CN100357442C - Efficient fusion expression carrier - Google Patents

Abstract

the invention discloses a high-effective prokaryotic fused expressive carrier based on EspA as fusing accomponany, which comprises the following parts: T7 strong promoter, coded EspA accompany protein nucleotide sequence and connecting area, wherein the connecting area contains flexible area, 6-group aminoacidemia purifying point, enterokinase cutting point and multi-clone position.

Description

A kind of efficient fusion expression carrier

Technical field

The invention belongs to technical field of bioengineering, be particularly related to a kind of efficient fusion expression carrier, it contains the proteic nucleotide sequence of the coding EspA companion body, when in host bacterium commonly used such as intestinal bacteria (E.coli), expressing, can promote that prokaryotic expression system efficiently expresses exogenous object protein, the target protein that itself does not express or expression amount is low is efficiently expressed.

Background technology

In the production of life science and bio-pharmaceuticals, biological products, utilizing expression vector to prepare recombinant protein is important and the key link.The recombinant protein that obtains q.s is the prerequisite of carrying out follow-up study and production.Making up effective expression vector is the basic demand of expressing goal gene, also is the important factor that influences gene expression dose and protein-active simultaneously.Existing expression vector is divided into non-pattern of fusion expression vector, pattern of fusion expression vector, co-expression carrier etc., can select carrier according to different test design, yet still have many foreign genes can not utilize existing expression vector to obtain the target protein that efficiently expresses, need to attempt multiple different expression vector, cause unnecessary loss, bring difficulty for follow-up study and production.The factor that influences exogenous gene expression has a lot, at first the appearance of rare codon impacts for the synthetic of target protein, if contain bunchiness or a plurality of E.coli rare codon in the gene, the expression of foreign protein will be very low, contain a reason (Sorensen et al., 1989 that too much rare codon is considered to low expression level and produces incomplete product in the goal gene; Zhang et al., 1991); Secondly virulent gene and plasmid stability also influence the expression of foreign protein, the plasmid that has virulent gene potentially unstable during incubated overnight in the DE3 lysogenic bacteria, this be since cAMP for the hormesis (Grossman etal., 1998) of T7 RNA polymerase; N-end principle, secondary translation initiation site, unexpected terminator codon, transcription terminator and unstable purpose mRNA can influence the expression of foreign protein in addition.Therefore the expression problem that solves foreign protein becomes key.

Summary of the invention

Purpose of the present invention just provides a kind of efficient fusion expression carrier that can promote that foreign protein efficiently expresses.

For achieving the above object, the present invention has adopted following technical scheme.

The invention provides a kind of efficient fusion expression carrier, this carrier contains a kind of specific nucleotide fragments, this nucleotide fragments by promotor, be selected from following a) or b) nucleotide sequence, joining region nucleotide sequence polyphone constitute,

A) the proteic nucleotide sequence of coding EspA shown in the SEQ ID NO:1;

B) because the degeneracy of genetic code is different from SEQ ID NO:1 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:1.

Wherein, above-mentioned promotor is preferably the T7 promotor.

Wherein, above-mentioned joining region nucleotide sequence comprises the nucleotide sequence of the Linker flexible zone aminoacid sequence of coding shown in SEQ ID NO:2, this Linker flexible zone provides a transition between the fusion companion body and foreign protein, reduce the two phase mutual interference on space structure and some rigid structures that may occur, just in time be in a zone that snappiness is good through DNAstar software analysis Linker, analytical results as shown in Figure 2.Preferably, the nucleotides sequence of coding Linker is classified the sequence shown in SEQ ID NO:3 as.

Wherein, above-mentioned joining region nucleotide sequence can also comprise the nucleotide sequence of 6 the Histidine sequences of coding shown in SEQ ID NO:4, and Histidine can provide coordination electronics and some metal ions such as Ni ²⁺Chelating site, 6 His labels can make fusion rotein be adsorbed in to contain Ni ²⁺Chromatographic stuffing on, utilize this affinity chromatography to come purified fusion protein, thereby simplified proteic purifying work.Preferably, the nucleotides sequence of 6 the Histidine sequences of coding shown in SEQ IDNO:4 is classified the sequence shown in SEQ ID NO:5 as.

Wherein, above-mentioned joining region nucleotide sequence can also comprise the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:6, this aminoacid sequence (Asp-Asp-Asp-Asp-Lys) can be by the enteropeptidase specific recognition, cleavage site is at the carboxyl terminal of Lys, with respect to other nickases, enteropeptidase has strong, the advantages such as cutting efficiency is higher, reaction conditions milder of identification specificity, because the cleavage site of enteropeptidase is at the C-terminal of recognition site, thereby the foreign protein aminoterminal that scales off do not have extra amino acid, thereby aminoacid sequence is remained unchanged.Preferably, the nucleotides sequence of the aminoacid sequence of this coding shown in SEQ ID NO:6 is classified the sequence shown in SEQ ID NO:7 as.

Wherein, above-mentioned joining region nucleotide sequence also comprises the multiple clone site shown in SEQ ID NO:8.

EspA (Esp is E.coli secreted protein abbreviation) is an enterorrhagia Bacillus coil 0157: the III type excretory system of H7 (type III Nsecretion system, TTSS) associated protein, the espA gene of coding EspA is 578bp altogether, and expressed proteins is about 25Kda.Utilize the recombinant protein EspA of gene recombination technology construction expression to have very high expression amount (the reference Wang Qing rising sun, Mao Xuhu, Zou Quanming etc., the cloning and expression of enterohemorrhagic colon bacillus O157:H7 espA gene. Chinese microbiology and Journal of Immunology, 2006,26 (6): 535-538; Further fusion rotein EspA-Stx2B (shiga toxin 2B subunit), the EspA-IntiminC300 that makes up (enterorrhagia Bacillus coil 0157: the plain C-of H7 tight adhesion holds the immune protective fragment), EspA-S1 (Toxins, pertussis S1 subunit) are also efficiently expressed.These studies show that in a large number EspA can be used as a kind of novel prokaryotic expression and merges the companion body.

There are some researches show that also EspA plays a key effect in the adhesion process of enterorrhagia Bacillus coil 0157: H7 and host cell, recombinant protein EspA immunizing rabbit can produce intensive immunne response (reference Sarah A.K ü hne, William S.Hawes, Roberto M.La Ragione, et al.Isolation ofRecombinant Antibodies against EspA and Intimin of Escherichia coliO157:H7[J] .Clin Microbiol.2004,42 (7): 2966-2976), so EspA has potential mucosal adjuvants function, it more helps fusion rotein and induces body to produce strong immunne response.

Therefore, utilize EspA can promote the characteristics that foreign protein efficiently expresses, by gene recombination technology itself or functional peptide section are wherein built up on the expression vector, add the enteropeptidase site simultaneously to obtain target protein, thereby obtain a kind of new and effective prokaryotic expression carrier, reach the purpose that promotes that foreign protein efficiently expresses, and EspA can provide potential mucosal adjuvants function for the purpose immune protein.

The present invention has also designed the enteropeptidase cleavage site after 6 Histidine purification tags of joining region.Enteropeptidase is a kind of specific protease, aspartic acid-aspartic acid-aspartic acid-aspartic acid-Methionin (Asp-Asp-Asp-Asp-Lys) five amino acid residue in its energy specific recognition peptide chain, and cleavage site is at the carboxyl terminal of Lys.Obtain target protein with respect to other nickases with effective excision companion body albumen, enteropeptidase has strong, the advantages such as cutting efficiency is higher, reaction conditions milder of identification specificity.

In sum, efficient fusion expression carrier of the present invention has utilized EspA can promote expressing fusion protein as merging the companion body, make the albumen that itself does not express or expression amount is low obtain to efficiently express, utilize the EspA monoclonal antibody to can be used for expressing fusion protein and identify, and can utilize the EspA monoclonal antibody to make the efficiently purifying that the affinity purification chromatography column carries out fusion rotein; The Linker flexible zone provides a transition between the fusion companion body and foreign protein, reduced the two phase mutual interference on space structure and some rigid structures that may occur; 6 His labels can make fusion rotein be adsorbed in to contain Ni ²⁺Chromatographic stuffing on, utilize this affinity chromatography to come purified fusion protein, simplified proteic purifying work; The specific recognition site of enteropeptidase is provided, can have finished cutting at the C-terminal of recognition site expeditiously under the reaction conditions of gentleness, the aminoterminal of the foreign protein that scales off does not have extra amino acid, and sequence remains unchanged.

The fusion expression vector pEspA that the present invention makes up can be applicable to efficiently expressing of various foreign proteins, can be used for the scale operation of recombinant protein through fermentation.

Description of drawings

Fig. 1 is the sequence of carrier of the present invention from promotor to the enteropeptidase site.

Fig. 2 is that DNAstar software is to Linker snappiness analysis chart.

Fig. 3 is the pcr amplification product agarose gel electrophoresis figure of EspA gene, and wherein 1 is that the sky is epoch 100bp Marker, the 2nd, amplified production.

Fig. 4 is the structure synoptic diagram that contains the cloning vector pMD18-T-EspA of EspA gene.

Fig. 5 is the structure synoptic diagram that contains the cloning vector pMD18-T-Linker of joining region gene order.

Fig. 6 is the structure synoptic diagram of fusion expression vector pEspA.

Fig. 7 utilizes pEspA to express the SDS-PAGE synoptic diagram of warm albumen EspA-Stx2B and purifying, and wherein 1 is that the reorganization bacterium is induced 4 hours whole bacterial proteins, and 2 is Takara protein standard Marker, and 3,4,5 for using Ni ²⁺The warm albumen EspA-Stx2B of affinity chromatography wash-out.

Fig. 8 utilizes pEspA to express the SDS-PAGE synoptic diagram of warm albumen EspA-IntiminC300 and purifying, and wherein 1 is that the reorganization bacterium is induced the 4h whole bacterial protein, and 2 is Takara protein standard Marker, and 3,4,5 for using Ni ²⁺The warm albumen EspA-IntiminC300 of affinity chromatography wash-out.

Fig. 9 utilizes pEspA to express the SDS-PAGE synoptic diagram of warm albumen EspA-S1, wherein 1 is Takara protein standard Marker, 2,3 induce cross-reference for empty plasmid, 4,5,6,7 are respectively and induce 1h, 2h, 4h, 6h whole bacterial protein, arrow to be depicted as the warm albumen EspA-S1 of expression.

Figure 10 is the collection of illustrative plates of fusion expression vector pEspA.

Embodiment

The present invention is described further below in conjunction with drawings and Examples.

The structure of embodiment 1 fusion expression vector pEspA

1.EspA the amplification of gene

1) design of primers synthetic (underscore shows restriction enzyme site)

The espA gene nucleotide series (AE005174) of the international standard strain EHEC O157:H7 EDL933 that announces according to GenBank, according to restriction enzyme site retrieval and design of primers principle, design a pair of primer, upstream primer (SEQ ID NO:9) 5 ' end is introduced the NcoI restriction enzyme site, Linker (YAPQDP) sequence (SEQID NO:2) meter is held at downstream primer (SEQ ID NO:10) 5 ', and introduce BamH I site, the sticky end of cutting with BamH I enzyme can carry out the correct connection between two sequences.

Upstream primer P1 (SEQ ID NO:9):

5’ CCATGGATACATCAAATGCAAC-3’(NcoI)

Downstream primer P2 (SEQ ID NO:10):

5’- GGATCCTGCGGCGCGTATTTACCAAGGGATATT-3’(BamHI)

Primer Primer Premier 5.0 software designs, oligo 6.7 assays, and synthetic by Shanghai Ying Jun Bioisystech Co., Ltd, the PAGE purifying.

2) pcr amplification of goal gene EspA

With enterorrhagia Bacillus coil 0157: H7 genomic dna (boiling brokenly the bacterium supernatant) is a template, is primer amplification EspA gene with P1 and P2, adopts following PCR system and program:

Template DNA 3 μ l

P1(25pmol/μl) 2μl

P2(25pmol/μl) 2μl

dNTPs(2.5mmol/L?each) 8μl

10×PCR?buffer 10μl

MgCl ₂(25mmol/L) 10μl

Ex-Taq?DNA?polymerase 1μl

ddH ₂O 63μl

total?volume 100μl

With the reaction system mixing that vibrates, after the centrifugal treating, add 40 μ l paraffin oils.94 ℃ of pre-sex change 10min, 94 ℃ of sex change 60s, 58 ℃ of annealing 40s, 72 ℃ are extended 60s, 35 circulations, 72 ℃ are extended 10min fully.Get 3 μ l reaction product after reaction finishes, detect the PCR effect with 1.0% agarose gel electrophoresis, the result as shown in Figure 3.

2. the structure that contains the cloning vector pMD18-T-EspA of EspA gene

Adopt TA cloning process clone PCR products, the plasmid construction process as shown in Figure 4.

3. the structure that contains the cloning vector pMD18-T-Linker of joining region gene order

1) according to synthetic two oligonucleotide fragments of complementary of joining region implementation sequence:

L1(SEQ?ID?NO：11)：

5’- GGATCCTCACCACCACCACCACCACGGTACCGACGACGACGACAAAGAA-3’(BamHI)

L2(SEQ?ID?NO：12)：

5’- CTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCGAATTCTTTGTCGTCGTCGTCGGTA-3’ (Xho?I)

Synthetic by Shanghai Ying Jun Bioisystech Co., Ltd, and carry out the PAGE purifying.Article two, oligonucleotide fragment on the PCR instrument through sex change, annealing, extend joining region sequence 6 His Tag-EK site-MCS.

2) adopt the TA cloning process to make up the pMD18-T-Linker carrier, the plasmid construction process as shown in Figure 5.

4. the structure of fusion expression vector pEspA

1) downcuts the EspA sequence through NcoI and BamHI double digestion from the pMD18-T-EspA carrier, be inserted into NcoI and the BamHI double digestion window of pET-28a (+), be built into pET-28a (+)-EspA carrier.

2) downcut the joining region sequence through BamHI and Xho I double digestion from the pMD18-T-Linker carrier, be inserted into BamHI and the Xho I double digestion window of pET-28a (+)-EspA, be built into fusion expression vector pEspA, the plasmid construction process as shown in Figure 6, the fusion expression vector pEspA that constructs is as shown in figure 10.EspA sequence and joining region sequence (comprising flexible zone, 6 Histidine purifying sites, enteropeptidase cleavage site and multiple clone site) are as shown in Figure 1.

Embodiment 2 fusion expression vector pEspA expressed fusion protein EspA-Stx2B

1.stx2B gene PCR amplification:

1) obtain EHEC O157:H7 stx2B gene by GenBank, with Primer Premier 5.0 software design primer sequences, upstream primer (SEQ ID NO:13):

5 '- GAATTCAAAGAAGATGTTTATGGCGGT-3 ', 5 ' end add EcoR I restriction enzyme site, downstream primer (SEQ ID NO:14): 5 '- CTCGAGGTCATTATTAAACTGCACTT-C-3 ', 5 ' end add Xho I restriction enzyme site, and primer is synthetic by Shanghai Ying Jun Bioisystech Co., Ltd.

2) get the EHEC O157:H7 bacterium liquid 10ml of overnight incubation, the centrifugal supernatant that goes adds the autoclaved distilled water suspendible of 2ml, boils 10 minutes, and 12000g centrifuging and taking supernatant is as pcr template.Get 1 μ l as template, 94 ℃ of pre-sex change 10 minutes, by 94 ℃ of 60s, 55 ℃ of 60s, 30 circulations of 72 ℃ of 60s temperature cycle patterns reactions, last 72 ℃ were extended 10 minutes, amplification stx2B gene fragment.

3) the stx2B gene fragment TA that obtains is cloned on the pMD18-T carrier Transformed E .coli DH5 α, ammonia benzyl resistance screening positive recombinant, extracting plasmid.

2. the structure of integrative gene expression vector pEspA-Stx2B:

The stx2B fragment of EcoR I and the cutting-out of XhoI double digestion is connected on the EeoR I and XhoI window of pEspA carrier, identifies through double digestion and merge fragment, after size is correct, be converted into host bacterium E.coli BL21 (DE3).

3. the abduction delivering of fusion rotein EspA-Stx2B:

Recombinant bacterial strain is cultivated at the LB liquid nutrient medium, to bacterium liquid OD ₆₀₀About 0.6 o'clock, add IPTG to final concentration be 1mmol/L, induce different time to collect bacterium liquid.The expression rate of fusion rotein EspA-Stx2B reaches 40%.

4. the purifying of fusion rotein EspA-Stx2B:

German B.Braum 10L fermentor tank is adopted in the fermentation of reorganization bacterium, carries out according to the engineering bacterium fermentation technology of routine.Fermentation ends is collected bacterium liquid, 4 ℃, the centrifugal 15min of 8000g.Supernatant is abandoned in suction, collects bacterium, and the back of weighing is frozen standby.The resuspended bacterium of TE damping fluid with pH value 7.4, break bacterium through the high-pressure homogenization instrument, high speed centrifugation (12000G then, 4 ℃, 30min), collecting precipitation, use the TE damping fluid that contains 1%Triton * 100 respectively and contain 1M, 2M urea TE damping fluid washing inclusion body, with 8M urea dissolving inclusion body, utilize after the dialysis albumen with 6 His labels, adopt the method for affinity chromatography to carry out protein purification.The recombinant bacterial strain precipitation is behind 4 broken bacterium of high pressure homogenizer, and differential centrifugation is collected inclusion body, carries out purifying with affinity column after washing, and purity can reach 90%.Warm albumen EspA-Stx2B expression and purification effect as shown in Figure 7.

Embodiment 3 fusion expression vector pEspA expressed fusion protein EspA-IntiminC300

1.IntiminC300 gene PCR amplification:

1) according to O157:H7 (SaKai type strain) the IntiminC300 gene of finding from GenBank, utilize software Primer Premier5.0 to carry out primer design and analysis.Upstream primer P1 (SEQ IDNO:15): 5 '- GAATTCTACTTCAGCACTTA-3 ', downstream primer P2 (SEQ ID NO:16): 5 '- CTCGAGTTCTACACAAACCGCATA-3 ', 5 of P1 ' end is introduced EcoR I restriction enzyme site, and 5 of P2 ' introduces Xho I restriction enzyme site.Primer is synthetic by Shanghai Ying Jun company.

2) delivery plate 2 μ l, primer P1, P2 or P3, each 1 μ l of P4, dNTPs 4 μ l, damping fluid 5 μ l, BxTaq enzyme 0.25 μ l, distilled water 32.75 μ l, by reacting on the following PCR of the circulating in instrument: 94 ℃ of pre-sex change 5min, carry out 30 circulations according to 94 ℃ of 30s → 55 ℃ 30s → 72 ℃ of 1min, last 72 ℃ are extended 10min, and the IntiminC300 gene fragment increases respectively.

3) the IntiminC300 gene fragment TA that obtains is cloned on the pMD18-T carrier Transformed E .coliDH5 α, ammonia benzyl resistance screening positive recombinant, extracting plasmid.

2. the structure of integrative gene expression vector pEspA-IntiminC300:

The IntiminC300 fragment of EcoR I and the cutting-out of XhoI double digestion is connected on the EcoR I and XhoI window of pEspA carrier, identifies through double digestion and merge fragment, after size is correct, be converted into host bacterium E.coli BL21 (DE3).

3. the abduction delivering of fusion rotein EspA-IntiminC300:

Recombinant bacterial strain is cultivated at the LB liquid nutrient medium, to bacterium liquid OD ₆₀₀About 0.6 o'clock, add IPTG to final concentration be 1mmol/L, induce different time to collect bacterium liquid.The expression rate of fusion rotein EspA-IntiminC300 reaches 40%.

4. the purifying of fusion rotein EspA-IntiminC300:

German B.Braun 10L fermentor tank is adopted in the fermentation of reorganization bacterium, carries out according to the engineering bacterium fermentation technology of routine.Fermentation ends is collected bacterium liquid, 4 ℃, the centrifugal 15min of 8000g.Supernatant is abandoned in suction, collects bacterium, and the back of weighing is frozen standby.The resuspended bacterium of TE damping fluid with pH value 8.0, break bacterium through the high-pressure homogenization instrument, high speed centrifugation (12000G then, 4 ℃, 30min), collecting precipitation, use the TE damping fluid that contains 1%Triton * 100 respectively and contain 1M, 2M urea TE damping fluid washing inclusion body, with 8M urea dissolving inclusion body, utilize after the dialysis albumen with 6 His labels, adopt the method for affinity chromatography to carry out protein purification.The recombinant bacterial strain precipitation is behind 4 broken bacterium of high pressure homogenizer, and differential centrifugation is collected inclusion body, carries out purifying with affinity column after washing, and purity can reach 85%.Warm albumen EspA-IntiminC300 expression and purification result as shown in Figure 8.

Embodiment 4 fusion expression vector pEspA expressed fusion protein EspA-S1

1. the pcr amplification of goal gene:

1) as follows according to the coding S1 subunit gene sequences Design primer of finding from GenBank: upstream primer P1 (SEQ ID NO:17): 5 '-GTA GAATTCGACGATCCTCCC-3 ', downstream primer P2 (SEQ ID NO:18): 5 '- CTCGAGCTAGAACGAATACGCGATG-3 ', 5 of P1 ' end is introduced EcoR I restriction enzyme site, and 5 of P2 ' introduces Xho I restriction enzyme site.Primer is synthetic by Shanghai Ying Jun company.

2) being converted into the extractive plasmid of DH5 α bacterium liquid (bacterium liquid be the full gene of bordetella pertussis CS bacterial strain PT (3114bp) be connected with PGEM-T Easy cloning vector be converted into escherichia coli DH5a) with PT-PGEM is template, carry out the amplification of S1 subunit gene, the PCR reaction conditions is: 94 ℃ of sex change 0.5 minute, annealed 0.5 minute for 60 ℃, 72 ℃ were extended totally 30 circulations 1 minute.Earlier 94 ℃ of pre-sex change 3 minutes, after finishing, amplification extended 10 minutes before the amplification at 72 ℃.

3) the target gene fragment TA that obtains is cloned on the pMD18-T carrier Transformed E .coli DH5 α, ammonia benzyl resistance screening positive recombinant, extracting plasmid.

2. the structure of integrative gene expression vector pEspA-S1:

The S1 fragment of EcoR I and the cutting-out of XhoI double digestion is connected on the EcoR I and XhoI window of pEspA carrier, identifies through double digestion and merge fragment, after size is correct, be converted into host bacterium E.coli BL21 (DE3).

3. the abduction delivering of fusion rotein EspA-S1:

Recombinant bacterial strain is cultivated at the LB liquid nutrient medium, to bacterium liquid OD ₆₀₀About 0.6 o'clock, add IPTG to final concentration be 1mmol/L, induce different time to collect bacterium liquid.The expression rate of fusion rotein EspA-S1 reaches 15%.The SDS-PAGE result of fusion rotein abduction delivering as shown in Figure 9.

Studies confirm that in a large number Toxins, pertussis (PT) S1 subunit is influential to plasmid stability because of its virulent gene in the process of abduction delivering, thereby cause not expressing, and adopt fusion expression vector pEspA to efficiently express, warm expressing quantity is 15%.

Above embodiment can clearly illustrate building process and the structural information thereof of fusion expression vector pEspA of the present invention, and has proved its expression amount height, and purifying is simple, is applicable to the mass-produced advantage of recombinant protein.But above embodiment is not in order to limiting the present invention, any person of ordinary skill in the field, and without departing from the spirit and scope of the present invention, when can doing a little change and improvement, so protection scope of the present invention is as the criterion when looking the claim person of defining.

Sequence table

＜110〉Military Medical Univ No.3, P.L.A

＜120〉a kind of efficient prokaryotic expression carrier

<130>6P99020-CN

<160>18

<170>PatentIn?version?3.2

<210>1

<211>576

<212>DNA

＜213〉the proteic nucleotide sequence of coding EspA of synthetic

<400>1

atggatacat?caaatgcaac?atccgttgtt?aatgtgagtg?cgagttcttc?gacatcgacg 60

atctatgact?taggtaatat?gtcgaaggat?gaggtggtta?agctatttga?ggaactcggt 120

gtttttcagg?ctgcgattct?catgttttct?tatatgtatc?aggcacaaag?taatctgtcg 180

attgcaaagt?ttgctgatat?gaatgaggca?tctaaagcgt?caaccacggc?acaaaagatg 240

gctaatcttg?tggatgccaa?aattgctgat?gttcagagta?gcactgataa?gaatgcgaaa 300

gccaaacttc?ctcaagacgt?gattgactat?ataaacgatc?cacgtaatga?cataagtgta 360

actggtattc?gtgatcttag?tggtgattta?agcgctggtg?atctgcaaac?agtgaaggcg 420

gctatttcag?ctaaagcgaa?taacctgaca?acggtagtga?ataatagcca?gctcgaaatt 480

cagcaaatgt?cgaatacatt?aaatctctta?acgagtgcac?gttctgatgt?gcaatctcta 540

caatatagaa?ctatttcagc?aatatccctt?ggtaaa 576

<210>2

<211>6

<212>PRT

＜213〉artificial sequence

<400>2

Tyr?Ala?Pro?Gln?Asp?Pro

1 5

<210>3

<211>17

<212>DNA

＜213〉artificial sequence

<400>3

acgcgccgca?ggatcct 17

<210>4

<211>6

<212>PRT

＜213〉artificial sequence

<400>4

His?His?His?His?His?His

1 5

<210>5

<211>18

<212>DNA

＜213〉artificial sequence

<400>5

CACCACCACCACCACCAC 18

<210>6

<211>5

<212>PRT

＜213〉artificial sequence

<400>6

Asp?Asp?Asp?Asp?Lys

1 5

<210>7

<211>15

<212>DNA

＜213〉artificial sequence

<400>7

gacgacgacg?acaaa 15

<210>8

<211>40

<212>DNA

＜213〉artificial sequence

<400>8

gaattcgagc?tccgtcgaca?agcttgcggc?cgcactcgag 40

<210>9

<211>22

<212>DNA

＜213〉based on the upstream primer of espA gene design and synthetic

<400>9

ccatggatac?atcaaatgca?ac 22

<210>10

<211>33

<212>DNA

＜213〉based on the downstream primer of espA gene design and synthetic

<400>10

ggatcctgcg?gcgcgtattt?accaagggat?att 33

<210>11

<211>49

<212>DNA

＜213〉artificial sequence

<400>11

ggatcctcac?caccaccacc?accacggtac?cgacgacgac?gacaaagaa 49

<210>12

<211>59

<212>DNA

＜213〉artificial sequence

<400>12

ctcgagtgcg?gccgcaagct?tgtcgacgga?gctcgaattc?tttgtcgtcg?tcgtcggta 59

<210>13

<211>27

<212>DNA

＜213〉based on the upstream primer of EHEC 0157:H7 stx2B gene design and synthetic

<400>13

gaattcaaag?aagatgttta?tggcggt 27

<210>14

<211>27

<212>DNA

＜213〉based on the downstream primer of EHEC 0157:H7 stx2B gene design and synthetic

<400>14

ctcgaggtca?ttattaaact?gcacttc 27

<210>15

<211>20

<212>DNA

＜213〉based on the upstream primer of 0157:H7 (SaKai type strain) IntiminC300 gene design and synthetic

<400>15

gaattctact?tcagcactta 20

<210>16

<211>24

<212>DNA

＜213〉based on the downstream primer of 0157:H7 (SaKai type strain) IntiminC300 gene design and synthetic

<400>16

ctcgagttct?acacaaaccg?cata 24

<210>17

<211>21

<212>DNA

＜213〉based on the upstream primer of coding S1 subunit gene sequences Design and synthetic

<400>17

gtagaattcg?acgatcctcc?c 21

<210>18

<211>25

<212>DNA

＜213〉based on the downstream primer of coding S1 subunit gene sequences Design and synthetic

<400>18

ctcgagctag?aacgaatacg?cgatg 25

Claims (3)

1. an efficient fusion expression carrier is characterized in that containing a kind of specific nucleotide fragments, described fragment by promotor, be selected from following a) or b) the series connection of nucleotide sequence, joining region nucleotide sequence constitute, wherein a) or b) nucleotides sequence classify as:

A) the proteic nucleotide sequence of coding EspA shown in the SEQ ID NO:1;

B) because the degeneracy of genetic code is different from SEQ ID NO:1 but the amino acid sequence coded aminoacid sequence identical nucleotide sequence coded with SEQ ID NO:1; Described joining region nucleotide sequence comprises the nucleotide sequence of the Linker flexible zone aminoacid sequence of coding shown in SEQ ID NO:2 successively from 5 '-3 ' direction; The nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:4; The nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:6; Multiple clone site shown in SEQ ID NO:8.

2. efficient fusion expression carrier according to claim 1, described promotor are the T7 promotor.

3. the nucleotide sequence of prokaryotic fusion expression vector according to claim 1 and 2, the described coding Linker flexible zone aminoacid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:3; The nucleotide sequence of the aminoacid sequence of described coding shown in SEQ ID NO:4 is shown in SEQ ID NO:5; The nucleotide sequence of the aminoacid sequence of described coding shown in SEQ ID NO:6 is shown in SEQ ID NO:7.

Images