING |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20121128 Address after: 101500 No. 23, science and technology road, Miyun Economic Development Zone, Beijing, China Patentee after: Beijing Yiling Bioengineering Co.,Ltd. Address before: 050091 Hebei province Shijiazhuang Xinshi North Road, No. 385 Patentee before: HEBEI YILING MEDICINE RESEARCH INSTITUTE Co.,Ltd. |
|
| CX01 | Expiry of patent term |
Granted publication date: 20100113 |
|
| CX01 | Expiry of patent term |