CN1435427A - Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use - Google Patents
Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use Download PDFInfo
- Publication number
- CN1435427A CN1435427A CN 03113829 CN03113829A CN1435427A CN 1435427 A CN1435427 A CN 1435427A CN 03113829 CN03113829 CN 03113829 CN 03113829 A CN03113829 A CN 03113829A CN 1435427 A CN1435427 A CN 1435427A
- Authority
- CN
- China
- Prior art keywords
- glu
- leu
- asp
- lys
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A recombinant alpha-thymosingen-interleukin 2 gene composed of humanized alpha-thymosingen and interleukin 2 and its expression and application are disclosed. It has stronger bioactivity, and can be used to prepare the medicines for treating viral infection, tumor and immunodeficiency diseases.
Description
Technical field
The invention belongs to biological technical field, specifically relate to a kind of recombinant human alpha prothymosin-interleukin-22 gene and expression thereof, application.
Background technology
People's alpha-Thymosin former (prothymosin-α) is a thymus gland excretory polypeptide hormone, is made up of 110 amino-acid residues, and tissue distribution is extensive.The function of original two aspects of alpha-Thymosin, the one, participate in cell proliferation as nucleoprotein; The 2nd, have immunostimulatory activity, regulate cell and humoral immune function state, improve immune self stability.The former application of people's alpha-Thymosin comprises treatment hepatitis, AIDS etc. and as immunomodulator (comprising anti-ageing and tumor aid treatment).Domestic Zadaxin mixture from thymus gland separation and Extraction such as pig, oxen is widely used in clinical as immunostimulant at present, but because the Zadaxin in sources such as pig, ox is compared with human thymosin, difference on the amino acid The Nomenclature Composition and Structure of Complexes of polypeptide, exist heterology and heterozoic safety issue, can produce rejection and give the mankind, influence its application at human body with the heterogenous animal disease propagation; The content of Zadaxin under physiological status is atomic in addition, be difficult to satisfy the requirement of clinical quality and quantity to it from the product of tissue extraction separation and purification, and but the people's alpha-Thymosin that passes through the reorganization of biotechnology mass production is former, satisfies requirements for clinical application.
(interleukin2 IL-2) is mainly produced by T cell or T clone human interleukin-2, and having biologic activity widely: Th, Tc and Ts cell all is the reacting cells of IL-2; Induce the differentiation and the effector function of multiple killer cell such as CTL, NK and LAK, and induce killer cell to produce cytokines such as IFN-γ, TNF-α; Directly act on the B cell, promote its propagation, differentiation and Ig secretion; Activated macrophage.Its clinical treatment tumour and infectious diseases of being mainly used in.Yet IL-2 is heavy dose of in vivo when using, and toxic side effect is bigger.
Summary of the invention
The object of the present invention is to provide a kind of recombinant human alpha prothymosin-interleukin-22 gene that has higher biologic activity than people α prothymosin and interleukin-22;
Another object of the present invention is to provide this Expression of Fusion Protein;
Another object of the present invention is to provide the application of this fusion rotein.
Purpose of the present invention realizes by the following method:
Synthetic respectively people's alpha-Thymosin is former, the upstream and downstream primer of interleukin-2, and isolate the former and interleukin-2 mRNA of people's alpha-Thymosin respectively by human thymocyte and human T-cell, carry out reverse transcription and pcr amplification respectively and obtain the former and interleukin-2 functional domain segment of people's alpha-Thymosin; Utilize secondary PCR to amplify fusion gene, enzyme is cut the back and is connected cloning vector, the screening order-checking identifies positive colony, and this fusion gene is connected to expression vector, obtain to have the fusion rotein of the former human interleukin-2 dual-active of people's alpha-Thymosin after transforming engineering bacteria abduction delivering, separation and purification, and can also contain connexon in this protein sequence.
This fusion gene cDNA can be by the former 1-230bp sequence of alpha-Thymosin, and IL-2250-652bp sequence and length are formed for the 15-45bp connexon, and the connexon amino acids coding can be made up of Serine, L-Ala, glycine etc., refers in particular to [G-G-G-G-S] n.
Fusion gene of the present invention is held the C end from N, can arrange by α prothymosin-interleukin-22 or interleukin-22-α prothymosin; The 3rd halfcystine of the gene of coding interleukin-2 is replaceable to be other conserved amino acid, and for example Serine folds thereby help the correct of polypeptide.
The present invention has also made up expression vector pProTM/IL-2, is obtained in expression vector pBV220 by gene clone of the present invention.Expression vector of the present invention can be used for preparing gene therapy medicament.
