CN100564395C - The human monoclonal antibody and the hybridoma cell strain thereof of anti-people's palatelet-selectin lectin-Urogastron functional domain - Google Patents

Abstract

The invention provides a kind of human monoclonal antibody that can anti-specifically people's palatelet-selectin lectin-Urogastron functional domain, and the hybridoma cell strain that produces this monoclonal antibody.Monoclonal antibody of the present invention more is applicable to be regulated and treatment anti-the sticking at palatelet-selectin of human body.

Description

The human monoclonal antibody and the hybridoma cell strain thereof of anti-people's palatelet-selectin lectin-Urogastron functional domain

Technical field

The present invention relates to field of transgenic technology, particularly a kind of anti-people's palatelet-selectin lectin-Urogastron (P-selectin-lectin-EGF, PsL-EGF) human monoclonal antibody of functional domain and produce the hybridoma cell strain of this antibody.

Background technology

Palatelet-selectin (P-selectin) is that a kind of molecular weight is the I type membrane glycoprotein of 140kD, is positioned in hematoblastic α particle and the endotheliocyte Weibel-Palade corpusculum, and total length is made up of 789 amino-acid residues.730 amino acid of its N-terminal constitute extracellular region, comprise 1 lectin (Lectin) structural domain, 1 Urogastron (EGF) structural domain and 9 Complement Regulatory Protein tumor-necrosis factor glycoproteinss (SCR) structural domain; 24 amino acid of C-terminal constitute strides the film district.35 amino acid constitute endochylema short-tail (Johnston GI in addition, Cook RG, McEver RP.Cloning of GMP-140, a granulemembrane protein of platelets and endothelium:sequence similarity to proteinsinvolved in cell adhesion and inflammation.Cell, 1989,56 (6): 1033-1044).Palatelet-selectin belongs to the plain family of selection of cell adhesion molecule, and it is as the sign of thrombocyte/activated endothelial cell and stick acceptor, but mediated leucocytes and activation endotheliocyte etc. stick at first, be the important component that starts inflammatory reaction and keep inflammatory conditions.Do not express under its normal circumstances or low the expression, after stimulating, the factors such as inflammation, damage that are subjected to significantly to express, and expressing also appears in the internal organs of originally not expressing, so palatelet-selectin participates in multiple pathophysiological processes such as immune inflammation damage, thrombosis and metastases, its excessively or continuous expression can become the sign of some organ disease, with many clinical diseases very confidential relation is arranged.Experiment shows, suppresses its expression and the cell adhesion effect has obtained prevention effect such as good anti-inflammatory, anti metastasis.

The patent No. the applicant is in the Chinese patent of ZL 200310108522.5, discloses mouse resource monoclonal antibody (PsL-EGF mAb) at anti-palatelet-selectin lectin-EGF (L-EGF) functional domain and preparation method thereof (comprising hybridoma) and uses.Testing data shows that PsL-EGF mAb has more anti-sticking/anti-inflammatory target retarding effect than palatelet-selectin total length monoclonal antibody, and to L-, E-selects element that the restraining effect of sticking is also arranged, and the body cell immunologic function is not had obvious inhibition and the adjusting effect is arranged; Further utilize the renal ischemic reperfusion injury rat model to prove that this monoclonal antibody can effectively suppress the leukocyte gathering that palatelet-selectin is expressed and mediated, alleviate the nephridial tissue pathology damage, improve renal function, and do not influence the normal immune defense function of body substantially.

Yet, mouse source property monoclonal antibody is applied to the problem that human body exists immunology and pharmacology two aspects: it is short mainly to show as the mouse-anti transformation period, can not effectively excite the cellulotoxic effect of suitable antibody dependence and the cellulotoxic effect that complement relies on, and the human antimouse antibody reaction etc., limited this mouse source monoclonal antibody medicine in clinical development and utilization.

Summary of the invention

The technical problem to be solved in the present invention promptly is above-mentioned problem, and human monoclonal antibody of a kind of anti-people's palatelet-selectin lectin-Urogastron functional domain and preparation method thereof is provided, and especially produces the specific cross tumor cell strain of this monoclonal antibody.

