CN101788563B - Spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit thereof and application of kit - Google Patents

Abstract

The invention belongs to the field of agricultural micrological gene-engineering and animal borne diseases, and relates to a spotted deer gamma-interferon double-antibody sandwich ELISA detection method, a kit thereof and application of the kit. A cell strain (CerIFN-gamma4C) capable of stably secreting a spotted deer gamma-interferon monoclonal antibody is obtained, and the storage number of the cell strain is CCTCC NO:C200966. The invention also establishes a spotted deer gamma-interferon double-sandwich ELISA detection method, which is characterized by establishing the spotted deer gamma-interferon monoclonal antibody, preparing a spotted deer gamma-interferon polyclonal antibody and the like. The kit of the invention comprises the spotted deer gamma-interferon monoclonal antibody, the spotted deer gamma-interferon polyclonal antibody, bovine tuberculosis specific three-gene fusion antigenic proteins RCE and other reagents. The invention also discloses the detection method and the application of the kit. The kit has the advantages of high specificity, high sensitivity, simple and convenient operations and quick diagnosis.

Description

Spotted deer gamma-interferon double-antibody sandwich ELISA detection method and kit and application

Technical field

The present invention relates to technical field of microbial genetic engineering and zoonosis technical field.Be specifically related to sika deer gamma interferon detection method and kit and application.

Background technology

Deer tuberculosis (Cervus Tuberculosis, CTB) mainly is a kind of chronic Zoonosis infectious disease that is caused by mycobacterium bovis BCG (Mycobacterium bovis).Its infectivity of this disease all can occur throughout the year, is worldwide popular, once is to cause one of disease that people and animals' death toll is maximum, is decided to be category-B zoonosis by OIE (OIE), and China classifies them as two class animal epidemics.Cause that mainly humans and animals mycobacterium lungy has 3 kinds: M. tuberculosis mycobacterium, mycobacterium bovis, fowl type Much's bacillus.The tuberculosis Etiological is all found both at home and abroad, and prapes, people's tuberculosis and deer tuberculosis are mutually to infect.Therefore, control perlsucht and people's tuberculosis must be taken into account the wild animal anti-systems lungy such as deer.Be used for deer control lungy owing to not yet finding so far active drug and vaccine, what some countries generally adopted is " quarantining-catch and kill " policy, and the positive deer of namely quarantining is catched and killed without exception and realizes controlling deer tuberculosis.Therefore, accurately and timely diagnostic method seems particularly important for the control of this disease.

The method of the unique recommendation of OIE is bovine tuberculosis rhzomorph intracutaneous allergic reaction (Tuberculin skin test, TST).But because tuberculin may include the heterogenetic antigen component identical with other mycobacterium, false positive appears easily during detection; Tuberculin intracutaneous allergic reaction is insensitive to the open tuberculosis and the generalized tuberculosis that infect the later stage.In addition, the TST program is loaded down with trivial details, time and effort consuming, result judge that subjectivity is strong, need professional's operation, the implementation result of " quarantining-slaughter " policy is had a greatly reduced quality, and it can only carry out live test, and can not carry out retrospective analysis to the sample of preserving, more be not suitable for the sick generaI investigation of bovine tuberculosis of wild animal and outlying mountain area.Therefore, people are devoted to develop the novel diagnostic method of a kind of easier, quick, high specific, hypersensitivity.

Gamma interferon (being called for short IFN-γ) is a kind of cell factor that CD4+Th1 cell, CD8+ cytotoxic T cell and NK cell etc. produce under antigen (bacterium, virus etc.) and mitogen (ConA and PHA etc.) stimulation.That IFN-γ has is anti-infective, antitumor activity and immunoregulation effect, as activated macrophage, improve MHC I class and II quasi-molecule expression, promote that antigen is offered, body anti-infective with immunity in play a significant role.Based on the close ties between IFN-γ and the infection, medical science reaches veterinarily all utilizes pathogen specific antigen stimulated in vitro monocyte generation IFN-γ to carry out Diagnosis of Infectious Diseases.The method sensitivity and specificity are all high, demonstrate very large application prospect.IFN-γ release in vitro detection method is examined animal's whole blood or peripheral blood mononuclear cells (PBMC) with mycobacteria specific or heterogenetic antigen external stimulus, make a small amount of T cell fully accept stimulation, thereby secrete a large amount of IFN-γ, then detect the cell method of IFN-γ concentration with enzyme linked immunosorbent assay, IFN-γ release in vitro detection method is significant to the early diagnosis of latent tuberculosis infection.

The higher specificity of IFN-γ test will help low popular country that tuberculosis subclinical infection (LTBI) is carried out more accurate diagnosis and in time carried out targetedly antituberculosis therapy to detecting individuality, reduce the propagation of resistance in Mycobacterium tuberculosis and control antibiotic abuse.Antigentic specificity IFN-γ test can be for detection of the effect of antituberculosis therapy.According to the test principle of antigentic specificity IFN-γ test, under the environment, when the effector cell of nearest contacted TB specific antigen runs into identical antigen again, only need a few hours can produce IFN-γ in vivo.Different from effector cell is that the memory T lymphocyte often needs several days time could generate IFN-γ.Therefore, if the incubation time of whole blood is 24 hours or shorter time in detection, detection mainly be the IFN-γ that effector cell produces, rather than produced by the memory T lymphocyte.And if the Extending culture time, that then detect will mainly be the IFN-γ that memory T cell produces, this may be so that through treatment or infect the patient who has been eliminated and produce positive findings.Therefore, antigentic specificity IFN-γ test can be used as estimating of TB body PD and result for the treatment of.

Summary of the invention

The object of the invention is to overcome the defective of prior art, a kind of spotted deer gamma-interferon double-antibody sandwich ELISA detection method, kit and the application in sika deer tuberculosis in-vitro diagnosis are provided.

Main points of the present invention are cell strain of monoclonal antibody that acquisition has fine specificity, susceptibility and stability, by to the determining of the determining of sika deer gamma interferon (IFN-γ) list/polyclonal antibody best effort concentration, best sealing concentration and time, optimum antibody in conjunction with the determining of (hatching) time, best blood plasma irritaiting concentration to be checked and determining of time and determining of best cell factor to be checked (IFN-γ) concentration, finally set up sika deer IFN-γ detection method lungy and dedicated kit and application.

The present invention is achieved through the following technical solutions:

The restructuring fusion vector plasmid pET-32a-IFN-γ that the present invention will make up transfers in the e. coli bl21 competent cell, and abduction delivering obtains a kind of have antiviral, antitumor activity, immunoregulation effect and strong stable on heating solubility IFN-γ albumen.Utilize the IFN-γ protein immunization mouse of purifying, express supernatant screening positive hybridoma cell with the eukaryotic cell lines stably excreting, obtain the monoclonal antibody that a plant height is tired.Set up double-antibody sandwich elisa detection method and the dedicated kit thereof of sika deer IFN-γ with the monoclonal antibody that obtains and the anti-IFN-γ of rabbit polyclonal antibody, its detection sensitivity reaches 24.9pg/ml.

The strain that the applicant will obtain can stably excreting sika deer interferon-γ monoclonal antibody cell line CerIFN-γ 4C deliver Chinese Typical Representative culture collection center (CCTCC) preservation in the Wuhan University of Wuhan City, Hubei Province on Dec 1st, 2009, deposit number is CCTCC NO:C200966.

