CN100500844C

CN100500844C - High secretion expression of recombination thymosin-alpha 1 in Escherichia coli and separation and purification therefor

Info

Publication number: CN100500844C
Application number: CNB200510024236XA
Authority: CN
Inventors: 甘人宝; 张倩; 冯宝山; 钱悦; 杜鹏; 丁红珍; 周庆玮
Original assignee: SHANGHAI APELOA PHARMACEUTICAL RESEARCH Co Ltd
Current assignee: Apeloa Pharmaceutical Co ltd; Shanghai Puluochuangzhi Pharmaceutical Technology Co ltd
Priority date: 2005-03-07
Filing date: 2005-03-07
Publication date: 2009-06-17
Anticipated expiration: 2025-03-07
Also published as: CN1831126A

Abstract

The invention supplies a recombination thymosin alpha 1 gene, expression particle pKAT, engineering bacterium YKAT containing pKAT and filtered engineering strain YKAT-8, and the manufacture method for recombination thymosin alpha 1. It uses colibacillus preference codon, designing and combining recombination thymosin alpha 1 gene, recombining the upstream sequence, constructing pKAT and constructing and filtering YKAT-8. After fermenting and cultivating, directly excreting rT alpha-1 into culture medium, and the excreting quality could reach 500mg/L, and the purity could be over 95% after separating and purifying. It could sharply decrease producing cost and production cycle.

Description

High secreting, expressing and the separation and purification of recombinant thymin alpha-1 in intestinal bacteria

Technical field

The invention belongs to bioengineering field, be specifically related to prepare recombinant thymin alpha-1 by gene engineering method.

Background technology

Thymus gland is the most important immune organ of human body, in immunity system, has crucial status, middle nineteen seventies, people separate from thymic tissue and obtain a kind of blended Thymosin prepared product, be referred to as TF5, the TF5 component is considered to strong immune-system enhancers, can impel the ripe and function of bringing into normal play of T cytodifferentiation, increase the antibody expression and the immune allograft reaction of body, promote expression of MIF (macrophage migration inhibition factor) or the like.

Thymosin (Thymosin α 1, be called for short: T α 1) be the earliest from the TF5 component purifying obtain an active polypeptide of homogeneous state, form by 28 amino acid; the N end is acetylation, and iso-electric point is pH4.2, molecular weight 3108; do not contain methionine(Met), halfcystine and aromatic amino acid.Survey in live system as MIF induces, demonstration is tested in the experiment of E one rosette, the generation of induction of lymphocyte surface markers etc. at some, thymosin exceeds 10 to 1000 times than TF5 activity, having significant immunocompetence, is one of main immune active ingredient in the TF5 component.

Thymosin is the strong toughener of immunity system, can promote immune multiple function, be applicable to a lot of treatment of diseases clinically, as the treatment of assisting therapy, immunocompromised disease and the immunological disease of virus disease hepatitis B and therapy for hepatitis C, cancer.

The production technique of the thymus gland series products of selling on the market at present, has two kinds: chemical synthesis and animal tissues's extraction method.The complex manufacturing of chemical synthesis, yield is low, the cost height, product price is very expensive; And the product that animal tissues extracts is a mixture, and price is low, but the quality instability, curative effect has sensitization not as thymosin to some patient.These have all greatly limited the application clinically of this product.If can reduce production costs, the thymosin medicine of high-quality cheapness is provided in a large number, will produce very high social benefit and economic benefit.

Producing polypeptide with gene engineering method and belong to newer problem in the genetically engineered field, also is a difficult problem.Because the molecular weight of polypeptide is less, be easy to by protease hydrolysis when in host bacterium thalline, expressing, according to newspaper

Producing polypeptide with gene engineering method and belong to newer problem in the genetically engineered field, also is a difficult problem.Because the molecular weight of polypeptide is less, be easy to by protease hydrolysis when in host bacterium thalline, expressing, it is reported that direct expression levels only can reach every liter several milligrams level, therefore, at present the domestic and international production technique that adopts mostly is limited to the gene multiple copied and expresses or with the formal representation polypeptide of fusion rotein, but also need the post-treatment step such as cut through chemical cracking or enzyme with these method expressed products, production technique is very complicated, loaded down with trivial details.

Present inventors concentrate on studies to the direct secretion express polypeptide, utilize the constructed expression system direct secretion express recombinant thymosin (rT α-1) of intestinal bacteria alkaline phosphatase promotor and signal peptide gene to substratum, obtained very high secreting, expressing amount, illustrate that it is not only feasible producing thymosin with the mode of secreting, expressing, and be the very effective mode of production, thereby finished the present invention.

Therefore, an object of the present invention is to provide the recombinant thymin alpha-1 gene.

Another object of the present invention provides the expression plasmid pKAT of secreting, expressing recombinant thymin alpha-1.

A further object of the present invention provides the engineering bacteria YKAT of secreting, expressing recombinant thymin alpha-1.

The engineering strain YKAT-8 that also has a purpose to provide high secretion express recombinant thymosin of the present invention.

Further purpose of the present invention provides the method for direct secretion express recombinant thymosin.