Fusion gene of the present invention derives from the cDNA in people source, and it is recombinant expressed to utilize genetic engineering technique to carry out.Recombinant human alpha-prothymosin provided by the invention-interleukin-2 fusion rotein has overcome when IL-2 is heavy dose of in vivo to be used, the shortcoming that toxic side effect is bigger, and utilized the synergy of IL-2 to strengthen the former immunostimulatory activity of people's alpha-Thymosin; The present invention has overcome heterology and heterozoic safety issue in addition; Recombinant human alpha-prothymosin/the interleukin-2 fusion rotein is former than alpha-Thymosin, interleukin-2 single-factor or double factor are united higher biologic activity.Fusion gene of the present invention can be used for preparing the medicine of treatment viral infection disease, antitumor and other immunodeficiency diseasess.
Description of drawings
Fig. 1 is a prothymosin cDNA clone collection of illustrative plates;
Fig. 2 is secondary PCR amplification fusion rotein PTM-IL-2;
Fig. 3 is the structure of pProTM/IL-2 fusion protein expression vector.
Embodiment
The invention will be further described below in conjunction with accompanying drawing, but do not limit the present invention in any form.
The total RNA of embodiment 1 thymocyte extracts and reverse transcription PCR
Get 3-4 month fetal thymus, be prepared into individual cells, be suspended in the RPMI1640 nutrient solution, cell density is 1 * 10
7Ml, under the combined stimulation of 20ug/ml PHA and 500U/ml IL-2 in 37 ℃, 5%CO
2Cultivated 24 hours under the condition, the thymocyte of getting cultivation extracts total RNA by the method for the total RNA test kit of TAKARA company, be dissolved in the deionized water that DEPC handled, get a certain amount of RNA, add downstream primer (P2) and dNTP,, the reverse transcription of alpha-Thymosin original mRNA is become strand cDNA 42 ℃ of following ThermoScript II effects 30 minutes, further add upstream primer (P1) and Taq enzyme and carry out PCR, obtain the former cDNA of alpha-Thymosin.Wherein said upstream and downstream primer is as follows respectively: upstream primer 5 ' GTC AAG CTT ATG TCA GAC GCA GCC GTA G3 ' downstream primer 5 ' ACT GGA TCC TTA GTC ATC CTC GTC GGT CTT C3 '
Taking heparin anticoagulation 5ml separates peripheral blood PBMC with density gradient method at lymphocyte separation medium, cell count is adjusted to (2～3) * 10 with RPMI1640
6/ ml adds PHA10ug, interleukin II 50IU respectively, at 37 ℃, and 5%CO
2Cultivated under the condition 24～48 hours; Collect above-mentioned cell, centrifugal 1000r/min, 5 minutes, get the bottom cell with PBS damping fluid Xian Di after, extract cell total rna with guanidinium isothiocyanate phenol chloroform single stage method.The RNA precipitation that obtains is dissolved with diethylpyrocarbonate (DECP) treating water, agarose gel electrophoresis (ethidium bromide that contains 0.5 μ g) through oxalic dialdehyde 1% is identified, ultraviolet spectrophotometer is measured total rna concentration, and 0D260nm/280nm is between 1.8～2.0, and-20 ℃ of refrigerators are preserved; Pressing the reverse transcription test kit description operation of TAKARA, is template with the total RNA that extracts, and adds the synthesizing single-stranded cDNA of IL-2 downstream primer (P4) reverse transcription; Add upstream primer (P3) pcr amplification again and go out people source IL-2 gene.The IL-2 gene of amplification is carried out digestion with restriction enzyme (HindIII/BamHI), be cloned into the PUC19 carrier again, get PUC19-IL2.Wherein the upstream and downstream primer is as follows respectively: P3:gtc-AAgCTT-atggcacctacttcaagttctacaaagaaP4:act-ggATCC-tta agttagtgttgagatgatgctttg
The former function area gene clone of embodiment 3 people's alpha-Thymosins
Utilize biosoftwares such as bio-soft, sequence to determine best annealing temperature, avoid to disturb the mRNA secondary structure of rotaring intertranslating start by Computer Analysis; Guarantee the pairing of no distinguished sequence between two primers, have special complementary pairing between the primer template to avoid the unnecessary sequence that increases; 5 ' imports BamHI, XbaI enzyme cutting site respectively in embodiment 1 described upstream and downstream primer, artificial synthetic oligonucleotide's primer: with the former cDNA of people's alpha-Thymosin is template, obtain people's alpha-Thymosin protogene fragment behind the pcr amplification, with above-mentioned fragment after the BamHI/XbaI restriction enzyme is handled, through phenol/chloroform extracting protein, ethanol sedimentation extraction DNA, directed cloning is to the PUC19 carrier, transformed into escherichia coli, screening hickie bacterium colony, enzyme are cut and are identified acquisition positive colony PUC19-prothymosin.Clone's collection of illustrative plates is seen Fig. 1.