The present invention selects for use the existing transgenic mice that can produce human monoclonal antibody to prepare people of the present invention source monoclonal antibody.This transgenic mice system adopts the preparation integration of artificial library to contain human normal immunoglobulin (Ig) site, knocks out endogenous Ig site simultaneously, and replaces mouse Ig gene with people Ig gene, expresses the specific antibody in complete people source after resetting.Specifically, the present invention selects for use and carries people Ig μ, Ig κ and Ig λ gene, and mouse source IgH and Ig κ chain are expressed inactivation, and be called five feature mouse (Nicholson IC, ZouX, Popov AV, et al.Antibody Repertoires of Four-and Five-Feature TranslocusMice Carrying Human Immunoglobulin Heavy Chain and κ and λ LightChain Yeast Artificial Chromosomes.The Journal of Immunology, 1999,163 (12): transgenic mice 6898-6906).Because the target gene fragment PsL-EGF of this research is 474bp only, the expressed proteins molecular weight ratio is less, antigenicity a little less than, and the used transgenic mice immunne response ability of experiment Antibody Preparation a little less than, need to select the suitable carriers construction of fusion protein with enhancing immunity originality; Consider Thiadiazolidine isomerase (Glutathione-S-Transferase, GST) some proteic amalgamation and expressions are had solubility and higher expression preferably, and that gsh solidifies the affinity chromatography resin that forms in agarose is very high to the purification efficiency of GST and fusion rotein thereof.Therefore, the present invention at first utilizes special primer, by pcr amplification target gene fragment PsL-EGF, is connected to pGEM T-easy carrier, with being built into pGEX-5X-1 carrier (containing GST) behind EcoRI and the Sal I double digestion, thereby made up the pGEX-PsL-EGF recombinant plasmid.The latter is transformed into escherichia coli BL21 after sequence verification, through isopropyl-(IPTG) abduction delivering the GST-PsL-EGF fusion rotein.Hybridoma technology is used as the antigen immune transgenic mice in the purified back of this fusion rotein, screening positive clone, preparation ascites and acquisition purpose antibody---the human monoclonal antibody of specific anti-human palatelet-selectin L-EGF functional domain.

Above-mentioned hybridoma technology comprises that subcutaneous intradermal injection and two kinds of immunization methods of abdominal injection hocket, the immune transgenic mouse, and the myeloma cell SP2/0 as immunocyte and mouse merges with its splenocyte.Then by the indirect ELISA screening positive clone, but obtain the people source monoclonal antibody hybridoma cell strain PsL-EGFmAb-2 of the anti-PsL-EGF functional domain of 1 strain stably excreting monoclonal antibody, its hypotype is IgM, light chain is the λ type, this people source monoclonal antibody hybridoma cell strain PsL-EGFmAb-2 has been preserved in Chinese typical culture collection center on October 26th, 2006, obtaining preserving number is CCTCC NO:C200634.

The characteristic of monoclonal antibody that the present invention obtains is identified and detects that the result shows: this monoclonal antibody behaviour source monoclonal antibody (IgM, λ type), and have good specificity and stability.The successful preparation of anti-PsL-EGF human monoclonal antibody is sticked treatment research for the specificity that further is applied to human diseases is anti-and is laid a good foundation, and has more the potential clinical value.

People of the present invention source monoclonal antibody hybridoma cell strain PsL-EGFmAb-2 has been deposited in the Chinese typical culture collection center (CCTCC) that is positioned at Chinese Wuhan University (postcode is 430072) on October 26th, 2006, obtaining preserving number is CCTCC NO:C200634.

Description of drawings

Fig. 1 cuts the electrophoretogram of evaluation for pGEX-PsL-EGF construction of recombinant plasmid and enzyme,

M1:DL 2,000Marker; M2:DL 15000Marker; A:PCR amplification PsL-EGF fragment; The B:PsL-EGF-pEGMT-easy recombinant plasmid; C:EcoR I, Sal I double digestion PsL-EGF-pEGMT-easy recombinant plasmid; The D:pGEX-5X-1 plasmid; E:EcoR I, Sal I double digestion pGEX-5X-1 plasmid; The F:pGEX-PsL-EGF recombinant plasmid; G:EcoR I, Sal I double digestion pGEX-PsL-EGF recombinant plasmid.

Fig. 2 is a pGEX-PsL-EGF vector construction synoptic diagram.

Fig. 3 is that the SDS-PAGE of GST-PsL-EGF expressing fusion protein and purifying detects collection of illustrative plates,

Bacterium liquid before A:IPTG induces; Nutrient solution after B:IPTG induces; C: supernatant behind the broken bacterium; D: broken bacterium postprecipitation; E: the GST-PsL-EGF albumen of urea purification; F: the GST-PsL-EGF albumen of acetone purifying; M: albumen Marker.

Fig. 4 is row SDS-PAGE gel electrophoresis result behind His-PsL-EGF and the GST protein purification,

M: albumen Marker; A:His-PsL-EGF albumen; B:GST albumen.

Fig. 5 is the chromosome analysis result of hybridoma cell strain of the present invention.

Fig. 6 is that RT-PCR identifies the human antibody result, and 1 is template with human lymphocyte cDNA; 2 cDNA with hybridoma cell strain CCTCC NO:C200634 are template; 3 is template with mouse lymphotactin cDNA.

Fig. 7 is anti-PsL-EGF human monoclonal antibody IgM Fc section sequencing result.

Fig. 8 is the antibody result in ELISA evaluation immune serum (A) and the hybridoma supernatant of the present invention (B).

Fig. 9 is the antibody result in Western blot evaluation immune serum (A) and the hybridoma supernatant of the present invention (B).

Embodiment

Further specify the present invention in the following embodiments, but do not limit the scope of the invention.

