CN100478439C

CN100478439C - Prawn antiviral growth-promoting double-function engineering strain, construct method and application

Info

Publication number: CN100478439C
Application number: CNB2006101246555A
Authority: CN
Inventors: 孟小林; 徐进平; 龙燕; 王健; 鲁伟; 韩建山
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2006-09-29
Filing date: 2006-09-29
Publication date: 2009-04-15
Anticipated expiration: 2026-09-29
Also published as: CN101016519A

Abstract

The invention discloses a prawn white spot comprehensive virus capsule membrane protein vp28 and genetic engineering strain of carp growth hormone GH fused protein and constructing method and appliance, which comprises the following steps: extracting total RNA from glandula pituitaria of prawn; reverse- transcripting; getting GH gene; extracting WSSV from ill prawn polypide; preparing vp28 gene through PCR method; constructing shuttle plasmid pPIC6alphac-GH-vp28 with growth hormone GH gene and WSSV vp28 gene; cutting pPIC6alphac-GH-vp28 with enzyme; making to linearization; inverting yeast X33 competence cell; inducing with methanol; expressing genetic engineering fused protein GH+VP28 protein in pichia. This protein can either accelerate growth of prawn, or increases immunity and disease resistance for WSSV.

Description

Prawn antiviral growth-promoting double-function engineering strain and construction process and application

Technical field

The present invention relates to the gene biological field of engineering technology, more specifically relate to a kind of engineering strain that efficiently expresses white spot syndrome virus (WSSV) (WSSV) envelope protein VP28 and carp growth hormone (GH) fusion rotein, also relate to a kind of construction process of engineering strain simultaneously.The invention still further relates to the purposes of this bacterial strain in the research and development of prawn antiviral growth-promoting.

Background technology

Prawn is the main aquaculture kind in coastal countries and area, and shrimp culture industry is the important pillar of the economy industry of China's Coastal Areas always, and China also is one of maximum prawn producing country in the whole world.1987 and 1988, extensive fulminant death took place in the tigar prawn that culture China Taiwan, and this is the what is called " shrimp pest " (prawn white spot syndrome) that occurs first in the world wide.The big area of shrimp white spot syndrome virus disease in 1993 is broken out, and has caused enormous economic loss for global shrimp culture industry, and therefore the prawn annual production of China has also reduced more than 70%.Causing the main pathogens of the crushing heavy losses of current global prawn industry is that (White Spot Syndrome Virus, WSSV), this virus remains one of the most serious virus causing disease of shrimp culture industry hazardness to shrimp white spot syndrome virus up to now.

Shrimp white spot syndrome virus is a kind ofly not have inclusion body, tool cyst membrane, an end tail shape structure, shaft-like double-stranded cyclic DNA virus are arranged, and genome sequence is determined.Its infection host wide range, it not only infects various wild and cultured prawns, and infects other aquatic crustaceans such as crab, crayfish and lobster etc., has become the virus to aquatic Crustacean biggest threat.Proved Penaeus vannamei (Penaeus vannamei) at present, tigar prawn (Penaeus monodon), japonicus (Penaeus japonicus), Penaeus merguiensis de man. (Penaeus merguiensis), penaeus penicillatus (Penaeus penicillatus), Chinese prawn (Penaeus orientalis), the new prawn of cutter volume (Metapenaeus ensis), the nearly new prawn of edge (Metapenaeus affinis), dusky white prawn cultured prawns such as (Palaemon carincauda) all can be infected by WSSV.With WSSV mud crab (Scylla serrata), Portunus trituberculatus Miers (Portunus trituberculatus), Procambius clarkii (Procambarus clarkii), Australian Lobster fresh water Crustaceans such as (Cherax quadricarinatus) have been carried out artificial challenge's experiment, it is deadly that the result proves that these animals all can be infected by WSSV without exception, shows the harm that WSSV may cause other fresh water shrimps, crayfish culture.

This viral infectivity is extremely strong, the prawn of acute HIV infection show as move about slow, food refusal, epidermis is loose, body colour is rubescent, and it is the symptoms such as white dot that 0.5～2mm differs in size that diameter appears in subcutaneous, crust and appendage, 3-7 in day lethality rate up to 90～100%.Find the stomach of the destruction prawn that this virus can be serious, the gill, lymphatic organ official rank by the tissue behind the infective virus being carried out histopathological analysis.The virus infection early sign shows as the enlargement of host cell nuclear, and the chromatin limit is moved.Ultrathin section(ing) is observed and can be found that a large amount of virus particle concentrates in the infected cells nuclear.

WSSV does not have the effectively preventing method at present as yet.Traditional aquaculture model of directly building the pond in the bay is the very easily sudden and violent one of the main reasons of WSSV.In addition; prawn is as the crustaceans lower animal; most kinds are extremely sensitive to WSSV; simultaneously can not produce specific immunoprotection with methods of vaccination again; abrupt change, water quality deterioration, the density of various possible stress situations such as temperature is too high, fish for etc., can become prawn white spot syndrome and break out and the popular risk factor.Improve the resistance against diseases of prawn body, optimize shrimp pond ecological environment, strengthen the science feeding and management, the route of transmission of stopping WSSV is the effective means of preventing and treating virus disease at present.Yet above measure is higher, the technical sophistication of cost on the one hand, but can not get rid of the possibility of failure fully.

In invertebrates, owing to lack immunoglobulin (Ig), the important factor that plays the effect of identification allogenic material in immunity is lectin and endoglobar pro-phenoloxidase system, after being activated, composition in this system can promote engulfing and parcel of hemocyte, produce bacteriocidal substance etc., play the effect of resisting pathogenic bacteria.There are report polysaccharide, alkaloid, ketone, organic acid etc. can activate the immunity system of prawn and Crustacean, strengthen the resistance against diseases of prawn.But rely on the non-specific immunity system that activates prawn to reach the purpose of anti-WSSV, prevention effect can not be satisfactory, and cost is also than higher.

At present, also do not illustrate at infection and the pathogenesis of molecular level WSSV.The invasion of virus needs virus to combine with the specificity of cell surface receptor, and virus envelope albumen plays an important role in this process, is the pathogenic indispensable protein of virus.And the specific antibody of envelope protein and combining of virus particle can be checked combining of virus and acceptor and then viral absorption and the intrusion of influence.

Existing bibliographical information utilizes polyclone or the monoclonal antibody of the main envelope protein VP28 of prawn WSSV can effectively suppress viral absorption and intrusion, thereby duplicating of blocking virus reaches the viral effect of neutralization.(Van Hulten M C W, Witteveldt J, VlakJ M, et al.White Spot Syndrome Virus Envelope Protein VP28 IsInvolved in the Systemic Infection of Shrimp.Virology, 2001,285:228-233. and You Z, Nadala EC Jr, Yang J, Production of polyclonalantiserum specific to the 27.5 kDa envelope protein of white spotsyndrome virus.Dis Aquat Organ, 2002,51 (1): 77-80)

Virus envelope albumen is virus antigen determinant place; for enhancement antigen; improve the neutralization of polyclonal antibody; Li; H-X and Meng; X-L selects cyst membrane fusion rotein VP (19+28) the antigen prepd rabbit anti-serum of escherichia coli expression for use; with the crayfish is animal model, and the research antiserum(antisera) is to the neutralizing effect of WSSV, and the result shows; the antiserum(antisera) of fusion rotein has produced good provide protection (Li to the experiment crayfish; H-X, Meng, X-L et al; 2005; Protection of crayfish, Cambarus clarkii, from white spot syndromevirus by polyclonal antibodies against a viral envelope fusion protein.; Journal of Fish Diseases 28 (5), 285-291.).But it is too high to use viral antiserum(antisera) to be applied to WSSV control production cost, is difficult to realize industrialization.

For the most effective measure of control of virus disease are preparations of vaccine, yet Crustacean is considered to lack similar mammiferous immunity system for a long time, can only rely on inborn antipathogen to resist the invasion of external cause of disease.But existing many research reports have confirmed that Crustaceans has relative Mammals " accurate immunity system ".Recently, AtsushiNamikoshi etc. induce the resistibility of prawn to WSSV with diverse ways, discover, come immune prawn with the WSSV of deactivation and Vibrio penaeicida mixture or with envelope protein VP28, the VP26 of the WSSV of escherichia coli expression, when the regular hour was attacked prawn with WSSV again after immunity, mortality ratio all descended to some extent.In addition, the JeroenWitteveldt envelope protein VP28 of the WSSV of escherichia coli expression, VP19-MBP (the maltose binding protein, MBP) prawn of injecting or throw something and feed as subunit vaccine, find that prawn has possessed certain resistibility (Witteveldt J to WSSV in the regular hour scope, Cifuentes CC, Vlak JM, et al., Protection of Penaeusmonodon against white spot syndrome virus by oral vaccination.JVirol, 2004,78 (4): 2057-2061. and Witteveldt J, Vlak J M., van HultenM C, Protection of Penaeus monodon against white spot syndromevirus using a WSSV subunit vaccine.Fish﹠amp; Shell.sh Immunology, 2004,16:571-579).In addition, Zhang Chunli etc. express VP28 with blue-green algae as the host, slightly carry the back and give prawn oral (Zhang Chunli, Shi Dingji, Huang Jian, Zhang Haixia, Peng Guohong, the clone of white spot syndrome virus (wssv) envelope protein VP28 gene reaches the structure of expression vector in blue-green algae, ocean science, 2003,27 (2): 72-76), this transgenic blue algae also is a kind of a kind of trial of WSSV subunit vaccine.