The gene clone of embodiment 4 fusion roteins
Do not change embodiment 1 and 2 designed prothymosin upstream primer and IL-2 downstream primers, redesign prothymosin downstream primer (P2 ') and the IL-2 upstream primer (P3 '), be tool prothymosin gene 3 ' end 20 bases, 18 bases of middle connexon and complete complementary pairing sequences of 26 bases of IL-2 gene 5 ' end between two primers, wherein the connexon sequence is 5 ' TCGGGTGGCGGTGGCTCT 3 '.Be that template is carried out pcr amplification with PUC19-prothymosin, PUC19-IL-2 respectively earlier; Be template with both amplified production mixtures again, carry out secondary PCR with prothymosin upstream primer (P1), IL-2 downstream primer (P4), amplification obtains prothymosin-IL-2 fusion gene, directed cloning is transformed into intestinal bacteria screening hickie bacterium colony enzyme and cuts evaluation acquisition positive colony PUC19-prothymosin-IL-2 to the PUC19 carrier after enzyme is cut.Clone's collection of illustrative plates is seen Fig. 2.Wherein P2 ', P3 ' primer are complementary fully, be respectively: P2 ': ttctttgtagaacttgaagtaggtgc-AgAgCCACCGCCACCCgA-gtcatcctcg tcggtcttctP3 ': agaagaccgacgaggatgac-TCgggTggCggTggCTCT-gcacctacttcaagtt ctacaaagaa black matrix is the base sequence of fusion rotein joining peptide, and its amino acid sequence coded is S-G-G-G-G-S.
Embodiment 5 fusion protein expression vectors structure
According to prothymosin cDNA sequence, with reference to the intestinal bacteria preference codon, design A, upstream primer that T content is high under the prerequisite of amino acid coding not changing, prothymosin/interleukin II antigen-4 fusion protein gene that pcr amplification is obtained is cloned into expression vector pBV220, get expression vector pProTM/IL-2, the vector construction process is seen Fig. 3.Described primer is respectively: upstream primer:
EcoRI restriction enzyme site downstream primer: gtc-
GAATTC-tta agttagtgttgagatgatgctttg
The EcoRI restriction enzyme site
Embodiment 6 escherichia coli high-level expression fusion roteins
With above-mentioned positive colony, the preparation overnight culture after about 1 hour OD600 of 30 ℃ of joltings reaches 0.4-0.6, is warming up to 42 ℃ and induced 4-6 hour, and conventional bacterium, cracking, the SDS-PAGE electrophoresis received records expressing protein with thin layer chromatography scanner and account for 20% of bacterial protein.
Renaturation, the purifying of embodiment 7 fusion roteins
The bacterium that low temperature is frozen is resuspended in dissolving damping fluid (the 50mMTris HCl of 6 times of volumes, pH8.0,1mM EDTA, the 1mM dithiothreitol (DTT), the 1mM phenylmethylsulfonyl fluoride, the 2mg/ml N,O-Diacetylmuramidase) and use ultrasonic disruption instrument cracking bacterium (5mm ultrasonic head, 50W, 8 circulations and timed interval of 50%, ice bath 10 minutes).By centrifugal inclusion body in the lysate is separated, be dissolved in the sex change liquid (6M urea element, 100mM Tris-acetic acid/sodium hydroxide pH9.5,25mM EDTA, 5mM dithiothreitol (DTT)).Extractive fusion rotein is added on potential buffer solution (50mM Tris HCl, pH9.0,5mM EDTA, 0.2mM Sleep-promoting factor B and 0.4mM reduced glutathion) gradually carries out again folding reaction.The fusion rotein solution of renaturation is further purified through ion exchange chromatography and molecular sieve filtration through folding again, gets the pure product in 95% left and right sides.
Embodiment 8 IL-2 transform the site
Utilize that rite-directed mutagenesis or direct labor are synthetic to carry out genetic modification to IL-2, with the 3rd halfcystine codon in its gene order make into the Serine codon (tgt → tct), thus be beneficial to the correct folding of polypeptide, and do not change the function of IL-2.
