CN100398155C - DNA vaccine for preventing haemonchus contortus disease of ruminant - Google Patents

Abstract

The present invention provides a DNA vaccine with the functions of preventing and treating ruminant haemonchus contortus diseases and a DNA vaccine of recombinant eukaryotic plasmid carriers of partial coding areas of haemonchus contortus protective hidden antigen genes H11. Specifically, the present invention also provides three recombinant eukaryotic plasmids; three segments of partial coding areas of haemonchus contortus protective hidden antigen genes H11 in different positions are inserted into the three recombinant eukaryotic plasmids, namely H11-1 ot H11-2 or H11-3. The present invention provides the DNA vaccine which comprises one plasmid of the three recombinant eukaryotic plasmids. In addition, the present invention also provides the DNA vaccine which comprises a carrier mixture of the three recombinant eukaryotic plasmids. The vaccine of the present invention comprises a plurality of T cell immune response elements which can effectively prevent and treat ruminant haemonchus contortus diseases.

Description

Be used to prevent the dna vaccination of haemonchus contortus disease of ruminant

Technical field

The invention belongs to field of biological product, relate to a kind of dna vaccination with prevention and the effect of treatment haemonchus contortus disease of ruminant.Particularly, the present invention relates to a kind of dna vaccination that comprises the reorganization eucaryon plasmid carrier that has wherein inserted haemonchus contortus (Haemonchus contortus) protectiveness sequestered antigen gene H11 part coding region.

Background technology

Haemonchus contortus disease is a kind of parasitic disease that is caused by the haemonchus contortus (Haemonchus contortus) that circle line order Mao Yuanke blood lance belongs to.Cause of disease parasitizes the host fourth stomach, in the accidental small intestinal, is its source of nutrition with host's blood.Ruminants such as infected cattle, sheep, deer, yak, camel cause anemia and anemia syndrome, the large quantities of death of serious actuatable thing, particularly lamb, and mortality rate is up to more than 30%.This disease is worldwide distribution, and all there is report domestic various places, and especially popular serious in flock of sheep in this disease of some pastoral areas, infection rate can reach more than the 70-80%.

Haemonchus contortus (Haemonchus contortus) is a kind of important enteron parasite of ruminant.Main at present employing chemotherapy, though obtained certain effect, drug residue and environmental pollution are serious.The appearance of Drug resistance worm strain and spreading makes traditional chemotherapy be subjected to serious challenge, and this has brought great economic loss to animal husbandry production, and it is very urgent and necessary that the applied immunology method is prevented and treated this disease.Haemonchus contortus disease is criticality and distributes, and all there is generation in the many places of China, and along with the adjustment of China's agricultural structure, many places are raised ruminant and developed as pillar industry, and therefore, developing effective vaccine prevention should disease become important topic.

At present, the multiple haemonchus contortus native antigen of immanoprotection action preferably that has has been found in research in succession, for example, and H11, H-gal-GP, H45 (P1), P52/46,15/24Kd ES and Hc-sL3.Wherein H11 is a kind of transmembrane glycoprotein in the parasitic stage haemonchus contortus intestinal microvillus epithelial cell; molecular weight is 110kDa; this antigen all has protective effect to all ages and classes section animal, and the strain of antagonism property of medicine worm, different geographical isolates have cross-protection.

But these antigens that comprise H11 are extremely low at the intravital content of worm, and the separation and purification process is complicated and loaded down with trivial details, is difficult to commercialization production.Research finds again no matter this antigenic recombination expression product is prokaryotic expression product or eukaryotic expression product, and its immune effect is all undesirable.Munn etc. use dodecyl sodium sulfate (SDS), SDS and dithiothreitol, DTT (DTT) to handle H11, change the native conformation of H11, distinguish immune sheep again, find that the worm's ovum slip all is starkly lower than the H11 of native conformation.Wherein reason is still not exclusively clear.

Nucleic acid vaccine is a kind of new generation vaccine that grew up in recent years, easy and simple to handle because of it, the safety that had both had recombinant subunit vaccine has the advantage that attenuated live vaccine is induced efficient, the persistence of comprehensive immunne response again, becomes one of focus of current vaccine research.Dna vaccination can be simulated the conformation of native antigen in vivo, carries out antigen presentation with MHC I and MHC II approach, not only causes the humoral immunoresponse(HI) reaction, and can cause the body cell immune response.Therefore, developing the dna vaccination with prevention and therapeutical effect has great importance.

Summary of the invention

The invention provides a kind of dna vaccination with immunity regulating type of prevention or the effect of treatment haemonchus contortus disease of ruminant.

The invention provides the method that a kind of preparation has the immunity regulating type DNA vaccine of prevention or the effect of treatment haemonchus contortus disease of ruminant.

In addition, the present invention also provides the purposes of described dna vaccination.

The present invention partly is based upon on the inventor's the following discovery: the reorganization eucaryon plasmid carrier that contains haemonchus contortus (Haemonchus contortus) protectiveness sequestered antigen gene H11 part coding region can provide effective immunoprotection at haemonchus contortus for ruminant; The haemonchus contortus protectiveness sequestered antigen gene H11 part coding region of 3 sections diverse locations is inserted the eucaryon plasmid carrier respectively, with the mixture immunity inoculation animal of 3 kinds of reorganization eucaryon plasmids, can provide better immunoprotection then.

What the present invention used is to have immunogenic H11 gene, and the proteantigen H11 of this gene code is a kind of transmembrane glycoprotein in the parasitic stage haemonchus contortus intestinal microvillus epithelial cell, and molecular weight is 110kDa.Discover that proteantigen H11 all has the certain protection effect to all ages and classes animal; ewe serum antibody and colostral antibody are transferred in newborn lamb (5 age in the week) body; found that 5 ages in week lamb obtain protections, can resist 3000 the 3rd the phase larva attack.H11 has protective effect equally to the lamb in 7～9 ages in week.Secondly, H11 has intersecting protective to different geographical isolates.

In the application's a specific embodiments, design the open reading frame of covering protection antigen gene H11 3 pairs of primers (P1:5 ' ATA CCGCGGATGACGTCGCAGGGGAG-3 ' and P1 ': 5 '-CGC TCTAGAAGAGCATATTGTGTCA-3 '; P2:5 ' ATA CCGCGGCCAGAGGCAAAGAAGA-3 ' and P2 ': 5 '-TTC TCTAGACCGTTCACCACAAAGGGA-3 '; And P3:5 '-ATA CCGCGGACATGGTTGAGAAGAGA-3 ' and P3 ': 5 '-GGC TCTAGAAAGGTGGCTTTCTTGA-3 ')

With three section part coding region H11-1, H11-2 and the H11-3 of these three primers, has the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively to amplifying protective antigen gene H11.

Therefore; an aspect; the invention provides the protectiveness sequestered antigen gene H11 part coding region of 3 sections diverse locations, promptly H11-1, H11-2 and H11-3 have the nucleotide sequence shown in SEQ ID NO:1, SEQ IDNO:2 and SEQ ID NO:3 respectively.

Another aspect; the invention provides a kind of dna vaccination with immunity regulating type of prevention and the effect of treatment haemonchus contortus disease of ruminant, this vaccine comprises the reorganization eucaryon plasmid carrier that has wherein inserted haemonchus contortus (Haemonchus contortus) protectiveness sequestered antigen gene H11 part coding region.

In a specific embodiments, a kind of recombinant DNA vaccine is provided, wherein comprise the reorganization eucaryon plasmid carrier that has wherein inserted H11-1 (SEQ ID NO:1).

In a specific embodiments, a kind of recombinant DNA vaccine is provided, wherein comprise the reorganization eucaryon plasmid carrier that has wherein inserted H11-2 (SEQ ID NO:2).

In a specific embodiments, a kind of recombinant DNA vaccine is provided, wherein comprise the reorganization eucaryon plasmid carrier that has wherein inserted H11-3 (SEQ ID NO:3).

In a preferred embodiment, a kind of dna vaccination with prevention and the effect of treatment haemonchus contortus disease of ruminant is provided, mixture comprising above-mentioned 3 kinds of reorganization eucaryon plasmid carriers, promptly contain H11-1 reorganization eucaryon plasmid carrier, contain the reorganization eucaryon plasmid carrier of H11-2 and contain the reorganization eucaryon plasmid carrier of H11-3, abbreviate pcDNA-H11-1+2+3 as.

In an especially preferred embodiment, the mixed proportion of 3 kinds of reorganization eucaryon plasmid carriers is 1: 1: 1.

Dna vaccination of the present invention uses the eucaryon plasmid expression vector as structural framing, and described eucaryon plasmid carrier removes has the expression vector primary element, and the place has inserted genes of interest at restriction enzyme site.Any eucaryon plasmid carrier known in the art all can be used for the present invention, for example, includes but not limited to pcDNA3.0, pcDNA3.1, pVAX1.0 and pcDNA4/His Max.In a concrete embodiment preferred of the present invention, described eucaryon plasmid carrier is pcDNA4/His Max (available from an American I nvitrogen company).

Aspect second of the present invention, a kind of method of production haemonchus contortus (Eimeria tenella) immunity regulating type DNA vaccine is provided, in brief, comprise the following steps:

1) three primers of the part coding region of pcr amplification haemonchus contortus protective antigen gene H11 design covering H11 gene complete open reading frame are right, by the pcr amplification means, the clone obtains 3 sections part coding regions of H11 gene, that is, and and H11-1, H11-2 and H11-3; The structure of dna vaccination reorganization eucaryon plasmid and corresponding gene engineering bacteria

2) utilize the recombination method of molecular biology routine, prepare the reorganization eucaryon plasmid that contains H11-1, H11-2 or H11-3, transform host bacterium (for example, the e. coli jm109 strain) with it then, the screening back obtains the recombination engineering bacteria;

3) the extensive separation and purification of the fermentation of genetic engineering bacterium and dna vaccination reorganization eucaryon plasmid obtains 3 kinds of 3 kinds of reorganization eucaryon plasmids that contain H11-1, H11-2 or H11-3, is the dna vaccination that contains H11-1, H11-2 or H11-3; And randomly also comprise

4) the 3 kinds of reorganization eucaryon plasmids that contain H11-1, H11-2 or H11-3 that step 3) obtained mix by a certain percentage and obtain a kind of vaccine, i.e. pCDA-H11-1+2+3, and for example mixed proportion is 1: 1: 1.

Aspect the 3rd of the present invention is the purposes of haemonchus contortus of the present invention (Eimeria tenella) immunity regulating type DNA vaccine.Dna vaccination with the reorganization eucaryon plasmid that has inserted H11-1, H11-2 or H11-3 comprising behind the purification; perhaps with behind the dna vaccination direct immunization animal that comprises described 3 kinds of reorganization eucaryon plasmid mixture; by every gram feces index, egg capsule slip, caecum lesion is kept the score and Multitest index such as nematicide index is found, 3 kinds of dna vaccinations that comprise the dna vaccination of single described reorganization eucaryon plasmid and comprise described three kinds of reorganization eucaryon plasmid mixture all have good immune protective effect (wherein the latter protect effect more remarkable).Therefore, dna vaccination of the present invention can be used for preparing the pharmaceutical preparation of prevention or treatment haemonchus contortus disease of ruminant.

The pharmaceutical composition that dna vaccination of the present invention can be used to prevent and treat the ruminant nematicide with commonly used carrier on the materia medica and/or adjuvant preparation.

Description of drawings

Fig. 1 is the structural representation of dna vaccination pcDNA-H11-1 (or pcDNA-H11-2 or pcDNA-H11-3).

Fig. 2 is the policy map of H11 gene design primer.

Fig. 3 is that recombiant plasmid pMD18T-H11-1 (or pMD18T-H11-2 or pMD18T-H11-3) makes up flow chart.

Fig. 4 is the structure flow chart of recombiant plasmid pET-H11-1 (or pET-H11-2 or pET-H11-3).

Fig. 5 is illustrated to be SDS-PAGE electrophoresis result behind recombiant plasmid pET-H11-1, pET-H11-2 and the pET-H11-3 abduction delivering.In the A and B of Fig. 7: M is the protein standard molecular weight, and the 1st swimming lane is pET28b (+); 2-9 swimming lane among the A respectively is pET28-H11-1 and induces the 0th, 1,2,3,4,5,6 and 7 hour the sampling in back: the 2-9 swimming lane among the B respectively is pET28-H11-2 and induces the 0th, 1,2,3,4,5,6 and 7 hour the sampling in back.In the C of Fig. 7: M is the protein standard molecular weight, and the 1st and 2 swimming lanes are respectively the last cleer and peaceful occlusion body of pET28-H11-1, and the 3rd and 4 swimming lanes are respectively the last cleer and peaceful occlusion body of pET28-H11-2, and the 5th and 6 swimming lanes are respectively the last cleer and peaceful occlusion body of pET28-H11-3.

Fig. 6 is recombiant plasmid pPICZaB-H11-1,2 or 3 structure flow chart.

Fig. 7 is dna vaccination pcDNA-H11-1,2 or 3 structure flow chart.

Fig. 8 detects dna vaccination pcDNA-H11-1,2 or 3 transcribing in muscle for RT-PCR.

M is the DNA standard molecular weight; 1,3,5 is respectively PBS immune group injection site muscle;

2,4,6 be respectively pcDNA-H11-3,2,1 immune group injection site muscle.

Fig. 9 detects pcDNA-H11-1,2, the expression figure of 3 dna vaccinations in muscle for the Western-trace.

A1, A2 are antigen with the muscle of PBS, pcDNA-H11-1+2+3 immune goat respectively, and rat anti H11 antibody is one anti-.

B1, B2 are antigen with pET28-H11-1 and pET28-H11-2 recombiant protein respectively, and the serum of pcDNA-H11-1+2+3 immune goat is one anti-.

C1, C2 are antigen with pET28-H11-1 and pET28-H11-2 recombiant protein respectively, and the serum of PBS immune goat is one anti-.

Figure 10 is the interior anti-H11 antibody horizontal curve chart of goat body after the dna vaccination immunity.

Goat was discharged haemonchus contortus ovum curve chart after Figure 11 attacked worm.

Figure 12 is that dna vaccination immune group and PBS matched group goat are by position health status comparison diagrams such as hair, eye conjunctivas.

Embodiment

Basic material: carrier for expression of eukaryon pcDNA4/His Max, pPICZ α B (American I nvitrogen company product); PMD18-T (precious biological (TaKaRa) Engineering Co., Ltd in Dalian); PET-28a, b, c (+) (U.S. Novagen company product).

The preparation of embodiment 1.H11 gene:

1. primer design is with synthetic

According to the nucleotide sequence of disclosed haemonchus contortus H11 gene among the GenBank, use 3 pairs of primers of Primer Premier5 software design, as follows:

P15’-ATA CCGCGGATGACGTCGCAGGGG?AG-3，

P1’5’-CGC TCTAGAAGAGCATATTGTGTCA-3’；

P25’-ATA CCGCGG?CCAGAGGCAAAGAAG?A-3’，

P2’5’-TTC TCTAGACCGTTCACCACAAAGGG?A-3’；

P35’-ATA CCGCGGACATGGTTGAGAAGAGA-3’，

P3’5’-GGC TCTAGA?AAGGTGGCTTTCTTGA-3’。

Layout strategy as shown in Figure 2, the 3 pairs of primers cover the open reading frame of H11.Be in these three pairs of primers at forward primer 5 ' end and introduce restriction enzyme site SacII, 5 ' end of downstream primer is introduced restriction enzyme site XbaI (shown in the underscore part), is used for construction of expression vector.

2. the extraction of the total RNA of haemonchus contortus polypide

40 haemonchus contortus adults of picking are put into the homogenizer of handling through DEPC, add Trizol reagent 1ml, homogenate 3 minutes.Homogenate is transferred in the Eppendorf pipe, and room temperature was placed 5 minutes, added 200 μ l chloroforms, the outstanding vibration in whirlpool 15 seconds.4 ℃, centrifugal 15 minutes of 12000r/min draws the upper strata water and goes in the new Eppendorf pipe, adds behind the 500 μ l isopropyl alcohols in 25 ℃ of precipitations 30 minutes.Centrifugal 10 minutes of 12000r/min, precipitation is dried the RNA precipitation with 75% washing with alcohol 2 times, and the water dissolution that does not have the RNA enzyme with 50 μ l precipitates.Ultraviolet spectrophotometer is measured content and the purity of RNA, and-20 ℃ of preservations are standby.

3.RT-PCR amplification

With the total RNA of the haemonchus contortus of said extracted is template, with oligo (dT) ₁₅Primer carries out reverse transcription, and synthetic cDNA first chain adopts 20 μ l reaction systems: total about 1.0 μ g of RNA, oligo (dT) ₁₅0.50 μ g, 70 ℃ of degeneration are put immediately after 10 minutes in the frozen water and were cooled off 2 minutes, add 5 * RT reaction buffer, 4.0 μ l then, MgCl ₂(25mmol/L) 2.0 μ l, dNTP (10mmol/L) 1.5 μ l, M-MLV reverse transcription (200U/ μ l) 1.0 μ l, RNasin (40U/ μ l) 0.5 μ l, no RNase water is mended to 20 μ l.Above-mentioned all the components is flicked mixing, of short duration centrifugal after, 42 ℃ of reactions 60 minutes, 95 ℃ of 5 minutes deactivation reverse transcription then.Reverse transcription product carries out PCR immediately or-20 ℃ of preservations are standby.

With the reverse transcription product is template, adopts 50 μ l systems to carry out pcr amplification, and each reacted constituent is as follows: cDNA template 2.0 μ l, 10 * PCR reaction buffer, 5.0 μ l, MgCl ₂(25mmol/L) 3.0 μ l, each 2.0 μ l of paired upstream and downstream primer (50pmol/ μ l) (promptly correspondingly adding each 2.0 μ l of P1 and P1 ', P2 and P2 ' or P3 and P3 ' respectively), dNTP (2.5mmol/L) 4.0 μ l, Taq enzyme (5U/ μ l) 0.5 μ l adds sterilization ddH ₂O to 50 μ l.Behind the centrifugal mix homogeneously of mentioned component, on the PCR instrument, increase, reaction condition is: 94 ℃ of pre-degeneration 3 minutes; 94 ℃ of degeneration 1 minute, 58 ℃ of annealing 1 minute, 72 ℃ were extended totally 30 circulations 1.5 minutes; 72 ℃ were extended 15 minutes then.

Use gene that primer obtains P1 and P1 ', P2 and P2 ' or P3 and P3 ' amplification called after H11-1, H11-2 and H11-3 respectively.Show that through order-checking H11-1, H11-2 that amplification obtains and H11-3 gene have the nucleotide sequence shown in 484-1607 position among 484-1457 position and the SEQ ID NO:3 among 484-1409 position, the SEQ ID NO:2 among the SEQ ID NO:1 respectively.

The preparation of embodiment 2.DNA vaccine

1. the structure (see figure 3) of recombiant plasmid pMD18-T-H11-1, pMD18-T-H11-2 and pMD18-T-H11-3

Get the PCR product 50 μ l that obtain among the embodiment 1, electrophoresis on 1% agarose gel downcuts purpose band place agarose gel under uviol lamp, uses the glue recovery test kit of the precious biotech firm in Dalian to reclaim purification purpose fragment, and method is with reference to description.The PCR product of getting purification be connected with the linearizing pMD18-T carrier of XbaI enzyme cutting through SacII, reaction system is as follows:

PCR reclaims product 4.0 μ l

PMD18-T carrier 1.0 μ l

Ligation?solution?I 5.0μl

Cumulative volume 10.0 μ l

With mentioned component in thin-walled eppendorf pipe behind the mix homogeneously 4 ℃ of connections spend the night.Connect product transformed competence colibacillus e. coli jm109, extract plasmid,, be defined as pMD18-T-H11-1, pMD18-T-H11-2 and pMD18-T-H11-3 with SacII and evaluations such as XbaI double digestion and order-checking.

2. the structure (see figure 4) of recombiant plasmid pET-H11-1, pET-H11-2 and pET-H11-3

Use BamHI and HindIII double digestion cloned plasmids pMD18-T-H11-1, pMD18-T-H11-2, pMD18-T-H11-3 and prokaryotic expression carrier pET28b (+) respectively, reclaim purification H11-1, H11-2, H11-3 and pET28b (+) endonuclease bamhi respectively, the T4 ligase connects, and reaction system is as follows:

H11-1 H11-2H 11-3

The purpose fragment 7 μ l 8 μ l 10 μ l that double digestion reclaims

PET28b (+) carrier recovery fragment 10 μ l 9 μ l 7 μ l

10 * connection buffer, 2 μ l, 2 μ l, 2 μ l

T ₄Dna ligase 1 μ l 1 μ l 1 μ l

20μl 20μl 20μl

First with after purpose fragment and the carrier segments adding, mix homogeneously, 45 ℃ act on 5 minutes, add other compositions then on ice, and of short duration centrifugal mixing is put 16 ℃ and is connected 12h.Connect product transformed competence colibacillus e. coli bl21, extract plasmid, identify, be defined as pET-H11-1, pET-H11-2 and pET-H11-3 recombinant vector with BamHI and HindIII double digestion.

3. the abduction delivering of recombiant plasmid pET-H11-1, pET-H11-2 and pET-H11-3

Have 28 ℃ of shaken cultivation of positive colony of pET-H11-1, pET-H11-2 and pET-H11-3 plasmid to spend the night conversion, bacterium liquid was diluted to 1: 50 and contains Kna ⁺The LB culture fluid in, 37 ℃ are continued to be cultured to OD ₆₀₀=0.4-0.6 carries out abduction delivering with final concentration 1mMol/L IPTG then, collects the bacterium liquid of 0hr, 1hr, 2hr, 3hr, 4hr, 5hr, 6hr respectively, and tropina carries out SDS-PAGE and identifies (see figure 5).

4. the structure (see figure 6) of recombinant plasmid pPICZ alpha B-H11-1, pPICZ α B-H11-2 and pPICZ α B-H11-3

PMD18-T-H11-1, pMD18-T-H11-2 or pMD18-T-H11-3 and expression vector pPICZ α B are used SacII and XbaI double digestion respectively, behind agarose gel electrophoresis, reclaim purpose fragment and carrier segments respectively, carry out cohesive end with suitable ratio and connect (construction strategy such as Fig. 4-1), reaction system is as follows:

H11-1 H11-2 H11-3

The purpose fragment 7 μ l 8 μ l 10 μ l that double digestion reclaims

The pPICZ α B carrier segments 10 μ l 9 μ l 7 μ l that reclaim

10 * connection buffer, 2 μ l, 2 μ l, 2 μ l

T ₄Dna ligase 1 μ l 1 μ l 1 μ l

20μl 20μl 20μl

16 ℃ connect 12 hours.The E.coli JM109 competent cell that product transforms prepared fresh respectively will be connected, the bacterium liquid that ice bath, heat shock and the resistance of learning from else's experience recovered is coated on the less salt LB solid medium flat board that contains ZeocinTM (25 μ g/ml), in 37 ℃ of incubators, be inverted and cultivate 18～24h, extract plasmid, with evaluations such as SacII and XbaI double digestions, be defined as pPICZ α B-H11-1, pPICZ α B-H11-2 and pPICZ α B-H11-3.

5. the structure (see figure 7) of recombiant plasmid pcDNA-H11-1, pcDNA-H11-2 and pcDNA-H11-3

PPICZ α B-H11-1, pPICZ α B-H11-2 or pPICZ α B-H11-3 plasmid and pcDNA4/HisMax plasmid are used XhoI and XbaI double digestion respectively, behind agarose gel electrophoresis, reclaim purpose fragment and carrier segments respectively, carry out cohesive end with suitable ratio and connect, reaction system is as follows:

H11-1 H11-2 H11-3

The purpose fragment 7 μ l 8 μ l 10 μ l that double digestion reclaims

PcDNA4/HisMax C fragment 10 μ l 9 μ l 7 μ l

10 * connection buffer, 2 μ l, 2 μ l, 2 μ l

T ₄Dna ligase 1 μ l 1 μ l 1 μ l

20μl 20μl 20μl

Connect product transformed competence colibacillus e. coli jm109, extract plasmid, determine to obtain to be pcDNA4/HisMax-H11-1, pcDNA4/HisMax-H11-2 and pcDNA4/HisMax-H11-3DNA vaccine with XhoI and XbaI double digestion.

6. contain the preparation of the dna vaccination of three kinds of reorganization eucaryon plasmid mixture

PcDNA4/HisMax-H11-1, pcDNA4/HisMax-H11-2 that aforesaid operations is obtained and pcDNA4/HisMax-H11-3 obtain containing the dna vaccination of these three kinds reorganization eucaryon plasmid mixture by 1: 1: 1 mixed.

The animal protection test of embodiment 3.DNA vaccine

1. experimental animal inoculation

The selective body heavy phase when, no twisted haemonchus infects, 5 '-7 monthly ages 15 of health goats, be divided into 3 groups at random, 5 every group.The 1st group of intramuscular injection PBS.The mixture (pcDNA4/HisMax-H11-1+2+3) of 3 kinds of reorganization of the 2nd group of intramuscular injection eucaryon plasmid carrier.2 all booster immunizations once after the first immunisation.Each every goat injection 1ml pcDNA4/HisMax-H11-1+2+3 (wherein H11-1,2 and 3 each 100 μ g/ml).Back 14 days of the 2nd immunity, every goat infection 10,000 haemonchus contortus third phases larva.The 3rd group of goat is not immune, does not attack stage yet.

2.RT-PCR detect the expression of nucleic acid vaccine

Back 7 days of the 1st immunity, the local anesthesia goat is got the vaccine injection muscle cell and extracts RNA, precipitates through DEPC treated water dissolving RNA with 20 μ l at last.For preventing the plasmid DNA pollution, the DNase with no RNase before the reverse transcription handles muscle RNA, carries out RT-PCR.Concrete grammar is described with embodiment 1.The result shows that dna vaccination has obtained to transcribe (see figure 8) in the goat muscle cell.

3.Western trace detects the expression of nucleic acid vaccine

In back 7 days of the 2nd immunity, take serum and vaccine injection portion muscle (local anesthesia), sample preparation, SDS-PAGE, electrotransfer are to nitrocellulose membrane.PBS washes film 2 times, the dyeing of 0.2% Ponceaux, pencil labelled protein standard molecular weight position; PBS washes film for several times, all take off to Ponceaux, 4 ℃ of 3%BSA (PBS) spend the night or 37 ℃ 1 hour; PBS washes film for several times, adds rat anti H11 antibody (3%BSA dilution), and 37 ℃ act on 1 hour; Normal saline is washed film for several times, adds goat-anti rat IgG-HRP (3%BSA dilution), and 37 ℃ act on 1 hour; Normal saline is washed film, adds the substrate colour developing, the normal saline rinsing, and the PBS cessation reaction, dry NC film is taken a picture.

PET28-H11-1, pET28-H11-2 or pET28-H11-3 (embodiment 3 the 3rd step in make up) prokaryotic expression recombiant protein sample preparation, SDS-PAGE, electrotransfer are that one anti-, the anti-goat IgG-HRP of rabbit is that the labelling two anti-Western traces that carry out detect with nucleic acid vaccine immunity for the second time 2 week back serum to nitrocellulose membrane.Found that dna vaccination has obtained good expression in muscle cell, and stimulate goat to produce anti-H11 antibody (see figure 9).

4.ELISA detection antibody horizontal

14 days, immunity were for the second time afterwards taked serum in 10,16,24,29,38,47 days before immunity, after the first immunisation.Determine envelope antigen and antibody (serum) dilution factor with matrix method.

To suitable concn, add ELISA Plate with coating buffer dilution H11 antigen, every hole 50 μ l, 37 ℃ after 1 hour 4 ℃ spend the night.Abandon coating buffer, PBS-Tween20 washing 3-5 time adds 100 μ l confining liquids, 4 ℃ spend the night or 37 ℃ 1 hour.Abandon confining liquid, PBS-Tween20 washing 3-5 time adds serum to be checked (dilution in 1: 1000) 50 μ l, and 37 ℃ are incubated 1 hour.Abandon serum, PBS-Tween20 washing 3-5 time adds ELIAS secondary antibody 50 μ l, and 37 ℃ are incubated 1 hour.Abandon two and resist, PBS-Tween20 washing 3-5 time adds colour developing liquid 100 μ l, lucifuge reaction 5 '-15 minutes, and every hole adds 100 μ l 2M sulphuric acid cessation reactions, and microplate reader is measured OD ₄₉₀

Found that for the second time back 10 days antibody titers of immunity reach higher level, yet behind secondary immunity, find that antibody titer drops sharply to reduced levels 16-29 days the time, bottom out again afterwards, and maintain a higher level (see figure 10).The t check shows that the pcDNA4/HisMax-H11-1+2+3 immune group antibody horizontal utmost point is significantly higher than PBS matched group (P＜0.01).

5. egg count

After the haemonchus contortus third phase, larva infected, gather feces, be used for egg count respectively at infecting the 21st, 23,25,27,29, the 31 and 33 day goat rectum in back.

Adopt the Mai Kemasiteshi method.Claim 2 gram feces in mortar, add water 10ml, stir evenly, add saturated brine 50ml again.Behind the mixing, draw liquid manure, inject the numeration chamber, put on the microscope desk, left standstill 1-2 minute.Count under mirror, the worm's ovum sum in the scale multiply by the 200 worm's ovum numbers that are in every gram feces.Worm's ovum slip=(the average every gram feces number of the average every gram feces number/matched group of 1-experimental group) * 100%.

Egg count result such as table 1.Attacked behind the worm 21 days, beginning can detect a spot of haemonchus contortus worm's ovum in the feces, as time passes, matched group and the every gram faecal egg of nucleic acid vaccine immunity group number (EPG) increase gradually, and not immune not infected group does not all detect the haemonchus contortus worm's ovum.

The every gram faecal egg of table 1 number (* 200)

Figure 11 is a worm's ovum discharge rule curve.PcDNA4/HisMax-H11-1+2+3 immune group goat worm's ovum is discharged quantity obvious (t check difference is P＜0.01 extremely significantly) and is less than the PBS matched group, and the worm's ovum slip reaches 58.75%.Though the goat worm's ovum slip with pcDNA4/HisMax-H11-1, pcDNA4/HisMax-H11-2 or pcDNA4/HisMax-H11-3 immune group is lower than the pcDNA4/HisMax-H11-1+2+3 immune group separately, worm's ovum is discharged quantity also obvious (t check difference is P＜0.01 extremely significantly) and is less than the PBS matched group.

6. egg hatch rate

In infecting the back the 27th, 29,31 day, rectum is gathered feces, behind the egg count, weighs, and cultivates 4-6 days for 26 ℃ behind the smearing dispersion equipment, adopts Bel's Man method ^[5]Separate stage, counting calculates the egg hatch rate.Egg hatch rate=stage number/worm's ovum number * 100%

The average incubation rate of pcDNA4/HisMax-H11-1+2+3 immune group worm's ovum is 3.90%, and it is 14.22% that PBS organizes average incubation rate.The egg hatch rate reduces by 72.57% behind the nucleic acid vaccine immunity, and t check difference is (P＜0.01) extremely significantly.Be higher than the pcDNA4/HisMax-H11-1+2+3 immune group though discharge quantity with the goat worm's ovum of pcDNA4/HisMax-H11-1, pcDNA4/HisMax-H11-2 or pcDNA4/HisMax-H11-3 immune group separately, also obviously (t check difference is P＜0.01 extremely significantly) is less than the PBS matched group.

7. adult is counted

Infected behind the stage the 35th day, the jugular vein blood-letting goat that causes death is collected fourth stomach, and the separation haemonchus contortus is counted male and female borer population order respectively.Adult slip=(the 1-experimental group on average becomes borer population/matched group on average to become borer population) * 100%.

The female worm, male worm, the adult lotus borer population that found that average every the goat of PBS matched group are respectively 266,170.5,436.5, and the nucleic acid vaccine immunity group is respectively 82.8,55.8,138.6 (table 2).The t check analysis shows immune group and matched group differences extremely significantly (P＜0.01)

Haemonchus contortus adult counting in the table 2 goat fourth stomach

Behind the haemonchus contortus H11 dna gene vaccine goat, attack third phase larva, found that with matched group and compare, the immune group goat is discharged worm's ovum minimizing 58.75%, egg hatch rate reduction by 72.57%, adult minimizing 68.25%.That the PBS matched group is attacked is thick disorderly by hair behind the worm, become thin, lethargy depressed (12 figure B), and the eye conjunctiva is pale, shows as Anemia (the 12 figure C right side); And immune group is healthy relatively, as Figure 12 A and Figure 12 C left side.

Sequence table

＜110〉Agricultural University Of Nanjing

＜120〉be used to prevent the dna vaccination of haemonchus contortus disease of ruminant

<130>

<160>3

<170>PatentIn?version?3.1

<210>1

<211>926

<212>DNA

＜213〉haemonchus contortus (Haemonchus contortus)

<220>

＜221〉the part coding region 1 (H11-1) of immune protective sequestered antigen gene H11

<222>(1)..(926)

<223>

<400>1

atgacgtcgc?aggggagaac?gcggacattg?ctgaatctaa?ctccaatccg?tcttattgtc 60

gcattatttc?tagtagctgc?tgcagtcggc?ctctctattg?gtctcaccta?ttactttact 120

cgcaaagcgt?tcgatacctc?agaaaagcca?gggaaggatg?atactggtgg?caaggacaaa 180

gacaattctc?cctctgcggc?ggaactactc?cttccaagta?atataaaacc?attgtcttac 240

gacttgacga?tcaaaacata?tctacctggt?tatgtggact?tcccaccgga?gcaaaacctc 300

acattcgatg?ggcgtgtgga?aatatcaatg?gttgtaattg?agccaacaaa?gagtatcgta 360

ctcaattcaa?agaagatctc?tgtaataccc?caagaatgtg?aactggtatc?gggcgataaa 420

aaactcgaaa?ttgaaagtgt?aaaggagcac?ccaagactgg?aaaaggttga?gtttcttatc 480

aaaagccaac?tggaaaaaga?tcaacaaatc?ttgctcaagg?tcggctacat?cggtctcatc 540

agcaacagcc?ttggtggaat?ctaccagacc?acttatacca?ccccggatgg?cacccctaag 600

atcgctgcag?tttcacaaaa?tgagcccata?gatgctcgtc?gaatggtacc?atgcatggat 660

gaaccgaaat?acaaagcaaa?ctggaccgtt?actgtcattc?atccaaaagg?cgccaaagcc 720

gtctcgaatg?gaatcgaagt?gaacggagat?ggagagatca?gtggtgattg?gatcacatcg 780

aagttcttga?ctactccacg?gatgtcatcc?tacttgttgg?cagttatggt?ttcagaattt 840

gaatacatcg?aaggtgaaac?aaagacgggt?gttcggttcc?gtatatggtc?acgcccagag 900

gcaaagaaga?tgacacaata?tgctct 926

<210>2

<211>974

<212DNA

＜213〉haemonchus contortus (Haemonchusc ontortus)

<220>

＜221〉the part coding region 2 (H11-2) of immune protective sequestered antigen gene H11

<222>(1)..(974)

<223>

<400>2

ccgcggccag?aggcaaagaa?gatgacacaa?tatgctctga?aatccggcat?caaatgcata 60

gagttctacg?aagatttctt?tgatatcaaa?tcccctctga?agaaacaaga?tgtgatcgcc 120

cttcctgatt?tctcagcagg?agccatggag?aactggggcc?tcatcactta?cagagaaaac 180

tctttgttgt?acgatgacag?attctatgca?ccgatgaata?aacagcgaat?tgctcgcatt 240

gttgctcatg?agcttgctca?tcagtggttt?ggcgacttgg?ttacgatgaa?gtggtgggac 300

aacttgtggt?tgaatgaagg?tttcgcaaga?ttcacagaat?tcattggagc?tggtcagata 360

actcaagatg?acgccagaat?gcggaactac?ttcctgattg?atgtacttga?acgcgctttg 420

aaagctgatt?cggtagcgtc?gagccatcca?ctttccttca?gaattgacaa?agctgcagaa 480

gttgaagaag?cctttgatga?tatcacatac?gccaaaggag?cttctgttct?tactatgctg 540

agagccttga?ttggagaaga?aaaacataag?cacgcagtat?cgcagtacct?caagaagttc 600

tcgtatagc?aatgcagaagc?gacagatcta?tgggcagttt?tcgatgaagt?tgtcactgac 660

gtcgagggtc?cagacggcaa?atctatgaga?accacggaat?tcgcaagtca?gtggacgact 720

cagatgggct?tcccagttat?ttccgtagca?gagtttaact?cgactacttt?gaaattaacg 780

caaagtcgat?ataaggcgaa?taaagatgct?gtggagaaag?agaagtaccg?tcatccgaaa 840

tacggattta?aatgggatat?tccactgtgg?tatcaggaag?gcgataagaa?ggagataaag 900

cgaacatggt?tgagaagaga?tgaaccgctt?tacttgcatg?taaatgatcc?tggcgctccc 960

tttgtggtga?acgg 974

<210>3

<211>1124

<212>DNA

＜213〉haemonchus contortus (Haemonchusco ntortus)

<220>

＜221〉the part coding region 3 (H11-3) of immune protective sequestered antigen gene H11

<222>(1)..(1124)

<223>

<400>3

acatggttga?gaagagatga?accgctttac?ttgcatgtta?gtgatgctgg?cgctcccttt 60

gtggtgaacg?cagaccgcta?tggattttat?cgacaaagtc?atgacgctaa?tggttggaaa 120

aagataatca?agcagctcaa?ggataatcat?gaggcttaca?gtccccggac?aagaaatgcc 180

atcattagcg?atgcgtttgc?tgcggctgca?actgacgcaa?ttgagtatga?gactgtattt 240

gaacttctga?attatgccga?aaaagaaacg?gaatatctac?cattagaaat?cgcaatgtcg 300

gggatctctt?cgattttgaa?atacttcggt?accgagccag?aggcaaagcc?agctcaagtg 360

tacatgatga?acatattgaa?accgatgtat?gagaaaagca?gtatcgaatt?cattgccaat 420

aactacagaa?atgacaagct?gtttttccaa?atcaacctcc?aaaaagatgt?cattgatatg 480

ttctgcgccc?tcggatcgca?agactgcagg?aagaaatata?aaaaactttt?cgatgacgaa 540

gtcatgaaca?aatgcaggga?tggtcaagca?gcaaccgaat?gcgtaagaat?cgccgctcct 600

ctccgatcaa?gtgtttattg?ttatggtgtg?aaggaaggcg?gtgattatgc?tttcgacaag 660

gtgatggagc?tttatacggc?cgaaacactc?gccctagaaa?aagacttcct?acgcctagca 720

ttgggatgtc?ataaagatgt?tactgctttg?aaaggacttc?tcttgcgggc?tctggacagg 780

aattcgtcgt?tcgtacgtat?gcaggatatc?ccaagtgctt?tcaatgatgt?agcagcaaat 840

cctatcggcg?gagaattcat?tttcaatttc?cttattgaaa?gatggccaga?tatcattgaa 900

agtataggaa?cgaagtacac?atacgttgag?aaagtgatac?cagcctgcac?ttcaggaatc 960

cgctcacaac?agcagattga?ccagctgaag?aatctgcaga?aaaatggcat?gaacgctcgt 1020

caattcggtg?cattcgataa?agcaatcgaa?cgagcacaaa?atagggtgga?ttggattaaa 1080

aaacatttcc?aaaaattagc?ggctttcttc?aagaaagcca?cctt 1124

Claims (6)

1. dna vaccination that is used to prevent and treat haemonchus contortus disease of ruminant; wherein comprise the eucaryon plasmid carrier that has inserted haemonchus contortus (Haemonchus contortus) protectiveness sequestered antigen gene H11 part coding region, the nucleotides sequence of wherein said H11 part coding region is classified SEQ ID NO:1 as.

2. dna vaccination that is used to prevent and treat haemonchus contortus disease of ruminant, this vaccine comprises following 3 kinds of different reorganization eucaryon plasmid carriers: contain nucleotides sequence classify the reorganization eukaryotic vector of the antigen gene of SEQ ID NO:1 as, contain nucleotides sequence classify as SEQ ID NO:2 antigen gene the reorganization eukaryotic vector and contain the reorganization eukaryotic vector that nucleotides sequence is classified the antigen gene of SEQ ID NO:3 as.

3. the described dna vaccination of claim 2, the mixed proportion of wherein said 3 kinds of reorganization eucaryon plasmid carriers is 1: 1: 1.

4. the described dna vaccination of claim 1-3, wherein said eucaryon plasmid carrier is pcDNA4/His Max.

5. each described dna vaccination is used for preventing and treating the purposes of the medicine of haemonchus contortus disease of ruminant among the claim 1-3 in preparation.

6. the described purposes of claim 5, wherein said ruminant is a goat.

Images