In the patent documentation of World Intellectual Property Organization, also prevent the application of WSSV as vaccine relevant for application WSSV envelope protein.3 patents have successively been applied for as Dutch AKZO NOBEL company, be the several main protein of VP28, VP26, VP24, VP19 and ORF167 of utilizing WSSV and prepare WSSV immune vaccine (WO0109340---Proteins Derived From White Spot Syndrome Virusand Use thereof), (WO03000900---White Sport Syndrome VirusVaccine), (WO0222664---Antigenic Proteins of Shrimp White SpotSyndrome Virus and Use thereof).

(Growth Hormone is by a kind of single chain protein matter of fish anterior lobe of hypophysis excretory GH) to fGH, and the most basic physiological function of fish GH is to promote the fish bulk-growth and participate in multiple short anabolic action.In culture fishery fish, shrimp artificial diet, usually add shrimp head powder and playing promotion growth effect with the tethelin that the pituitary gland that promotes its growth, be actually to contain in the shrimp head powder produces.FGH field in aquaculture has great using value, thereby more and more comes into one's own.Become the focus of aquaculture research, and carried out business-like trial step by step, obtained very big progress.

The work that separates fish GH first starts from the mid-1970s, the fGH of purifying out first in the Mozambique tilapia.The middle and later periods eighties forms the research focus, has the separated purifying of GH of nearly 20 kinds of fish at present in the world, has separated the fish GH that obtains and has generally contained 187～188 amino acid, and molecular weight mostly is 21～22kD, and fish GH iso-electric point is between 5.6～7.1.GH performance function is mainly via two approach: the one, and inducing hepatocyte, myocyte produce somatomdein, work indirectly via medium again; The 2nd, directly act on target cell and produce physiological effect.That a kind of mode GH needs at first with the combination of cell surface specific receptors, again by receptor-mediated, excite the biochemical reaction in a series of born of the same parents and finally causes the generation of corresponding biological effect.

FGH can promote growing of fish, quickens the physiological function of protein synthesis and lipid degradation, what is more important, and fish GH does not have any in conjunction with active to mammiferous growth hormone receptor, thereby has very high biological safety.The research that fGH is used in aquaculture is carried out widely.Since fGH in the fish body itself content seldom, be by directly extracting in the fish body, cost is bigger, it is loaded down with trivial details that technology also compares.The applied research of all present stages mainly concentrates on two aspects: the breeding of the long hormone gene fish of reincarnation and the research of albonubes somatotropic hormone gene engineering.

FGH is single polypeptide, does not have subunit, does not need modifications such as glycosylation, and contains less disulfide linkage, and renaturation is carried out gene engineering expression so adapt to especially easily.The gene engineering expression of the fGH that present stage carries out mainly is to express by intestinal bacteria and yeast.The clear grade of letter transformed salmon growth hormone cDNA, and to expression in escherichia coli, expression product as the fodder additives tilapia of throwing something and feeding, has tangible growth promoting function after preliminary purification and renaturation with improved gene clone.

FGH has also been obtained very big progress in the intravital expression of yeast, and yeast, has than intestinal bacteria and more to many superiority particularly as the expression of the comparatively simple exogenous protein of this structure of tethelin as the expressive host of heterologous protein.At first, environment is more suitable for the correct folding of eukaryotic protein in the zymic born of the same parents; Secondly, yeast has the glycosylation ability, and this is vital for proteic structure integration, solubility and biological activity.Pichia spp (Pichia pastoris) expression system is a kind of novel and effective heterologous gene expression system, contain the AOX1 strong promoter that is subjected to the methyl alcohol regulation and control, can the stability and high efficiency expression alien gene. this yeast also can be translated post-treatment to expression product and modify, and is the desirable host of eukaryotic gene expression.In addition, the Pichia bacterial strain is extremely good unicellular fodder yeast, can be on simple substratum high density fermentation.Perch tethelin is successfully expressed in pichia spp, has obtained well shortly to increase the middle test of carrying out the cage culture of seawater after the effect and obtained success in feeding the experiment of raising tilapia.

In recent years research is flooded or is added feeding prawn in the feed with proof, tethelin, also can play the effect that promotes growth.Wu Aizhen etc. are at expression in escherichia coli carp growth hormone recombinant DNA, through high density fermentation, the extraction of inclusion body and renaturation, can improve survival rate (Wu Aizhen greatly with dipping method processing fry and shrimp seedling, Sun Yukun. the production research of genetically engineered fish growth hormone, the biotechnology journal, 1997,13 (2): 200～205.).The recombinant human growth hormone that the big squama fiber crops that Xu Bin etc. will express in yeast breathe out fish is added into the prawn young of throwing something and feeding in the Articial bait making, study it to the growth of the Chinese prawn young and the influence of surviving rate, when experiment finished through 50d, the average body weight average of two experimental group juvenile prawns was significantly higher than the mean body weight of control group juvenile prawn.The body weight gain rate of experimental group juvenile prawn also is significantly higher than the control group juvenile prawn.In addition, the surviving rate of experimental group juvenile prawn also be significantly higher than the control group juvenile prawn surviving rate (Xu Bin. the separation of fish growth hormone, evaluation and physiological function progress of research thereof. Oceanologia et Limnologia Sinica, 1997,28 (2): 209～214.).This result of study shows that fully the reorganization fish growth hormone adds the prawn of throwing something and feeding in the bait, has the effect of significant promotion Chinese prawn shrimp bulk-growth, has improved the surviving rate that juvenile prawn grows simultaneously greatly.

Another object of the present invention is to provide a kind of method for preparing pichia pastoris gene engineering bacterial strain.Pichia yeast expression system is a kind of comparatively ideal eukaryotic protein expression system, and have the following advantages: (1) foreign gene can be incorporated on the pichia pastoris phaff genome, and engineering strain is more stable.(2) can process folding and posttranslational modification to expressed proteins, thereby make the expressed proteins biologically active; (3) has strong alcohol oxidase (AOX1) gene promoter, expression that can strict regulation and control foreign protein; (4) pichia spp is easy to operate and cultivate.Nutritional requirement is low, and growth is fast, and the substratum cheapness can the high density fermentation growth, also can industrialized production; (5) expression amount height.

Summary of the invention

The object of the present invention is to provide a kind of pichia pastoris gene engineering bacterial strain, this bacterial strain can be expressed vp28 and the carp growth hormone GH genetic engineering fusion protein (vp28+GH) that produces WSSV.Its advantage is the expression amount height, is easy to suitability for industrialized production, and cost is low, and security is good.

A further object of the invention is to be to provide the application of genetically engineered Pichi strain in shrimp culture industry.

Further object of the present invention is that the genetically engineered Pichi strain is as the application in the medicine of preparation treatment or the infection of prevention prawn.

The object of the present invention is to provide the preparation method of a kind of antiviral growth-promoting double-function medicine (feed), this kind medicine (feed) has the effect of prevention and treatment WSSV, and can promote the g and D of prawn, improves prawn output.And free from environmental pollution, can other species in the water body not worked the mischief, to the person poultry harmless.

Before told and, the main envelope protein VP28 of WSSV has the ability that the anti-WSSV of prawn infects that improves.The recombinant fish growth hormone that obtains from genetically engineered can be brought into play the function of similar spontaneous growth hormone, can be applied to the culture experiment of shrimp by injection, mode such as oral, and evidence can promote the growth of shrimp.Innovation part of the present invention is, the present invention selects the fusion rotein of Pichia anomala expression carp growth hormone (GH) and WSSV envelope protein vp28 for use, be intended to fully utilize the effect of its short prawn growth and raising immunizing power, can be by recombinant human growth hormone and VP28 fusion rotein that genetically engineered is produced be applied to the prawn culture fishery for fodder additives, can promote the prawn growth, improve immunizing power and disease resistance simultaneously, improve the foster industry of prawn and grow output.Pichia yeast expression system is a kind of novel and effective heterologous gene expression system, contain the AOX1 strong promoter that is subjected to the methyl alcohol regulation and control, can the stability and high efficiency expression alien gene, under induce of methyl alcohol as unique carbon source, expression amount can account for 30% of whole yeast total protein.This yeast also can be translated post-treatment to expression product and modify, and is the desirable host of eukaryotic gene expression.To also have an important advantage be exactly that security is good to yeast on using, and can directly feed as the additive of feed, can exempt the program of purified growth hormone, has broad application prospects.

Technical scheme of the present invention is as follows:

One of technical essential of the present invention is the structure and the abduction delivering of the pichia pastoris gene engineering bacterial strain of expressing gene engineering fusion rotein (vp28+GH).

Molecular biology method involved in the present invention is conventional method, by those skilled in the art are familiar with.A kind of method that makes up engineering strain is provided in one embodiment of the invention, bacterial strain is pichia spp Pichia pastoris X-33pPIC 6 α c-GH+vp28, depositary institution: Chinese typical culture collection center, address: China. Wuhan. Wuhan University, preservation date: on September 19th, 2006, deposit number: CCTCC M206101, classification name: Pichia pastoris X-33/pPIC 6 α c-GH+vp28.

Utilize genetically engineered pichia spp bacteria strain, the method steps of preparation fusion rotein is as follows:

1. the preparation of carp growth hormone gene

The present invention extracts total RNA from Medulla Cyprinus carpio hypophysis, reverse transcription obtains growth hormone gene then, and technical route is as follows:

Get Medulla Cyprinus carpio hypophysis, extract the method for test kit introduction according to RNA and extract total RNA, electrophoretic analysis RNA quality.According to the sequences Design primer of carp GH mature peptide, introduce restriction enzyme respectively at the primer two ends, be beneficial to the clone, and, be convenient to gene Fusion original terminator codon TAG sudden change.Carry out the synthetic and pcr amplification of cDNA according to the method for reverse transcription test kit introduction, whether the PCR product conforms to expection by its size of detected through gel electrophoresis, with the gene sequencing rear clone that obtains in the pMD-18T carrier, picking colony rapid extraction plasmid carries out enzyme and cuts evaluation, resulting positive colony is to comprise the intestinal bacteria that the present invention relates to the GH gene, is used for the propagation and the preservation of gene.

2.WSSV the preparation of vp28 gene

The present invention extracts WSSV from the prawn polypide of falling ill and the method by PCR prepares the vp28 gene, and technological line comprises:

(1) the virus genomic preparation of WSSV: in lung, stomach and the heart of getting the disease shrimp on ice, ice bath homogenate, add Proteinase K (100 μ g/ml) then, handling the back boils about 15min in boiling water, ice bath 5min immediately, 12, the centrifugal 10min of 000r/min gets its supernatant liquor and does template DNA, all the other 4 ℃ of preservations.

(2) pcr amplification vp28 gene

Amplimer is synthetic: according to the WSSV sequences Design PCR oligonucleotide amplimer of having delivered among the GeneBank.Adopt conventional PCR method amplifying target genes vp28, whether the PCR product conforms to expection by its size of detected through gel electrophoresis.Reclaim the PCR product and it is cloned in the carrier, picking colony rapid extraction plasmid carries out enzyme and cuts evaluation, and resulting positive colony is to comprise the intestinal bacteria that the present invention relates to the vp28 gene, is used for the propagation and the preservation of gene.

3. the structure of the preparation of fusion gene and shuttle plasmid

(1) structure of shuttle plasmid pPI6 α c-GH: enzyme is cut recombinant plasmid and the shuttle plasmid pPIC6 α c that contains the GH gene simultaneously, glue reclaims the band that order contains the GH gene, be transformed among the competence E.coli after 16 ℃ of connections, resulting positive colony is to comprise the intestinal bacteria that the present invention relates to the GH gene, called after pPIC6 α c-GH is used for the preparation of fusion gene and the structure of shuttle plasmid.

(2) structure of shuttle plasmid pPI6 α c-GH-vp28

Enzyme is cut recombinant plasmid that contains the vp28 gene and the shuttle plasmid pPI6 α c-GH that contains the GH gene simultaneously; glue reclaims the band of order vp28 gene; be transformed among the competence E.coli after 16 ℃ of connections; resulting positive colony (pPI6 α c-GH-vp28) comprises the intestinal bacteria that the present invention relates to the GH+vp28 fusion gene, and this plasmid also can be used as the structure that shuttle plasmid is used for yeast gene engineering bacteria.

4. the structure of yeast gene engineering bacteria

Enzyme is cut recombinant shuttle plasmid pPI6 α c-GH-vp28 and is made its linearizing, transformed yeast X33 competent cell.The picking transformant extracts pastoris genomic dna, carries out PCR respectively with special primer and universal primer and detects, and filters out positive transformant pPI6 α c-GH-vp28/X33.Resulting positive colony is the engineering strain that can express GH gene and vp28 gene simultaneously involved in the present invention, can be used to prepare related productss such as prawn antiviral growth-promoting double-function related drugs, feed, additive.

5. the preparation of genetic engineering fusion protein

The gene A OX1 and the AOX2 of two coding alcohol oxidases are arranged in pichia spp, can utilize methyl alcohol to grow fast, and when having other carbon sources in the substratum, the AOX gene is not expressed as sole carbon source.In pichia pastoris engineered strain, foreign gene is cloned into the control of AOX1 promotor down, must also be that sole carbon source is realized efficiently expressing of foreign protein simultaneously with methyl alcohol as inductor therefore, when abduction delivering, should replenish methyl alcohol to keep its content of 0.5%.

A kind of method of pichia pastoris engineered strain abduction delivering is provided in an embodiment of the present invention, the substratum that can be used for the pichia pastoris engineered strain abduction delivering includes but are not limited to following substratum: MGY, MM, BMM, BMMY, the collocation method of various substratum and pichia pastoris engineered strain derivational expression method the following is the method that present technique field personnel are familiar with very much, can obtain detailed information by the reference pertinent literature.

Two of technical essential of the present invention is determinations of activity of genetic engineering fusion protein.

A kind of method of determination of activity of genetic engineering fusion protein is provided in one embodiment of the invention, prove genetic engineering fusion protein involved in the present invention can urge prawn growth and, improve prawn and support industry output, also can improve immunizing power and the disease resistance of prawn simultaneously WSSV.

The present invention compared with prior art has the following advantages and effect:

(1) the short shrimp bulk-growth effect experiment of recombinant protein GH+VP28

Each group experiment shrimp surviving rate during the injection in 5 weeks is 100%, the take off data of experiment mean number ± standard deviation (x ± s) expression.Through 5 week experiments, the body weight gain rate of experimental group 1 is faster 20% than control group, and group 2 is than control group fast 8%.Through the t check, compare with control group, there were significant differences to organize 1 body weight, and it is not remarkable to organize 2 differences.The result shows: fusion rotein GH+VP28 prawn bulk-growth has promoter action.

(2) the anti-WSSV infection effect experiment of recombinant protein GH+VP28

The result who cultures under 22 ℃-25 ℃ condition shows, cumulative mortality is 35% behind the huge legendary turtle shrimp 8d of injection purified fusion protein GH+VP28 protein groups, the huge legendary turtle shrimp of positive controls cumulative mortality after infecting WSSV 9d has reached 100%, and reach dead peak at 3-5d, and the negative control group huge legendary turtle shrimp of having injected TN buffer does not have any pathological phenomenon.Illustrate that injection recombination fusion protein GH+VP28 can obviously improve the anti-WSSV infectivity of prawn.

Description of drawings

The building process of Fig. 1 recombinant shuttle plasmid-pPIC6 α C-gh+vp28

The enzyme of Fig. 2 recombinant shuttle plasmid pPIC6 α C-(gh+vp28) is cut with PCR and is identified

Fig?2.The?identification?of?recombinant?shuttle?plasmids?pPIC6αC-(gh+vp28)

1：PCR?production?of?vp28by?Primer3，4；2：PCR?production?of?ghby?Primer?1，2；3：pPIC6αC-(gh+vp28)/EcoR?I+Xba?I；4：pPIC6αC-(gh+vp28)/Xba?I；5：recombinant?vector?pPIC6αC-(gh+vp28)；6：PCR?production?of?gh+vp28by?primer?1，4；7：PCRproduction?of?gh+vp28?By?Primer?AOX1.

Fig. 3 positive bacteria genome PCR identifies

Fig3.The?identification?of?positive?strain?genosome?by?PCRM：Marker?DL2000；1：PCR?production?of?gh+vp28?by?prime?AOX1；2：PCR?production?of?vp28?by?Primer3，4?3：PCR?production?of?ghprimer1，2；4：PCR?production?of?gh+vp28?by?prime?1，4、5、6：positivecontrol?fragments?of?gh?and?vp28?PCR.

Fig. 4 .SDS-PAGE and Western Blot Analysis and Identification target protein

Fig4.The analysis of fusional protein GH+VP28 expression1:Western Blot; 2: methanol induction 96h, methanol induction 72h, methanol induction 48h; 5: negative control: methanol induction 96h.M is the protein molecular mark.

Fig. 5 .3 group experiment shrimp is injected the growth curve after 5 weeks

Fig. 6 respectively organizes shrimp bulk-growth cumulative mortality curve after infecting WSSV

Fig.6?Time-morality?relationship?of?each?group?of?crayfish?afterinfected?WSSV

1：group?injected?with?WSSV：injected?with?TN?buffer?twice?at?5?daysinterval?and?then?infected?WSSV?2?days?later；2：group?injected?withGH+VP28?injected?with?purified?GH+VP28?twice?at?5?days?interval?andthen?infected?WSSV?2?days?later；3：group?injected?with?TN?buffer：injected?with?TN?buffer?twice?at?5?days?interval?and?infected?with?TNbutfer?2?days?later.

Embodiment

The invention will be further described below in conjunction with drawings and Examples, substratum among all embodiment and molecular biology working method are familiar with by those skilled in the art, can " " (laboratory manual, cold spring port, 1989) etc. obtain detailed information molecular cloning with reference to Sambrook etc.

The preparation of embodiment 1 carp growth hormone gene

Sequences Design primer according to the GH that has delivered among the GenBank.The upstream primer prime1 of gh: GAATTCATCAGACAACCAGCGGCTCTTCAATAATGC. (line place is the EcoRI site), the downstream primer prime2 of gh: TCTAGAAACTCCAGGGTGCAGTTGGAATCCA (line place is the XbaI site).With PMD-18-gh is that template is carried out PCR.The PCR reaction system: 10 * reactionbuffer 5uL, MgCl2 3uL (1.5mM), dNTP 1uL (0.2mM), each 1uL of upstream and downstream primer (30pmol), Taq archaeal dna polymerase 1uL (5U), template 4uL, adding sterilized water to final volume is 50uL.The reaction conditions of PCR is: 95 ℃ of 5min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, after 30 circulations, 72 ℃ of 10min.

The preparation of the vp28 gene of embodiment 2WSSV

Sequences Design primer according to the vp28 that has delivered among the GenBank.Vp28 upstream primer prime3: TCTAGAATGGATCTTTCTTTCACTCTTTC (line place is the XbaI site), vp28 downstream primer prime4: TCTAGAAATTGCTCGGTCTCAGTGCCAG (line place is the XbaI site).With pUCm-vp28 is that template is carried out PCR.PCR reaction system: 10 * reaction buffer5uL, MgCl ₂3uL (1.5mM), dNTP 1uL (0.2mM), each 1uL of upstream and downstream primer (30pmol), Taq archaeal dna polymerase 1uL (5U), template 4uL, adding sterilized water to final volume is 50uL.The reaction conditions of PCR is: 95 ℃ of 5min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, after 30 circulations, 72 ℃ of 10min.

Recovery, purifying and the subclone of embodiment 3 PCR products

With above PCR product electrophoresis (1 * TAE) on sepharose, observe the electrophoresis situation with ultraviolet lamp, when the DNA band that will reclaim separates fully with other bands, stop electrophoresis, under ultraviolet lamp, downcut desire and reclaim band with blade, with PCR product purification test kit purifying. in the Eppendorf pipe, glue is smashed to pieces, added the sol solutions Binding Buffer of 4 times of volumes, 65 ℃ of water-bath 7min, every therebetween 2min jog Eppendorf pipe once makes glue melt fully, get 750 μ l and be added on the pillar, the centrifugal 1min of 12000rpm discards liquid, add 300 μ lBinding Buffer, the centrifugal liquid that discards adds 750 μ l Washing Buffer, the centrifugal liquid that discards, repeat once, the centrifugal 1min of the sub-12000rpm of void column is put in 1.5ml Eppendorf pipe to dry liquid with pillar, adds the aseptic ddH of 30 μ l ₂O, 37 ℃ of insulation 2min, the centrifugal 1min of 12000rpm, it is quantitative that the PCR product that obtains is got 2 μ l electrophoresis detection, all the other store in-20 ℃ standby.

The subclone of PCR product

The PCR product of purifying is connected with pMD-18T carrier (available from Takara company).Linked system is as follows:

10×Ligation?Buffer 1μl

PMD-18T carrier 1 μ l

PCR product 5 μ l behind the purifying

ddH ₂O 2μl

T4DNA?Ligase 1μl

Total reaction volume 10 μ l

After 16 ℃ of water-baths of ligation liquid are placed and are spent the night, be stored in-20 ℃ standby.

Embodiment 4 positive recombinants

The enzyme of pMD-gh and pMD-vp28 is cut evaluation

1. Calcium Chloride Method prepares competent escherichia coli cell

1) with the single bacterium colony of e. coli jm109 (available from promega company) of the new recovery on the aseptic toothpick picking solid LB flat board, be inoculated in the 5ml LB substratum, 37 ℃, the activation of 250rpm shaking table is spent the night.

2) get the above-mentioned activation intestinal bacteria of 10-20 μ l, be inoculated in the fresh LB substratum of 5ml, 37 ℃, 250rpm cultivates 2-3h, to OD ₆₀₀Value is 0.4-0.6.

3) get the bacterium liquid in 1.5ml step 2 and add in the aseptic Eppendorf centrifuge tube, 4000rpm, 4 ℃ of centrifugal 10min blot supernatant with liquid-transfering gun.

4) add the 0.1M calcium chloride that 800 μ l ice precooling, the resuspended bacterial sediment that vibrates gently, ice bath 30min, 4000rpm, 4 ℃ of centrifugal 10min blot supernatant with liquid-transfering gun.

5) add the resuspended precipitation of 0.1M calcium chloride solution that 100 μ l ice precooling, the competent cell that obtains preparing.Place 4 ℃ of preservations, use in 2 days.

2. recombinant plasmid transformed competent escherichia coli cell

1) gets ligation liquid (being no more than 10 μ l volumes), join in the competent cell of the above-mentioned preparation of 100 μ l, mixing gently, ice bath 30min.

2) heat shock 90s in 42 ℃ of water-baths moves to ice bath 2min in the ice rapidly.

3) add the fresh LB liquid nutrient medium of 390 μ l, 37 ℃, the 150rpm jog makes cell recovery 50min.

4) the centrifugal 5min of 4000rpm inhales and to abandon 400 μ l supernatants, with remaining bacterium liquid with liquid-transfering gun mixing gently.

5) get 100 μ l bacterial suspensions, be evenly coated on the LB flat board that contains IPTG, X-gal, Amp, forward is placed 1-2h, is fully absorbed until liquid, is inverted flat board, and overnight incubation in 37 ℃ of incubators is utilized α-Hu Bu effect screening positive clone.

3. the enzyme of positive recombinant pMD-gh and pMD-vp29 is cut evaluation

With EcoR I and Xba I the plasmid DNA of being extracted is carried out double digestion, it is as follows that enzyme is cut system:

Plasmid DNA pMD-gh:8 μ l

EcoR?I ：0.5μl

Xba?I ：0.5μl

10×H?buffer ：1μl

Total reaction volume: 10 μ l

Plasmid DNA pMD-vp28:8 μ l

Xba?I ：1μl

10×H?buffer ：1μl

Total reaction volume:: 10 μ l

Above endonuclease reaction condition is 37 ℃, reaction times 4h.Enzyme is cut product and is carried out interpretation of result with agarose gel electrophoresis.

The preparation of embodiment 5 fusion genes and the structure of shuttle plasmid

1. the structure of recombinant shuttle plasmid-pPIC6 α C-gh

With EcoR I and Xba I double digestion PMD-gh and pPIC6 α C, purpose fragment glue reclaims the back and connects, and transformed into escherichia coli JM109 competent cell extracts plasmid in a small amount, with identifying positive recombinant, recombinant plasmid called after pPIC6 α C-gh with EcoR I and Xba I double digestion.

2. the structure of recombinant shuttle plasmid-pPIC6 α C-gh+vp28

With Xba I single endonuclease digestion PMD 18-vp28, the purpose fragment that reclaims is connected with the pPIC6 α C-gh of XbaI single endonuclease digestion, identify the forward and reverse connection of vp28.Choose the mono-clonal that forward connects, extract plasmid, called after pPIC6 α C-(gh+vp28), and serve the sea and give birth to the order-checking of worker company limited.The building process of recombinant shuttle plasmid-pPIC6 α C-gh+vp28 is seen Fig. 1.

3.PCR the enzyme of amplification gh, vp28 gene and shuttle plasmid pPIC6 α C-(gh+vp28) is cut evaluation

With pPIC6 α C-(gh+vp28) shuttle plasmid is template, carries out gh and WSSVvp28 gene PCR respectively, and PCR product size position meets gh, vp28 size.PPIC6 α C-(gh+vp28) shuttle plasmid obtains GH and VP28 target fragment with EcoRI+XbaI double digestion and XbaI single endonuclease digestion.PPIC6 α C-(gh+vp28) shuttle plasmid is 47500bp, and the position size meets.With pPIC6 α C-(gh+vp28) shuttle plasmid is template, is that primer carries out PCR with prime1, prime4, and the PCR product is (gh+vp28) total length fusion gene, and size is 1197bp; With pPIC6 α C-(gh+vp28) shuttle plasmid is template, carries out PCR with AOX1, obtains about 1750bp object tape, and the position size meets.The enzyme of recombinant shuttle plasmid pPIC6 α C-(gh+vp28) is cut and is identified with PCR and to see Fig. 2.Above result shows: cut evaluation through PCR and enzyme, gh and vp28 gene are properly inserted in proper order with front and back between the cloning site EcoRI and XbaI of pPIC6 α C shuttle plasmid, give birth to worker's order-checking through Shanghai, and gene order is in full accord, meet translation and read frame.The building process of recombinant shuttle plasmid pPIC6 α C-(gh+vp28) is seen Fig. 1.

Structure, screening and the evaluation of embodiment 6 yeast gene engineering bacterias

1. recombinant shuttle plasmid-pPIC6 α C-(gh+vp28) yeast X-33

(1) linearizing of transformed yeast recombinant plasmid

Prepare recombinant expression plasmid DNA 15-20 μ g in a small amount, digest 30min with RNase A at 37 ℃, in 100 μ l systems, carry out linearization for enzyme restriction then with restriction enzyme Bstx1, after being incubated 4h in 37 ℃ of water-baths, use phenol: chloroform (25: 24) extracting once, chloroform: primary isoamyl alcohol (24: 1) extracting once, the sodium acetate (pH5.2) that adds the 3M of 0.1 volume, 2.5 the dehydrated alcohol of volume doubly, mixing places-20 ℃ of precipitations to spend the night 4 ℃, the centrifugal 20min of 12000rpm abandons supernatant, with 75% the ethanol desalinization of soil by flooding or leaching of ultrapure water configuration 2 times, naturally after drying, with 5-10 μ l TE solution dissolution precipitation ,-20 ℃ of preservations are standby.With restriction enzyme Bstx I linearization for enzyme restriction empty carrier plasmid pPIC6 α C, as negative control.

(2) preparation of yeast competent cell

With aseptic toothpick picking one yeast list bacterium colony, be inoculated among the 5mlYPD, 30 ℃, 260rpm jolting overnight incubation got 200 μ l yeast liquid in second day to be inoculated in 20ml YPD, and 30 ℃, 280rpm jolting are cultivated OD ₆₀₀Be 0.6～0.8 o'clock, go to aseptic centrifuge tube, room temperature (20～25 ℃), the centrifugal 10min of 4000rpm remove supernatant, collect thalline, with the aseptic ddH of 25ml ₂O is resuspended, and room temperature, the centrifugal 10min of 4000rpm remove supernatant, collects thalline, uses the aseptic ddH of 1ml again ₂O is resuspended, forward in the Eppendorf pipe of 1.5ml, room temperature, the centrifugal 10min of 4000rpm remove supernatant, collect thalline, add the resuspended thalline of 1ml 0.1M LiCl, with the centrifugal 15sec of microcentrifuge maximum speed of revolution, abandon most supernatant, with the resuspended thalline of 400 μ l 0.1M LiCl, with the Eppendorf pipe of 1.5ml, every pipe 100 μ l packing are used.

(3) recombinant expression plasmid transformed yeast bacterium X-33

With 100 μ l yeast competent cells of above preparation, the centrifugal 15sec of maximum speed of revolution abandons most supernatant, and strictness adds reagent in the following order in this Eppendorf pipe:

Gene 240 μ l 50%PEG

36μl 1M?LiCl

25μl 2mg/ml?single-stranded?DNA

linearized?pPIC6αC-gh+vp28?DNA?in?50μl?sterilewater

The about 1min of high vibration on the vortex oscillation device makes each reagent composition thorough mixing even, after cell fully suspends; Mixed solution left standstill under 30 ℃ of conditions hatch 30min, follow 42 ℃ of heat shock 20～25min, the centrifugal 5min of 6000-8000rpm under the room temperature then, abandon supernatant, use the 1mlYPD re-suspended cell, 30 ℃, 200rpm jolting cultivation are got cell culture fluid 100 μ l and are coated on the YPD flat board that contains 300 μ g/ml Blasticidin behind the 1h.Flat board just is put in 30 ℃ of incubators, is blotting to planar surface liquid, be inverted and cultivated 2～3 days, observing the formation of single bacterium colony. simultaneously by with quadrat method transition lines empty carrier plasmid pPIC6 α C, as negative control.

2. the extraction of yeast genes group

Picking 10～20 yeast list bacterium colonies from the YPDS flat board, be inoculated in respectively in the 3mlYPD nutrient solution, 1.5ml incubated overnight liquid forwarded in the Eppendorf pipe of 1.5ml, room temperature 20～25, the centrifugal 1min of 12000rpm, abandon supernatant, cell is resuspended in the 50 μ l STES damping fluids; The granulated glass sphere that in sterilised yeast suspension, adds 50 μ l pickling.Every pipe adds 20 μ l TE (pH7.6), adds 60 μ l phenol then: chloroform (25: 24), cover tight lid.Vibration 1min makes organic phase and water thorough mixing earlier, and every then vibration 30sec just is inserted in the Eppendorf pipe on ice, repeats to vibrate 6 times.Room temperature, the centrifugal 8min of 12000rpm, the water on upper strata is transferred in the Eppendorf pipe of a new 1.5ml, added the NaAc (pH5.3) of the 3mol/l of 1/10 volume, the dehydrated alcohol of 2.5 times of volumes respectively ,-20 ℃ of precipitation 20min, centrifugal 10min under 4 ℃, 12000rpm, remove supernatant, precipitation is with 75% washing with alcohol 1 time, the centrifugal 2min of 12000rpm, remove supernatant, the dry air post precipitation in 40 μ l TEBuffer (pH7.6), gets the genome sample with resolution of precipitate.Get 6 μ l samples and do the agarose electrophoresis detection.Before using the genome sample is boiled 5min in boiling water, be inserted in immediately on ice then or-20 ℃ frozen standby. can get the template of 1～10 μ l genome solution as the PCR evaluation.With empty bacterium X-33 is empty map, with the negative contrast of strain X-33 (pPIC6 α C) that has transformed empty carrier pPIC6 α C.

3. the PCR of recombination microzyme X-33 (pPIC6 α C-(gh+vp28)) identifies

With the yeast genes group is template, and primer is respectively universal primer AOX1, prime1,2, prime3,4, and prime1,4 is a primer.Be that template is carried out PCR with PMD-18-gh and pUCm-vp28 respectively simultaneously, its product is as positive control.The PCR reaction conditions is: 95 ℃ of 5min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min30s, after 30 circulations, 72 ℃ of 10min.

Extract the yeast genes group as template, respectively with AOX1, prime1,2, prime3,4, prime1,4 is for primer carries out PCR, and size is respectively 1750bp, 615bp, 582bp, 1197bp.Positive bacteria genome PCR identifies and sees Fig. 3.The result shows: linearizing pPIC6 α C-(gh+vp28) shuttle plasmid is incorporated into the specific site of yeast genes group exactly, obtains genetic engineering recombination strain.

Embodiment 7 genetic engineering fusion protein GH+VP28 albumen

Abduction delivering in pichia spp

1. the abduction delivering of genetic engineering fusion protein GH+VP28 albumen in pichia spp

With aseptic toothpick single bacterium colony of picking recombination yeast X-33 (pPIC6 α C-(gh+vp28)) from the purifying flat board, be inoculated in the 20mlYPD nutrient solution, 30 ℃, 260rpm jolting overnight incubation, get this bacterium liquid and transfer in 100ml BMGY substratum, 30 ℃, 200rpm jolting cultivation 20h by 2% volume ratio.4 ℃, the centrifugal 5min of 4000rpm collect thalline, and with the resuspended thalline of 100mlBMMY, 0.5% volume of pressing nutrient solution every 24h replenishes anhydrous methanol, and 28 ℃, 200rpm jolting cultivation 120h induce exogenous protein expression.Took a sample once in per 24 hours, 4 ℃, the centrifugal 10min of 4800rpm collect and express supernatant, add an amount of proteinase inhibitor PMSF, EDTA and fungistat sodium azide, are stored in-20 ℃.

Get the sample and 96 hours sample of the negative control race SDS-PAGE that induce 48,72,96 hours and be Western Blot.

2, the Western Blot of target protein GH+VP28 identifies

(1) when SDS-PAGE will finish, with wiping adherent drop on the dried battery lead plate with paper handkerchief behind the distilled water drip washing graphite cake.

(2) wear disposable glove and cut six filter paper and a cellulose filter membrane, its size should fit like a glove with the gel size, carries out mark with soft pencil at filter membrane one jiao.

A. filter membrane floats in the plate that deionized water is housed, and borrows wicking action to make it moistening from the bottom up, soaks 5min in water at least, stays bubble on filter membrane with expeling.

B. the filter paper that shears is soaked in the transfering buffering liquid, the time is 15-30min

(3) wear disposable glove transfer device be installed as follows:

A. keep flat the bottom electrode of half-dried electroporation, Yi Bian graphite up.

B. place three soaked filter paper on it, accurately alignment is driven bubble away with glass stick.

C. the filter membrane after wetting is put on the filter paper, index face is accurately alignd up, drives bubble away with glass stick.

The gel that d. will be used for changeing film the plate that fills deionized water slightly rinsing once be put on the NC film, the lower left corner of gel is placed on the mark angle of NC film, accurately bubble is driven in alignment gently away.

E. on gel, put three soaked three filter paper again, align and drive bubble away.

(4) put second half electrode, two portions electrode is fixed with adhesive plaster.Connect power supply, electroporation is put 4 ℃ of refrigerator-freezers, electricity changes 1.5-2h.

(5) dismantle transfer device from top to bottom, lift each layer one by one, film is put into the little plate that the 10ml confining liquid is housed, room temperature is shaken 60min on rocking bed, and gel silver is dyed to detect changes membrane efficiency.

(6) film is taken out with tweezers, after the TBST flushing, anti-VP28 (1: 3000) the solution room temperature that changes 20ml TBST dilution over to is shaken 30min.

(7) room temperature is washed four times continuously with flushing membrane among the 50ml TBST, each 15min.

(8) film is changed in crosslinked goat anti-rabbit igg s (1: the 10000) solution of 20ml TBST dilution horseradish peroxidase over to room temperature and shake 30min.

(9) repeating step (7)

(10) room temperature is washed film 15min to remove excessive phosphoric acid salt and polysorbas20 with PBS.

(11) film is soaked in 10-30min in the 10ml DAB colour developing liquid, occurs until protein band.

(13) react with color development stopping with the PBS cleaning.

Selecting five positive reorganization bacterium expresses with methyl alcohol a small amount of abduction delivering, found 1 high expression level bacterium, saccharomycetic expression product is 66KD, and expression amount reaches 10mg/l, because alpha factor signal sequence and HIS tail have 11.5KD, can affirm that the alpha factor signal sequence of this product does not have cut.

Get the 5mL fermented liquid after centrifugal, behind 10 times of the ultrafiltration and concentration, get 40 μ L samples and run 10%SDS-PAGE, silver dyes colour developing.And do the reaction of Western Blot trace and identify target protein, SDS-PAGE and Western Blot Analysis and Identification are seen Fig. 4.The result shows at about 66kDa place and object tape occurs.

The proteic purifying of embodiment 8 genetic engineering fusion protein GH+VP28

Recombination microzyme is centrifugal collection supernatant behind methanol induction, contains dialysis tubing (molecular weight cut-off 10KD) and is concentrated to the nearly degree of doing (can add repeatedly) through polyoxyethylene glycol, adds binding buffer then, shakes up.N in (above operation is all at 4 ℃, and have under the situation of sanitas carry out) preparation ²⁺-HIS BAND post.

1) Ni2+ post 1 * Binding Buffer (0.5mM imidazoles of 10 times of the interior medium volumes of post, 0.5mM NaCl, 2mMTris-HCl) the aseptic washing post bed of 10 times of volumes, 1 * Charge Buffer (50mMNiSO4) with 10 times of volumes replenishes Ni2+, use 1 * Binding Buffer of 10 times of volumes to clean the post bed again, prepare the beginning affinity chromatography.

2) protein solution joins in the good affinity column of balance in a looping fashion with peristaltic pump, makes the abundant Ni2+ combination of the sample that has His6, and collect and the reacted sample of Ni2+ (being leakage liquid) from the Ni2+ column outlet back of spending the night.

3) make 1 * Binding Buffer of 20 times of volumes wash post, with wash down stay in the post on a small quantity not with Ni2+ bonded sample.

4) with non-target protein (effluent volume and concentration are looked total protein content and non-target protein and Ni2+ binding ability and changed flexibly) on the imidazoles eluant solution Ni2+ post of 10mM～100mM.

5) with 1 * Elute Buffer (1M imidazoles, 0.5M NaCl, 20mM Tris-HCl) wash-out Ni2+ post, target protein elutes, and is that elutriant is collected by unit with 2mL.

6) each tubulin that gets collection carries out the distribution of 10%SDS-PAGE electrophoresis detection target protein in elutriant.

7) the Ni2+ post continues wash-out with 1 * Elute Buffer, washes the whole residual proteins in the post bed off, uses 1 * StripBuffer (100mM EDTA, 0.5M NaCl, 20mMTris-HCl) the Ni2+ ion on the flush away pillar again.

8) washing of Histidine affinity column, regeneration and preservation.

In general, the Ni2+ affinity column can use 3-4 time repeatedly, and palpus washs and need not regenerate before reusing, and then need regenerate if repeated multiple times is used.

(1) washes the Histidine affinity column with the 6M Guanidinium hydrochloride of 2 times of volumes, the acetic acid solution of 0.2M;

(2) wash post with the deionization of 2 times of volumes;

(3) wash post with 1 times of volume 2%SDS;

(4) wash post with 1 times of volume 25% ethanol;

(5) wash post with 1 times of volume 50% ethanol;

(6) wash post with 1 times of volume 75% ethanol;

(7) wash post with 5 times of volume 100% ethanol;

(8) successively repeating

step

6,5,4 each once;

(9) once with the rinsed with deionized water post of 1 times of volume;

(10) wash post with 5 times of volume 100mM EDTA (pH8.0), thoroughly remove the Ni2+ ion on the chromatography column;

(11) the regenerated chromatography column is placed 20% ethanolic soln that contains 0.1% sodium azide, 4 ℃ of preservations.

Embodiment 9 genetic engineering fusion proteins are to the growth promoting function of prawn

The healthy huge legendary turtle shrimp of the about 4g of body weight is divided into 2 groups at random, (sample is given in every group of mean body weight 4 ± 0.2g) injections:

experimental group

1,2 is injected 10 μ L 0.4mg/mL and 10 μ L 0.2mg/mL recombinant protein GH+VP28, negative control injecting normal saline respectively according to every gram of shrimp body weight in uromere shallow-layer muscle place for every group 40 tail.Every 1 week injection 1 time, inject altogether 5 times.Under 22～25 ℃ of conditions, culture, change water every day and the artificial shrimp feed of throwing something and feeding, weigh and keep a record for every group weekly.Body weight gain rate (%)=((W _t-W ₀)/W ₀) * 100.W _t, W ₀Be respectively injection back, the preceding mean body weight of injection.

Each group experiment shrimp surviving rate during the injection in 5 weeks is 100%, the take off data of experiment mean number ± standard deviation (x ± s) expression.Through 5 week experiments, the body weight gain rate of experimental group 1 is faster 20% than control group, and group 2 is than control group fast 8%.Through the t check, compare with control group, there were significant differences to organize 1 body weight, and it is not remarkable to organize 2 differences.Above experimental data is three groups of repeated experiments gained, the results are shown in Table 1 and Fig. 5.The result shows: fusion rotein GH+VP28 prawn bulk-growth has promoter action

Each group experiment shrimp of table 1 mean body weight statistics behind 5w

Table1.The?avarage?weights?of?three?group?shrimp?injectedGH+VP28for5w

The anti-WSSV infection effect of embodiment 10 recombinant protein GH+VP28

The healthy huge legendary turtle shrimp of the about 10g of body weight is divided into 3 groups at random, every group 20 tail.Sample is given in injection: inject 10 μ L samples according to every group of the every gram of shrimp body weight, and in the 3rd uromere shallow-layer muscle place reciprocal injection, injection at twice, 5d at interval.Experimental group: injection 0.4mg/mL recombinant protein GH+VP28.Behind the 2nd the injection 2d, the WSSV crude extract is diluted 1 times with TN buffer ^[11], infectable infection huge legendary turtle shrimp; Positive controls:, behind the 2nd the injection 2d, inject WSSV in the same way and infect the huge legendary turtle shrimp according to the every gram injection of shrimp body weight TNbuffer; Negative control group: according to the every gram injection of shrimp body weight TN buffer, behind the 2nd the injection 2d, injection once continues to raise again.Under 22 ℃～25 ℃ conditions, culture, change water every day and the artificial shrimp feed of throwing something and feeding, the situation of record shrimp death.

The result who cultures under 22-25 ℃ condition shows, cumulative mortality is 35% behind the huge legendary turtle shrimp 8d of injection purified fusion protein GH+VP28 protein groups, the huge legendary turtle shrimp of positive controls cumulative mortality after infecting WSSV 9d has reached 100%, and reach dead peak at 3-5d, and the negative control group huge legendary turtle shrimp of having injected TN buffer does not have any pathological phenomenon.Above experimental data is three groups of repeated experiments gained, the results are shown in Figure 6.Show that injection recombination fusion protein GH+VP28 can obviously improve the anti-WSSV infectivity of prawn.

SEQUENCE?LISTING

1

＜110〉Wuhan University

＜120〉prawn antiviral growth-promoting double-function engineering strain and construction process and application

＜130〉white spot syndrome virus (WSSV) envelope protein VP28 and carp growth hormone fusion rotein nucleotide sequence

<160>2

<170>PatentIn?version?3.1

<210>1

<211>1194

<212>DNA

＜213〉recombinant DNA

<220>

<221>CDS

<222>(1)..(1194)

<223>

<400>1

tca?tca?gac?aac?cag?cgg?ctc?ttc?aat?aat?gca?gtc?att?cgt?gta?caa 48

Ser?Ser?Asp?Asn?Gln?Arg?Leu?Phe?Asn?Asn?Ala?Val?Ile?Arg?Val?Gln

1 5 10 15

cac?ctg?cac?cag?ctg?gct?gca?aaa?atg?att?aac?gac?ttt?gag?gac?agc 96

His?Leu?His?Gln?Leu?Ala?Ala?Lys?Met?Ile?Asn?Asp?Phe?Glu?Asp?Ser

20 25 30

ctg?ttg?cct?gag?gaa?cgc?aga?cag?ctg?agt?aaa?atc?ttc?cct?ctg?tct 144

Leu?Leu?Pro?Glu?Glu?Arg?Arg?Gln?Leu?Ser?Lys?Ile?Phe?Pro?Leu?Ser

35 40 45

ttc?tgc?aat?tct?gac?tac?att?gag?gcg?cct?gct?gga?aaa?gat?gaa?aca 192

Phe?Cys?Asn?Ser?Asp?Tyr?Ile?Glu?Ala?Pro?Ala?Gly?Lys?Asp?Glu?Thr

50 55 60

cag?aag?agc?tct?atg?ctg?aag?ctt?ctt?cgc?atc?tct?ttt?cac?ctc?att 240

Gln?Lys?Ser?Ser?Met?Leu?Lys?Leu?Leu?Arg?Ile?Ser?Phe?His?Leu?Ile

65 70 75 80

gag?tcc?tgg?gag?ttc?cca?agc?cag?tcc?ctg?agc?gga?acc?gtc?tca?aac 288

Glu?Ser?Trp?Glu?Phe?Pro?Ser?Gln?Ser?Leu?Ser?Gly?Thr?Val?Ser?Asn

85 90 95

agc?ctg?acc?gta?ggg?aac?ccc?aac?cag?ctc?act?gag?aag?ctg?gcc?gac 336

Ser?Leu?Thr?Val?Gly?Asn?Pro?Asn?Gln?Leu?Thr?Glu?Lys?Leu?Ala?Asp

100 105 110

ttg?aaa?atg?ggc?atc?agt?gtg?ctc?atc?cag?gca?tgt?ctc?gat?ggt?caa 384

Leu?Lys?Met?Gly?Ile?Ser?Val?Leu?Ile?Gln?Ala?Cys?Leu?Asp?Gly?Gln

115 120 125

cca?aac?atg?gat?gat?aac?gac?tcc?ttg?ccg?ctg?cct?ttt?gag?gac?ttc 432

Pro?Asn?Met?Asp?Asp?Asn?Asp?Ser?Leu?Pro?Leu?Pro?Phe?Glu?Asp?Phe

130 135 140

tac?ttg?acc?atg?ggg?gag?aac?aac?ctc?aga?gag?agc?ttt?cgt?ctg?ctg 480

Tyr?Leu?Thr?Met?Gly?Glu?Asn?Asn?Leu?Arg?Glu?Ser?Phe?Arg?Leu?Leu

145 150 155 160

gct?tgc?ttc?aag?aag?gac?atg?cac?aaa?gtc?gag?acc?tac?ttg?agg?gtt 528

Ala?Cys?Phe?Lys?Lys?Asp?Met?His?Lys?Val?Glu?Thr?Tyr?Leu?Arg?Val

165 170 175

gca?aat?tgc?agg?aga?tcc?ctg?gat?tcc?aac?tgc?acc?ctg?gag?ttt?cta 576

Ala?Asn?Cys?Arg?Arg?Ser?Leu?Asp?Ser?Asn?Cys?Thr?Leu?Glu?Phe?Leu

180 185 190

gaa?atg?gat?ctt?tct?ttc?act?ctt?tcg?gtc?gtg?tcg?gcc?atc?ctc?gcc 624

Glu?Met?Asp?Leu?Ser?Phe?Thr?Leu?Ser?Val?Val?Ser?Ala?Ile?Leu?Ala

195 200 205

atc?act?gct?gtg?att?gct?gta?ttt?att?gtg?att?ttt?agg?tat?cac?aac 672

Ile?Thr?Ala?Val?Ile?Ala?Val?Phe?Ile?Val?Ile?Phe?Arg?Tyr?His?Asn

210 215 220

act?gtg?acc?aag?acc?atc?gaa?acc?cac?aca?gac?aat?atc?gag?aca?aac 720

Thr?Val?Thr?Lys?Thr?Ile?Glu?Thr?His?Thr?Asp?Asn?Ile?Glu?Thr?Asn

225 230 235 240

atg?gat?gaa?aac?ctc?cgc?att?cct?gtg?act?gct?gag?gtt?gga?tca?ggc 768

Met?Asp?Glu?Asn?Leu?Arg?Ile?Pro?Val?Thr?Ala?Glu?Val?Gly?Ser?Gly

245 250 255

tac?ttc?aag?atg?act?gat?gtg?tcc?ttt?gac?agc?gac?acc?ttg?ggc?aaa 816

Tyr?Phe?Lys?Met?Thr?Asp?Val?Ser?Phe?Asp?Ser?Asp?Thr?Leu?Gly?Lys

260 265 270

atc?aag?atc?cgc?aat?gga?aag?tct?gat?gca?cag?atg?aag?gaa?gaa?gat 864

Ile?Lys?Ile?Arg?Asn?Gly?Lys?Ser?Asp?Ala?Gln?Met?Lys?Glu?Glu?Asp

275 280 285

gcg?gat?ctt?gtc?atc?act?ccc?gtg?gag?ggc?cga?gca?ctc?gaa?gtg?act 912

Ala?Asp?Leu?Val?Ile?Thr?Pro?Val?Glu?Gly?Arg?Ala?Leu?Glu?Val?Thr

290 295 300

gtg?ggg?cag?aat?ctc?acc?ttt?gag?gga?aca?ttc?aag?gtg?tgg?aac?aac 960

Val?Gly?Gln?Asn?Leu?Thr?Phe?Glu?Gly?Thr?Phe?Lys?Val?Trp?Asn?Asn

305 310 315 320

aca?tca?aga?aag?atc?aac?atc?act?ggt?atg?cag?atg?gtg?cca?aag?att 1008

Thr?Ser?Arg?Lys?Ile?Asn?Ile?Thr?Gly?Met?Gln?Met?Val?Pro?Lys?Ile

325 330 335

aac?cca?tca?aag?gcc?ttt?gtc?ggt?agc?tcc?aac?acc?tcc?tcc?ttc?acc 1056

Asn?Pro?Ser?Lys?Ala?Phe?Val?Gly?Ser?Ser?Asn?Thr?Ser?Ser?Phe?Thr

340 345 350

ccc?gtc?tct?att?gat?gag?gat?gaa?gtt?ggc?acc?ttt?gtg?tgt?ggt?acc 1104

Pro?Val?Ser?Ile?Asp?Glu?Asp?Glu?Val?Gly?Thr?Phe?Val?Cys?Gly?Thr

355 360 365

acc?ttt?ggc?gca?cca?att?gca?gct?acc?gcc?ggt?gga?aat?ctt?ttc?gac 1152

Thr?Phe?Gly?Ala?Pro?Ile?Ala?Ala?Thr?Ala?Gly?Gly?Asn?Leu?Phe?Asp

370 375 380

atg?tac?gtg?cac?gtc?acc?tac?tct?ggc?act?gag?acc?gag?taa 1194

Met?Tyr?Val?His?Val?Thr?Tyr?Ser?Gly?Thr?Glu?Thr?Glu

385 390 395

<210>2

<211>397

<212>PRT

＜213〉recombinant DNA

<400>2

Ser?Ser?Asp?Asn?Gln?Arg?Leu?Phe?Asn?Asn?Ala?Val?Ile?Arg?Val?Gln

1 5 10 15

His?Leu?His?Gln?Leu?Ala?Ala?Lys?Met?Ile?Asn?Asp?Phe?Glu?Asp?Ser

20 25 30

Leu?Leu?Pro?Glu?Glu?Arg?Arg?Gln?Leu?Ser?Lys?Ile?Phe?Pro?Leu?Ser

35 40 45

Phe?Cys?Asn?Ser?Asp?Tyr?Ile?Glu?Ala?Pro?Ala?Gly?Lys?Asp?Glu?Thr

50 55 60

Gln?Lys?Ser?Ser?Met?Leu?Lys?Leu?Leu?Arg?Ile?Ser?Phe?His?Leu?Ile

65 70 75 80

Glu?Ser?Trp?Glu?Phe?Pro?Ser?Gln?Ser?Leu?Ser?Gly?Thr?Val?Ser?Asn

85 90 95

Ser?Leu?Thr?Val?Gly?Asn?Pro?Asn?Gln?Leu?Thr?Glu?Lys?Leu?Ala?Asp

100 105 110

Leu?Lys?Met?Gly?Ile?Ser?Val?Leu?Ile?Gln?Ala?Cys?Leu?Asp?Gly?Gln

115 120 125

Pro?Asn?Met?Asp?Asp?Asn?Asp?Ser?Leu?Pro?Leu?Pro?Phe?Glu?Asp?Phe

130 135 140

Tyr?Leu?Thr?Met?Gly?Glu?Asn?Asn?Leu?Arg?Glu?Ser?Phe?Arg?Leu?Leu

145 150 155 160

Ala?Cys?Phe?Lys?Lys?Asp?Met?His?Lys?Val?Glu?Thr?Tyr?Leu?Arg?Val

165 170 175

Ala?Asn?Cys?Arg?Arg?Ser?Leu?Asp?Ser?Asn?Cys?Thr?Leu?Glu?Phe?Leu

180 185 190

Glu?Met?Asp?Leu?Ser?Phe?Thr?Leu?Ser?Val?Val?Ser?Ala?Ile?Leu?Ala

195 200 205

Ile?Thr?Ala?Val?Ile?Ala?Val?Phe?Ile?Val?Ile?Phe?Arg?Tyr?His?Asn

210 215 220

Thr?Val?Thr?Lys?Thr?Ile?Glu?Thr?His?Thr?Asp?Asn?Ile?Glu?Thr?Asn

225 230 235 240

Met?Asp?Glu?Asn?Leu?Arg?Ile?Pro?Val?Thr?Ala?Glu?Val?Gly?Ser?Gly

245 250 255

Tyr?Phe?Lys?Met?Thr?Asp?Val?Ser?Phe?Asp?Ser?Asp?Thr?Leu?Gly?Lys

260 265 270

Ile?Lys?Ile?Arg?Asn?Gly?Lys?Ser?Asp?Ala?Gln?Met?Lys?Glu?Glu?Asp

275 280 285

Ala?Asp?Leu?Val?Ile?Thr?Pro?Val?Glu?Gly?Arg?Ala?Leu?Glu?Val?Thr

290 295 300

Val?Gly?Gln?Asn?Leu?Thr?Phe?Glu?Gly?Thr?Phe?Lys?Val?Trp?Asn?Asn

305 310 315 320

Thr?Ser?Arg?Lys?Ile?Asn?Ile?Thr?Gly?Met?Gln?Met?Val?Pro?Lys?Ile

325 330 335

Asn?Pro?Ser?Lys?Ala?Phe?Val?Gly?Ser?Ser?Asn?Thr?Ser?Ser?Phe?Thr

340 345 350

Pro?Val?Ser?Ile?Asp?Glu?Asp?Glu?Val?Gly?Thr?Phe?Val?Cys?Gly?Thr

355 360 365

Thr?Phe?Gly?Ala?Pro?Ile?Ala?Ala?Thr?Ala?Gly?Gly?Asn?Leu?Phe?Asp

370 375 380

Met?Tyr?Val?His?Val?Thr?Tyr?Ser?Gly?Thr?Glu?Thr?Glu

385 390 395

SEQUENCE?LISTING

2

＜110〉Wuhan University

＜130〉white spot syndrome virus (WSSV) envelope protein VP28 and carp growth hormone fusion rotein aminoacid sequence

<160>1

<170>PatentIn?version?3.1

<210>1

<211>397

<212>PRT

＜213〉recombinant protein

<400>1

Ser?Ser?Asp?Asn?Gln?Arg?Leu?Phe?Asn?Asn?Ala?Val?Ile?Arg?Val?Gln

1 5 10 15

His?Leu?His?Gln?Leu?Ala?Ala?Lys?Met?Ile?Asn?Asp?Phe?Glu?Asp?Ser

20 25 30

Leu?Leu?Pro?Glu?Glu?Arg?Arg?Gln?Leu?Ser?Lys?Ile?Phe?Pro?Leu?Ser

35 40 45

Phe?Cys?Asn?Ser?Asp?Tyr?Ile?Glu?Ala?Pro?Ala?Gly?Lys?Asp?Glu?Thr

50 55 60

Gln?Lys?Ser?Ser?Met?Leu?Lys?Leu?Leu?Arg?Ile?Ser?Phe?His?Leu?Ile

65 70 75 80

Glu?Ser?Trp?Glu?Phe?Pro?Ser?Gln?Ser?Leu?Ser?Gly?Thr?Val?Ser?Asn

85 90 95

Ser?Leu?Thr?Val?Gly?Asn?Pro?Asn?Gln?Leu?Thr?Glu?Lys?Leu?Ala?Asp

100 105 110

Leu?Lys?Met?Gly?Ile?Ser?Val?Leu?Ile?Gln?Ala?Cys?Leu?Asp?Gly?Gln

115 120 125

Pro?Asn?Met?Asp?Asp?Asn?Asp?Ser?Leu?Pro?Leu?Pro?Phe?Glu?Asp?Phe

130 135 140

Tyr?Leu?Thr?Met?Gly?Glu?Asn?Asn?Leu?Arg?Glu?Ser?Phe?Arg?Leu?Leu

145 150 155 160

Ala?Cys?Phe?Lys?Lys?Asp?Met?His?Lys?Val?Glu?Thr?Tyr?Leu?Arg?Val

165 170 175

Ala?Asn?Cys?Arg?Arg?Ser?Leu?Asp?Ser?Asn?Cys?Thr?Leu?Glu?Phe?Leu

180 185 190

Glu?Met?Asp?Leu?Ser?Phe?Thr?Leu?Ser?Val?Val?Ser?Ala?Ile?Leu?Ala

195 200 205

Ile?Thr?Ala?Val?Ile?Ala?Val?Phe?Ile?Val?Ile?Phe?Arg?Tyr?His?Asn

210 215 220

Thr?Val?Thr?Lys?Thr?Ile?Glu?Thr?His?Thr?Asp?Asn?Ile?Glu?Thr?Asn

225 230 235 240

Met?Asp?Glu?Asn?Leu?Arg?Ile?Pro?Val?Thr?Ala?Glu?Val?Gly?Ser?Gly

245 250 255

Tyr?Phe?Lys?Met?Thr?Asp?Val?Ser?Phe?Asp?Ser?Asp?Thr?Leu?Gly?Lys

260 265 270

Ile?Lys?Ile?Arg?Asn?Gly?Lys?Ser?Asp?Ala?Gln?Met?Lys?Glu?Glu?Asp

275 280 285

Ala?Asp?Leu?Val?Ile?Thr?Pro?Val?Glu?Gly?Arg?Ala?Leu?Glu?Val?Thr

290 295 300

Val?Gly?Gln?Asn?Leu?Thr?Phe?Glu?Gly?Thr?Phe?Lys?Val?Trp?Asn?Asn

305 310 315 320

Thr?Ser?Arg?Lys?Ile?Asn?Ile?Thr?Gly?Met?Gln?Met?Val?Pro?Lys?Ile

325 330 335

Asn?Pro?Ser?Lys?Ala?Phe?Val?Gly?Ser?Ser?Asn?Thr?Ser?Ser?Phe?Thr

340 345 350

Pro?Val?Ser?Ile?Asp?Glu?Asp?Glu?Val?Gly?Thr?Phe?Val?Cys?Gly?Thr

355 360 365

Thr?Phe?Gly?Ala?Pro?Ile?Ala?Ala?Thr?Ala?Gly?Gly?Asn?Leu?Phe?Asp

370 375 380

Met?Tyr?Val?His?Val?Thr?Tyr?Ser?Gly?Thr?Glu?Thr?Glu

385 390 395

Claims

1, a kind of pichia pastoris gene engineering bacterial strain is characterized in that: this bacterial strain is pichia spp Pichia pastoris X-33 pPIC6 α c-GH+vp28, CCTCC M206101.

2, a kind of preparation method who is used for the described Pichi strain of claim 1, it comprises the following steps:

A, the preparation of carp growth hormone gene: get Medulla Cyprinus carpio hypophysis, extract the method for test kit according to RNA and extract total RNA, electrophoretic analysis RNA quality, sequences Design primer according to carp GH peptide, introduce restriction endonuclease sites respectively at the primer two ends, with original terminator codon TAG sudden change, be convenient to gene Fusion, carry out the synthetic and pcr amplification of cDNA according to the method for reverse transcription test kit, the PCR product is by detected through gel electrophoresis, and in carrier, picking colony extracts plasmid to carry out enzyme and cut evaluation with the gene sequencing rear clone that obtains, positive colony that obtains is to comprise the intestinal bacteria that relate to the GH gene, is used for the propagation and the preservation of gene;

The preparation of the vp28 gene of B, WSSV: at first be the virus genomic preparation of WSSV, in lung, stomach and the heart of getting the disease shrimp on ice, ice bath homogenate, add Proteinase K/100 μ g/ml then, in boiling water, boil 15min, ice bath 5min, 12, the centrifugal 10min of 000r/min gets its supernatant liquor and does template DNA, 4 ℃ of preservations; Next is a pcr amplification vp28 gene, amplimer is synthetic, according to the WSSV sequences Design PCR oligonucleotide amplimer among the GeneBank, adopt PCR method amplifying target genes vp28, the PCR product is by detected through gel electrophoresis, reclaims the PCR product and it is cloned in the carrier, and picking colony extracts plasmid to carry out enzyme and cut evaluation, positive colony that obtains is the intestinal bacteria that comprise the vp28 gene, is used for the propagation and the preservation of gene;

The preparation of C, fusion gene and the structure of shuttle plasmid: the structure that at first is shuttle plasmid pPI6 α c-GH, enzyme is cut recombinant plasmid and the shuttle plasmid pPI6 α c that contains the GH gene, glue reclaims the band that contains the GH gene, be transformed among the competence E.coli after 16 ℃ of connections, positive colony that obtains is to comprise the intestinal bacteria that relate to the GH gene, is pPI6 α c-GH; Next is the structure of shuttle plasmid pPI6 α c-GH-vp28, enzyme is cut the recombinant plasmid that contains the vp28 gene and is contained the shuttle plasmid pPI6 α c-GH of GH gene, glue reclaims the band of vp28 gene, be transformed among the competence E.coli after 16 ℃ of connections, the sub-pPI6 α of the positive colony that obtains c-GH-vp28 comprises the intestinal bacteria that relate to the GH+vp28 fusion gene;

The structure of D, yeast gene engineering bacteria: enzyme is cut recombinant shuttle plasmid pPI6 α c-GH-vp28 and is made its linearizing, transformed yeast X33 competent cell, the picking transformant, extract pastoris genomic dna, carrying out PCR respectively with special primer and universal primer detects, filter out positive transformant pPI6 α c-GH-vp28/X33, the positive colony that obtains is the engineering strain of expressing GH gene and vp28 gene simultaneously.

3, the application of the described a kind of pichia pastoris gene engineering bacterial strain of claim 1 in improving anti-WSSV virus capable of prawn and the growth of promotion prawn.