Embodiment 9 determinations of activity
1. fusion protein immunization activity identification: adopt the E-rosette test to detect:
With lymphocyte separation medium separation of human peripheral blood lymphocytes, be made into 2 * 10 with Hanks liquid
6/ ml, experiment tube adds a certain amount of expressing fusion protein supernatant, contrast then adds same amount contrast bacterium supernatant, after 30 ℃ of water-baths are hatched 90min, are added 0.5% sheep red blood cell (SRBC), smear, dyeing, count the cell count (in conjunction with 4 and above sheep red blood cell (SRBC)) that forms rosette in 200 lymphocytes down in high power lens, calculate the percentage ratio that Rose forms cell, available formula is tried to achieve the activity ratio of expressing supernatant.
Take the lymphocytic rosette activity ratio of normal adults T as 100%, the former relative activity ratio with the fusion rosette of the alpha-Thymosin of variable concentrations is as follows: the former rosette of alpha-Thymosin activates the fusion rosette and activates (ug/1ml) rate (%) 16 30 12 28 8 51 6 50 4 65 3 65 2 100 1.5 100 1 57 0.75 53 0.5 33 0.38 32 of (ug/1ml) rate (%)
2.IL-2 active detection the: the CTLL-2 cell mtt assay that adopts IL-2 to rely on: will detect cell and be made into 5 * 10
5Ml enchylema, every plate adds 100ul in 96 well culture plates.Get different dilution IL-2 standard substance of 100ul and expressing fusion protein supernatant and add in each hole, each extent of dilution is done 3 multiple holes, and attached nutrient solution control wells, puts 37 ℃, 5%CO
2In educated 24-48 hour; Supernatant is removed in suction, adds the PBS washing, adds 10ulMTT solution, continues to cultivate 4-6 hour; Each adds the 0.01mol/l HCl that contains 10%SDS, and fully mixing left standstill several minutes, allows the first particle that forms fully dissolve; Selecting wavelength on enzyme connection instrument is 570nm, and reference wavelength 630nm measures the D value respectively.D value (Y) with log2 extent of dilution (X) and each extent of dilution correspondence is done straight-line regression.Press the probit analysis method and calculate the IL-2 activity.Final measured fusion rotein specific activity is 2 * 10
6U/mg.
Sequence table＜110〉Baidi Bio-Medical Co., Ltd., Guangzhou＜120〉recombinant human alpha-prothymosin interleukin 2 gene and expression thereof, application＜130〉＜140＜141＜160〉8＜170〉PatentIn Ver.2.1＜210〉1＜211〉729＜212〉DNA＜213〉artificial sequence＜220〉＜221〉CDS＜222〉(1) .. (729)＜400〉1atg tca gac gca gcc gta gac acc agc tcc gaa atc acc acc aag gac 48Met Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp 15 10 15tta aag gag aag aag gaa gtt gtg gaa gag gca gaa aat gga aga gac 96Leu Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Asn Gly Arg Asp
20 25 30gcc?cct?gct?aac?ggg?aat?gct?aat?gag?gaa?aat?ggg?gag?cag?gag?gct 144Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala
35 40 45gac?aat?gag?gta?gac?gaa?gaa?gag?gaa?gaa?ggt?ggg?gag?gaa?gag?gag 192Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu
50 55 60gag?gaa?gaa?gaa?ggt?gat?ggt?gag?gag?gag?ggt?gga?gat?gaa?gat?gag 240Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?65 70 75 80gaa?gct?gag?tca?gct?acg?ggc?aag?cgg?gca?gct?gaa?gat?gat?gag?gat 288Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp
85 90 95gac?gat?gtc?gat?acc?aag?aag?cag?aag?acc?gac?gag?gat?gac?gca?cct 336Asp?Asp?Val?Asp?Thr?Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp?Ala?Pro
100 105 110act?tca?agt?tct?aca?aag?aaa?aca?cag?cta?caa?ctg?gag?cat?tta?ctg 384Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu?Gln?Leu?Glu?His?Leu?Leu
115 120 125ctg?gat?tta?cag?atg?att?ttg?aat?gga?att?aat?aat?tac?aag?aat?ccc 432Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile?Asn?Asn?Tyr?Lys?Asn?Pro 130 135 140aaa?ctc?acc?agg?atg?ctc?aca?ttt?aag?ttt?tac?atg?ccc?aag?aag?gcc 480Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala145 150 155 160aca?gaa?ctg?aaa?cat?ctt?cag?tgt?cta?gaa?gaa?gaa?ctc?aaa?cct?ctg 528Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu
165 170 175gag?gaa?gtg?cta?aat?tta?gct?caa?agc?aaa?aac?ttt?cac?tta?aga?ccc 576Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?Arg?Pro
180 185 190agg?gac?tta?atc?agc?aat?atc?aac?gta?ata?gtt?ctg?gaa?cta?aag?gga 624Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu?Lys?Gly