Summary of the invention

Recombinant thymin alpha-1 gene provided by the invention has the following nucleotide sequence shown in the SEQ ID NO.1 in the sequence table: 5 '-TCTGACGCTG CTGTTGACAC TTCTTCCGAA ATCACTACCA AAGACCTGAA AGAAAAGAAA GAAGTTGTAG AAGAGGCTGA AAACTAATAA3 '

The expression plasmid pKAT of secreting, expressing recombinant thymin alpha-1 provided by the invention is that initial plasmid construction forms with pTZ18R; Comprise the recombinant thymin alpha-1 gene shown in the SEQ ID NO.1, and the startup that is positioned at described upstream region of gene is expressed and the alkaline phosphatase phoA promotor and the signal peptide gene of secretion recombinant thymin alpha-1, and the kalamycin resistance gene that derives from pET-24a (+).

Among the expression plasmid pKAT of the present invention, described promotor and signal peptide gene also comprise can start all prokaryotic promoters and the signal peptide gene of expressing and secreting recombinant thymin alpha-1.

Engineering bacteria YKAT provided by the invention is that expression plasmid pKAT is transformed into intestinal bacteria YK537 and all bacterial strains with kalamycin resistance of obtaining.

The present invention also provides the engineering strain YKAT-8 of secreting, expressing recombinant thymin alpha-1, and described engineering strain is the highest bacterial strain of expression amount that filters out from engineering bacteria YKAT.

1. utilize the intestinal bacteria preference codon to design and synthesize the recombinant thymin alpha-1 gene according to the aminoacid sequence of natural thymosin;

2. be initial plasmid with pTZ18R, with intestinal bacteria alkaline phosphatase phoA promotor and signal peptide gene upstream sequence, construction expression plasmid pKAT as the recombinant thymin alpha-1 gene;

3. access kalamycin resistance gene;

4. make up and filter out engineering strain YKAT-8;

5. the fermentation culture of genetic engineering bacterium YKAT-8;

6. the separation and purification of expression product.

Recombinant thymin alpha-1 separation purification method provided by the invention is the array mode that adopts ultrafiltration, anion exchange chromatography, gel permeation chromatography and anti-phase high pressure liquid chromatography.

The invention is characterized in and utilize the intestinal bacteria preference codon to design the gene order of thymosin at escherichia coli expression according to the aminoacid sequence of natural thymosin; and the mode that the first Application direct secretion is expressed is produced recombinant thymin alpha-1; successfully direct secretion express recombinant thymosin is to substratum; present secreting, expressing level has reached 500 milligrams every liter; through separation and purification; obtain N and hold the pure product of non-acetylizad recombinant thymin alpha-1, its purity is greater than 95%.Experiment showed, that the recombinant thymin alpha-1 of purifying and the thymosin of chemosynthesis have similar biological activity, and than Zadaxin to be mixed with thing active high.Method steps of the present invention is simple, the method of producing thymosin with chemosynthesis and intestinal bacteria amalgamation and expression compares, obviously reduce and shorten in productive expense with on the production cycle, thereby make large-scale industrial production, extensive clinical application become possibility.

Description of drawings

Fig. 1 is a pAAT plasmid construction synoptic diagram.

Fig. 2 is a pKAT plasmid construction synoptic diagram.

Fig. 3 is that the enzyme of plasmid pAAT is cut evaluation figure.Among the figure, the 1st swimming lane is the electrophoretic band of pAAT after PstI, HindIII enzyme are cut; The 2nd swimming lane is the DNA standard molecular weight.

Fig. 4 is the SDS-PAGE gel electrophoresis figure that engineering bacteria YKAT shakes the bottle screening.Among the figure, 1-5,8-13,15 swimming lanes are 300 μ l shake-flask culture base supernatants, are followed successively by engineering bacteria YKAT1-12; The 6th swimming lane is the YK537 substratum supernatant that 300 μ l do not contain plasmid; The 7th, 14 swimming lane is the thymosin standard substance of chemosynthesis.

Fig. 5 is engineering strain YKAT-8 expresses supernatant in fermentor tank a SDS-PAGE gel electrophoresis figure.Among the figure, the 1-3 swimming lane is 10 μ l fermented liquid supernatant, be followed successively by to cultivate 14 hours, and 16 hours, 18 hours; The 4-8 swimming lane is the thymosin standard substance of chemosynthesis, is followed successively by 0.5 μ g, 1 μ g, 2 μ g, 3 μ g, 5 μ g.

Fig. 6 is Q Sepharose Fast Flow ion-exchange purification figure.

Fig. 7 is Sephadex G-50 gel-filtration purifying figure.

Fig. 8 is reversed-phase HPLC purifying figure.

Fig. 9 is the SDS-PAGE electrophoretic analysis figure of purified product.Among the figure, the 1st swimming lane is the recombinant thymin alpha-1 of 10 μ g purifying; The 2nd swimming lane is the thymosin standard substance of 10 μ g chemosynthesis.

Figure 10 is the reversed-phase HPLC rating diagram of purified product.

Figure 11 is the N terminal amino acid sequence rating diagram (1) of purified product.

Figure 12 is the N terminal amino acid sequence rating diagram (2) of purified product.