Below material among the described embodiment be:

1, plasmid, bacterial strain and main preparation E.coli DH5 α, E.coli XLI-Blue bacterial strain is a GBICO company product, E.coli BL-21 (DE3) bacterial strain, pGEX-5X-1 plasmid are PharmaciaBiotech company product; Restriction enzyme (EcoR I, Sal I) is TaKaRa company product, T ₄Dna ligase, TaqPlus archaeal dna polymerase, pGEM-T easy carrier connect test kit, dNTP is Promega company product; DNA marker DL2000 is a NEB company product, and the RT-PCR test kit is an Invitrogen company product; QIA quick Gel Extraction Kit, plasmid are taken out test kit for a short time, the PCR product reclaims test kit, Ni ²⁺-NTA superflow resin is Qiagen company product; Glutathione Sepharose 4B affinity column is a BD company product; RNA extract Trizol, reverse transcription test kit, RPMI-1640 substratum, foetal calf serum, complete Freund's adjuvant, incomplete Freund's adjuvant, PEG, HAT, HT are GibcoBRL company product; RhP-selectin/Fc chimera is R﹠amp; D company product; Goat-anti people IgM (μ chain) antibody of HRP mark is Protol research Inc company product; The goat-anti people κ chain antibody of HRP mark, the goat-anti people λ chain antibody of HRP mark are bethyl company product; Ethanol, phenol, chloroform, primary isoamyl alcohol, formaldehyde, glutaraldehyde, IPTG (sec.-propyl-β-D thiogalactoside), ethylenediamine tetraacetic acid (EDTA) (EDTA), dithiothreitol (DTT) (DTT), sodium laurylsulfonate (SDS), Tutofusin tris (Tris) wait other conventional reagent to be commercially available import or homemade analytical pure.

2, animal and cell strain 6-8 Balb/c mouse in age in week is female, and 20-25g/, available from experimentation on animals center, Chinese Academy of Sciences Shanghai; Raise 1 week, normal diet in the Animal House special messenger of the court before the experiment; Murine myeloma cell SP2/0 takes from Shanghai Institute of Immunology; Transgenic mice (five feature mouse) is available from Shanghai Research Center of Genetically Modified.

3, autogamy reagent

1) LB nutrient solution

Peptone 10g

Yeast extract 5g

Sodium-chlor 10g

Be dissolved in distilled water, transfer pH to 7.0, be settled to 1000ml, 121 ℃ of autoclavings, 20min with NaOH.If make flat board, then add the 15g agar powder, 121 ℃ of autoclavings, 20min.If do LB-Amp nutrient solution or flat board, behind the autoclaving, treat that substratum is chilled to that to add penbritin (Amp) to final concentration about 50 ℃ again be 50ug/ml.

2) 2 * YT substratum

Tryptone 16g, Yeast Extract 10g, NaCl 5g, adding distil water transfer pH7.0, high pressure steam sterilization (1.034 * 10 to 1L with 5mol/L NaOH ⁵Pa) 20min, it is standby to put 4 ℃ of refrigerators.

3) TAE electrophoretic buffer (50 * storage liquid): 48.4g Tris alkali, the 11.42ml glacial acetic acid, 20ml0.5mol/L EDTA (pH8.0) is settled to 1000ml.

4) dna gel sample loading buffer: 0.25% bromjophenol blue, 40% (W/V) aqueous sucrose solution.

5) EB (10mg/ml): 0.01g EB powder is dissolved in the 1ml distilled water, and room temperature keeps in Dark Place.

6) SDS-PAGE electrophoretic buffer (50 * storage liquid): 48.4g Tris alkali, the 11.42ml glacial acetic acid, 20ml 0.5mol/L EDTA (pH8.0) is settled to 1000ml.

7) 2 * SDS sample-loading buffer

1M?Tris-HCl(pH6.8) 2.5ml

10％SDS 4ml

Glycerine 2ml

Distilled water 1.5ml

Tetrabromophenol sulfonphthalein 0.1%

DTT 0.015g

Be total to 10ml

8) 5% spacer gel (two boards)

Distilled water 2.7ml

30% gel storage liquid 0.67ml

0.5MTris-HCl(pH6.8) 0.5ml

10％SDS 40ul

10% ammonium persulphate (AP) 40ul

TEMED 4ul

The latter two add at last.

9) 12% separation gel (two boards)

Distilled water 3.3ml

30% gel storage liquid 4.0ml

1.5M?Tris-HCl(pH8.8) 2.5ml

10％SDS 0.1ml

10% ammonium persulphate (AP) 0.1ml

TEMED 4ul

The latter two add at last.

10) electrophoretic buffer

Tris 3g

Glycine (Padil) 14.4g

SDS 1g

Be dissolved in distilled water and be settled to 1000ml, 4 ℃ of preservations.

11) Xylene Brilliant Cyanine G destainer

Methyl alcohol 40ml

Acetate 10ml

Distilled water 50ml

12) coomassie brilliant blue staining liquid: promptly in destainer, add 0.1% coomassie brilliant blue R250.

13) RPMI-1640-20 nutrient solution: RPMI 1640 is replenished 20% inactivated fetal bovine serum, added with antibiotic (penicillin 100IU/ml, Streptomycin sulphate 100ug/ml), glutamine (200mmol/L) and Sodium.alpha.-ketopropionate (100mmol/L) are made into complete culture solution.

14) 1640-HAT nutrient solution: add 50 * HAT 2ml in the 98ml RPMI-1640-20 nutrient solution.

15) 50%PEG:PEG1500 is in charge of with the 1g/ pipe, and the rearmounted 4 ℃ of preservations of autoclaving cooling are faced with before adding equal-volume RPMI-1640 nutrient solution and mixed.

16) 10% methyl-sulphoxide (DMSO) frozen storing liquid

Add 10%DMSO among the RPMI 1640.Face with preceding fresh configuration, or place 4 ℃ of refrigerators (lucifuge) standby, preserved about 1 month.

17) coating buffer (the 0.05M carbonic acid buffer, pH9.6)

Yellow soda ash 1.59g

Sodium bicarbonate 2.93

Distilled water 1000ml

18) washings (0.01MPBS-T, pH7.2)

Sodium phosphate dibasic 2.579g

SODIUM PHOSPHATE, MONOBASIC 0.4369g

Sodium-chlor 8.5g

Tween-20 0.5ml

The water-soluble 1000ml that is settled to, 4 ℃ of preservations.

19) dilution buffer liquid (the 0.02M PBS damping fluid that contains 1%BSA, pH7.4)

Repone K 0.2g

Potassium primary phosphate 0.2

Sodium phosphate dibasic .12H ₂O 2.9g

Sodium-chlor 8.0g

Distilled water 1000ml

Face with before adding 1%BSA.

20) substrate solution

A liquid: 0.1mol/l citric acid solution

B liquid: 0.2mol/lNa ₂HPO ₄Solution

Face with before getting A liquid 5ml and B liquid 5ml and mix adding O-Phenylene Diamine (OPD) 4mg, treat that fully the dissolving back adds 30%H ₂O ₂2.5ul, the substrate working fluid.

21) transfering buffering liquid

Tris 3g

Glycine (Padil) 14.4g

Water-soluble to 1000ml, 4 ℃ of preservations.

22) Ponceau S staining fluid

Ponceau S 2g

Trichoroacetic acid(TCA) 30g

Sulphosalicylic acid 30g

Water-soluble to 1000ml, by dilution in 1: 9, can use repeatedly during use.

23) (MOPS 0.2mol/L, EDTA 0.01mol/L regulate pH to 7.0 with 2mol/L sodium hydroxide behind the NaAC0.05mol/L mixing to 10 * RNA electrophoretic buffer, face the time spent with DEPC-H ₂The O dilution).

24) RNA sample-loading buffer (composition has 100% methane amide 0.5ml, 37% formaldehyde 0.2ml, 10 * electrophoretic buffer 0.1ml, bromjophenol blue 0.06ml, faces the time spent preparation).

4, the proteic expression and purification of His-PsL-EGF

Prepare purifying according to above-mentioned patent CN200310108522.5 embodiment 1-4, the result as shown in Figure 4.

5, the proteic expression and purification of GST

The pGEX-5X-1 plasmid is transformed into BL21 expresses in the bacterium, get mono-clonal next day and add the LB nutrient solution that 5ml contains penbritin, 37 ℃, the 250rpm jolting is spent the night.Add 2 * YT substratum that 500ml contain penbritin with this bacterium liquid next day, and 37 ℃, the 250rpm jolting is to OD ₆₀₀Value reaches 0.6-0.8, adds 0.4mM IPTG abduction delivering differential protein subsequently, collects bacterium liquid behind 28 ℃ of expression 5h.

GST protein purification process is summarized as follows: above-mentioned bacterium liquid is put 4 ℃, the centrifugal 5min of 8000rpm, abandon supernatant liquor, add 1 * PBS 40ml in precipitation, vibration makes its abundant suspendible, the branch short run is put broken bacterium in the Ultrasonic Cell Disruptor, until the shape that is translucent, the adding final concentration is 1% TritonX-100, puts vibrator vibration 30min, 4 ℃, the centrifugal 15min of 8000rpm abandons precipitation, and supernatant liquor is added on ready-formed Glutathione Sepharose 4B affinity column, sample is 3 times in the circulation, after the 1 * PBS 50ml washing, add elutriant, leave standstill 10min after, collect effluent liquid, collect by every pipe 1ml, numbering.Get sample segment and carry out the SDS-PAGE electrophoresis, remainder-20 ℃ preservation is standby, and the result as shown in Figure 4.

Embodiment 1 pcr amplification

With pET42b-PsL-EGF plasmid (being pET42b (+)-L-E plasmid, referring to patent CN200310108522.5) is template, carries out pcr amplification with primer and obtains people's palatelet-selectin Lectin--EGF zone 474bp fragment.

1, design of primers is according to a pair of primer of mRNA sequences Design of people's palatelet-selectin lectin-EGF functional domain among the GenBank (accession number M25322) and in conjunction with the polyclone restriction enzyme site of carrier, add restriction endonuclease sites respectively at upstream and downstream primer 5 ' end, primer sequence is as follows, underscore partly is EcoR I and Sal I restriction enzyme site, and primer is given birth to worker biotech firm by Shanghai and synthesized.