The applicant has set up a kind of double-antibody sandwich elisa detection method of sika deer gamma interferon, and its step comprises:

(1) be that the sika deer gamma interferon monoclonal antibody of CCTCC NO:C200966 is diluted to working concentration (50ng/ hole) and adds in the ELISA Plate hole every hole 100 μ l, 37 ℃ of rearmounted 4 ℃ of refrigerator overnight of effect 1h with coating buffer with preserving number;

(2) discard liquid in the hole, wash ELISA Plate 3 times with washing fluid, each 3min pats dry with thieving paper;

(3) add confining liquid 100 μ l in the hole in each ELISA Plate hole, 37 ℃ of effect 1h are by the method washing of step (2);

(4) the sika deer whole blood culture supernatant to be measured that will induce, adding is coated with in the elisa plate hole of sika deer gamma interferon monoclonal antibody every hole 100 μ l; The feminine gender that to collect simultaneously and positive control culture supernatant are divided and are added in the hand-hole, 37 ℃ of effect 1h, the method washing of repeating step (2);

(5) with washing fluid the anti-sika deer gamma interferon of rabbit polyclonal antibody is pressed working concentration (50ng/ hole) dilution, every hole adds 100 μ l, 37 ℃ of effect 1h, the method washing of repeating step (2);

(6) with washing fluid the goat anti-rabbit igg of horseradish peroxidase mark is pressed working concentration dilution (according to volume ratio 1: 5000), every hole adds 100 μ l, 37 ℃ of effect 1h, the method washing of repeating step (2);

(7) in every hole in ELISA Plate hole, add nitrite ion 100 μ l, room temperature lucifuge colour developing 10min;

(8) in every hole in ELISA Plate hole, add 50 μ l stop buffers and make its cessation reaction;

(9) on enzyme-linked immunosorbent assay instrument in 630nm wavelength place determination step (8) absorbance value;

Wherein:

The described coating buffer of step (1) is formulated as follows: sodium carbonate 1.59g; Sodium bicarbonate 2.93g; Be settled to 1000ml with distilled water;

Described being formulated as follows of step (2): sodium chloride 8.0g; Potassium chloride 0.2g; Sodium hydrogen phosphate 0.2g; Potassium dihydrogen phosphate 2.9g; Tween-20 0.5ml; Be settled to 1000ml with distilled water, pH7.4;

The described confining liquid of step (3) is formulated as follows: washing fluid 100ml; Skim milk 10g;

The described nitrite ion of step (7) is formulated as follows: sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Be settled to 100ml with distilled water, obtain A liquid; Sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Be settled to 100ml with distilled water, pH 5.0, obtain the phosphate-citrate salts damping fluid 100ml of 0.1mol/L, add o-phenylenediamine 40mg again; The hydrogen peroxidase 10 .15ml of 30% concentration obtains B liquid, mixes described A liquid and B liquid, obtains nitrite ion.

The described stop buffer of step (8) is formulated as follows: the sulfuric acid 22.2ml of 2mol/L, distilled water 177.8ml.

The applicant has also assembled the ELISA detection kit of the double-antibody sandwich of the sika deer gamma interferon that adapts with above-mentioned detection method, it comprises: deposit number is the sika deer gamma interferon monoclonal antibody of CCTCC NO:C200966, sika deer gamma interferon polyclonal antibody, preserving number is that (number of patent application is 2009100609131 to CCTCC NO:M208244, patent publication No. is CN101538578A) prapes specificity three gene fusion antigen protein RCE, horseradish peroxidase mark goat anti-rabbit igg, nitrite ion and stop buffer.

Component and the compound method of wherein said nitrite ion and stop buffer are as follows:

Nitrite ion: sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Be settled to 100ml with distilled water, obtain A liquid; Sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Be settled to 100ml with distilled water, pH 5.0, obtain the phosphate-citrate salts damping fluid 100ml of 0.1mol/L, add o-phenylenediamine 40mg; The hydrogen peroxidase 10 .15ml of 30% concentration obtains B liquid, mixes described A liquid and B liquid, obtains nitrite ion.

Stop buffer: 2mol/L sulfuric acid 22.2ml; Distilled water 177.8ml.

More detailed technical scheme is as described in " embodiment ".

Description of drawings

Sequence table SEQ ID NO:1 is the dna sequence dna of sika deer IFN-γ genetic fragment of the present invention.

Sequence table SEQ ID NO:3-4 is the primer sequence of amplification sika deer IFN-γ genetic fragment among the present invention.

Fig. 1: be general technical route map of the present invention.

Fig. 2: be the used prokaryotic expression carrier pET32a of the present invention (+) collection of illustrative plates.

Fig. 3: be pcr amplification sika deer IFN-γ electrophoresis pattern of the present invention.Among the figure: M, DNA standard DL2000; 1, negative control; 2, RT-PCR product

Fig. 4: be that the SDS-PAGE that the present invention prepares detects plum deer IFN-γ protein expression form evaluation collection of illustrative plates.Among the figure: M, protein molecular quality standard; 1, albumin on the CerIFN-γ; 2, purifying CerIFN-γ albumen.

Fig. 5: be the sika deer IFN-γ albumen Western-Blot figure that the present invention prepares.Among the figure 1, restructuring pET32 α-CerIFN-γ; 2, the negative confrontation shone; M, protein standard substance.

Fig. 6: being the present invention detects sika deer IFN-γ monoclonal antibody (McAb) the titre figure that tires by indirect ELISA.

Fig. 7: being the present invention detects sika deer IFN-γ polyclonal antibody (PcAb) the titre figure that tires by indirect ELISA.

Fig. 8: be that the present invention detects sika deer IFN-γ monoclonal antibody (McAb) sensitivity titre figure by indirect ELISA.

Embodiment

Embodiment 1: the clone of genes of interest sika deer IFN-γ

1, plasmid and Host Strains source

Used pET-32a (+) plasmid vector of the present embodiment is available from Novagen company.Colon bacillus BL21 (DE3) competent cell is available from Wuhan City, Hubei Province life technology company limited.

2, design of primers and synthetic

According to sika deer IFN-γ cDNA sequence (GenBank accession No:X63079) the design prokaryotic expression primer according to the upper issue of GenBank.Primer is given birth to worker Bioisystech Co., Ltd by Shanghai and is synthesized.

The prokaryotic expression primer sequence is as follows: upstream primer: 5 ' ATAT GGATCCGATCTTATGGCCAGGGCCCA3 ' (lower setting-out is the BamHI site); Downstream primer: 5 ' TAAT AAGCTTTTACGTTGATGCTCTCCGGCCTCG3 ' (lower setting-out is the HindIII site).

3, the pcr amplification of genes of interest

The aseptic sika deer jugular vein blood of taking, anticoagulant heparin is got the whole blood of 10mL sika deer, adds con A (english abbreviation: Con A, available from Sigma company) 60 μ g/mL in 37 ℃ and 5%CO ₂Cultivate 24h under the environment.Extract the total RNA of peripheral blood leucocyte of Con A stimulation as the template of RT-PCR, utilize one step amplification to obtain sika deer IFN-γ mature peptide sequence, see that shown in the sequence table SEQ ID NO:1, the sequence total length is 438bp.

The pcr amplification reaction system is: 10 * Taq Buffer, 5.0 μ L, 25mmol/L MgCl ₂1.0 μ l, 2mmol/L dNTPs 1.5 μ L, each 1.0 μ L of 20 μ mol/L upstream and downstream primers, Taq archaeal dna polymerase 1.0 μ L, template 3 μ L, aseptic double-distilled water adds to 50 μ L.The loop parameter of amplification: 95 ℃ of denaturation 5min; Then 95 ℃ of sex change 30s, 59 ℃ of annealing 30s, 72 ℃ are extended 45s, 30 circulations; Last 72 ℃ are extended 10min.Amplified production detects with 0.8% agarose gel electrophoresis, and glue reclaims kit (giving birth to worker's biotechnology company limited available from Shanghai, with reference to this kit instructions) purified pcr product.

4, the PCR product reclaims:

Adopt Shanghai to give birth to the UNIQ-10 pillar DNA glue recovery kit recovery dna fragmentation that worker Bioisystech Co., Ltd produces, the step that provides of the instructions of kit is provided according to the centrifugal dna gel of this UNIQ-10 pillar carries out, concrete operations are as follows:

Agarose gel electrophoresis with 0.8% separates target DNA fragment and other DNA as far as possible, under long-wave ultra violet lamp, is used in the knife blade that burnt on the spirit lamp flame and downcuts the agar block that contains target DNA fragment, puts into 1.5mL sterilization centrifuge tube.

Add 400 μ L Binding Buffer by every 100mg agarose gel, put 10min in the 50-60 ℃ of water-bath, make Ago-Gel thoroughly melt (when adding thermosol, every 2min mixing once).

The UNIQ-10 post is put into collection tube, the sol solution that melts is transferred in the UNIQ-10 post, room temperature leaves standstill 2min, the centrifugal 1min of room temperature 8000r/min.

Take off the UNIQ-10 post, outwell the waste liquid in the collection tube, the UNIQ-10 post is put into same collection tube, add 500 μ L WashSolution, the centrifugal 1min of room temperature 8000r/min.

Add again 500 μ L Wash Solution, take off the UNIQ-10 post, outwell the waste liquid in the collection tube, the UNIQ-10 post is put into same collection tube, the centrifugal 15sec of room temperature 12000r/min.

The UNIQ-10 post is put into the 1.5mL centrifuge tube of a sterilization, according to PCR product amount relatively what, the film central authorities in the pillar bottom add 10-20 μ L Elution Buffer or ddH ₂O, room temperature or 37 ℃ are placed the centrifugal 1min of 2min room temperature 12000r/min, the liquid in the centrifuge tube is the dna fragmentation of recovery, can use immediately or be stored in-20 ℃ for subsequent use.

The structure of embodiment 2, recombinant plasmid pET-32a-IFN-γ

1, vector plasmid pET-32a and the IFN-γ PCR connection of being connected product

By restriction enzyme BamH I and Hind III (available from precious bioengineering (Dalian) company limited) double digestion prokaryotic expression carrier pET32a and reclaim the IFN-γ PCR product that obtains simultaneously respectively, enzyme is cut product and is detected with 0.8% agarose gel electrophoresis, and glue reclaims kit purifying enzyme and cuts product.The enzyme of purifying is cut product glue terminal the connection with T4DNA Ligase (available from Fermentas company), 16 ℃ of water-baths connect spends the night, and transforms the bacillus coli DH 5 alpha competent cell.

2, connect the conversion of product

Get competent cell DH5 α 100 μ L and join in the sterilization 1.5mL EP pipe, each the 10 μ L of middle interstitial granules pET-32a-IFN-γ after connecting are added and mixing.After putting on ice 30min, 42 ℃ of heat shock 90sec, ice bath 3-5min.Add 400 μ L LB fluid nutrient mediums (every liter contains yeast extract 5g, tryptone 10g, NaCl 10g transfers pH to 7.5 with 10mol/L NaOH, 121 ℃ of autoclaving 20min, 4 ℃ save backup.In per 100 milliliters of LB fluid nutrient mediums, add the 1.5g agar powder and be solid LB nutrient culture media, 121 ℃ of autoclaving 20min, 4 ℃ save backup), make its recovery in 37 ℃ of constant-temperature table 200r/min shaken cultivation 45min.Recombination bacillus coli suspension after the recovery discards 400 μ L supernatants in 4 ℃ of centrifugal 10min of 5000r/min, coats the LB agar plate that contains 25 μ g/mL kanamycins (available from Invitrogen company) with the resuspended precipitation of remaining 100 μ L.37 ℃ of propagation 1h turn over flat board again, are inverted 37 ℃ of cultivation 14-16h and occur to bacterium colony.

3, the extraction of plasmid

Use alkaline lysis (with reference to Pehanorm Brooker .J, Ritchie .E.F not, Manny A Disi .T chief editor, the molecular cloning experiment guide, Huang Peitang etc. translate, the third edition, Science Press, Beijing, 2002 editions method) to carry out, concrete operations are as follows:

With sterilizing toothpick random several single bacterium colonies of picking on the LB flat board, be inoculated in respectively in the LB fluid nutrient medium of 3mL 25 μ g/mL kanamycins, 37 ℃ of constant-temperature table 200r/min shaken cultivation are spent the night.

Bacterium liquid is changed in the 1.5mL centrifuge tube, in 4 ℃ of centrifugal 3min of 8000r/min, abandon supernatant, with remaining 1.5mL bacterium liquid repeated centrifugation, the handstand centrifuge tube flows to end liquid on thieving paper again.

Solution I (the 0.05mol/L glucose that adds the precooling of 100 μ L ice, 0.025mol/L Tris-HCl (pH8.0), 0.01mol/L EDTA), vortex fully suspends thalline, solution II (the 0.2mol/L NaOH that adds again the new preparation of 200 μ L, 1%SDS, now with the current), repeatedly put upside down centrifuge tube for several times, ice bath 5min, solution III (the 5mol/L sodium acetate 60mL that adds at last the precooling of 150 μ L ice, glacial acetic acid 11.5mL, water 28.5mL, pH5.0), gentleness is put upside down centrifuge tube for several times, ice bath 10min.

In 4 ℃ with the centrifugal 10min of 12000r/min, draw supernatant to another 1.5mL centrifuge tube, add isopyknic isopropyl alcohol, evenly mixed, room temperature leaves standstill 5min.

The centrifugal 10min of room temperature 12000r/min abandons supernatant, precipitates with after the 75% cold ethanol rinsing vacuum drying or natural drying.

Precipitation contains TE (pH8.0) dissolving of 20 μ L Rnase (20 μ g/mL) with 200 μ L, 56 ℃ of water-bath 30min or 37 ℃ of water-bath 1h are to remove RNA.

Add 7.5mol/L NH ₄Ac 100 μ L, room temperature leaves standstill 5min, again in the centrifugal 5min of room temperature 12000r/min.

Draw supernatant in the EP pipe of another 1.5mL, add the cold absolute ethyl alcohol of 2 times of volumes, ice bath is put 10min.

In 4 ℃ of centrifugal 10min of 12000r/min, abandon supernatant, precipitation is dissolved in 20 μ L ddH with after the 75% cold ethanol rinsing after the vacuum drying ₂O or TE (1mmol/L EDTA, 10mmol/L Tris-Cl, pH8.0) put-20 ℃ of Refrigerator stores for subsequent use.

4, the enzyme of recombinant plasmid pET-32a-IFN-γ is cut evaluation

Utilize restriction enzyme BamH I and Hind III to carry out respectively interstitial granules pET-32a-IFN-γ in single endonuclease digestion and the double digestion, enzyme is cut external source fragment and the carrier segment of rear appearance expection size, the bacillus coli DH 5 alpha bacterium liquid that will comprise interstitial granules in this is served the order-checking of sea living worker's biotechnology Engineering Co., Ltd, sequencing result and Genbank (sequence accession number: the sequence alignment of the sika deer IFN-γ that announces X63079), coincidence rate 100% as a result, the construction of recombinant plasmid success that makes up in this invention is described, can be used for expression in escherichia coli.

Embodiment 3, purpose fusion Expression in Escherichia coli and purifying

1, the abduction delivering of genes of interest

The coli strain DH5 α that will include recombinant expression carrier is inoculated in the 3mL LB fluid nutrient medium that contains 25 μ g/mL kanamycins, is cultured to OD in 37 ℃ of shaking tables ₆₀₀Reach 0.6-0.8.From cultured bacterium liquid, get 100 μ L and be inoculated in the fresh LB fluid nutrient medium that 10mL contains 25 μ g/mL kanamycins, in the about 3h of 37 ℃ of shaken cultivation, to OD ₆₀₀Reach 0.6-0.8, adding isopropylthio-β-D-galactoside (IPTG is available from Invitrogen company) to final concentration is 0.8mmol/L, collects thalline after continuing to cultivate 3h.

2, the SDS-PAGE electrophoretic analysis of expression product

2.1SDS-PAGE the preparation of electrophoresis sample

With the centrifugal 15min of recombination bacillus coli 8000r/min after inducing.Precipitate resuspended with the 50mM Tris-HCl (pH8.0) of 1/10 volume, ice bath 30min.Carry out under the condition of ice bath ultrasonic broken broken, until bacterium liquid thickness no longer, 10000r/min, centrifugal 30min.Upper cleer and peaceful precipitation after the cracking takes a morsel respectively, add 2 * protein electrophoresis sample-loading buffer (100mmol/L Tris-HCl (pH6.8), 200mmol/L dithiothreitol (DTT) (DTT is available from Amresco company), 4%SDS (electrophoresis level), 0.2% bromophenol blue, 20% glycerine) 125 μ L, the vibration mixing, 100 ℃ are boiled 10min, the centrifugal 5min of 12000r/min gets supernatant and carries out the SDS-PAGE electrophoretic analysis.

2.2SDS the preparation of polyacrylamide gel and electrophoresis

15% separation gel preparation: purified water 1.6mL, 30% acrylamide solution 2.0mL, 1.5mol/L Tris-Base solution (pH8.8) 1.3mL, 10%SDS 0.05mL, 10% ammonium persulfate 0.05mL, TEMED 0.003mL; Mix rapidly after each composition adds, add in the glue plate, the above adds isobutyl alcohol.

5% concentrated glue preparation: purified water 2.1mL, 30% acrylamide solution 0.5mL, 1.0mol/L Tris-Base solution (pH6.8) 0.38mL, 10%SDS 0.03mL, 10% ammonium persulfate 0.03mL, TEMED 0.003mL; Mix rapidly after each composition adds, above the separation gel of adding glue plate, fill rear insertion application of sample comb.After spacer gel solidifies, take off comb; Gel is fixed on the electrophoretic apparatus, adds the Tris-glycocoll electrophoretic buffer of q.s, in well, add respectively each sample; Electrophoretic voltage 80V, when treating bromophenol blue to the separation gel interface, voltage changes 120V into, to bromophenol blue swimming plastic emitting bottom surface, stops electrophoresis.

2.3 polyacrylamide gel dyeing and decolouring

Unload gel, with coomassie brilliant blue R250 dyeing liquor (45% methyl alcohol, 45% purified water, 10% glacial acetic acid, 0.25% coomassie brilliant blue R250) more than the dyeing 4h, uses again destainer (45% methyl alcohol, 45% purified water, 10% glacial acetic acid) decolours to background colour and slough observations fully.Determine that destination protein is solubility expression or with the formal representation of inclusion body.

2.4 the purifying of recombinant protein

The damping fluid that the expression of recombinant proteins bacterium BL/pET-32a-IFN-γ that collects uses the kit available from Novagen company to carry is resuspended, ultrasonic disruption, 4 ℃ of centrifugal 15min of 12000g get the supernatant loading.Use Ni-NTA HisBand chromatographic column (available from Novagen company) purifying destination protein.Use respectively in conjunction with Binding buffer and lavation buffer solution Washing buffer (20mM Tris-HCl pH7.9,15mMImidazole, 0.5M NaCl) wash post until the OD value reaches near the baseline, use elution buffer Elute buffer (20mM Tris-HCl pH7.9 instead, 40mM Imidazole, 0.5M the NaCl) recombinant protein of elution of bound is collected the crest Partial Protein and is analyzed for further as the recombinant protein of purifying.

3, destination protein is expressed determining of top condition

According to the method for above-mentioned steps 2 (being the SDS-PAGE electrophoretic analysis of expression product), detection shows that the recombination fusion protein IFN-γ that the present invention prepares is solubility expression.Again the conversion of recovery preservation has e. coli bl21 (DE3) the bacterium liquid of pET-32a-IFN-γ, and 37 ℃ of shaking tables are cultured to OD ₆₀₀When reaching 0.6-0.8, be respectively 0.4mM, 0.8mM and 1.0mM according to IPTG concentration, and respectively at inducing front and inducing rear 3h, 4h, 5h sampling, SDS-PAGE analyzes.

The optimum condition of the expression of determining IFN-γ albumen is IPTG 0.8mmol/L, induces the 3h expression the highest for 37 ℃.

4, the recombinant protein purification top condition determines

For groping imidazole concentration best among the Wash Buffer, imidazole concentration among the Wash Buffer is pressed final concentration 30mM, 40mM, three gradient dilutions of 50mM, with behind the centrifugal supernatant upper prop that obtains after the bacteria breaking, add Binding Buffer after, receive respectively sample after adding three concentration Wash Buffer successively, SDS-PAGE analyzes.

The best Wash Buffer imidazole concentration of determining IFN-γ protein purification is 30mM.

Embodiment 4: the preparation of recombinant protein IFN-γ list/polyclonal antibody

1, with recombinant protein IFN-γ immune mouse and White Rabbit

The Balb/C mouse that the present embodiment is used and Japanese screech owl White Rabbit are all available from Hubei Province's prevent disease control center, 6 of the female Balb/C mouse in age in 4-6 week, press the only restructuring IFN-γ of subcutaneous multiple spot inoculation purifying of 200 μ g/, head exempts from equivalent Fu Shi Freund's complete adjuvant recombinant antigen, 2 the week after booster immunization equivalent freund 's incomplete adjuvant antigens, after 2 weeks again hypodermic injection without the equivalent antigen of adjuvant.At least the interval is after 1 month, and the high Balb/C mouse of antibody titer is selected in before fusion the 3rd day, carry out lumbar injection every day by 500 μ g/ antigen doses, behind the continuous immunity 3 days, mouse is carried out tail vein blood, indirect ELISA detects tiring of the anti-CerIFN-gamma antibodies of serum.

Simultaneously, the CerIFN-γ of purifying is pressed the female Japanese screech owl White Rabbit of three above body weight of 2.0kg of above program immunity, antigen immune dosage is 700 μ g/, three exempt to measure serum antibody titer by indirect ELISA afterwards, antibody titer reaches bloodletting after the requirement, utilizes saturated ammonium sulfate method purifying hyper-immune serum.

2, sika deer IFN-gamma cells merges

2.1SP2/0 myeloma cell's activation

Used myeloma (SP2/0) cell of the present embodiment is available from China Veterinary Drugs Supervisory Inst., with the SP2/0 cell of recovery, collects with 0.5mLRPMI-1640 basal liquid (0.5～1 * 106) injection Balb/C mouse back that suspends subcutaneous.Behind 9～10d implanted solid tumor growth, select the time get oncocyte depending on size.

2.2 Fusion of Cells

Get respectively the SP2/0 myeloma cell of immune mouse spleen cell and activation, with the two fusion, prepare simultaneously feeder cells under the effect of fusion agent, with the growth of auxiliary hybridoma, method is summarized as follows (Shi Liangru, 1984):

2.2.1SP2/0 the preparation of oncocyte

If cultivate in the cell bottle, directly wash with the RPMI-1640 basal liquid, centrifugal collection gets final product.The method for preparing from the mouse tumor is as follows: the disconnected neck of mouse is put to death, 75% alcohol-pickled 5mim, and the super-clean bench germ-free condition is got knurl, first tumor mass is cut, and is put in one aseptic; In the plate, to be cut into altogether several fritters first, move to again in the homogenizer, after adding 5mL RPMI-1640 basal liquid and fully grinding, add 10mL RPMI-1640 liquid, leave standstill 2min, be sunken to pipe until the larger agglomerate of organizing, the cell suspension of drawing the upper strata is for subsequent use in another centrifuge tube, adds 10mL RPMI-1640 liquid again at the end, repeat once, the cell suspension volume that takes out is controlled at 30mL.In another 50mL centrifuge tube, add the 15mL lymphocyte separation medium, cell suspension is added in (ratio is 1: 2 to 1: 1) on the parting liquid lightly, 1800～2000r/m 20min, draw the white cellular layer that is positioned at the interface densification with suction pipe, wash 2 times with RPMI-1640 liquid, for subsequent use behind the counting.

2.2.2 the preparation of immune spleen cell:

(1) learn from else's experience one of the Balb/C mouse of last reinforced immunological, eye socket sacrificed by exsanguination (collect serum, be positive serum) is soaked the 5min sterilization in 75% alcohol.

(2) mouse that disinfects is fixed on the dissection plate, forelimb is fixed, and hind leg intersection (left hind is upper) is fixing, clamp lower abdomen skin with tweezers, cut an osculum, tear skin and expose peritonaeum, transducer set tweezers and scissors, cut off peritonaeum, expose spleen, again the transducer set apparatus, clamp spleen with tweezers, remove the adipose tissue of AC with scissors, break the spleen adventitia, put into the homogenizer of sterilization.

(3) add 3mL RPMI-RPMI-1640 basal liquid in homogenizer, grind (too inviolent, in order to avoid the damage splenocyte can be selected the relatively homogenizer of pine), squeeze out splenocyte, taking-up homogenate rod, add 7mL RPMI-1640 basal liquid, leave standstill 2min, draw the upper strata cell suspension in another aseptic 50mL centrifuge tube, add again 10mL RPMI-1640 liquid in homogenizer, the same repetition 2 times.

(4) the centrifugal 10min of 1000r/m removes supernatant, the resuspended rear counting of cell.

2.2.3 the preparation of feeder cells

(1) get a non-immune Balb/C mouse, the negative serum of serum is collected in the eye socket bloodletting.

(2) after four limbs were fixed, the tear initiation skin exposed peritonaeum, cut an osculum (in belly central authorities) at peritonaeum, then inject mouse peritoneal with suction pipe 3mL RPMI-1640 liquid, inhale and beat several times, the liquid sucking-off is put in a 50mL centrifuge tube again, repeats once again, this is peritoneal macrophage.

(3) the same operation prepares splenocyte suspension, and puts into the peritoneal macrophage pipe.

(4) the centrifugal 10min of 1000r/m removes supernatant, the resuspended rear counting of cell.

2.2.4 Fusion of Cells

(1) first with the centrifugal 1000rpm of feeder cells, 5min removes supernatant, and is for subsequent use in 37 ℃ of placements.

(2) with 1-2 * 107 SP2/0 and 108 immunocytes (1: 10-1: 15) mixing in the 50mL centrifuge tube, 1500r/m, centrifugal 10min.

(3) turned letter supernatant (filter paper of available sterilization blots) knocks the pipe end gently, makes cell precipitation loosening slightly.

The centrifuge tube that (4) cell mixture will be housed is put in 37 ℃ of water-baths.Then in 1min, slowly splash into the 50%PEG of pre-temperature to 37 ℃

0.8mL the limit edged stirs 1min with pipette tip gently.

(5) then slowly add 37 ℃ of pre-warm RPMI-1640 basal liquid 10mL.Concrete grammar is: dropwise splashed into 1mL in first minute.Added 1mL in second minute, added 3mL in 3-4 minute, added remaining 5mL on the 5th minute, each added-time needs slowly to add, and constantly stirs lightly.Add at last 30mL RPMI-1640 liquid, also need slowly to add.

(6) the centrifugal 5min of 8000r/m goes supernatant to place 5-8min in 37 ℃.

(7) with the suspension of HAT nutrient culture media, the while is also used the mixing with cells after splenocyte and fusion are raised in the suspension of HAT nutrient culture media, adds as required an amount of HAT nutrient culture media, divides and plants in 96 well culture plates, approximately 250 μ L/ holes.Single cell fusion can be inoculated 4-8 piece 96 orifice plates.Also can plant less as required, generally press the cell number of SP2/0 and calculate, every hole inoculum concentration approximately contains 10 ⁴About SP2/0 cell.

(8) in 37 ℃, 5%CO ₂Cultivate in the incubator.

(9) merge after second day begin to observe, have pollution-freely, added 1 HAT nutrient culture media in the 4th day, sucked 100 μ L nutrient culture media and change HT nutrient culture media 100 μ L in 8-10 days.Treat that the fused cell colony grows to culture hole 1/4, when nutrient culture media omits flavescence, carry out antibody test.

2.2.5 indirect ELISA method detects the hybridoma supernatant, the screening positive hybridoma cell

In measuring 4 ℃ of the previous days coated spend the night (gG:50ng/ hole), cleansing solution is washed three times and is patted dry, 37 ℃ of sealing 1h, cleansing solution is washed three times and is patted dry, add the Hybridoma Cell Culture supernatant, in 37 ℃ of incubation 1h, cleansing solution is washed three times and is patted dry, and adds the sheep anti-mouse igg-HRP of dilution in 1: 10000,37 ℃ of incubation 45mins, wash 5 times, add tmb substrate 100 μ L, lucifuge colour developing 10min, add at last 50 μ L stop buffer cessation reactions, under the 630nm wavelength, measure the OD value with microplate reader, establish simultaneously the culture supernatant of SP2/0 cell as negative control, OD ₆₃₀Sample greater than 2 times of negative controls is positive.

2.2.6 the cloning of hybridoma (limiting dilution assay)

(1) before the clone or prepare the mouse feeder layer the previous day.

(2) hybridoma that will clone is blown down in culture hole gently, blood cell counting plate living cell counting number.

(3) cell is diluted to 5,10,50 cells/ml with complete medium.

(4) cell suspension of above-mentioned three concentration is added respectively 96 well culture plates of the feeder cells that prepared, 100 μ L/ holes make corresponding every hole contain respectively 0.5,1 and 5 cell.

(5) cultivate and to change liquid once on the 4th day, examined the growing state of each hole inner cell and record in 5-6 days.

(6) detection of specific antibody: behind the clone 7-9 days, when cell clone covers with 1/3-1/2 the visual field, can detect, as detect the Growth of Cells hole specific antibody is arranged, can select antibody titer high, be single clonal growth, the cell hole that form is good continues to clone or enlarge cultivation with method.

(7) cell in positive hole can be moved to 24 well culture plates, and adds another batch nutrient culture media in foramen primum, in case the two pollutes or cell death simultaneously.When treating that Growth of Cells in 24 orifice plates is good, but transferred species to little square vase, and frozen cell more than 2.

Embodiment 5: the evaluation of sika deer IFN-γ monoclonal antibody

1, the detection of hybridoma chromosome number

After passage is cultivated 48h, add demecolcine, make its ultimate density reach 0.04 μ g/mL, continue to cultivate 2-2.5h.After stopping cultivating, adherent cell is all blown down with suction pipe, moved into the centrifuge tube of 10mL, with the centrifugal 10min of 1000r/m, abandoning supernatant.The potassium chloride hypotonic solution 5mL that adds the 0.075mol/L of 37 ℃ of pre-temperature with suction pipe piping and druming evenly, puts 37 ℃ of water-bath 15-20min.Every pipe add freshly prepared immobile liquid (methyl alcohol: glacial acetic acid=3: 1) 1mL mixing, with the centrifugal 10min of 1000r/m, remove supernatant.Every pipe is fixed liquid 5mL again, and mixing behind the static 30min, with the centrifugal 10min of 1000r/m, is abandoned supernatant gently.Again fixing, be fixed liquid 5mL, the static 30min of mixing with the centrifugal 10min of 1000r/m, abandons supernatant gently, is fixed liquid 5mL with same method and beats evenly, seals up the mouth of pipe in 4 ℃ of static spending the night.Suck gently supernatant, stay the supernatant about 0.5mL, mixing suspends cell, draw cell suspension 2-3 with dropper and drip, drop on the microslide of the cleaning of soaking with frozen water, dispel immediately, and at flame by several times, impel cell to be tiled on the microslide, natural drying.With 10%Giemsa dye liquor dyeing 10min, the flush away washing lotion is natural drying.Observe counting (Zhang Gusheng, Rong Bingpei, 1987) in microscopically at last.

2, the production of monoclonal antibody and titration

Build hybridoma after the strain and enlarge and cultivate, collect supernatant, measure with indirect ELISA and tire.Also can in Mice Body, induce mouse ascites manufacture order clonal antibody, get the 8-10 mouse in age in week, the whiteruss 0.5mL/ that lumbar injection is sterilized, 7-10 days pneumoretroperitoneum injection hybridomas 5 * 10 ⁵/ only, extract mouse ascites after 7-10 days, the centrifuging and taking supernatant, mensuration is tired, and frozen.

3, the specificity of Western-blot analysis list clonal antibody

The recombination fusion protein IFN-γ of above-mentioned purifying is carried out the SDS-PAGE electrophoresis.

Shift: cut out 6 Whatman 3M filter paper and 1 nitrocellulose membrane (NC film), the size of filter paper and film will equate fully with the size of gel or be slightly less than gel, marks one jiao of filter membrane with pencil, guarantees the relative direction of transfer printing caudacoria and gel; Nitrocellulose membrane is soaked 5min in purified water; In another shallow pallet, add a small amount of transfering buffering liquid (39mmol/L glycocoll, 48mmol/L Tris alkali, 0.037% SDS (electrophoresis level), 20% methyl alcohol), 6 Whatman 3M filter paper are soaked in wherein.Then the electrophoretic blotting groove is installed as follows: keep flat the base (negative pole) of graphite electrode, put successively 3 layers of 3M filter paper, polyacrylamide gel, nitrocellulose membrane and 3 layers of 3M filter paper.The bubble of thoroughly getting rid of each interlayer; The loam cake of electrophoretic blotting groove is anchored on graphite electrode-transfer membrane glue complex; Connect power supply, according to the gel slab area according to 0.65-1.0mA/cm ²The parameter turn-on current, electrophoretic transfer 0.5-2h.

The NC film is placed among the 1 * TBST (10mmol/L Tris-HCl, 150mmol/L NaCl, 0.05%Tween-20, pH8.0) of the skimmed milk power that contains 1%BSA and 5%, room temperature sealing is spent the night or 30min at least;

Wash film: abandon confining liquid, wash the NC film 3 times with 1 * TBST, each 5min;

Primary antibodie is hatched: the NC film is put into the sika deer IFN-γ monoclonal antibody (volume ratio is 1: 3000) of diluting with 1 * TBST, hatched 1h for 37 ℃;

Wash film: take out the NC film, wash film 3 times with 1 * TBST, each 10min;

Two anti-hatching: film is changed over to goat-anti ox IgG (available from the Sigma company) antibody (volume ratio is 1: 5000) of HRP (horseradish peroxidase) mark of 1 * TBST dilution, hatch 1h for 37 ℃;

Wash film: take out the NC film, wash film 3 times with 1 * TBST, each 10min;

Colour developing: the NC film is placed the DAB nitrite ion of new configuration, put the dark place colour developing, after the color depth of protein band reaches requirement, wash with cessation reaction with 1 * TBST.

The result shows, sika deer IFN-γ monoclonal antibody shows very high specificity, and reaction does not appear in negative control group (pET32a (+) vector expression bacterium).

Embodiment 6: building up of sika deer IFN-γ double-antibodies sandwich ELISA is vertical

1. the mensuration of sika deer IFN-γ monoclonal antibody susceptibility

Utilize double-antibody sandwich elisa to measure sika deer IFN-γ monoclonal antibody susceptibility.(the 25mmol/L carbonate buffer solution, pH9.6) 3000 times of dilutions of conservative value monoclonal antibody adds in the elisa plate hole by every hole 100 μ l, 4 ℃ of coated spending the night with coating buffer.Inferior daily PBST (PBS, the pH7.4 that contain 0.05%Tween20) fully adds 37 ℃ of sealings of 5% skimmed milk power 45min after the washing.After PBST fully washs, increase progressively dilution antigen (CerIFN-γ standard items) with cleansing solution, be 50ng, 25.5ng, 12.75ng, 6.375ng, 3.1875ng, 1.593ng, 0.79ng, 0.398ng, 0.199ng, 0.099ng, 0.498ng, 0.025ng, 0.012ng, 0.006ng, 0.003ng and 12 gradients of 0.002ng after the dilution, hatch 1h, repeated washing for 37 ℃.With the anti-CerIFN-γ of the rabbit polyclonal antibody of 5000 times of dilutions of the conservative value of cleansing solution, every hole 100 μ l are hatched fully washing behind the 45min for 37 ℃.The HRP-goat anti-rabbit igg that adds dilution in 1: 5000, every hole 100 μ l, 37 ℃ of 30min, fully every hole 100 μ lTMB/H after the washing ₂O ₂Substrate solution, behind the room temperature lucifuge reaction 10min, every hole adds 50 μ l stop buffer (0.25% hydrofluorite) cessation reactions, reads the optical density value (OD) of wavelength 630nm.

2. sika deer IFN-γ list/polyclonal antibody best effort concentration determines

Utilize the square formation indirect titration to determine that best best effort concentration is definite.With sika deer IFN-γ as antigen, be coated with 96 hole elisa plates with 50ng, 25.5ng, 12.75ng, 6.375ng, 3.1875ng, 1.593ng, 0.79ng, 0.398ng, 0.199ng, 0.099ng, 0.498ng, 0.025ng, 0.012ng, 0.006ng, 0.003ng and 12 gradients of 0.002ng by every hole 100 μ L respectively, 4 ℃ of coated spending the night.Inferior daily PBST fully washs 37 ℃ of sealings of rear adding 5% skimmed milk power 30min.With the CerIFN-γ monoclonal antibody of cleansing solution 200,400,800,1600,3200,6400,12800 and 25600 times of 8 gradient dilutions the CerIFN-γ polyclonal antibody of cleansing solution 400,800,1600,3200,6400,12800,25600 and 51200 times of 8 gradient dilutions (or with), every hole 100 μ L are hatched fully washing behind the 30min for 37 ℃.The HRP-sheep anti-mouse igg (or HRP-goat anti-rabbit igg) that adds dilution in 1: 5000, every hole 100 μ l, 37 ℃ of 30min, fully every hole 100 μ L TMB/H after the washing ₂O ₂Substrate solution, behind the room temperature lucifuge reaction 10min, every hole adds 50 μ L stop buffer (0.25% hydrofluorite) cessation reactions, reads the optical density value (OD) of wavelength 630nm

3. the external specificity of sika deer IFN-γ discharges

Extract sika deer jugular vein blood, anticoagulant heparin.Add respectively whole blood in three holes of 24 porocyte culture plates by the 1.5ml/ hole, wherein positive control contains 60 μ g con As (Con A), detect hole 80 μ g tulase specific proteins Rv3872-CFP10-ESAT6 fusions, the blank hole contains 50 μ basis RPMI-1640.Slight shaken cultivation plate makes each hole reagent fully mix with blood, in containing 5%CO ₂Cell culture incubator in 37 ℃ cultivate 16-24h.Collect culture supernatant next day, sandwich ELISA detects IFN-γ concentration.

4. sika deer IFN-γ detects the foundation of sandwich ELISA

Suitably dilute monoclonal antibody with coating buffer, add in the elisa plate hole by every hole 100 μ l, 4 ℃ of coated spending the night.Inferior daily PBST fully washs 37 ℃ of sealings of rear adding 5% skimmed milk power 45min.After PBST fully washed, the above-mentioned three kinds of supernatants of every hole 100 μ l were hatched 1h, repeated washing for 37 ℃.With the suitable anti-CerIFN-γ of the rabbit polyclonal antibody of dilution of cleansing solution, every hole 100 μ l are hatched fully washing behind the 45min for 37 ℃.The HRP-goat anti-rabbit igg that adds dilution in 1: 5000, every hole 100 μ l, 37 ℃ of 30min, fully every hole 100 μ lTMB/H after the washing ₂O ₂Substrate solution, behind the room temperature lucifuge reaction 10min, every hole adds 50 μ l stop buffer (0.25% hydrofluorite) cessation reactions, reads the optical density value (OD) of wavelength 630nm.

Embodiment 7: sika deer IFN-γ detects the application of diagnosis method

1. the processing of sample

Get 120 parts of anti-freezing sika deer deer blood sample, add respectively by the 1.5ml/ hole in three holes of 24 porocyte culture plates, wherein positive control contains 60 μ g con As (available from Sigma company), detecting hole 80 μ g preserving numbers is that (number of patent application is 2009100609131 to CCTCC NO:M208244, patent publication No. is CN101538578A) prapes specificity three gene fusion antigen protein RCE, 50 μ basis RPMI-1640 (prescription is seen appendix 1) is contained in the blank hole.Slight shaken cultivation plate makes each hole reagent fully mix with blood, cultivates 16-24h for 37 ℃ in the cell culture incubator that contains 5%CO2, collects culture supernatant next day.

2. detect above-mentioned sample (control test 1) with commercialization ELISA kit

The used commercialization ELISA kit of the present embodiment is available from Wuhan Keqian Animal Biological Products Co., Ltd..Method is as follows: (number of patent application is 2009100609131 as CCTCC NO:M208244 to use preserving number, patent publication No. is CN101538578A) prapes specificity three gene fusion antigen protein RCE, in 4 ℃ of coated elisa plates that spend the night, cleansing solution washing 3 times, with 37 ℃ of sealings of 5% skimmed milk power 1h of cleansing solution dilution, cleansing solution adds 1: 100 (volume ratio) times dilute serum, 100 μ L/ holes after washing plate 3 times, repeat 3 times in every hole, 37 ℃ of reaction 30min.Wash plate and add afterwards the goat-anti ox IgG that volume ratio is 1: 10000 (volume ratio) dilution for 3 times, 37 ℃ of reaction 30min.Wash and add 100 μ L substrate solutions behind the plate 5 times and (contain 1mg/mL TMB and 0.03%H ₂O ₂), add the 0.25%HF cessation reaction behind the lucifuge colour developing 10min, in OD ₆₃₀Reading.(as a result table 1)

3. with the above-mentioned sample of commercialization ELISA test strip (control test 2):

The used commercialization test strips of the present embodiment available from Korea S animal heredity company (English name of company: Animal Genetices, Inc, trade name is: Anigen Rapid Bovine TB Ab Test Kit).Instructions operation according to test strips: the blood sample of above-mentioned sika deer to be checked is got 100 μ L add in the ELISA test strip hole observations behind the 10min (as a result table 2).

4. detect with sika deer gamma interferon double-antibodies sandwich ELISA of the present invention:

Concrete grammar is as follows: according to 50ng/ hole dilution monoclonal antibody, add in the ELISA ELISA Plate hole 4 ℃ of coated spending the night by every hole 100 μ l with coating buffer (seeing appendix 2).Inferior daily washing fluid (seeing appendix 2) fully adds 37 ℃ of sealings of 5% skimmed milk power 45min after the washing.After fully washing with washing fluid, every above-mentioned three kinds of supernatants of hole 100 μ l (blood sample to be checked) are hatched 1h, repeated washing for 37 ℃.With the anti-sika deer gamma interferon of the rabbit polyclonal antibody of washing fluid (50ng/ hole) dilution, every hole 100 μ l are hatched fully washing behind the 45min for 37 ℃.The goat anti-rabbit igg that adds the horseradish peroxidase-labeled of dilution in 1: 5000, every hole 100 μ l, 37 ℃ of 30min, every hole 100 μ l nitrite ions after fully washing, behind the room temperature lucifuge reaction 10min, every hole adds 50 μ l stop buffer (seeing appendix 3) cessation reactions, measures absorbance on enzyme-linked immunosorbent assay instrument in 630nm wavelength place.

Table 1120 part testing sample testing result

Table 2120 part testing sample testing result

5. result's judgement

When the OD value difference of positive and negative control hole 〉=0.25, the OD value difference of specific antigen (RCE) and negative control hole 〉=0.1 o'clock is judged as the tuberculosis positive;

When the OD value difference of positive and negative control hole 〉=0.25, the OD value difference of specific antigen (RCE) and negative control hole＜0.1 o'clock is judged as the tuberculosis feminine gender;

When the OD value difference of positive and negative control hole＜0.25, the OD value difference of specific antigen (RCE) and negative control hole＜0.1 o'clock, the result can't determine.

Appendix 1

1, the preparation of RPMI1640 basic culture solution

(1) measures deionized water 950ml, place certain container;

(2) RPMI1640 pulvis (available from the green skies, Shanghai Bioisystech Co., Ltd) 10g is added in 15 ℃-30 ℃ the deionized water, the limit edged stirs, and obtains nutrient solution;

(3) in the nutrient solution of step (2), add the 2g sodium bicarbonate by the 1000ml nutrient solution;

(4) add water to 1000ml, use CO ₂Medium pH value is transferred to pH6.5-6.8, before filtering, should cover tightly the container bottle stopper;

(5) be the miillpore filter positive press filtration degerming of 0.22 μ m with the aperture immediately, 4 ℃ of Refrigerator stores are for subsequent use.

Appendix 2

(1) washing fluid: sodium chloride 8.0g, potassium chloride 0.2g, sodium hydrogen phosphate 0.2g, potassium dihydrogen phosphate 2.9g, Tween-20 0.5ml is settled to 1000ml with distilled water, pH7.4.

(2) coating buffer: sodium carbonate 1.59g, sodium bicarbonate 2.93g is settled to 1000ml with distilled water.

(3) confining liquid: washing fluid 100ml, skim milk 10g.

Appendix 3

The preparation of nitrite ion:

The preparation of colour developing A liquid: sodium hydrogen phosphate 71.6g, citric acid 19.2g is settled to 1000ml with distilled water.

The preparation of colour developing B liquid: the phosphate-citrate salts damping fluid 100ml of 0.1mol/L pH5.0 (sodium hydrogen phosphate 7.16g, citric acid 1.92g is settled to 100ml with distilled water), o-phenylenediamine 40mg, the hydrogen peroxidase 10 .15ml of 30% concentration.

Stop buffer: 2mol/L sulfuric acid 22.2ml, distilled water 177.8ml.

Illustrate: " the sika deer interferon-γ " of name is the same biological material specimens in " sika deer gamma interferon " of the present invention and the biological material specimens preservation proof, and " the sika deer interferon-γ " that this instructions is named biological material specimens is revised as " sika deer gamma interferon " and is more suitable for Chinese statement custom.

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉spotted deer gamma-interferon double-antibody sandwich ELISA detection method and kit and application

<130>

<141>2010-01-28

<160>4

<170>PatentIn version 3.1

<210>1

<211>438

<212>DNA

＜213〉sika deer (Cervus nippon)

<220>

<221>gene

<222>(1)..(438)

<223>

<220>

<221>CDS

<222>(1)..(438)

<223>

<400>1

tct tat ggc cag ggc cca ttt ttt aaa gaa ata gaa aac tta aag gag 48

Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu

1 5 10 15

tat ttt aat gca agt aac cca gat gta gct gag ggt ggg cct ctt ttc 96

Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Glu Gly Gly Pro Leu Phe

20 25 30

ata gaa att ttg aag aat tgg aaa gag gag agt gac aga aaa att att 144

Ile Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp Arg Lys Ile Ile

35 40 45

cag agc caa att gtc tcc ttc tac ttc aaa ctc ttt gaa aac ttc aaa 192

Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Phe Lys

50 55 60

gat aac cag gtc att cag agg agc gtg gat atc atc aag caa gac atg 240

Asp Asn Gln Val Ile Gln Arg Ser Val Asp Ile Ile Lys Gln Asp Met

65 70 75 80

ttt cag aag ttc ttg aat ggc agc tct gag aaa ctg gag gac ttc aaa 288

Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys

85 90 95

aag ctg att caa att tcg gtg gat gat atg cag atc cag cgc aaa gcc 336

Lys Leu Ile Gln Ile Ser Val Asp Asp Met Gln Ile Gln Arg Lys Ala

100 105 110

ata aat gaa ctc atc aaa gtg atg aat gac ctg tcg cca aaa tct aac 384

Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn

115 120 125

ctc ata aag cgg aag aga agt cag aat ctc ttt cga ggc cgg aga gca 432

Leu Ile Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala

130 135 140

tca atg 438

Ser Met

145

<210>2

<211>146

<212>PRT

＜213〉sika deer (Cervus nippon)

<400>2

Ser Tyr Gly Gln Gly Pro Phe Phe Lys Glu Ile Glu Asn Leu Lys Glu

1 5 10 15

Tyr Phe Asn Ala Ser Asn Pro Asp Val Ala Glu Gly Gly Pro Leu Phe

20 25 30

Ile Glu Ile Leu Lys Asn Trp Lys Glu Glu Ser Asp Arg Lys Ile Ile

35 40 45

Gln Ser Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe Glu Asn Phe Lys

50 55 60

Asp Asn Gln Val Ile Gln Arg Ser Val Asp Ile Ile Lys Gln Asp Met

65 70 75 80

Phe Gln Lys Phe Leu Asn Gly Ser Ser Glu Lys Leu Glu Asp Phe Lys

85 90 95

Lys Leu Ile Gln Ile Ser Val Asp Asp Met Gln Ile Gln Arg Lys Ala

100 105 110

Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro Lys Ser Asn

115 120 125

Leu Ile Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg Gly Arg Arg Ala

130 135 140

Ser Met

145

<210>3

<211>30

<212>DNA

＜213〉sika deer (Cervus nippon)

<220>

<221>primer_bind

<222>(1)..(30)

<223>

<400>3

atatggatcc gatcttatgg ccagggccca 30

<210>4

<211>34

<212>DNA

＜213〉sika deer (Cervus nippon)

<220>

<221>primer_bind

<222>(1)..(34)

<223>

<400>4

taataagctt ttacgttgat gctctccggc ctcg 34

Claims (4)

1. the cell line CerIFN-γ 4C that a strain can stably excreting sika deer gamma interferon monoclonal antibody is deposited in Chinese Typical Representative culture collection center, and deposit number is CCTCC NO:C200966.

2. monoclonal antibody specific by the sika deer gamma interferon of the described cell line of claim 1 secretion.

3. the double-antibody sandwich elisa detection kit of a sika deer gamma interferon, it is characterized in that, this kit comprises that deposit number is the sika deer gamma interferon monoclonal antibody of the cell line CerIFN-γ 4C secretion of CCTCC NO:C200966, sika deer IFN-γ polyclonal antibody, this polyclonal antibody is to be that Escherichia coli (Escherichia coli) BL21/pET-28a-RCE of CCTCC NO:M208244 is expressed by preserving number, horseradish peroxidase mark goat anti-rabbit igg, nitrite ion and stop buffer

Wherein said nitrite ion and stop buffer compound method are as follows:

Nitrite ion: sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Supply distilled water to 100ml, obtain A liquid; Sodium hydrogen phosphate 7.16g; Citric acid 1.92g; Supply distilled water to 100ml, pH 5.0, obtain the phosphate-citrate salts damping fluid 100ml of 0.1mol/L, add o-phenylenediamine 40mg; The hydrogen peroxidase 10 .15ml of 30% concentration obtains B liquid, mixes described A liquid and B liquid, obtains nitrite ion;

Stop buffer: 2mol/L sulfuric acid (H ₂SO ₄) 22.2ml; Distilled water 177.8ml.

4. the application of monoclonal antibody claimed in claim 2 in preparation sika deer gamma interferon detection kit.

Images