Figure 13 is the N terminal amino acid sequence rating diagram (3) of purified product.

Describe the present invention with embodiment below.These embodiment only illustrate, and the present invention are not constituted any restriction.

Embodiment 1 designs and synthesizes the recombinant thymin alpha-1 gene:

We have designed following two fragments (SEQ ID NO.3 in the sequence table and SEQ ID NO.4), and underscore partly is two fragment complementation districts.When fragment is synthesized in design, fully followed following principle:, select the codon of intestinal bacteria preference for use according to the aminoacid sequence (the SEQ ID NO.10 in the sequence table) of natural thymosin; AT, GC content near and be evenly distributed; Avoid the generation of secondary structure in the fragment; The intersegmental tumor-necrosis factor glycoproteins of avoiding of sheet; 3 ' end at gene adds two terminator codons.

Fragment 1:5 '-TCTGACGCTGCTGTTGACACTTCTTCCGAAATCACTAC

CAAA GACCTGAAAGAAAAG—3′

Fragment 2:5 '-CCCAAGCTTATTAGTTTTCAGCCTCTTCTACAACTTCTTT

CTTTTCTTTCAGGTC—3′

Two each 1OD of gene fragment with above-mentioned chemosynthesis, 95 ℃ of annealing 5 minutes, slow again cool to room temperature, add 5U klenow enzyme (TaKaRa company), 8 μ l 2.5mM dNTP (TaKaRa company) and 10 μ l, 10 * klenow enzyme buffer liquid (TaKaRa company), replenish distilled water to 100 μ l, 37 ℃ of polymerizations 2 hours, electrophoresis in 1.5% sepharose, extract the 97bp segment, reclaim test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims this dna fragmentation, is recombinant thymin alpha-1 gene (the SEQ ID NO.1 in the sequence table).Corresponding natural human thymosin gene is seen the SEQ ID NO.2 in the sequence table.

Embodiment 2 chemosynthesis alkaline phosphatase phoA promotor and signal peptide genes:

We are fully according to synthetic this gene of the natural gene sequence (the SEQ ID NO.5 in the sequence table) of intestinal bacteria alkaline phosphatase phoA promotor (phoA-P) and signal peptide (sig).Earlier synthetic following 4 fragments (fragment 3-6) (being followed successively by SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ IDNO.9 in the sequence table), underscore partly are the intersegmental complementary district of sheet.Add the restriction enzyme site of PstI, BglII, XbaI at the 5 ' end of phoA-P, so that make up.

Fragment 3:5 '-AACTGCAGATCTAGAGCTCGTCAGTAAAAAGTTAATCTTT

TC AACAGCTGTCATAAAGTT-3′

Fragment 4:5 '- TTAAAAAATAAAAACAAAGCGACTATAAGTCTCGGCCGTG

AC AACTTTATGACAGCTGTT-3′

Fragment 5:5 '- TTTGTTTTTATTTTTTAATGTATTTGTACATGGAGAAAAT

AA AGTGAAACAAAGCACTAT-3′

Fragment 6:5 '-CGCTTTTGTCACAGGGGTAAACAGTAACGGTAAGAGTGCC

AGTGCA? ATAGTGCTTTGTTTCACT-3′

Four each 1OD of gene fragment with above-mentioned chemosynthesis, 95 ℃ of annealing 5 minutes, slow again cool to room temperature, add 5U klenow enzyme (TaKaRa company), 8 μ l 2.5mM dNTP (TaKaRa company) and 10 μ l, 10 * klenow enzyme buffer liquid (TaKaRa company), replenish distilled water to 100 μ l, 37 ℃ of polymerizations 2 hours, electrophoresis in 1.5% sepharose, extract the 190bp segment, reclaim test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims this dna fragmentation, is alkaline phosphatase phoA promotor and signal peptide gene.

The structure (Fig. 1) of embodiment 3 expression plasmids:

3.1 the enzyme of carrier is cut processing:

With plasmid pTZ18R (Pharmacia company) as the plasmid that sets out.Get 5 microgram pTZ18R and add 20UPstI enzyme (TaKaRa company) and 10 μ l, 10 * PstI enzyme buffer liquid (TaKaRa company), replenish distilled water to 100 μ l, 37 ℃ of enzymes were cut 4 hours, added 10 μ l 3M sodium acetates again, the dehydrated alcohol of 200 μ l, abundant mixing, centrifugal 10 minutes of 12000rpm, supernatant discarded, add 200 μ l, 70% ethanol, abundant mixing, centrifugal 2 minutes of 12000rpm abandons supernatant.After treating that precipitation is dried, add 20U HindIII enzyme (TaKaRa company) and 5 μ l10 * HindIII enzyme buffer liquid (TaKaRa company), replenish distilled water to 50 μ l, 37 ℃ of enzymes are cut and are spent the night, enzyme is cut mixture electrophoresis in 1% sepharose, extracts about 2.9kb band, reclaims test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims this dna fragmentation, promptly obtains the linear carrier that PstI, HindIII sticky end are contained in two ends.