195 200 205tct?gaa?aca?aca?ttc?atg?tgt?gaa?tat?gct?gat?gag?aca?gca?acc?att 672Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile
210 215 220gta gaa ttt ctg aac aga tgg att acc ttt tgt caa agc atc atc tca 720Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser225,230 235 240aca cta act 729Thr Leu Thr＜210〉2＜211〉243＜212〉PRT＜213〉artificial sequence＜400〉2Met Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp, 15 10 15Leu Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Asn Gly Arg Asp
20 25 30Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala
35 40 45Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu
50 55 60Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?65 70 75 80Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp
85 90 95Asp?Asp?Val?Asp?Thr?Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp?Ala?Pro
100 105 110Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu?Gln?Leu?Glu?His?Leu?Leu
115 120 125Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile?Asn?Asn?Tyr?Lys?Asn?Pro
130 135 140Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala145 150 155 160Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu
165 170 175Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?Arg?Pro
180 185 190Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu?Lys?Gly
195 200 205Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile
210 215 220Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Cys Gln Ser Ile Ile Ser225,230 235 240Thr Leu Thr＜210〉3＜211〉729＜212〉DNA＜213〉artificial sequence＜220〉＜221〉CDS＜222〉(1) .. (729)＜400〉3agt tct aca aag aaa aca cag cta caa ctg gag cat tta ctg ctg gat 48Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp 15 10 15tta cag atg att ttg aat gga att aat aat tac aag aat ccc aaa ctc 96Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu
20 25 30acc?agg?atg?ctc?aca?ttt?aag?ttt?tac?atg?ccc?aag?aag?gcc?aca?gaa 144Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu
35 40 45ctg?aaa?cat?ctt?cag?tgt?cta?gaa?gaa?gaa?ctc?aaa?cct?ctg?gag?gaa 192Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu
50 55 60gtg?cta?aat?tta?gct?caa?agc?aaa?aac?ttt?cac?tta?aga?ccc?agg?gac 240Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?Arg?Pro?Arg?Asp?65 70 75 80tta?atc?agc?aat?atc?aac?gta?ata?gtt?ctg?gaa?cta?aag?gga?tct?gaa 288Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu
85 90 95aca?aca?ttc?atg?tgt?gaa?tat?gct?gat?gag?aca?gca?acc?att?gta?gaa 336Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu
100 105 110ttt?ctg?aac?aga?tgg?att?acc?ttt?tgt?caa?agc?atc?atc?tca?aca?cta 384Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu
115 120 125act?atg?tca?gac?gca?gcc?gta?gac?acc?agc?tcc?gaa?atc?acc?acc?aag 432Thr?Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys
130 135 140gac?tta?aag?gag?aag?aag?gaa?gtt?gtg?gaa?gag?gca?gaa?aat?gga?aga 480Asp?Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Arg145 150 155 160gac?gcc?cct?gct?aac?ggg?aat?gct?aat?gag?gaa?aat?ggg?gag?cag?gag 528Asp?Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu
165 170 175gct?gac?aat?gag?gta?gac?gaa?gaa?gag?gaa?gaa?ggt?ggg?gag?gaa?gag 576Ala?Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu
180 185 190gag?gag?gaa?gaa?gaa?ggt?gat?ggt?gag?gag?gag?ggt?gga?gat?gaa?gat 624Glu?Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp
195 200 205gag?gaa?gct?gag?tca?gct?acg?ggc?aag?cgg?gca?gct?gaa?gat?gat?gag 672Glu?Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu
210 215 220gat gac gat gtc gat acc aag aag cag aag acc gac gag gat gac gca 720Asp Asp Asp Val Asp Thr Lys Lys Gln Lys Thr Asp Glu Asp Asp Ala225,230 235 240cct act tca 729Pro Thr Ser＜210〉4＜21l〉243＜212〉PRT＜213〉artificial sequence＜400〉4Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp, 15 10 15Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu
20 25 30Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu
35 40 45Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu
50 55 60Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Ash?Phe?His?Leu?Arg?Pro?Arg?Asp?65 70 75 80Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu
85 90 95Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu
100 105 110Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu
115 120 125Thr?Met?Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys
130 135 140Asp?Leu?Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Arg145 150 155 160Asp?Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu
165 170 175Ala?Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu
180 185 190Glu?Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp
195 200 205Glu?Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu
210 215 220Asp Asp Asp Val Asp Thr Lys Lys Gln Lys Thr Asp Glu Asp Asp Ala225,230 235 240Pro Thr Ser＜210〉5＜211〉750＜212〉DNA＜213〉artificial sequence＜220〉＜221〉CDS＜222〉(1) .. (747)＜400〉5atg tca gac gca gcc gta gac acc agc tcc gaa atc acc acc aag gac 48Met Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp 15 10 15tta aag gag aag aag gaa gtt gtg gaa gag gca gaa aat gga aga gac 96Leu Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Asn Gly Arg Asp
20 25 30gcc?cct?gct?aac?ggg?aat?gct?aat?gag?gaa?aat?ggg?gag?cag?gag?gct 144Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala
35 40 45gac?aat?gag?gta?gac?gaa?gaa?gag?gaa?gaa?ggt?ggg?gag?gaa?gag?gag 192Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu
50 55 60gag?gaa?gaa?gaa?ggt?gat?ggt?gag?gag?gag?ggt?gga?gat?gaa?gat?gag 240Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?65 70 75 80gaa?gct?gag?tca?gct?acg?ggc?aag?cgg?gca?gct?gaa?gat?gat?gag?gat 288Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp
85 90 95gac?gat?gtc?gat?acc?aag?aag?cag?aag?acc?gac?gag?gat?gac?tcg?ggt 336Asp?Asp?Val?Asp?Thr?Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp?Ser?Gly
100 105 110ggc?ggt?ggc?tct?gca?cct?act?tca?agt?tct?aca?aag?aaa?aca?cag?cta 384Gly?Gly?Gly?Ser?Ala?Pro?Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu
115 120 125caa?ctg?gag?cat?tta?ctg?ctg?gat?tta?cag?atg?att?ttg?aat?gga?att 432Gln?Leu?Glu?His?Leu?Leu?Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile
130 135 140aat?aat?tac?aag?aat?ccc?aaa?ctc?acc?agg?atg?ctc?aca?ttt?aag?ttt 480Asn?Asn?Tyr?Lys?Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe145 150 155 160tac?atg?ccc?aag?aag?gcc?aca?gaa?ctg?aaa?cat?ctt?cag?tgt?cta?gaa 528Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu
165 170 175gaa?gaa?ctc?aaa?cct?ctg?gag?gaa?gtg?cta?aat?tta?gct?caa?agc?aaa 576Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys
180 185 190aac?ttt?cac?tta?aga?ccc?agg?gac?tta?atc?agc?aat?atc?aac?gta?ata 624Asn?Phe?His?Leu?Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile
195 200 205gtt?ctg?gaa?cta?aag?gga?tct?gaa?aca?aca?ttc?atg?tgt?gaa?tat?gct 672Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala
210 215 220gat?gag?aca?gca?acc?att?gta?gaa?ttt?ctg?aac?aga?tgg?att?acc?ttt 720Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe225 230 235 240tgt?caa?agc?atc?atc?tca?aca?cta?act?taa 750Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu?Thr
245＜210〉6＜211〉249＜212〉PRT＜213〉artificial sequence＜400〉6Met Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp, 15 10 15Leu Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Asn Gly Arg Asp
20 25 30Ala?Pro?Ala?Asn?Gly?Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala
35 40 45Asp?Asn?Glu?Val?Asp?Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu
50 55 60Glu?Glu?Glu?Glu?Gly?Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?65 70 75 80Glu?Ala?Glu?Ser?Ala?Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp
85 90 95Asp?Asp?Val?Asp?Thr?Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp?Ser?Gly
100 105 110Gly?Gly?Gly?Ser?Ala?Pro?Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu
115 120 125Gln?Leu?Glu?His?Leu?Leu?Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile
130 135 140Asn?Asn?Tyr?Lys?Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe145 150 155 160Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu
165 170 175Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys
180 185 190Asn?Phe?His?Leu?Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile
195 200 205Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala
210 215 220Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe225 230 235 240Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu?Thr
245＜210〉7＜21l〉747＜212〉DNA＜213〉artificial sequence＜220〉＜221〉CDS＜222〉(1) .. (747)＜400〉7gca cct act tca agt tct aca aag aaa aca cag cta caa ctg gag cat 48Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His 15 10 15tta ctg ctg gat tta cag atg att ttg aat gga att aat aat tac aag 96Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys
20 25 30aat?ccc?aaa?ctc?acc?agg?atg?ctc?aca?ttt?aag?ttt?tac?atg?ccc?aag 144Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys
35 40 45aag?gcc?aca?gaa?ctg?aaa?cat?ctt?cag?tgt?cta?gaa?gaa?gaa?ctc?aaa 192Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys
50 55 60cct?ctg?gag?gaa?gtg?cta?aat?tta?gct?caa?agc?aaa?aac?ttt?cac?tta 240Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?65 70 75 80aga?ccc?agg?gac?tta?atc?agc?aat?atc?aac?gta?ata?gtt?ctg?gaa?cta 288Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu
85 90 95aag?gga?tct?gaa?aca?aca?ttc?atg?tgt?gaa?tat?gct?gat?gag?aca?gca 336Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala
100 105 110acc?att?gta?gaa?ttt?ctg?aac?aga?tgg?att?acc?ttt?tgt?caa?agc?atc 384Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser?Ile
115 120 125atc?tca?aca?cta?act?tcg?ggt?ggc?ggt?ggc?tct?atg?tca?gac?gca?gcc 432Ile?Ser?Thr?Leu?Thr?Ser?Gly?Gly?Gly?Gly?Ser?Met?Ser?Asp?Ala?Ala
130 135 140gta?gac?acc?agc?tcc?gaa?atc?acc?acc?aag?gac?tta?aag?gag?aag?aag 480Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp?Leu?Lys?Glu?Lys?Lys145 150 155 160gaa?gtt?gtg?gaa?gag?gca?gaa?aat?gga?aga?gac?gcc?cct?gct?aac?ggg 528Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Arg?Asp?Ala?Pro?Ala?Asn?Gly
165 170 175aat?gct?aat?gag?gaa?aat?ggg?gag?cag?gag?gct?gac?aat?gag?gta?gac 576Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala?Asp?Asn?Glu?Val?Asp
180 185 190gaa?gaa?gag?gaa?gaa?ggt?ggg?gag?gaa?gag?gag?gag?gaa?gaa?gaa?ggt 624Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Gly
195 200 205gat?ggt?gag?gag?gag?ggt?gga?gat?gaa?gat?gag?gaa?gct?gag?tca?gct 672Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?Glu?Ala?Glu?Ser?Ala
210 215 220acg?ggc?aag?cgg?gca?gct?gaa?gat?gat?gag?gat?gac?gat?gtc?gat?acc 720Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp?Asp?Asp?Val?Asp?Thr225 230 235 240aag?aag?cag?aag?acc?gac?gag?gat?gac 747Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp
245＜210〉8＜211〉249＜212〉PRT＜213〉artificial sequence＜400〉8Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His l, 5 10 15Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys
20 25 30Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys
35 40 45Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys
50 55 60Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?65 70 75 80Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu
85 90 95Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala
100 105 1l0Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser?Ile
115 120 125Ile?Ser?Thr?Leu?Thr?Ser?Gly?Gly?Gly?Gly?Ser?Met?Ser?Asp?Ala?Ala
130 135 140Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp?Leu?Lys?Glu?Lys?Lys145 150 155 160Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Gly?Arg?Asp?Ala?Pro?Ala?Asn?Gly
165 170 175Asn?Ala?Asn?Glu?Glu?Asn?Gly?Glu?Gln?Glu?Ala?Asp?Asn?Glu?Val?Asp
180 185 190Glu?Glu?Glu?Glu?Glu?Gly?Gly?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Glu?Gly
195 200 205Asp?Gly?Glu?Glu?Glu?Gly?Gly?Asp?Glu?Asp?Glu?Glu?Ala?Glu?Ser?Ala
210 215 220Thr?Gly?Lys?Arg?Ala?Ala?Glu?Asp?Asp?Glu?Asp?Asp?Asp?Val?Asp?Thr225 230 235 240Lys?Lys?Gln?Lys?Thr?Asp?Glu?Asp?Asp
245
Claims (10)
1, a kind of recombinant human alpha prothymosin-interleukin-22 gene, its nucleotide sequence is shown in sequence table.
2, the described recombinant human alpha prothymosin of claim 1-interleukin-22 gene is characterized in that holding the C end from N, can arrange by α prothymosin-interleukin-22 or interleukin-22-α prothymosin.
3, a kind of fusion rotein is characterized in that its amino acid sequence coded is shown in sequence table by the described recombinant human alpha prothymosin of claim 2-interleukin-22 genetic expression gained.
4, the described recombinant human alpha prothymosin of claim 2-interleukin-22 gene, the 3rd halfcystine of the interleukin-2 gene that it is characterized in that encoding be replaceable to be other conserved amino acid.
5, the described recombinant human alpha prothymosin of claim 4-interleukin-22 gene, the 3rd halfcystine of the interleukin-2 gene that it is characterized in that encoding be replaceable to be Serine.
6, the described recombinant human alpha prothymosin of claim 2-interleukin-22 gene is characterized in that also containing in this gene order connexon.