Upstream: 5 ' CGT GAATTCTGGACTTATCATTACAGCAC 3 '

EcoR?I

Downstream: 5 ' TTC GTCGACCTCTCTCACGTATTCACATTCT 3 '

Sal?I

2、PCR

PET42b-PsL-EGF plasmid 1ul

primer(25pmol/ul) 1ul 95℃ 5min

Tag?D NA?polymerase 1ul ?72℃ 10min

Cumulative volume: 50ul

3, PCR product electrophoresis is got above-mentioned product carry out electrophoretic analysis in 1% sepharose (containing the 0.5ug/ul ethidium bromide), 100V, 30min, ultraviolet lamp observe PCR product dyeing band down, the result shows that the size of amplified fragments conforms to the 474bp of expection, and the result is shown in the A swimming lane of Fig. 1.

4, the PCR product purification reclaims the PCR product with QIAGEN quick-spin PCR purification kit, and detailed process sees the test kit explanation for details.

Embodiment 2PsL-EGF-pEGM T-easy construction of recombinant plasmid

The PsL-EGF fragment with EcoR I and Sal I double digestion, is cut product with enzyme and is connected into the pGEM T-Easy carrier of cutting through same enzyme, obtain PsL-EGF-pEGM T-easy recombinant plasmid.Transformed E .coli DH5 α competent cell is coated in the selectivity LB culture dish that contains penbritin and IPTG/X-Gal (isopropyl-/5-bromo-4-chloro-3-indoles-beta galactose glycosides), in 37 ℃ of overnight incubation.Picking white mono-clonal is inoculated in the LB substratum that 5ml contains penbritin, and 37 ℃, the 250rpm jolting is spent the night.Extract plasmid and carry out EcoR I and the evaluation of Sal I restriction enzyme digestion and electrophoresis, can get big or small two fragments, prove and contain correct insertion fragment that the result is shown in the C swimming lane of Fig. 1.

Embodiment 3pGEX-PsL-EGF construction of recombinant plasmid

The small segment that embodiment 2 gained recombinant plasmid PsL-EGF-pEGM T-easy are carried out obtaining after EcoR I and Sal I enzyme are cut is tapped rubber after purifying reclaims, be connected with the big fragment pGEX fragment (shown in the E swimming lane of Fig. 1) that pGEX-5X-1 plasmid behind EcoR I, the Sal I double digestion obtains, obtain pGEX-PsL-EGF recombinant plasmid (shown in the F swimming lane of Fig. 1, building process as shown in Figure 2).Transformed E .coli XLI-Blue competent cell is coated on the LB flat board that contains penbritin, is inverted overnight incubation for 37 ℃.Picking white mono-clonal extracts plasmid and carries out EcoR I and the evaluation of Sal I restriction enzyme digestion and electrophoresis, can get big or small two fragments, and the about 474bp of small segment proves and contain correct insertion fragment that the result is shown in the G swimming lane of Fig. 1.Small segment being checked order through the PE3700 sequenator, compares check order row and the sequence among the GenBank with BLAST software in the order-checking back again, and unanimity illustrates that constructed recombinant plasmid is correct as a result.

The expression and purification of embodiment 4 target protein matter GST-PsL-EGF

To identify that correct recombinant plasmid pGEX-PsL-EGF is transformed into expression bacterial classification E.coli BL21 (DE3) and obtains genetic engineering bacterium E.coli BL21 (DE3)/pGEX-PsL-EGF.Genetic engineering bacterium E.coli BL21 (DE3)/pGEX-PsL-EGF is inoculated in the 5ml LB nutrient solution, 37 ℃ of activation are spent the night, and next day above-mentioned bacterium liquid are inoculated in 500ml with 1% ratio and contain in 2 * YT substratum of penbritin 25 ℃, 250rpm jolting 3-4h makes its OD ₆₀₀Value reaches 0.5-0.8, gets the contrast of 1ml bacterium liquid before as abduction delivering, all the other bacterium liquid add IPTG to final concentration be 0.1mmol/L, collect thalline after inducing 3h.

After collection bacterium liquid is centrifugal, 1 * PBS washing thalline 3 times, Buffer A (Tris-base 50mM, EDTA0.5mM, NaCl 50mM, glycerine 5%, DTT 5mM) resuspended thalline, the ultrasonication thalline is to limpid (400W, each 5s in the ice bath, intermittently 12s is total to ultrasonic 20 times), 4 ℃, the centrifugal 15min of 8000rpm abandons supernatant liquor, uses Buffer A washing precipitation 2-3 time again, the urea room temperature that adds 8M in precipitation leaves standstill 30min to 2h makes its slow dissolving, with filter paper filtering insoluble substance.Row SDS-PAGE gel electrophoresis behind the solution adding sample buffer mixing, use particular sample comb, make and once go up the sample volume and can reach about 1ml, gel with protein standard substance and small portion sample place after electrophoresis finishes downcuts, and uses coomassie brilliant blue staining, to determine the position of target protein, all the other gels immerse in the ice-cold 0.25M KCl solution and dye, be visible white protein band behind the 2-3min,, embathe 15min with deionized water with the band cutting-out of target protein position, wash again 2 times, smash gel strips Elute solution (0.1%SDS, 50mM Tris-HClpH 7.9,0.1mM EDTA to pieces, 5mM DTT, 0.2M NaCl) soak, 4 ℃ are spent the night, the centrifugal 20min of 8000rpm next day, get the acetone (20 ℃ of precoolings) that supernatant liquor adds 4 times of volumes, behind-20 ℃ of placement 4h, 4 ℃, the centrifugal 20min of 8000rpm, abandon supernatant liquor, precipitation is dissolved-20 ℃ of preservations in back with 8M urea, is the GST-PsL-EGF albumen of electrophoresis level purifying, and the result as shown in Figure 3.

Embodiment 5 animal immunes

(1) processing of immune proantigen: get the GST-PsL-EGF fusion rotein behind an amount of purifying, row 12%SDS-PAGE gel electrophoresis, after electrophoresis finishes gel immersed in the ice-cold 0.25M KCl solution and dye, downcut white ribbon, embathe 15min with deionized water, wash again 2 times, smash gel strips to pieces and make it become the suspension shape stand-by.

(2) immunization method: subcutaneous intradermal injection and abdominal injection hocket.Promptly respectively at the above-mentioned antigen 0.01ml of transgenic mice both sides sole subcutaneous injection, remainder is injected in shank respectively, the back is subcutaneous and intracutaneous in subcutaneous intradermal injection.Abdominal injection dosage is not more than 0.5ml.

(3) immunizing dose and pitch time: each every above-mentioned antigen of mouse immune 100 μ g, behind the initial immunity, every 2-3 week booster immunization once, behind the booster immunization 7d from childhood rathole socket of the eye endocanthion get blood and survey and to tire, 20d behind the booster immunization, by tail vein injection antigenic solution 100-150ug/ only, carry out cytogamy in the 3-5d.

Embodiment 6 cytogamy, screening and cloning

1, cell is prepared

1) splenocyte prepares: the transgenic mice behind the booster immunization among the embodiment 5 is extractd taken off neck execution after eyeball is got blood, collect blood and make positive control with separation of serum.After in addition above-mentioned execution mouse being dipped in 75% ethanol 5min, belly places on the super clean bench up, under aseptic condition, isolate spleen, wash away blood and peel off reticular tissue on every side, then spleen is packed in the 100 order nylon net bags, place the sterile petri dish that fills the 10mlRPMI-1640 nutrient solution, grind splenocyte to becoming single cell suspension with tweezers filter bag, again with behind a small amount of RPMI-1640 nutrient solution flushing mesh bag, splenocyte suspension is moved in the 50ml centrifuge tube, carry out cell counting in the RPMI-1640 nutrient solution with being suspended in after the RPMI-1640 nutrient solution washed twice.

2) feeder cell preparation: the fusion proxima luce (prox. luc) is got a transgenic mice and is taken off neck execution, after being dipped in 75% ethanol 5min, belly places on the super clean bench up, upwards tear mouse skin in the below with two tweezers in mouse abdomen middle part, when mentioning belly ready-formed 1640-HAT nutrient solution is injected in the mouse peritoneal with aseptic nipper, the capable cell counting of pumpback intraperitoneal liquid, adjusting cell concn with the 1640-HAT nutrient solution is 2 * 10 ⁵/ ml is added to the feeder cell drop in the 96 porocyte culture plates by every hole 100ul then, and culture plate is placed 5%CO ₂, cultivate in 37 ℃ of incubators.

3) myeloma cell's preparation: ordinary method recovery myeloma cell SP2/0 adds the RPMI-1640-20 nutrient solution and is placed on 5%CO ₂, cultivate in 37 ℃ of incubators.Went down to posterity once by 1: 3 before the cytogamy, and change liquid, and fusion should be in logarithmic phase with cell be advisable the same day in merging the proxima luce (prox. luc) cell.With suction pipe cell is blown off gently before merging, be collected in the 50ml centrifuge tube, the centrifugal 5min of room temperature 1000rpm shifts out supernatant liquor, and precipitation is suspended in row cell counting in the RPMI-1640 nutrient solution.

2, cytogamy

With the splenocyte of above-mentioned preparation and myeloma cell with 10: 1 mixed in the 50ml centrifuge tube, the centrifugal 5min of 1000rpm, with RPMI-1640 nutrient solution washing 2 times, beat the test tube bottom gently at the palm of the hand after shifting out supernatant liquor, after making the cell mass pine even, put and slowly add 1ml50%PEG in 37 ℃ of water-baths, the limit edged slowly stirs, and then leaves standstill 1.5min in water-bath, adds RPMI-1640 nutrient solution 10ml from slow to fast by speed in the 5min, add this nutrient solution then to 40ml, rotate test tube gently, make it uniform mixing, the centrifugal 5min of 1000rpm, abandon supernatant liquor, the 1640-HAT nutrient solution that takes a morsel dispels cell mass gently, adds an amount of 1640-HAT nutrient solution again and fully dilutes, and is added to by the 100ul/ hole in 96 well culture plates that are covered with feeder cell, place 37 ℃, 5%CO ₂Incubator is cultivated.Frequent observation of cell growing state during this time, fluid infusion in time and change liquid.

3, the screening of positive colony

When the hybridoma growth conditions is good, when accounting at the bottom of the hole 25-50% left and right sides, adopt the indirect elisa method screening positive clone.

1) wrapper sheet: His-PsL-EGF albumen is diluted to 5ug/ml with coating buffer, adds enzyme plate, put 4 ℃ of refrigerator overnight by every hole 100ul.

2) sealing: after enzyme plate washed 3 times, every hole added confining liquid 300ul, put 37 ℃ of sealing 1h.

3) application of sample: after the same washing,, put 37 ℃ of incubator incubation 1h by transgenic mice immune serum (positive control) and the RPMI-1640 nutrient solution (negative control) that every hole 100ul adds hybridoma supernatant, dilution in 1: 100.

4) add ELIAS secondary antibody: pat dry after the same washing, add goat-anti people IgM (μ chain) antibody of the HRP mark of dilution in 1: 5000 respectively, every hole 100ul puts 37 ℃ of incubator incubation 1h.

5) colour developing: pat dry after the same washing, every hole adds colour developing liquid 100ul, after application of sample finishes, with shrouding film shrouding, puts 37 ℃ of colour developing 15-20min, adds 50ul 2mol/L sulphuric acid soln color development stopping, reads light absorption value in microplate reader wavelength 490nm place, with OD ₄₉₀Value is positive greater than 2 times of negative control.The pairing cell hole in the positive hole of enzyme plate is renewed bright nutrient solution, select plain standard protein (rhP-selectin/Fc chimera) wrapper sheet to give detection again with 5ug/mlP-behind the cultivation 1-2d.With OD ₄₉₀Value greater than negative hole more than 2 times the person carry out cloning and cultivate.

4, hybridoma cloning

Adopt limiting dilution assay to carry out cloning.

1) clone prepared feeder cell the same day, inoculated in 96 orifice plates 100ul/ hole (2 * 10 ⁴/ hole).

2) positive cell washes down counting gently in culture plate.

3) become 10 cells/ml inoculation to be added with in 96 orifice plates of feeder cell the 100ul/ hole with nutrient solution serial dilution cell suspension.

4) about 10 days, when the hybridoma colony grows at the bottom of the hole 25-50% left and right sides, begin to measure antibody activity in the supernatant.

When 5) recording the positive cell hole of antibody activity, the clone carries out 4 times altogether again.

Through above-mentioned ELISA screening and the subclone of repeating, filter out the hybridoma cell strain of the anti-palatelet-selectin Lectin-EGF of 1 strain energy stably excreting monoclonal antibody at last, name is people source monoclonal antibody hybridoma cell strain PsL-EGFmAb-2, this cell strain has been preserved in Chinese typical culture collection center on October 26th, 2006, obtaining preserving number is CCTCC NO:C200634.

The chromosome analysis of embodiment 7 hybridomas

Adopt the colchicine method to carry out chromosome analysis, in order to identify the cell strain that is screened.

1) adding the preceding 24-48h of colchicine goes down to posterity hybridoma cell strain CCTCC NO:C200634.

2) adding final concentration in nutrient solution is the colchicine of 0.02-0.05ug/ml, continues to cultivate 2.5-3h, collecting cell, and the centrifugal 10min of 1000rpm abandons supernatant liquor.

3) add temperature in advance to 37 ℃ 0.075mol/L KCl solution 2ml, spare 37 ℃ of water-bath 15-20min with cell is outstanding.

4) slowly add the freshly prepared stationary liquid of 100ul (methyl alcohol mixes with Glacial acetic acid at 3: 1) in suspension, room temperature leaves standstill 15min behind the mixing, and the centrifugal 10min of 1000rpm abandons supernatant liquor then.

5) add stationary liquid 1ml, cell is outstanding even, and room temperature leaves standstill 15-20min, and the centrifugal 10min of 1000rpm abandons supernatant liquor then.

6) repetitive operation is once inhaled and is removed supernatant liquor, stays the 200-400ul stationary liquid according to cell pack, with cell outstanding even after, draw cell suspension 1-2 and drip, drip in the slide glass that just from frozen water, takes out, for several times cell being tiled on the slide glass excessively on the flame, dry naturally.

7) with freshly prepared 10%Giemsa dye liquor dyeing 30min, dye liquor is removed in the tap water rinsing, dries naturally.

8) microscopy: the selective staining body is scattered, and zero lap does not have the cell that scatters and carries out observation analysis.

Show that through hybridoma chromosome analysis result chromosome number reaches about 90 and be more concentrated, majority be kinetochore, end karyomit(e), the marker chromosomes (as shown in Figure 5) that minority has kinetochore in the middle part of middle part or the Asia also occurs.

The evaluation of embodiment 8 monoclonal antibody light chain types

Adopt indirect elisa method to detect the hybridoma excretory monoclonal antibody light chain type of being screened.

1) P selects plain standard protein (rhP-selectin/Fc chimera) with every hole 0.5ug coated elisa plate, puts 4 ℃ and spends the night.

2) 37 ℃ of sealings of confining liquid 1h, washing.

3) divide two groups on κ chain, λ chain, establish 6 multiple holes, add hybridoma cell strain CCTCC NO:C200634 supernatant liquor 100ul respectively for every group.Negative control two holes add confining liquid and PBS100ul respectively.Positive control two holes add immune serum 100ul respectively, hatch 1h for 37 ℃, washing.

4) add goat-anti people κ chain, λ chain monoclonal antibody (each 6 multiple hole) 100ul respectively for two groups in κ chain, λ chain, negative control and positive control hole all add goat-anti people IgM (μ chain) the antibody 100ul of suitable dilution, hatch 1h for 37 ℃, washing.

5) every hole adds OPD colour developing liquid 100ul, after application of sample finishes, with shrouding film shrouding, puts 37 ℃ of colour developing 15-20min, adds 50ul 2mol/L sulphuric acid soln color development stopping, reads light absorption value in microplate reader wavelength 490nm place.

The indirect elisa method result shows that the hybridoma cell strain excretory monoclonal antibody light chain of this research screening is a λ type (table 1).

The qualification result of table 1 monoclonal antibody light chain type

The evaluation of embodiment 9 human antibodies

After the extractive mRNA of hybridoma cell strain CCTCC NO:C200634 carried out reverse transcription, according to the mRNA sequences Design primer of people IgM Fc section among the GenBank, primer sequence was:

Upstream 5 '-CAGTCCCCGGCAGATTCAG-3 '

Downstream 5 '-CTTCGCCATTCTGGCGG-3 '

With above-mentioned cDNA is that template is carried out pcr amplification, simultaneously with the positive contrast of human lymphocyte, and the negative contrast of mouse (Balb/c mouse) lymphocyte.The PCR product is checked order, in order to identify the monoclonal antibody of being screened.

PCR result shows that can amplify people IgM Fc section in human lymphocyte and hybridoma cell strain CCTCC NO:C200634, expanding fragment length is 380bp, but can not amplify same fragment (as shown in Figure 6) in mouse lymphotactin.After hybridoma cell strain CCTCC NO:C200634 amplification PCR products carried out purifying, check order through the PE3700 sequenator, sequencing result conforms to above-mentioned PCR result again, and the result as shown in Figure 7.

The specific detection of embodiment 10 monoclonal antibodies

1, ELISA method

1) use GST-PsL-EGF, His-PsL-EGF, each 5ug/ml wrapper sheet of three kinds of albumen of GST respectively, 4 ℃ are spent the night;

2) enzyme plate pats dry after washing 3 times, and every hole adds confining liquid 300ul, puts 37 ℃ of sealing 1h;

3) enzyme plate pats dry after washing 3 times, and every hole adds immune serum (contrast) 100ul of hybridoma cell strain CCTCC NO:C200634 supernatant liquor or transgenic mice, and 37 ℃ of temperature are incubated 1h;

4) enzyme plate pats dry after washing 3 times, adds goat-anti people IgM (μ chain) antibody of HRP mark, the 100ul/ hole, and 37 ℃ of temperature are incubated 1h;

5) enzyme plate pats dry after washing 3 times, adding OPD colour developing liquid 100ul/ hole, and after application of sample finishes, with shrouding film shrouding, 37 ℃ of 15-20min that develop the color, 2mol/L sulfuric acid 50ul/ hole color development stopping, absorption value in each hole of mensuration, microplate reader wavelength 490nm place.

ELISA detects discovery, the immune serum of transgenic mice and His-PsL-EGF and GST albumen all can have an effect (shown in the A of Fig. 8); But hybridoma cell strain CCTCC NO:C200634 supernatant liquor is only had an effect with His-PsL-EGF albumen, and reactionless with GST albumen, the result is shown in the B of Fig. 8.

2、Western?blot

Add equal-volume 2 * sds gel sample loading buffer in His-PsL-EGF, GST protein solution, go up the capable 12%SDS-PAGE gel electrophoresis of sample after boiling 5min in the boiling water.Electrophoresis is transferred to nitrocellulose filter with half-dried transfer instrument with the albumen on the polyacrylamide gel after finishing.After transfer finishes, with membrane closure liquid chamber temperature sealing 2h, adding hybridoma cell strain CCTCC NO:C200634 supernatant liquor spends the night for 4 ℃, next day, film washings washing was 3 times, and each 15min adds anti-people IgM (μ chain) the antibody room temperature reaction 2h of the HRP mark that dilutes at 1: 2000, film washings washing 3 times, each 15min drips ECL liquid on film, develop a film after compressing tablet, development, photographic fixing and read the result.

Same method, with sample on His-PsL-EGF, the GST solution, as anti-a reaction, compressing tablet reads the result with the transgenic mice immune serum (contrast) of suitable dilution.

Western-blot result shows, the immune serum of transgenic mice all can with His-PsL-EGF fusion rotein and GST albumen test, there are anti-PsL-EGF functional domain and the proteic antibody of anti-GST in the serum, also have antibody (shown in the A of Fig. 9) at other foreign proteins in the intestinal bacteria.Hybridoma cell strain CCTCC NO:C200634 supernatant liquor only can react with His-PsL-EGF albumen, and reactionless with GST albumen, shows that the monoclonal anti physical efficiency that the present invention obtains combines with the PsL-EGF antigen-specific, and the result is shown in the B of Fig. 9.

Claims (2)

1, a kind of by hybridoma cell strain CCTCC NO:C200634 excretory monoclonal antibody, its be can anti-specifically people's palatelet-selectin lectin-Urogastron functional domain human monoclonal antibody.

2, a kind of preserving number is the hybridoma cell strain of CCTCC NO:C200634.

Images