3.2 alkaline phosphatase phoA promotor and signal peptide gene are connected and amplification with the recombinant thymin alpha-1 gene:

Alkaline phosphatase phoA promotor that recombinant thymin alpha-1 gene that embodiment 1 is obtained and embodiment 2 obtain and signal peptide gene add T with the ratio of 1:1 ₄The reaction system of dna ligase (TaKaRa company) (is pressed T ₄The preparation of dna ligase working instructions) in, 16 ℃ of connections are spent the night.In the little centrifuge tube of 500 μ l, add the above-mentioned connection mixture of 1 μ l, 50pmol fragment 2 (the SEQ ID NO.4 in the sequence table), 50pmol fragment 3 (the SEQ ID NO.6 in the sequence table), 8 μ l 2.5mM dNTP (TaKaRa company), 10 μ l, 10 * pfu dna polymerase buffer liquid (TaKaRa company), 2.5U pfu archaeal dna polymerase (TaKaRa company), and make up water to 100 μ l, on the PCR instrument, increase then, amplification method: 94 ℃ 2 minutes, 1 circulation; 94 ℃ 30 seconds, 72 ℃ 45 seconds, 30 circulations; 72 ℃ 2 minutes.With amplification mixture electrophoresis in 1% sepharose, extract the 287bp segment, reclaim test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims this dna fragmentation, is the gene that the order of connection is 5 '-alkaline phosphatase promotor and signal peptide+recombinant thymin alpha-1-3 ' (as Fig. 1).

3.3 the enzyme of alkaline phosphatase promotor and signal peptide+recombinant thymin alpha-1 gene is cut processing:

In the 3.2 alkaline phosphatase promotors that obtain and signal peptide+recombinant thymin alpha-1 gene, add 50UPstI enzyme (TaKaRa company) and 10 μ l, 10 * PstI enzyme buffer liquid (TaKaRa company), replenish distilled water to 100 μ l, 37 ℃ of enzymes are cut and are spent the night, and add 10 μ l 3M sodium acetates again, the dehydrated alcohol of 200 μ l, abundant mixing, centrifugal 10 minutes of 12000rpm, supernatant discarded, add 200 μ l, 70% ethanol, abundant mixing, centrifugal 2 minutes of 12000rpm abandons supernatant.After treating that precipitation is dried, add 50U HindIII enzyme (TaKaRa company) and 5 μ l10 * HindIII enzyme buffer liquid (TaKaRa company), replenish distilled water to 50 μ l, 37 ℃ of enzymes are cut and are spent the night, enzyme is cut mixture electrophoresis in 1% sepharose, extract about 280bp band, reclaim test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims this dna fragmentation, obtains promptly that 5 ' end contains the PstI cohesive end, 3 ' end contains the insertion fragment of HindIII cohesive end.

3.4 connect:

The alkaline phosphatase promotor that contains two cohesive ends that 3.1 linear carriers that contain two cohesive ends and 3.3 that obtain are obtained and signal peptide+recombinant thymin alpha-1 gene add T with the ratio of 1:5 ₄The reaction system of dna ligase (TaKaRa company) (is pressed T ₄The preparation of dna ligase working instructions) in, 16 ℃ of connections are spent the night.

3.5 the preparation of competent cell:

Inoculation intestinal bacteria Top10F ' glycerol stock [F ' { proAB, lacl ^q, lacZ △ M15, Tn10 (Tet ^R) mcrA, △ (mrr-hsdRMS-mcrBC), Φ 80lacZ △ M15, △ lacX74, deoR, recA1, araD139, △ (ara-leu) 7697, galU, galK, rpsL (Str ^R), endA1, nupG λ-] (available from Invitrogen company) to 3mL LB substratum (10g/L peptone, 5g/L yeast extract, 10g/L sodium-chlor), 37 ℃ of 200rpm overnight incubation.Get 100 μ l and transfer in the fresh LB substratum of 3mL, 37 ℃ of 200rpm continue to be cultured to A ₆₀₀Between 0.3～0.4, centrifugal 10 minutes of 4000rpm abandons supernatant, and thalline is with the calcium solution (0.1mol/LCaCl of precooling ₂) washing, centrifugal 10 minutes of 4000rpm is resuspended in the calcium solution of 200 μ l.

3.6 connect the conversion of product:

Get the 3.4 connection mixtures that obtain, add in the competent cell of 3.5 preparations ice bath 30 minutes, 42 ℃ of heat-shockeds 90 seconds, add the fresh LB substratum of 800 μ l subsequently, 37 ℃, 100rpm, slowly jolting is 30 minutes, get LB flat board (10g/L peptone, 5g/L yeast extract, 10g/L sodium-chlor that 100 μ l coating contains 100 mcg/ml penbritins, 15g/L agar) on, 37 ℃ of overnight incubation.

3.7 a small amount of of plasmid preparation:

The single bacterium colony that obtains with sterilization toothpick picking 3.6 contains in the LB substratum of 100 mcg/ml penbritins in 3mL, 37 ℃ of 200rpm cultivated after 8～10 hours, for a short time take out test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with plasmid, the method that provides by test kit extracts plasmid, carry out enzyme and cut evaluation, finish the structure of expression plasmid pAAT.

The evaluation of embodiment 4 expression plasmids

Get the plasmid of a small amount of preparation of 1 μ g embodiment, 3 acquisitions, add 5U PstI enzyme (TaKaRa company) and 5U HindIII enzyme (TaKaRa company), add 2 μ l, 10 * K damping fluid (TaKaRa company) again, replenish distilled water to 20 μ l, 37 ℃ of enzymes were cut 2 hours, and enzyme is cut mixture electrophoresis in 1% sepharose, and ultraviolet lamp is observation down, cut out the fragment that is about the 280bp size, consistent (Fig. 3) that expects during with experimental design.

Entrust Shanghai Bo Ya Bioisystech Co., Ltd to carry out determined dna sequence, sequencing result shows in the expression plasmid pAAT that makes up, alkaline phosphatase phoA promotor and signal peptide gene sequence (the SEQ ID NO.5 in the sequence table) and recombinant thymin alpha-1 gene order (the SEQ ID NO.1 in the sequence table) are all entirely true, and alkaline phosphatase promotor and signal peptide gene are positioned at the upstream of recombinant thymin alpha-1 gene, consistent (see figure 1) with experimental design.

The resistance transformation (Fig. 2) of embodiment 5 expression plasmids:

5.1 a large amount of preparations of pAAT plasmid:

(1) the intestinal bacteria Top10F ' that will contain the pAAT plasmid inserts 200mL LB substratum, and 37 ℃ of 200rpm shaking culture are spent the night.

(2) centrifugal 10 minutes of 4000rpm precipitation thalline adds the 5mL solution I, adds the 10mL solution II after breaing up thalline on the vibrator, and room temperature is placed and added the 7.5mL solution III after 3 minutes, ice bath centrifugal 10 minutes of 12000rpm after 5 minutes.

(3) get supernatant, add two volumes ethanol, mixing, centrifugal 10 minutes of 12000rpm abandons supernatant, dries precipitation, is dissolved among the 1mL TE, adds RNaseA to 50 μ g/mL, 37 ℃ of water-baths 30 minutes.Utilize Sepharose CL-2B post to carry out purifying then, use the TE wash-out, collect first peak.

(4) after adding equal-volume phenol/chloroform (1:1) vibration, centrifugal 5 minutes of 12000rpm draws upper solution.

(5) repeating step is (4) twice.

(6) add the 3M NaAc of 1/10 volume and the dehydrated alcohol of 2 times of volumes, 12000rpm is centrifugal 10 minutes behind the mixing, with 70% washing with alcohol once, dries precipitation, and is dissolved among the TE.

Solution I: 50mmol/L glucose, 25mmol/L Tris-Cl, 10mmol/L EDTA, pH8.0.

Solution II: 0.2mol/L NaOH, 1% SDS.

Solution III: 5mol/L potassium acetate 60mL, glacial acetic acid 11.5mL, sterilized water 28.6mL.

TE：10mM?Tris?HCl(pH8.0)，1mM?EDTA(pH8.0)

RNaseA:10mg RNaseA powder dissolution is in 1mL distilled water, and 100 ℃ were heated 15 minutes, and centrifugal back supernatant is stored in 4 ℃.

5.2 the enzyme of plasmid pET-24a (+) and plasmid pAAT is cut processing:

With 10U Eco57I enzyme (Huamei Bio-Engrg Co.) respectively enzyme cut 10 μ g plasmid pET-24a (+) (Novogen company) and 5.1 the preparation 10 μ g plasmid pAAT, cut in the system (pressing the preparation of Eco57I enzyme working instructions) at 100 μ l enzymes, 37 ℃ of enzymes were cut 2 hours, the phenol that adds 100 μ l more respectively: chloroform (1:1) is mixing fully, centrifugal 5 minutes of 12000rpm, draw upper solution, add 10 μ l 3M sodium acetates, the dehydrated alcohol of 200 μ l, abundant mixing, centrifugal 10 minutes of 12000rpm, supernatant discarded.After treating that precipitation is dried, add 30U Hind III enzyme and 5 μ l, 10 * HindIII enzyme buffer liquid (TaKaRa company) respectively, replenish distilled water to 50 μ l, 37 ℃ of enzymes are cut and are spent the night, enzyme is cut mixture electrophoresis in 1% sepharose, the big fragment of pAAT that extracts the 1200bp kalamycin resistance gene segment that from pET-24a (+), cuts out and cut ampicillin resistance gene, reclaim test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with DNA glue, the method that provides by test kit reclaims dna fragmentation.

5.3 the access of kalamycin resistance gene:

By 3.4 methods the 5.2 two recovery dna fragmentations that obtain are connected, and be transformed in the intestinal bacteria Top10F ' competent cell, coating contains the LB flat board of 50 mcg/ml kantlex, 37 ℃ of overnight incubation, picking list bacterium colony contains in the LB substratum of 50 mcg/ml kantlex in 3mL, 37 ℃ of 200rpm cultivated after 8～10 hours, for a short time take out test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) with plasmid, the method that provides by test kit extracts plasmid, carries out enzyme again and cuts evaluation.

5.4 identify:

Enzyme is cut authentication method with embodiment 4, and enzyme is cut and identified that correct plasmid is expression plasmid pKAT.Further entrust Shanghai Bo Ya Bioisystech Co., Ltd that plasmid pKAT is carried out determined dna sequence, the sequencing result shows that alkaline phosphatase phoA promotor and signal peptide gene sequence (the SEQ ID NO.5 in the sequence table) and recombinant thymin alpha-1 gene order (the SEQ ID NO.1 in the sequence table) are entirely true, and all correctly is connected into (see figure 2) in the kalamycin resistance plasmid.

Structure and the screening of embodiment 6 genetic engineering bacterium YKAT

6.1 the structure of genetic engineering bacterium YKAT:

Prepare intestinal bacteria YK537[supE44 hsdR hsdM recA1 phoA8 leuB6 thilacY rpsL20 galK2 ara-14 xyl-5 mtl-1 by 3.5 methods] competent cell of (being so kind as to give) by Dr.Yamasaki, by 3.6 methods expression plasmid pKAT is transformed among the YK537, coating contains the LB flat board of 50 mcg/ml kantlex, 37 ℃ of overnight incubation.

6.2 the abduction delivering of genetic engineering bacterium YKAT:

Single bacterium colony that picking 6.1 obtains is put into 3 milliliters of LB substratum, and 37 ℃ of 200rpm overnight incubation are transferred in the LB substratum in the ratio of 1:100 then, utilize 5N NaOH to regulate medium pH to 7.0 after 6 hours, regulated once in per 1 hour, and continued to cultivate 12 hours, get the 1mL nutrient solution as sample, get supernatant after centrifugal, the acetone that in supernatant, adds 4 times of volumes, ice bath centrifugal 5 minutes of 12000rpm after 10 minutes, solution inclines, dry precipitation, be used to carry out the SDS-PAGE gel electrophoresis analysis.

6.3 culture supernatant filters out the highest engineering strain of expression amount: YKAT-8 through SDS-PAGE gel electrophoresis analysis (Fig. 4).The SDS-PAGE electrophoresis method is as follows:

(1) preparation of SDS-PAGE electrophoretic separation glue (17%): 3.2mL 38% acrylamide storage liquid, 2.33mL separation gel damping fluid, 1.5mL 50% glycerine, 100 μ l, 10% ammonium persulphate and 100 μ l 10%TEMED are mixed.Use immediately after preparing, the upper strata water of glue is sealed, with starvation.

(2) preparation of SDS-PAGE electrophoresis spacer gel (5%): with 0.5mL 30% acrylamide storage liquid, 0.38mL spacer gel damping fluid, 2mL H ₂O, 60 μ l 0.5M EDTA (pH8.0), 60 μ l, 10% ammonium persulphate and 60 μ l 10%TEMED mix.Use immediately after preparing, use after 1 hour is placed in gelling back admittedly.

(3) install electrophoresis apparatus, add inside groove electrophoretic buffer and water jacket electrophoretic buffer, stand-by.

(4) 6.2 samples that dry that obtain are dissolved in 15 μ l, 1 * SDS sample loading buffer, sample carried out electrophoresis on placement got final product in 5 minutes in boiling water bath, treated to stop electrophoresis after bromjophenol blue is walked out gel.

38% acrylamide storage liquid: the 35.76g acrylamide, the 2.24g methylene diacrylamide, adding distil water is settled to 100mL, filters 4 ℃ of preservations of back lucifuge.

30% acrylamide storage liquid: the 29g acrylamide, the 1g methylene diacrylamide, adding distil water is settled to 100mL, filters 4 ℃ of preservations of back lucifuge.

The separation gel damping fluid: 3M Tris alkali, 0.3%g SDS, pH are 8.9.

The spacer gel damping fluid: 1M Tris alkali, pH are 6.8.

10 * inside groove electrophoretic buffer: 1M Tris alkali, 1M Tricine, 1%SDS.

5 * water jacket electrophoretic buffer: 1M Tris alkali, pH are 8.9.

1 * sample-loading buffer (10mL): the 0.2mg bromjophenol blue, the 0.15g 3-mercaptoethanol, 0.2g SDS, 1mL glycerine, 1.25mL spacer gel damping fluid, make up water is to 10mL.

The fermentation culture of embodiment 7 genetic engineering bacterium YKAT-8 in the 20L fermentor tank

The bacterial strain YKAT-8 that embodiment 6 screening is obtained inserts 200mL LB substratum in the ratio of 1:100, and 37 ℃ of 200rpm shaking culture are to the logarithmic growth after date, and fermentor tank 10L substratum is gone in switching.Adjusting by stirring velocity in the culturing process is controlled at dissolved oxygen about 20%, utilizes ammoniacal liquor that pH is controlled at 7.0.Cultivate and begin feed supplement after 8 hours, feed supplement speed is 1.5mL/ minute; Cultivate after 12 hours every 2 hours sampling 1mL, it is to be detected to get supernatant after centrifugal.Cultivate and put jar after 18-20 hours.After putting jar, nutrient solution 4000rpm centrifuging and taking supernatant is in order to the purifying of back.

Fermented liquid carries out the SDS-PAGE gel electrophoresis by 6.3 methods, shows through scanning analysis: recombinant thymin alpha-1 is secreted in the substratum, and its high expression level amount surpasses 500mg/L training base (Fig. 5).

Fermention medium: 1% yeast extract, 2% peptone, 0.5% casamino acids, 0.2% MgSO ₄, 0.2% NH ₄Cl, 0.2% (NH ₄) ₂SO ₄, 0.1% NaCl, 0.6% glucose;

Feed supplement: 300g/L glucose, 5g/L casamino acids;

The separation and purification of embodiment 8 expression products

8.1 ultrafiltration:

Use the ultra-filtration membrane of molecular weight cut-off 100,000 to remove the foreign protein of some macromolecules the medium supernatant that embodiment 7 obtains.

8.2 ion exchange column (Q-Sepharose Fast Flow) chromatography:

(Φ 26 * 100mm) is with level pad (10mM TrispH7.2) balances, and it is below 5 that the fermented liquid of ultra filtration is diluted to specific conductivity with level pad, and last sample, flow velocity are 10ml/ minute for ion exchange column Q-Sepharose FF.Treat that sample finishes and wash post with level pad again, the albumen that is not adsorbed is washed to the greatest extent.In level pad, add 0.05M, 0.1M successively then, 2M NaCl carries out stepwise elution, collects the elution peak (Fig. 6) of 0.1M NaCl.

8.3 Sephadex G-50 gel-filtration:

With the 8.2 wash-out component lyophilizes of collecting, be dissolved in then in the distilled water of small volume, through 0.45 μ m filtering with microporous membrane, (Φ 100 * 900mm) carries out purifying to last Sephadex G-50 post.Damping fluid is 5mM PB (pH7.2), and flow velocity is 20ml/ minute, collects 2# peak (Fig. 7).

8.4 reversed-phase HPLC:

With the 8.3 2# component lyophilizes that obtain, be dissolved in then in the double distilled water of small volume, through 0.45 μ m filtering with microporous membrane, the high pressure liquid chromatograph with Waters company carries out purifying then, collects main peak (Fig. 8).

C8 reversed-phase column: ULTRASPHERE (Φ 10.0mm * 25cm).

Buffer A: 0.1% TFA.

Buffer B: 0.1%TFA, 50% acetonitrile.

Gradient: 0%～50%B is in 25 minutes.

Flow velocity: 3ml/ minute.

The calibrating of embodiment 9 purified products

9.1 electrophoresis calibrating:

Carry out the SDS-PAGE gel electrophoresis by 6.3 methods, through scanning analysis, the recombinant thymin alpha-1 purity of purifying is greater than 95% (Fig. 9).

9.2 reversed-phase HPLC calibrating:

Analytical results (Figure 10) shows that the recombinant thymin alpha-1 purity of purifying is greater than 95%.

RP-300 (Φ 2.1 * 30mm) HPLC analysis conditions:

Buffer A: 0.1% TFA.

Buffer B: 0.1% TFA, 90% acetonitrile.

Gradient: 0%～45%B is in 35 minutes.

Flow velocity: 0.4ml/ minute.

9.3 the N terminal amino acid sequence is analyzed:

Entrust Chinese Academy of Sciences's Shanghai biological chemistry and the used ABI of the RESEARCH ON CELL-BIOLOGY Protein Sequencer491 of company type sequenator to carry out the N terminal amino acid sequence and analyze (seeing Figure 11-13), measured 15 amino acid of recombinant thymin alpha-1 N end of purifying altogether, its sequence is followed successively by:

Ser-Asp-Ala-Ala-Val-Asp-Thr-Ser-Ser-Glu-Ile-Thr-Thr-Lys-Asp, (SEQ ID NO.10 in the sequence table) is consistent with natural thymosin N terminal amino acid sequence, proves that signal peptide is correctly excised.

9.4 the Rose connection is measured active:

(1) preparation of T cell: 1 in fresh calf thymus gland, degrease also shreds, and adds an amount of Hank ' s liquid, the muddy enchylema that contains the T cell filters through 100 mesh sieves, have in the centrifuge tube of 1/3 volume lymphocyte separation medium filtrate adding, centrifugal 20 minutes of 2000rpm, careful sucking-off intermediary white thymocyte, put into another centrifuge tube, add 5 milliliters of Hank ' s liquid washings (jolting is even), centrifugal 3 minutes of 1500rpm abandons supernatant liquor, add 5 milliliters of Hank ' s liquid again, three times repeatedly.At last, add 3 milliliters of Hank ' s liquid and shake up, 45 ℃ of waters bath with thermostatic control 30 minutes, centrifugal 3 minutes of 1500rpm abandon supernatant liquor, give a baby a bath on the third day after its birth repeatedly time with Hank ' s liquid, and with Hank ' s dilution counting also, making its ultimate density is 3-5 * 10 at last ⁶Cells/ml.

(2) the erythrocytic preparation of sheep: get fresh sheep blood, give a baby a bath on the third day after its birth time with an amount of Hank ' s liquid, abandon supernatant liquor, add an amount of Hank ' s liquid dilution and counting, making ultimate density is 10 times of T cell, about 3-5 * 10 ⁷Cells/ml.

(3) measure: the thymosin of different concns is added in the good T enchylema of 1 milliliter of dilution, 37 ℃ are incubated 1 hour, centrifugal 3 minutes of 1500rpm, abandon supernatant liquor, it is inferior to give a baby a bath on the third day after its birth repeatedly with Hank ' s, adds each 1 milliliter of good sheep red blood cell (SRBC) suspension of dilution and Hank ' s liquid, mixing, centrifugal 3 minutes of 1500rpm puts into 4 ℃ of refrigerator overnight.Take out next day, abandons supernatant liquor (staying a little), and each pipe is smear respectively, add each 1 of stationary liquid, leave standstill after shaking up when stationary liquid is done soon, add 2 of staining fluids, shake up, leave standstill about 30 minutes, remove staining fluid with Hank ' s flushing earlier, at last once, on opticmicroscope, count with flushing with clean water, several 100-200 T cells calculate the percentage ratio (referring in conjunction with 4 erythrocytic lymphocytes of above sheep) that the E Rose is formed altogether.

Hank ' s liquid: contain 0.8% sodium-chlor, 0.1% glucose, 0.04% Repone K, 0.015% potassium primary phosphate and 0.038% disodium phosphate soln, transfer pH to 7.20 with 4% sodium carbonate solution.

Stationary liquid: 25% glutaraldehyde, 3.5% sodium bicarbonate.

Staining fluid: get 2 milliliters of Ji's nurse Sa stostes, add 6 milliliters of Hank ' s liquid, mixing, centrifuging and taking supernatant liquor.

(4) active verification result sees Table 1, and the result shows that the recombinant thymin alpha-1 of purifying and the thymosin of chemosynthesis have similar biological activity, than Zadaxin to be mixed with thing active high.

Table 1: rosette test result

Embodiment described above is intended to set forth preferred forms of the present invention rather than limits the present invention in any form.Those skilled in the art are according to enlightenment of the present invention, and the various changes in conjunction with the general knowledge of this area is done all drop in the scope of the present patent application claim.

Sequence table

＜110〉Puluo Pharmaceutical Research Inst. Co., Ltd., Shanghai

＜120〉high secreting, expressing and the separation and purification of recombinant thymin alpha-1 in intestinal bacteria

<130>021252

<160>10

<170>PatentIn?version?3.2

<210>1

<211>90

<212>DNA

＜213〉synthetic

<400>1

<210>2

<211>84

<212>DNA

＜213〉people (human)

<400>2

<210>3

<211>57

<212>DNA

＜213〉synthetic

<400>3

<210>4

<211>55

<212>DNA

＜213〉synthetic

<400>4

<210>5

<211>175

<212>DNA

＜213〉synthetic

<400>5

<210>6

<211>60

<212>DNA

＜213〉synthetic

<400>6

<210>7

<211>60

<212>DNA

＜213〉synthetic

<400>7

<210>8

<211>60

<212>DNA

＜213〉synthetic

<400>8

<210>9

<211>64

<212>DNA

＜213〉synthetic

<400>9

<210>10

<211>28

<212>PRT

＜213〉people (human)

<400>10

Claims

1. recombinant thymin alpha-1 gene, its nucleotides sequence is classified sequence shown in the SEQ ID NO.1 as.

2. the expression plasmid pKAT of secreting, expressing recombinant thymin alpha-1, it is characterized in that: with pTZ18R is that initial plasmid construction forms; Comprise the described recombinant thymin alpha-1 gene of claim 1, and the startup that is positioned at described recombinant thymin alpha-1 upstream region of gene is expressed and the alkaline phosphatase phoA promotor and the signal peptide gene of secretion recombinant thymin alpha-1, and the kalamycin resistance gene that derives from pET-24a (+).

3. expression plasmid pKAT as claimed in claim 2, the wherein said described gene that is positioned at described recombinant thymin alpha-1 upstream region of gene comprise all prokaryotic promoters and the signal peptide gene that starts expression and secretion recombinant thymin alpha-1.

4. engineering bacteria YKAT, described engineering bacteria are that the described expression plasmid pKAT of claim 2 is transformed into intestinal bacteria YK537 and all bacterial strains with kalamycin resistance of obtaining.

5. the preparation method of recombinant thymin alpha-1 is characterized in that comprising the steps:

(1) utilize the intestinal bacteria preference codon to design and synthesize the recombinant thymin alpha-1 gene according to the aminoacid sequence of natural thymosin, this gene contains nucleotide sequence as claimed in claim 1;

(2) be initial plasmid with pTZ18R,, make up and comprise recombinant thymin alpha-1 expression of gene plasmid with intestinal bacteria alkaline phosphatase phoA promotor and signal peptide gene upstream sequence as the recombinant thymin alpha-1 gene;

(3) insert kalamycin resistance gene, construction expression plasmid pKAT;

(4) make up and filter out the highest engineering strain of secreting, expressing amount;

(5) to the described genetic engineering bacterium fermentation culture that filters out;

(6) separation and purification of expression product.

6. preparation method as claimed in claim 5, wherein said separation purification method is the array mode that adopts ultrafiltration, anion exchange chromatography, gel permeation chromatography and anti-phase high pressure liquid chromatography.