7, the described recombinant human alpha prothymosin of claim 6-interleukin-22 gene is characterized in that described connexon sequence is 5 ' TCGGGTGGCGGTGGCTCT 3 '.
8, a kind of expression vector pProTM/IL-2 is characterized in that containing the described recombinant human alpha prothymosin of claim 2-interleukin-22 gene.
9, the application of the described fusion rotein of claim 3 in preparation treatment viral infection disease, antitumor and other immunodeficiency diseases medicines.
10, the application of the described expression vector of claim 8 in the preparation gene therapy medicament.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031138292A CN1186448C (en) | 2003-02-28 | 2003-02-28 | Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031138292A CN1186448C (en) | 2003-02-28 | 2003-02-28 | Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1435427A true CN1435427A (en) | 2003-08-13 |
| CN1186448C CN1186448C (en) | 2005-01-26 |
Family
ID=27634211
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031138292A Expired - Fee Related CN1186448C (en) | 2003-02-28 | 2003-02-28 | Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1186448C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100500844C (en) * | 2005-03-07 | 2009-06-17 | 上海普洛康裕药物研究院有限公司 | High secretion expression of recombination thymosin-alpha 1 in Escherichia coli and separation and purification therefor |
| CN103230586A (en) * | 2013-05-08 | 2013-08-07 | 厦门大学 | Application of recombinant human thymosin alpha protein to preparation of drugs for wound healing |
-
2003
- 2003-02-28 CN CNB031138292A patent/CN1186448C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100500844C (en) * | 2005-03-07 | 2009-06-17 | 上海普洛康裕药物研究院有限公司 | High secretion expression of recombination thymosin-alpha 1 in Escherichia coli and separation and purification therefor |
| CN103230586A (en) * | 2013-05-08 | 2013-08-07 | 厦门大学 | Application of recombinant human thymosin alpha protein to preparation of drugs for wound healing |
| CN103230586B (en) * | 2013-05-08 | 2014-09-03 | 厦门大学 | Application of recombinant human thymosin alpha protein to preparation of drugs for wound healing |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1186448C (en) | 2005-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1309705A (en) | IL-2 selective agonists and antagonists | |
| CN1104217A (en) | Peptides having T cell helper activity | |
| CN1079225A (en) | Tnf-muteins | |
| CN1604965A (en) | Growth hormone fusion protein | |
| CN1062014C (en) | Recombinant gene coding for human alpha interferon and expression vector thereof, ETC. | |
| CN1673232A (en) | Receptor DR5 monoclonal antibody (AD5-10) resisting human tumor necrosin related apoptosis inducing ligand and its prepn and use | |
| CN1276428A (en) | Clone and expression of anti-CA125 bifunctional genetically engineered antibody | |
| CN1435427A (en) | Recombinant human alpha-prothymosin interleukin 2 gene and its expression and use | |
| CN102174522B (en) | Preparation method of protein 4-1BBL | |
| CN1191271C (en) | Thymic peptide fusion protein as one new interferon and its prepn. and use | |
| CN1861635A (en) | Human pancreas hyperglycemiacin relative peptide-2 analogue | |
| CN1088107C (en) | Method for preparing human granulocyte macrophage colony stimulating factor and its expressing carrier and engineering bacteria | |
| CN1490333A (en) | Insulinotropic peptide and its use | |
| CN1523040A (en) | Fusion protein of human thymosin alpha1 and human composite interferon and preparation thereof | |
| CN1844390A (en) | Duck B lymphocyte stimulating factor cDNA and its clone method and recombinant use | |
| CN1295332C (en) | Recombination human alkaline fiber forming cell growth factor gene and its nonfusion expression product, production method and application | |
| CN1033837A (en) | Cultivate the method for recombinant protein expression cells | |
| CN1651464A (en) | Chain antibiotics / granul cell-macrophage colong stimulating factor fusion protein | |
| CN1746188A (en) | Analog of GLP-1 | |
| CN1203920A (en) | Method for producing recombinant human interleukin-6 | |
| CN1869230A (en) | Nucleotid sequence of human interleukin 21 and method and application of producing matured human interleukin 21 | |
| CN1197877C (en) | AsLc-IFN fusion protein and its preparation | |
| CN1220701C (en) | Recombinded chemotaxis cytokine of human cirumferential lymphatic tissue as well as its preparing method and usage | |
| CN100335499C (en) | C-terminal amino acid lactone modified extrasin alpha-1 and its uses | |
| CN1284798C (en) | Poly thymosin-alpha 1, its composition, its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |