WO2005116062A1

WO2005116062A1 - Products and uses thereof

Info

Publication number: WO2005116062A1
Application number: PCT/GB2005/002067
Authority: WO
Inventors: Gadi Frankel; Valerie F. Crepin-Sevenou
Original assignee: Imperial Innovations Limited
Priority date: 2004-05-25
Filing date: 2005-05-25
Publication date: 2005-12-08
Also published as: GB0411624D0

Abstract

A recombinant polypeptide comprising an EspA polypeptide and one or more further polypeptide(s) inserted within the EspA polypeptide, wherein said recombinant polypeptide is competent to assemble into EspA filaments. Vaccines comprising a recombinant polypeptide of the invention or cells expressing a recombinant polypeptide of the invention.

Description

Products and uses thereof

The present invention relates to recombinant EspA polypeptides having one or more further polypeptides inserted within the EspA polypeptide and uses of such proteins as vaccines.

Enteropathogenic (EPEC) and enterohaemonhagic (EHEC) Escherichia coli (also refened to as Verocytotoxin producing E. coli (VTEC) and Sbiga toxigenic E. coli (STEC)) are important causes of severe infantile diarrhoeal disease in many parts of the world. EPEC and EHEC colonise the gastrointestinal mucosa and, by subverting intestinal epithelial cell function, produce a characteristic bistopathological feature known as the "attaching and effacing" (A/E) lesion. The A/E lesion is characterised by localised destruction (effacement) of brush border microvilli, intimate attachment of the bacterium to the host cell membrane and the formation of an underlying pedestal-like structure in the host cell. EPEC and EHEC are members of a family of enteric bacterial pathogens which use A/E lesion formation to colonise the host. E. coli capable of forming A/E lesions have also been recovered from diseased cattle (China et al (1999) R s Microbiol. 150(5):323-32), dog and cats (Beutin (1999) Vet Res 30(23), 285-98), rabbits (Jerse et al (1991) Infect Immun. 59(11), 3869-75) and pigs (An et al (2000) Microb Pathog. 28(5), 291-300). In mice, Citrobacter rodentium colonises gut enterocytes via A/E lesion formation and, like EPEC and EHEC in humans, causes disease in the large bowel.

Several genes (and their encoded proteins) have been implicated in A/E lesion formation and most of these map to a 35 Kbp pathogenicity island tenned the locus of enterocyte effacement or the "LEE" region (Frankel et al (1998) Mol Microbiol. 30(5), 911-21). The LEE pathogenicity island, which is present in EPEC, EHEC and C. rodentium, is necessary and in the case of EPEC sufficient for bacteria to promote the induction of A/E lesions on epithelial cells. The LEE region encodes a type III secretion S3'stem, three Translocator proteins EspA, EspB and EspD, an outer membrane adhesin, intimin, and a translocated inti in receptor, Tir, other effector proteins and chaperones.

For EHEC, EPEC and C. rodentium, intimate bacterial attachment is mediated through tight interaction between the outer membrane adhesion molecule intimin (Jerse et al. Proc Nail Acad Sci USA 1990 Oct;87(20):7839-4) and Tir, a receptor for intirnin that is delivered to the host cell plasma membrane via a type III secretion system (TTSS) (Kenny et al. Cell 1997 Nov 14;91(4):511-20).

The type III secretion system (TTSS) is a modular apparatus assembled by many pathogenic Gram-negative bacteria that acts to translocate proteins through the bacterial cell wall into the eukaryotic host cell. The conserved components of the TTSS comprise stacks of rings spamήng the inner and outer bacterial membrane and a narrow, needle-like structure projecting outwards.

It has recently been shown that one of the translocator proteins, EspA, of TTSS of EPEC and EHEC polymerizes to form an extension to the needle complex which interacts with the host cell (Daniell et al (2001) Cell Microbiol 3, 865-871). This extension is termed an "EspA filament". The 3D structure of EspA filaments suggests that the filament comprises a helical tube with a diameter of 120 A enclosing a central channel of 25 A diameter through which effector proteins may be transported (Daniell et al (2003) Mol- Microbiol 49, 301-308). The EspA filament probably interacts with the TTSS needle complex via EscF, the major structural protein of the needle complex (Wilson et al (2001) Cell Microbiol 3, 753-762). From this work it has been concluded that the EspA filament provides a hollow conduit connecting EPEC TTSS and a translocation pore in the host cell plasma membrane.

This adaptation of the TTSS system has been termed FTTSS (filamentous type III secretion system). The FTTSS s of EPEC and EHEC are structurally distinct from that of the archaetypal system observed in Shigella and most likely reflect specialization and adaptation in order to overcome the mucous barrier and a thick glycocalyx in order to communicate with the underlying intestinal enterocyte cell (Daniell et al (2001) Cell Microbiol 3, 865-871). A number of plant pathogens express another distinct TTSS where an elongated needles form a thin filamentous extension. These include the HrpA pilus of Pseudomonas syringae (Roine et al., 1997) and the HrpY pilus of Ralstonia solanacearum (Van Gijsegem et al., 2000). The poly-needle structures are likely to represent an adaptation of plant pathogens that must penetrate the plant cell wall in order to contact the plasma membrane. The HrpA pilus of Pseudomonas syringae differs morphologically from the TTSS filaments of animal pathogens and the genes encoding the pillin subunits are not conserved between the plant and animal pathogens. Hence HrpA and HrpY are not ho ologues of EspA (Li et al (2002) EMBO J 21, 1909-1915).

Genes encoding EspA proteins can be found in E. coli strains belonging to other classical EPEC (055, Oll l, 026, 0119, 0128, 0142, O103 etc) and EHEC (0157, Olll, 026, O103, etc) serogroups (Neves et al (1998) FEMS Miobiol Lett 169, 73-80).

Secondary structure prediction indicates that up to 60% of the EspA subunit protein is likely to adopt α-helical confonriations. These regions are predicted to occur throughout the sequence punctuated with short areas of β-sheet at the N- and C- tenrnni. The C-teπninus of EspA is also predicted to have a coiled-coil region. This is likely to be involved in EspA:EspA interactions since disruption of this region has a detrimental effect on" filament assembly (Delahay et al (1999) J Biol Chem 274, 35969-35974). Furthermore, pure recombinant EspA naturally forms multimeric structures of a filamentous nature (B. C. Neves, S. J. Daniell, R. M. Delahay, S. Knutton and G. Frankel, pers. corrrm.). Although examination by EM suggests that these multimers form randomly, they are immensely difficult to depolymerize, requiring treatment with phenol to obtain the rnonomeric fonri. This is indicative of the type of interactions occurring within EspA filaments during the assembly of the large, stable, polymeric structure that is assembled on the bacterial surface. It also suggests that other factors such as an EspA chaperone are necessary for the correct folding and presentation of EspA for filament assembly. Indeed, we have recently assigned an EspA chaperone function to orf3 of the LEE region (Creasey et al (2003) Microbiology 149, 3639-3647 and renamed the gene CesAB. CesAB was found to be essential for EspA stability and secretion (Creasey et al. 2003, supra). Hence it the EspA protein subunit has structural features which are critical for the formation of ordered polymeric EspA filaments.

We have found that one or more further polypeptide(s) may be inserted into the EspA polypeptide without compromising the EspA subunit' s capacity to form the polymeric EspA filaments or one of their biological functions (e.g. protein translocation). This is surprising as the correct folding and presentation of EspA polypeptide subunits is required for EspA filament assembly. We have found that fusions to either amino or carboxy terminus are biologically inactive.

As will be set out below, EspA filaments comprising chimeric EspA subunits are of particular use as vaccines and may also be used for the expression and recovery of recombinant proteins.

A first aspect of the invention provides a recombinant polypeptide comprising an EspA polypeptide and one or more further polypeptide(s) inserted within the EspA polypeptide, wherein said recombinant polypeptide is competent to assemble into EspA filaments.

The recombinant polypeptide of the invention can be prepared from a number of different sources: recombinant polypeptide can be expressed in a cell using a number of different expression systems (both prokaryotic or eukaryotic) and isolated, optionally with a protein tag. A cell can synthesise and secrete recombinant polypeptide of the invention into a supernatant and the recombinant polypeptide then purified, or the supernatant can be used directly as a source of the recombinant polypeptide. EspA filaments comprising recombinant polypeptide of the invention can be prepared from cells synthesizing said peptides. Alternatively, since cells can present recombinant polypeptide of the invention in the fonn of EspA filaments then the cells themselves can be used as a source of said recombinant polypeptide. Hence there are a number of different materials that can comprise the recombinant polypeptide of the invention.

As set out below, an aspect of the invention is a vaccine comprising a recombinant polypeptide of the invention. Therefore such a vaccine could comprise isolated recombinant polypeptide of the invention, or supernatant comprising said recombinant polypeptide, or EspA filaments comprising said recombinant polypeptide or, alternatively, a cell presenting EspA filaments comprising said recombinant polypeptide.

By "EspA polypeptide" is included any full length naturally occurring EspA polypeptide or fragment thereof, or any variant thereof, which is competent to assemble into EspA filaments, as will be discussed further below. The term "EspA" is well known to those skilled in the art, and includes a polypeptide which is a secreted protein from enteropathogenic or enterohemonhagic E. coli and has a molecular mass of about 25 kDa as determined by SDS-PAGE. It is considered to be necessary for activating epithelial cell signal transduction, intimate contact and formation of A/E lesions.

Examples of naturally occurring EspA polypeptides are given in the following: WO 97/40063; Genbank accession numbers Y13068, U80908, Z54352, AJ225021, AJ225020, AJ225019, AJ225018, AJ225017, AJ225016, AJ225015, AF022236, AF200363, NP_312583 (EspA EHEC O157:H7), AAC38394 (EspA EPEC O126:H6), CAC81874 (026), CAA12349 (O55:H6), CAA12348 (Olll), CAA12346 (O119:H2), CAA12347 (O119:H6), AAC38394 (0127), CAA12350 (O55:H7), CAA12351 (0128), CAA73506, AAC31501, AAG58820, D91198 (0157), AAL57554 (Rabbit EPEC strain 015:H-), AAK26727 (Rabbit EPEC strain 015:H-), AAC82358 (Rabbit EPEC strain O103:H2:K-), AAO66617 (O49:H12)₅ AAF26454 (strain 4221, Dog E. coli), CAA74172 (Strain 413/89-1), AAC99337 (strain 1390). A further EspA polypeptide may be found at Genbank accession number AAL06381 (Citrobacter rodentium). Searching databases may identify further EspA polypeptides suitable for use in the first aspect of the invention. For example, BLAST searching (http ://www.ncbi.nlm.nih. gov/BLAST/) may identify other EspA polypeptides that, as would be appreciated by a person skilled in the art, may be suitable for use in the first aspect of the invention.

We also include homologues of EspA that are present on other bacterial species. For example, an important EspA homologue exists in pathogenicity island 2 of Salmonella sp.: SseB AAC28879 (Salmonella typhimurim), AAL20322 (Salmonella typhimurim LT2), NP_457066 (Salmonella typhi CT18), AAO68045 ((Salmonella typhi Ty2). These polypeptides are also included within the scope of the term "EspA polypeptide". However, HrpA and Hrp Y are not considered to be EspA polypeptides for the purpose of this invention, since, as mentioned above, the genes encoding these polypeptides are not homologous to genes encoding EspA polypeptides .

An EspA polypeptide suitable for use in the first aspect of the invention may have at least 50%, 60% to 70%, 70% to 80%, 80 to 90% or 90 to 95% sequence identity with a naturally occurring EspA polypeptide sequence, for example as given in one of the listed accession numbers above (for example in AAC38394 (EspA EPEC 0126:H6) or AAL06381 (Citrobacter rodentium).

A "variant" will have a region which has at least 50% (preferably 60,70, 80,90, 95 or 99%ι) sequence identity with an EspA polypeptide as described herein or in the references indicated above, as measured by the Bestfit Program of the Wisconsin Sequence Analysis Package, version 8 for Unix. The percentage identity may be calculated by reference to a region of at least 50 amino acids (preferably at least 60, 75, or 100) of the candidate variant molecule, and the most similar region of equivalent length in the intimin sequence, allowing gaps of up to 5%.

The percent identity may be determined, for example, by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (Nucl. Acids res. 12:387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the alignment method of Neddleman and Wunsch (J. Mol. Biol. 48:443, 1970), as revised by Smith and Waterman (Adv. Appl. Math 2.482. 1981). The preferred default parameters for the GAP program include : (1) a comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Bribskov and Burgess, Nucl. Acids Res. 14:6745, 1986 as described by Schwarts and Dayhoff, eds, Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.

As mentioned above, the recombinant polypeptide of the first aspect of the invention is competent to assemble into EspA filaments. By 'EspA filaments' we mean a filament comprising three or more EspA subunit polypeptides. Preferably, the recombinant polypeptide of the first aspect of the invention is competent to assemble into EspA filaments comprising 10, 20, 50, 100, 200, 500 or several thousand such EspA subunits.

There are a number of ways to determine whether a recombinant polypeptide is competent to assemble into EspA filaments. The recombinant polypeptide may be introduced into a strain of EPEC lacking native EspA polypeptide, termed ΔespA. Fluorescent staining and negative stain can then be used to determine whether the recombinant ΔespA strain has any EspA filaments: presence of the EspA filaments indicates that the recombinant polypeptide can produce EspA filaments.

The in vitro functional activity of the recombinant polypeptide can be determined by measuring the ability of a bacterial ΔespA strain comprising the recombinant polypeptide of the first aspect of the invention to induce A/E lesion formation (determined by the FAS test), translocate effector proteins and induce haemolysis of red blood cells. These phenotypes are a good indication of the recombinant EPEC strain having functional EspA filaments. Finally, in vivo functional activity of the recombinant polypeptide can be determined by introducing the recombinant polypeptide into a strain of Citrobacter rodentium lacking EspA. The ability of the recombinant ΔespA strain comprising the recombinant polypeptide of the first aspect of the invention to colonise mice is a measure of the biological function of the EspA filaments in vivo.

By 'inserted within' we mean that the further polypeptide is placed internal to the natural N- or C- terminal regions of the EspA polypeptide, as would be appreciated by a person skilled in the art.

Methods of producing a recombinant polypeptide of the first aspect of the invention will be well known to those skilled in the art. For example, a DNA molecule encoding an EspA polypeptide suitable for use in the first aspect of the invention can be modified to also include a DNA molecule encoding a 'further polypeptide'. Such DNA modification can be performed by standard molecular biology techniques, for example vector-based cloning using restriction enzymes or PCR, as discussed in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2001. 3rd edition.

Once such a DNA molecule has been prepared it is straightforward to use the DNA molecule to prepare recombinant polypeptide of the first aspect of the invention, as would be appreciated by a person skilled in the art. Examples of how a recombmant polypeptide of the first aspect of the invention may be prepared from such a DNA molecule are provided in further aspects of the invention and in Example 1 below.

In an embodiment of this aspect of the invention the EspA polypeptide is an E. coli EspA polypeptide. Examples of such polypeptides include those polypeptides mentioned above. A further preferred embodiment of this aspect of the invention is wherein the EspA polypeptide is an EPEC or EHEC polypeptide. Examples of such polypeptides are mentioned above in relation to this aspect of the invention.

A still further embodiment of this aspect of the invention is wherein the EspA polypeptide is:

mdtsttasva sanaststsm aydlgs skd dvidlfnklg vfqaailmfa ymyqaqsdls iakfadmnea skesttaqkm anlvdakiad vqsssdknak aqlpdevisy indprnditi sgidninaql gagdlqtvka aisakannlt ttvnnsqlei qqmsntlnll tsarsdmqsl qyrtisgisl gk

as provided in Genbank accession number AAC38394 (EPEC 0127).

mdtstmtsva gasaststsm tydlgsmske kvielfakvg vfqaallmfe ymf aqsels iakfadmnea skasitaqk anlvdakiad vqsssdknak aklpqevidy isdsrnsitv sgisdlaael sagdlqtvka sisakannlt ttvdnsrldi qqmtntlnll tsarsdiqsl qyrtvsaipi gk

as provided in Genbank accession number AAL06381 (Citrobacter rodentium).

Suitable fragments or variants of these EspA polypeptides are also included in the above embodiments of the invention.

A further embodiment of this aspect of the invention is wherein said further polypeptide is inserted within a variable domain. Preferably, the further polypeptide is inserted within a hypervariable domain.

Sequence alignment of EspA polypeptides from different strains reveals that the both carboxy and amino termini are highly conserved while the central region (amino acids 95 to 128) is variable (Neves et al., (1998) FEMS Microbiol Lett 169 73-80; Fig. 2). Within this variable region we identified a hyper variable region (amino acids 117-128). The hypervariable region is an important determinant of EspA antigenicity and can tolerate insertion of polypeptides without compromising the capacity of the EspA polypeptide to assemble into EspA filaments (see Example 1). Hence they are preferred sites for the insertion of further polypeptides as part of the recombinant polypeptide of this aspect of the invention.

A further embodiment of this aspect of the invention is wherein said further polypeptide is inserted at a position equivalent to 117 to 126 amino acids from the N-terminus of an EspA polypeptide provided in Genbank accession number AAC38394.

A further embodiment of this aspect of the invention is wherein said further polypeptide is inserted 117 amino acids from the N-terminus of the EspA polypeptide provided in Genbank accession number AAC38394.

A further embodiment of this aspect of the invention is wherein said further polypeptide is inserted 126 amino acids from the N-terminus of the EspA polypeptide provided in Genbank accession number AAC38394.

For example, the structure of the recombinant polypeptide of the invention may comprise:

mdtsttasva sanaststsm aydlgs skd dvidlfnklg vfqaailmfa ymyqaqsdls iakfadmnea skesttaqkm anlvdakiad vqsssdknak aqlpdevisy indprnd - further polypeptide - itisgidnina qlgagdlqtv kaaisakann ltttvnnsql eiqqmsntln lltsarsdmq slqyrtisgi slgk

i.e. 117 amino acids from the N-tenninus of the EspA polypeptide provided in Genbank accession number AAC38394.

Alternatively, the recombinant polypeptide of the invention may comprise: dtsttasva sanaststsm aydlgsmskd dvidlfnklg vfqaailmfa ymyqaqsdls iakfadmnea skesttaqkm anlvdakiad vqsssdknak aqlpdevisy indprnditi sgidni- further polypeptide - naq lgagdlqtvk aaisakannl tttvnnsqle iqqmsntlnl ltsarsdmqs lqyrtisgis lgk

i.e. 126 amino acids from the N-terminus of the EspA polypeptide provided in Genbank accession number AAC38394.

Equivalent positions for the insertion of the further polypeptide in other EspA polypeptides that can be used in the first aspect of the invention will be easily derivable for the person of skill in the art. An alignment of EspA amino acid sequences from different EPEC serotypes is presented in Figure 2.

For example, where the EspA polypeptide is that provided in Genbank accession number AAL06381, then the structure of the recombinant polypeptide of the invention may comprise:

mdtstmtsva gasaststsm tydlgsmske kvielfakvg vfqaallmfe ymfhaqsels iakfadmnea skasitaqkm anlvdakiad vqsssdknak aklpqevidy isdsrns - further polypeptide - itvsgisdla aelsagdlqt vkasisakan nltttvdnsr ldiqqmtntl nlltsarsdi qslqyrtvsa ipigk

i.e. 117 amino acids from the N-terminus of the porypeptide sequence of AAL06381.

Alternatively, the recombinant polypeptide of the invention may comprise:

mdtstmtsva gasaststsm tydlgsmske kvielfakvg vfqaallmfe ymfhaqsels iakfadmnea skasitaqkm anlvdakiad vqsssdknak aklpqevidy isdsrnsitv sgisdl - further polypeptide - a aelsagdlqt vkasisakan nltttvdnsr ldiqqmtntl nlltsarsdi qslqyrtvsa ipigk i.e. 126 amino acids from the N-terminus of the polypeptide sequence of AAL06381.

The recombinant polypeptides set out above in relation to the first aspect of the invention may comprise further amino acids which have been introduced into the polypeptide as a consequence of the methods used to prepare a polynucleotide encoding the polypeptide. For example, the amino acid sequence set out in section 4 of Example 1 below has a 'DV amino acid insertion as part of the further polypeptide sequence.

A further embodiment of this aspect of the invention is wherein a section of the EspA polypeptide is deleted.

As mentioned above, hypervariable region of EspA can tolerate insertion of polypeptides without compromising the capacity of the EspA polypeptide to assemble into EspA filaments. Also, a section of the amino acid sequence in this region of EspA can be deleted since this region of the EspA polypeptide does not seem to play an important role in EspA filament assembly.

For example, amino acids 123 to 129 (e.g. amino acids IDNINAQ of the EspA polypeptide provided in Genbank accession number AAC38394) of the EspA polypeptide may be replaced.

This embodiment of the invention includes where the deleted section of the EspA polypeptide is replaced with one or more further polypeptides.

The 'further polypeptide' of the first aspect of the invention may be any polypeptide that does not prevent the EspA polypeptide from assembling into EspA filaments.

An embodiment of the first aspect of the invention is wherein the further polypeptide is antigenic. A further embodiment of this aspect of the invention is wherein the further polypeptide disrupts the native antigenicity of the EspA polypeptide. A still further embodiment of this aspect of the invention is wherein the recombinant polypeptide comprises the antigenicity of the further polypeptide.

We have found that one or more further polypeptide(s) inserted within the EspA polypeptide may destroy the native antigenicity of EspA filaments comprised of the recombinant polypeptide of the invention, and may also generate new antigenic activity.

For example, an insertion of a further polypeptide at 117 amino acids from the N- terminus of the polypeptide sequence given in AAC38394 destroys the native antigenicity of EspA filaments comprised of the recombinant polypeptide of the invention, but may not confer the antigenicity of the further polypeptide on the EspA filaments. That is, EspA filaments comprising recombinant polypeptides of the invention may not have an epitope recognised by an antibody to EspA filaments or an antibody to the further polypeptide.

In contrast an insertion of a further polypeptide at 126 amino acids from the N- terminus of the polypeptide sequence given in AAC38394 destroys the native antigenicity of EspA filaments comprised of the recombinant polypeptide of the invention and does confer the antigenicity of the further polypeptide on the EspA filaments. That is, an antibody to EspA filaments does not recognise EspA filaments comprising recombinant polypeptides of the invention, but an antibody to the further polypeptides does recognise the recombinant EspA filaments. Hence EspA filaments comprising recombinant polypeptide of the invention comprise the antigenicity of the further polypeptide.

Therefore it is possible to select whether you wish an EspA filament to have the antigenicity of the further polypeptide or to have an antigenicity which is neither the antigenicity of the further polypeptide or of a native EspA filament. Alternatively, as demonstrated in Example 3, a recombinant polypeptide of the invention may retain the native antigenicity of EspA filaments when one or more further polypeptide(s) are inserted within the EspA polypeptide at position 117 or 126 amino acids from the N-terminus of the polypeptide sequence given in AAC38394. That is, an antibody to EspA filaments may recognise EspA filaments comprising recombinant polypeptides of the invention.

Furthermore, as also demonstrated in Example 3, an insertion of one or more further polypeptide(s) at 117 or 126 amino acids from the N-terminus of the polypeptide sequence given in AAC38394 may confer the antigenicity of the further polypeptide on the EspA filaments. That is, an antibody to the further polypeptide(s) may recognise EspA filaments comprising recombinant polypeptides of the invention.

Therefore it is possible that EspA filaments comprising recombinant polypeptides of the invention having one or more further polypeptide(s) inserted at 117 or 126 amino acids from the N-terminus of the polypeptide sequence given in AAC383 4 can have the antigenicity of an EspA filament and the further polypeptide(s).

A further embodiment of this aspect of the invention is wherein the recombinant polypeptide may have one or more further polypeptide(s) inserted at 117-and 126 amino acids from the N-tenninus of the polypeptide sequence given in AAC38394.

A further embodiment of this aspect of the invention is wherein the further polypeptide is a viral, bacterial or animal antigen or a viral or bacterial pathogen antigen. Examples of such antigens are influenza or RSV antigen, Mycobacterium tuberculosis antigen or Lawsonia intracellularis antigen.

Further examples of bacterial antigens that may be of use in this embodiment of the invention include antigens derived from Pestivirus Classical Swine Fever, Foot and Mouth Disease (FMD) or Rotta Virus. Further examples of bacterial antigens that may be of use in this embodiment of the invention include antigens derived from Salmonella sp., Mycobacterium sp., Brucella sp., Lawsonia sp. and E. coli sp, for example strain ETEC as discussed above.

In addition to the viral, bacterial or animal antigens discussed above, the recombinant polypeptide of this aspect of the invention may comprise an antigenic further polypeptide derived from unicellular or multicelmlar parasitic organisms, for example Cryptosporidium sp. of protozoa.

Polypeptides that encode antigenic regions of these organisms are well known to those skilled in the art and nonetheless may be easily identified from publications.

For example, relevant antigens that may be used in these embodiments of the invention include epitopes from influenza virus, e.g. TYQRTRALV, or epitopes from RSV, e.g. AICI RIPNKKPGKKT (called RSV-G epitope) or SYIGSINNI

(called RSV-M2 epitope), all of which may be inserted 126 amino acids from the N-terminus of the EspA polypeptide and still allowed the assembly of EspA polypeptides into biologically active filaments.

A further embodiment of this aspect of the invention is wherein the further polypeptide comprises two or more antigens.

The further polypeptide may contain more than one antigen. These may be antigens from the same organism (eg two different antigens from influenza virus or RSV, or Mycobacterium tuberculosis Lawsonia intracellularis bacterial pathogens). Alternatively, the antigens may be from a combination of different organisms.

hi this way, the recombinant polypeptide of the invention could assemble into EspA filaments having a range of different antigenicities. The further polypeptide may be of any size. Preferably, the polypeptide is between 4 and 100 amino acids, or 6 and 70 amino acids, or 6 and 50 amino acids. In a further embodiment of this aspect of the invention the further polypeptide comprises between 6 and 17 amino acids.

The recombinant polypeptide of the invention may also be used as part of a protein expression system. This is because an EspA filament comprised of recombinant polypeptides of the first aspect of the invention will have a large number of copies of EspA subunits and, hence, a large number of copies of 'further polypeptides'. Therefore, by preparing EspA filaments having recombinant polypeptides of the first aspect of the invention and subsequently isolating the recombinant polypeptides from the EspA filaments, it is also possible to isolate a large number of copies of the 'further polypeptide'.

To aid the recovery of purified 'further polypeptides' from EspA subunits and filaments, a further embodiment of the first aspect of the invention is wherein the further polypeptide is linked with the EspA polypeptide via one or more cleavable linker(s). The cleavable linker may be a self-splicing linker, for example an intein, or may be a polypeptide sequence which is recognised and cleaved by a protease, for example Factor Xa cleavage sequence, or Proteinase K sequence, as would be appreciated by a person of skill in the art. Hence, the 'further polypeptide' can be readily isolated from the EspA polypeptide.

A second aspect of the invention is a polynucleotide encoding a recombinant polypeptide according to any of the previous claims.

The polynucleotide may be DNA or RNA. Preferably, the polynucleotide is DNA.

The DNA molecule will encode an EspA polypeptide suitable for use in the first aspect of the invention and a further polypeptide. Examples of DNA molecules that encode EspA polypeptides of use in the first aspect of the invention are given in the above Genbank accession numbers. We also include fragments and variants of such DNA molecules that encode EspA polypeptides competent to assemble into EspA filaments.

The DNA molecule that encodes the 'further polypeptide' will vary depending on what further polypeptide is to be inserted into the EspA polypeptide to produce the recombinant polypeptide of the first aspect of the invention.

Methods of producing a recombinant polynucleotide of the second aspect of the invention are well known to those skilled in the art. Examples of such methods are discussed in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2001. 3rd edition and also discussed in Example 1 below.

A third aspect of the invention is a vector suitable for expressing a polypeptide in a host cell comprising a polynucleotide according to the second aspect of the invention.

A DNA polynucleotide of the second aspect of the invention may be used in accordance with known techniques, appropriately modified in view of the teachings contained herein, to construct an expression vector.

Generally, the DNA is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression. If necessary, the DNA may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognised by the desired host, although such controls are generally available in the expression vector. Thus, the DNA insert may be operatively linked to an appropriate promoter. Bacterial promoters include the E.coli lad and lacZ promoters, the T3, T5 and T7 promoters, the tac and araBAD promoters, the tet promoter, the gpt promoter, the phage λ PR and PL promoters, the phoA promoter and the tip promoter. Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters and the promoters of retro viral LTRs. Other suitable promoters will be known to the skilled artisan. The expression constructs will desirably also contain sites for transcription initiation and teπnination, and in the transcribed region, a ribosome binding site for translation. (Hastings et al, International Patent No. WO 98/16643, published 23 April 1998)

Suitable prokaryotic expression vectors include recombinant bacteriophage, plasmid or cosmid DNA expression vectors, as would be appreciated by a person of skill in the art. Examples of such vectors include the pET, pBAD, pACYC, pKK177-3, pBR322, pQE vectors and pGEMEX vectors (Promega Corp). Further commercial expression vectors that may be used in this aspect of the invention will be well known to those of skill in the art.

Suitable eukaryotic expression vectors include yeast expression vectors; insect cell systems transformed with, for example, viral expression vectors (eg. baculo virus); plant cell systems transfected with, for example viral or bacterial expression vectors; animal cell systems transfected with, for example, adenovirus expression vectors. Examples of such vectors include pSI and pCI mammalian expression vectors (Promega Corp). A typical mammalian cell vector plasmid is pSVL available from Pharmacia (Piscataway, NJ, USA). This vector uses the SV40 late promoter to drive expression of cloned genes, the highest level of expression being found in T antigen- producing cells, such as COS-1 cells. An example of an inducible mammalian expression vector is pMSG, also available from Pharmacia (Piscataway, NJ, USA). This vector uses the glucocorticoid-inducible promoter of the mouse mammary tumour virus long teiininal repeat to drive expression of the cloned gene.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding sequence and, for example appropriate transcriptional or translational controls. One such method involves ligation via homopolymer tails. Homopolymer polydA (or polydC) tails are added to exposed 3' OH groups on the DNA fragment to be cloned by terminal deoxynucleotidyl transferases. The fragment is then capable of annealing to the polydT (or polydG) tails added to the ends of a linearised plasmid vector. Gaps left following annealing can be filled by DNA polymerase and the free ends joined by DNA ligase.

Another method involves ligation via cohesive ends. Compatible cohesive ends can be generated on the DNA fragment and vector by the action of suitable restriction enzymes. These ends will rapidly anneal through complementary base pairing and remaining nicks can be closed by the action of DNA ligase.

A further method uses synthetic molecules called linkers and adaptors. DNA fragments with blunt ends are generated by bacteriophage T4 DNA polymerase or E.coli DNA polymerase I which remove protruding 3 ' termini and fill in recessed 3' ends. Synthetic linkers, pieces of blunt-ended double-stranded DNA which contain recognition sequences for defined restriction enzymes, can be ligated to blunt-ended DNA fragments by T4 DNA ligase. They are subsequently digested with appropriate restriction enzymes to create cohesive ends and ligated to an expression vector with compatible termini. Adaptors are also chemically synthesised DNA fragments which contain one blunt end used for ligation but which also possess one preformed cohesive end.

Synthetic linkers containing a variety of restriction endonuclease sites are commercially available from a number of sources including International Biotechnologies Inc, New Haven, CN, USA.

A desirable way to modify the DNA encoding the polypeptide of the invention is to use the polymerase chain reaction as disclosed by Saiki et al (1988) Science 239, 487-491. In this method the DNA to be enzymatically amplified is flanked by two specific oligonucleotide primers which themselves become incorporated into the amplified DNA. The said specific primers may contain restriction endonuclease recognition sites which can be used for cloning into expression vectors using methods known in the art. A fourth aspect of the invention is an EspA filament comprising a recombinant polypeptide according to any of the previous claims.

The recombinant polypeptide of the first aspect of the invention will assemble into EspA filaments when produced by a suitable host cell. It is possible to then purify EspA filaments from the host cell and the culture medium in which the cell was grown, using, for example, a method set out in Daniell et al (2003) Mol Microbiol 49, 301-308. Briefly, host cells producing EspA filaments of the fourth aspect of the invention are collected by centrifugation at 5000 g for 10 minutes at 4°C and resuspended in lOOμl of PBS (phosphate buffered saline, see Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2001. 3rd edition for information as to how to prepare this solution). The EspA filaments are then sheared from the bacteria by passage through a 25 gauge needle. Bacteria were removed by centrifugation.

A fifth aspect of the invention is a cell comprising a recombinant polypeptide according to the first aspect of the invention and/or a polynucleotide according to the second aspect of the invention and/or a vector according to the third aspect of the invention and/or an EspA filament according to the fourth aspect of the invention.

The recombinant polypeptide and EspA filaments can only be produced by a cell once the cell contains the polynucleotide according to the second aspect of the invention and/or a vector according to the third aspect of the invention.

The cell can be either prokaryotic or eukaryotic. Bacterial cells are preferred prokaryotic cells and typically are a strain of E. coli such as, for example, the E. coli strains XLl-Blue (supplied by Stratagene), TOP 10 (supplied by Invitrogen), DH5 (available from Bethesda Research Laboratories Inc., Bethesda, MD, USA) and RR1 (available from the American Type Culture Collection (ATCC) of Rockville, MD, USA (No ATCC 31343)), as well as EPEC and EHEC pathogenic strains. The strains can be of human or animal (including, for example mice, rabbits, dogs, cats, pigs, goats) origin and includes those pathogens inducing attaching/effacing lesions.

Preferred eukaryotic cells include yeast and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human fibroblastic cell line. Yeast cells include YPH499, YPH500 and YPH501 which are generally available from Stratagene Cloning Systems, La Jolla, CA 92037, USA. Preferred mammalian cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NTH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658, and monkey kidney-derived COS-1 cells available from the ATCC as CRL 1650. Preferred insect cells are Sf9 cells which can be transfected with baculovirus expression vectors.

In an embodiment of this aspect of the invention the cell is a prokaryotic cell.

In a further embodiment of this aspect of the invention the cell is an extracellular pathogen. Examples of such cells are E. coli, V. cholerae, C. botulinum, C. rodenium. Preferably the cell is a strain of E. coli, more preferably EHEC or EPEC.

Examples of strains of E. coli that may be used in this aspect of the invention include serotype 026, O5, 0118, 0138:H48, 0136, H-, 028:H9, O110:H2 and O52:H12. These strains are naturally either Shiga toxin positive or. negative; recombinant polypeptide of the invention will be expressed primarily in Shiga toxin negative strains (either natural or lab-engineered mutants), and are of particular use in relation to the method of the seventh aspect of the invention, as discussed below.

As mentioned above, the cell may be a pathogen. Preferably, if the cell is a pathogen then it is an attenuated pathogen. By 'attenuated' we mean that the capacity of the cell to be pathogenic has been reduced or removed. Further cell strains that may be used in this aspect of the invention include strains where, if appropriate, the gene encoding the native EspA polypeptide has been deleted, i.e. ΔespA strains of Citrobacter rodentium, ΔespA E. coli EPEC/EHEC (various serotypes as mentioned above) or strains of these cells that have deletions in further type III section system genes, for example Map, EspG, EspF, EspH, Cifi Espl and translocators such as EspB. Further cell types that may be used include strains that have mutations in flagellar genes such as fliC. As set out below, such cells may be of particular use in preparing attenuated pathogens to be used in the seventh aspect of the invention.

EspA polypeptides from one strain of cells can functionally replace the native EspA in a further strain of cell. For example, EPEC EspA can functionally replace the native EspA of EHEC and Citrobacter rodentium. Therefore, a recombinant polypeptide according to the first aspect of the invention can be expressed in a range of cells strains and is not restricted to the strain from which the EspA polypeptide component is derived.

A further embodiment of this aspect of the invention is wherein the cell does not comprise a gene encoding a native EspA polypeptide. Hence a preferred embodiment of this aspect of the invention is wherein the cell is an attenuated pathogen and a gene encoding a native EspA polypeptide has been deleted.

A further embodiment of this aspect of the invention is wherein the cell comprises a polynucleotide or vector that encodes, or the EspA filament comprises, an antigenic recombinant polypeptide.

A further aspect of this aspect of the invention is wherein the cell also comprises an EspA chaperone polypeptide. Examples of such chaperones include CesAB (Creasey et al (2003) Microbiology 149 (12), 3639-3647; examples of such polypeptides are presented in Genbank accession numbers AAC38366, NP_312613, AAL06351). It is straightforward for a person of skill in the art to prepare a cell line expressing CesAB using the methods discussed above. Transfonnation of appropriate cell hosts with a DNA construct of the present invention is accomplished by well known methods that typically depend on the type of vector used. With regard to transfonnation of prokaryotic cells, see, for example, Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69, 2110 and Sambrook et al (2001) Molecular Cloning, A Laboratoiy Manual, 3^r Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Transfonnation of yeast cells is described in Sherman et al (1986) Methods In Yeast Genetics, A Laboratoiy Manual, Cold Spring Harbor, NY. The method of Beggs (1978) Nature 275, 104-109 is also useful. With regard to vertebrate cells, reagents useful in transfecting such cells, for example calcium phosphate and DEAE-dextran or liposome formulations, are available from Stratagene Cloning Systems, or Life Technologies Inc., Gaithersburg, MD 20877, USA.

Electroporation is also useful for fransforming cells and is well known in the art for fransforming yeast cell, bacterial cells and vertebrate cells.

For example, many bacterial species may be transformed by the methods described in Luchansky et al (1988) Mol. Microbiol. 2, 637-646 incorporated herein by reference. The greatest number of fransformants is consistently recovered following electroporation of the DNA-cell mixture suspended in 2.5X PEB using 6250V per cm at25μFD.

Methods for transformation of yeast by electroporation are disclosed in Becker & Guarente (1990) Methods Enzymol 194, 182.

Physical methods may be used for introducing DNA into animal and plant cells. For example, microinjection uses a very fine pipette to inject DNA molecules directly into the nucleus of the cells to be transformed. Another example involves bombardment of the cells with high- velocity microprojectiles, usually particles of gold or tungsten that have been coated with DNA. The polynucleotide of the third aspect of the invention can also be integrated into a bacterial chromosome. This may or may not replace any native gene encoding an EspA polypeptide. Methods by which polynucleotides can be inserted into a bacterial chromosome are well known to those skilled in the art and include homologous recombination. This method can also be used to replace the native gene encoding EspA polypeptide with a polynucleotide encoding a recombinant polypeptide according to the first aspect of the invention.

Successfully transformed cells, ie. cells that contain a DNA construct of the present invention, can be identified by well known techniques. For example, one selection technique involves incorporating into the expression vector a DNA sequence (marker) that codes for a selectable trait in the transfonned cell. These markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture, and tetracyclin, kanamycin, nalidixic acid, chloramphenicol or ampicillin resistance genes for culturing in E.coli and other bacteria. Alternatively, the gene for such selectable trait can be on another vector, which is used to co-transform the desired cell.

The marker gene can be used to identify transfonnants but it is desirable to determine which of the cells contain recombmant DNA molecules and which contain self- ligated vector molecules. This can be achieved by using a cloning vector where insertion of a DNA fragment destroys the integrity of one of the genes present on the molecule. Recombinants can therefore be identified because of loss of function of that gene.

Another method of identifying successfully transformed cells involves growing the cells resulting from the introduction of an expression construct of the present invention to produce the polypeptide or EspA filament of the invention. Cells can be harvested and lysed and their DNA content examined for the presence of the DNA using a method such as that described by Southern (1975) J. Mol. Biol. 98, 503 or Berent et al (1985) Biotech. 3, 208. Alternatively, the presence of the protein in the supernatant can be detected using antibodies. In addition to directly assaying for the presence of recombinant DNA, successful transformation can be confirmed by well known immunological methods when the recombinant DNA is capable of directing the expression of the protein. For example, cells successfully transformed with an expression vector produce proteins displaying appropriate antigenicity. Samples of cells suspected of being transformed are harvested and assayed for the protein using suitable antibodies.

Thus, in addition to the transformed cells themselves, the present invention also contemplates a culture of those cells, preferably a monoclonal (clonally homogeneous) culture, or a culture derived from a monoclonal culture, in a nutrient medium.

A sixth aspect of the invention is a method of producing a recombinant polypeptide according to the first aspect of the invention comprising:

a) providing a suitable host cell comprising a vector according to the third aspect of the invention; and,

b) expressing said vector in said host cell so as to produce the recombinant polypeptide; and, optionally,

c) recovering said recombinant polypeptide from the host cell and/or the medium in which the host cell is grown.

By 'suitable host cell' we include those cells mentioned above in relation to the fifth aspect of the invention that can be used to express the recombmant polypeptide of the first aspect of the invention.

For example, stram EPEC 0126:H7 (E2348/69) which is ΔEspB, ΔEspD and lacks the genes encoding effector proteins may be of particular use in preparing soluble recombinant polypeptide of the first aspect of the invention. Strain EPEC EPEC 0126:H7 (E2348/69) which is ΔEspB and lacks the genes encoding effector proteins may be of particular use in preparing EspA filaments. Furthermore, the strains could be ΔespA so that all EspA polypeptide produced by the cell, including EspA filaments, is recombinant polypeptide of the first aspect of the invention and there is no native EspA.

Methods of introducing a vector according to the third aspect of the invention into a suitable host cell are disclosed above in relation to the fifth aspect of the invention. Hence these methods can be used to prepare a suitable host cell for this aspect of the invention.

Host cells that have been transformed with a vector according to the third aspect of the invention are then cultured for a sufficient time and under appropriate conditions, as would be known to those skilled in the art, to permit the expression of the recombinant polypeptide of the first aspect of the invention in the cell.

The recombinant polypeptide of the first aspect of the invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.

Alternatively, the polypeptide of the first aspect of the invention may not be recovered from the supernatant. In this case, the host cell is removed from the supernatant by simple centrifugation as would be appreciated by a person skilled in the art. The recovered supernatant comprising polypeptide of the first aspect of the invention may be used directly in some further aspects of the invention, as set out below. A further embodiment of this aspect of the invention is wherein the recombinant polypeptide of the first aspect of the invention is recovered from optional step c) in the form of EspA filaments. Methods of purifying EspA filaments from host cells expressing the recombinant polypeptide of the first aspect of the invention are discussed above in relation to the fourth aspect of the invention and also in Daniell et al (2003) Mol Microbiol 49, 301-308.

A seventh aspect of the invention is a method of preparing an attenuated pathogenic cell according to the fifth aspect of the invention comprising:

a) providing a suitable attenuated pathogenic cell comprising a vector according to the third aspect of the invention; and,

b) expressing said vector in said cell so as to produce a recombinant polypeptide; and, optionally,

c) recovering said cell from the medium in which the cell is grown.

By 'suitable host cell' we include those cells mentioned above in relation to the fifth aspect of the invention that can be used to express the recombinant polypeptide of the first aspect of the invention; for example an attenuated strain of EHEC or EPEC may be used. This includes cells that further comprise a CesAB chaperone and cells that are ΔespA so that all EspA polypeptide produced by the cell, including EspA filaments, is recombinant polypeptide of the first aspect of the invention and there is no native EspA.

Examples of attenuated bacteria strains that may be used in this method of the invention include strains that are stx^" and may also contain a mutation in one or more genes encoding effector proteins so as to modulate the capacity of the cell to colonise a host. Different strains of the host cell can be used depending on the intended use of the recovered cell. For example, different strains of EHEC colonise different regions of the gut, so different strains may be used depending on the epitope and where in the gut they will be most effective. Also, different strains may be used when the host cell is to be used for a human or animal purpose.

Preferably, the cell used in this method of the invention is a Shiga toxin (also known as Vero cytotoxin) negative strain; for example, E. coli strains 026, 05, 0118, 0138:H48, 0136, H-, 028:H9, O110:H2 and 052:H12. The Shiga toxin negative strain may be a natural strain or a strain that is a laboratory-engineered to be toxin negative.

Host cells that have been transformed with a vector according to the third aspect of the invention are then cultured for a sufficient time and under appropriate conditions known to those skilled in the art to permit the expression of the recombmant polypeptide of the first aspect of the invention.

Methods of recovering cells from a cell culture are well Icnown to those skilled in the art and are disclosed in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2001. 3rd edition.

A further embodiment of the methods of the sixth and seventh aspects of the invention is wherein said vector encodes an antigenic recombinant polypeptide as disclosed in the first aspect of the invention.

A further embodiment of this aspect of the invention is wherein a gene encoding a native EspA polypeptide has been deleted from said suitable attenuated pathogenic cell used in these methods of the invention. An eighth aspect of the invention is vaccine comprising a recombinant polypeptide according to the first aspect of the invention wherein the further polypeptide is antigenic and/or a recombinant polypeptide obtained by the method of the sixth aspect of the invention wherein the further polypeptide is antigenic and/or an EspA filament according to the fourth aspect of the invention and/or an EspA filament obtained by the method of the sixth aspect of the invention.

A ninth aspect of the invention is a vaccine comprising an attenuated pathogenic cell having an antigenic recombinant polypeptide and/or an EspA filament according to the fifth aspect of the invention, or an attenuated pathogenic cell having an antigenic recombinant polypeptide and/or an EspA filament obtained by the method of the seventh aspect of the invention.

A vaccine according to the eighth or ninth aspects of the invention may comprise a recombinant polypeptide of the invention obtained in a number of different ways.

For example, the said recombinant polypeptide can be expressed in a cell using a number of different expression systems (both prokaryotic or eukaryotic) and isolated, optionally with a protein tag. Hence the vaccine would comprise the said recombinant polypeptide.

Alternatively, a cell can synthesis and secrete said recombinant polypeptide into a supematant and the recombinant polypeptide then purified, or the supernatant can be used directly as a source of the recombinant polypeptide. Hence the vaccine would comprise the said recombinant polypeptide purified from a cell supernatant or the supernatant itself.

A further alternative is where a cell produces EspA filaments comprising said recombinant polypeptide. Here the EspA filaments can be isolated from the cell (as described above) and used directly in a vaccine. Finally, the vaccine can comprise a cell presenting recombinant polypeptide of the invention in the fonn of EspA filaments. The cell can be any of the cells mentioned above. Of particular interest is wherein the cell is an attenuated pathogen, as is set out below.

As mentioned above, we have found that one or more further polypeptide(s) inserted within the EspA polypeptide may destroy the native antigenicity of EspA filaments, and may also generate new antigenic activity. Therefore the vaccines of the eighth and ninth aspects of the invention comprise recombinant polypeptides that have a different antigenic activity than native EspA polypeptides or filaments. This different antigenicity is a function of the antigenic nature of the 'further polypeptide' and therefore the use of the vaccine according to these aspects of the invention can depend on the nature of the 'further polypeptide'.

Examples of 'further polypeptides' are provided in relation to the first aspect of the invention and include viral, bacterial or animal antigens or a viral or bacterial pathogen antigens. Examples of such antigens are influenza or RSV antigen; Mycobacterium tuberculosis antigen or Lawsonia intracellularis antigen; antigens derived from Pestivirus Classical Swine Fever, Foot and Mouth Disease (FMD) or Rotta Virus; antigens derived from Salmonella sp., Mycobacterium sp., Brucella sp., Lawsonia sp. and E. coli sp., for example strain ETEC as discussed above; antigens derived from unicellular or multicellular parasitic organisms, for example Cryptosporidium sp. of protozoa.

Hence the vaccine according to the eighth or ninth aspects of the invention may comprise any of the antigens mentioned herein.

For example, the vaccine may comprise an attenuated pathogenic cell having a recombmant polypeptide including an antigen from Mycobacterium tuberculosis. This vaccine may be used to prevent or treat tuberculosis. An advantage of using such a vaccine over presently used vaccines is that the attenuated pathogenic cell may be an extracellular pathogen, for example a Shiga toxin negative strain of E. coli, and hence the vaccine cannot spread systemically throughout the animal body. Furthermore, the Shiga toxin negative strain of E. coli mentioned above present the antigenic recombinant polypeptide of the invention at mucosal surfaces in the animal.

The vaccine may be used to prevent or treat disorders in both humans and other animals, for example, cows, sheep, horses, pigs, cats, dogs, goats or any other mammalian species.

The type of attenuated pathogenic cells to be used in the vaccine according to the invention may be selected with regard to the purpose for the vaccine. For example, where the vaccine is to be used in pigs, then the attenuated pathogenic cell can be that which is native to pigs, eg E. coli strain 0145. In addition, where the vaccine is to be used in cattle, then the attenuated pathogenic cell can be that which is native to cattle, eg E. coli strain 026 or 0157. Preferably the stram of attenuated pathogenic cell to be used would be a strain that is native to animals but are presently unknown to cause human disease.

The recombinant polypeptides used in the vaccines of the eighth or ninth aspects of the invention may be presented as supernatant comprising the recombinant polypeptide, as mentioned above in relation to the sixth aspect of the invention.

It is particularly preferred that the attenuated pathogenic cell used in the vaccine according to the ninth aspect of the invention is ΕPΕC or ΕHΕC. These bacteria colonise mucosal surfaces while remaining extracellular (unlike Salmonella sp.). The bacteria also target the Peyer's Patch, which is where antigens are presented to the immune system. Hence these cells should present ΕspA filaments comprising antigenic further polypeptides to the immune system. As such, we consider that they would be useful components of vaccines.

Such a vaccine would offer considerable advantages over present vaccines based on attenuated pathogens. On reason is because the ΕspA filament is a critical component of the pathogenicity of the cell, and, hence, there is a selective pressure on the cell maintaining the polynucleotide encoding the recombinant polypeptide. This offers an advantage to flagella-based antigen presenting vaccines. Furthermore, as set out above, extracellular pathogenic cells cannot spread systemically throughout the animal body, unlike vaccines based on intracellular Salmonella pathogens.

An example of a vaccine that is particularly preferred is a cell obtained from the method of the seventh aspect of the invention comprising a recombinant polypeptide of the first aspect of the invention, wherein the cell is an attenuated pathogen and is ΔespA.

The vaccine may be used, for example to treat a herd of cattle or a population of pigs to immunise the animals against infection by a pathogen that has serious health or financial implications. For example, a population of pigs may be immunised with an attenuated pathogenic cell comprising a recombmant polypeptide of the invention in which the further polypeptide is a Lawsonia intracellularis antigen. Such a vaccine may prevent the pigs developing enteropathy.

Alternatively, the vaccine may be used prevent or treat a human disorder. For example, humans may be treated with an attenuated pathogenic cell comprising a recombinant polypeptide of the invention in which the further polypeptide is a Mycobacterium tuberculosis antigen. Such a vaccine may prevent aid the recovery of a human subj ect from tuberculosis.

A further embodiment of the eighth or ninth aspects of the invention is wherein the vaccine further comprises an adjuvant. Suitable adjuvants that may be used hi these aspects of the invention are BCG or alum. Other suitable adjuvants include Aquila's QS21 stimulon (Aquila Biotech, Worcester, MA, USA) which is derived from saponin, mycobacterial extracts and synthetic bacterial cell wall mimics, and proprietary adjuvants such as Ribi's Detox. Quil A, another saponin-derived adjuvant, may also be used (Superfos, Denmark). Other adjuvants such as Freund's may also be useful.

A tenth aspect of the invention is a pharmaceutical composition comprising a vaccine according to the eighth and ninth aspects of the invention and a pharmaceutically acceptable carrier.

Whilst it is possible for vaccine as described herein to be administered alone, it is preferable to present it as a pharmaceutical fonnulation, together with one or more acceptable carriers. The carrier(s) must be "acceptable" in the sense of being compatible with the vaccine and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free.

The pharmaceutical composition may further comprise a component for increasing the antigenicity and/or immungenicity of the vaccine, for example an adjuvant and/or a cytokine. A polyvalent antigen (cluster of antigens) may be useful.

Nasal sprays may be useful formulations.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of phannacy. Such methods include the step of bringing into association the vaccine with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by unifonnly and intimately bringing into association the vaccine with liquid carriers or finely divided solid earners or both, and then, if necessary, shaping the product.

Fonnulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the vaccine; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion.

Formulations suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

An eleventh aspect of the invention is a recombinant polypeptide according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention, an EspA filament according to the fourth aspect of the invention, a cell according to the fifth aspect of the invention, a vaccine according to the eighth or ninth aspects of the invention or a pharmaceutical composition according to the tenth aspect of the invention for use in medicine.

A twelfth aspect of the invention is the use of a recombinant polynucleotide according to the first aspect of the invention comprising a Mycobacterium tuberculosis antigen or a polynucleotide or vector according to the second aspect or third aspects of the invention when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to the fifth, eighth, ninth or tenth aspects of the invention when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of tuberculosis.

A thirteenth aspect of the invention is the use of a recombinant polynucleotide according to the first aspect of the invention comprising a Lawsonia intracellular is antigen or a polynucleotide or vector according to the second aspect or third aspects of the invention when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to the fifth, eighth, ninth or tenth aspects of the invention when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of enteropathy.

A fourteenth aspect of the invention is the use of a recombinant polynucleotide according to the first aspect of the invention comprising a influenza antigen or a polynucleotide or vector according to the second aspect or third aspects of the invention when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to the fifth, eighth, ninth or tenth aspects of the invention when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of influenza.

A fifteenth aspect of the invention is the use of a recombinant polynucleotide according to the first aspect of the invention comprising a RSV antigen or a polynucleotide or vector according to the second aspect or third aspects of the invention when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to the fifth, eighth, ninth or tenth aspects of the invention when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of any disorder caused by RSV infection.

All documents referred to herein are, for the avoidance of doubt, hereby incorporated by reference. The invention is now described by reference to the following, non-limiting, figures and examples.

Figure Legends

Figure 1: Antibodies to recombinant EspA polypeptide of EPEC recognise EspA filaments on the EPEC cell surface, but do not cross react with EspA filaments of EHEC.

Figure 2: Sequence alignment of EspA polypeptides from different strains.

Figure 3: FLAG tag at position 117 amino acids from the N-terminus of EspA

Figure 4: Anti EspA antiserum does recognise the FLAG tagged EspA filaments on EPEC cell surface.

Figure 5: A second insertion site of the FLAG epitope within EspA.

Figure 6: Anti EspA antiserum does not recognise the second FLAG tagged EspA filaments but anti FLAG antibodies do stain the FLAG tagged EspA filaments.

Figure 7. Identification of variable and hypervariable regions within EspA. (a) Sequence alignments of EspA amino acid 77 to 138, from EPEC-0127:H6, EPEC-055:H6, EPEC-055:H7 and EHEC-0157:H7 (9,40,54). Amino acids highlighted in dark grey are identical; light grey shows conserved residue substitutions. The star marks the serine 109 position of EPEC 0127:H6. The alignment was performed using ClustalW from the DNAssist program, (b) Schematic representation of the variable and hypervariable regions (HV1 and HV2) within EspA with the corresponding EPEC and EHEC amino acids sequences, (c) Resulting amino acid sequences after deletion 1 (EspA_ΔHVi_> pICC322) and deletion 2 (ES A_ΛH ₂, pICC321), ithin the EspA hypervariable regions. Deleted amino acids are shown in italic whereas bold caps show amino acids inserted during the cloning procedure, (d) Resulting amino acid sequences following insertion of the Flag tag sequence (DYKDDDDK, shown in bold) between amino acids 117 and 118 (EspAn_7-fl_ag-πs, pICC323) or 126 and 127 (EspA_126-flag-127, pICC324).

Figure 8. Immunofluorescence staining of EspA filaments and fluorescent actin staining (FAS) test (53). (a) HEp-2 cells were infected with either UMD872(pICC317) or UMD872(pICC316), which express ESPA_EPE_C→EHE_C-_HVI and ESPAE_PE_C→_EH_EC-H_V2, respectively. Filaments were detected on the surface of both bacterial strains using ESPA_EP_EC an ESPAEHEC antisera. Both strains produce a positive FAS assay. Expression and secretion of EspA proteins in bacterial cells (P) and concentrated culture supernatants (SN) was monitored by Western blotting using rabbit polyclonal EspA antiserum. (b) HEp-2 cells were infected with either UMD872(pICC318), UMD872(pICC320) or UMD872(pICC319), expressing EspA_Sιo9D, EspA_slo9D-EPEC→EHEC-Rvι and EspAsιo9D-EPEC→EHEC-HV2, respectively. Filaments were detected on the surface of UMD872(pICC318) using both ESPA_EPE_C and ESPA_EH_EC antisera whereas for strains UMD872(pICC320) and UMD872(pICC319), filaments could only be labelled using the EspA_EHEc antiserum. All strains produce a positive FAS assay and EspA expression was detected by Western blotting using rabbit polyclonal EspA antiserum. (c) HEp-2 cells were infected with either wild-type EPEC (E2348/69) or EHEC (85-170) strains. EspA filaments could only be labelled on the surface of the bacteria using their corresponding ESPAEPE_C or ESPAEHEC antisera. The magnification bar represents 0.5 μm.

Figure 9. Iminunofluorescence staining of EspA filaments and FAS assays. HEp- 2 cells were infected with either UMD872(pICC322) or UMD872(pICC321), expressing ESPA_ΛH I and ESPA_ΛH 2, respectively. ESPAEPE_C antiserum was used to label EspA filaments. UMD872(pICC322) produces functional EspA filaments as shown by actin polymerisation underneath the bacteria whereas no filaments or actin accumulation could be observed for UMD872(pICC321). The magnification bar represents 0.5 μm. Expression and secretion of the EspA_ΔHvι and EspA_ΔHV2 proteins in bacterial cells (P) and concentrated culture supernatants (SN) was monitored by Western blotting using rabbit polyclonal EspA antiserum.

Figure 10. Hydropathic profile plot of EspA (analysis program available at http://www.bip.weizmann.ac.il). The X-axes show amino acid positions for the respective proteins. The Y-axes show regions of hydrophilicity (0 to 4) and hydrophobicity (0 to —4) within the proteins, (a) Hydropathic profile of ESPA_EPE_C with enlargement of the region between amino acid 90 and 145. Double-headed closed and open arrows show the positions where tags 117-flag-l 18 and 126-flag- 127, respectively, will be inserted, (b) Hydropathic profile of EspAiπ-fiag-πs, with enlargement of the region between amino acid 90 and 153 of the EspAπ _-fi_ag-118 protein. The double-headed closed arrow shows broadening of the peak where 117-flag-l 18 tag has been inserted compared to the peak (double-headed closed arrow) in native ESPAEPEC- (C) Hydropathic profile of EspAι 6-fia_g-i27, with enlargement of the region between amino acid 90 and 153 of the EspAι _6-flag-ι ₇ protein. The double-headed open arrow shows broadening of the peak where 126- flag- 127 tag has been inserted compared to the peak (double-headed open arrow) in native ESPAEPEC-

Figure 11. EspA and FAS staining, (a) HEp-2 cells were infected with either UMD872(pICC323) or UMD872(pICC324), expressing EspA_117-flag-1ι₈ and EspA₁₂6-_fiag-i2₇₅ respectively and EspA filaments detected on the surface of bacterial strains using ESPAEPEC commercial Flag or EspAiπ.flag-πs antisera. EspAιπ.fiag-118 and EspAι₂6-fiag-i27 filaments were recognised by all three antibodies and both strains produced a positive FAS assay, (b) HEp-2 cells were infected with either wild-type EPEC (E2348/69) or EHEC (85-170) strains. No EspA filaments were observed with either commercial Flag or EspAπ _-fi_ag-ιi₈ antisera. The magnification bar represents 0.5 μm.

Example 1. Production of a recombinant polypeptide comprising EspA and one or more further polypeptides. Introduction

In a previous study we have shown that antibodies raised against recombinant EspA polypeptide of EPEC recognised the mature EspA filaments on the EPEC cell surface, but do not cross react with EspA filaments of EHEC (Neves et al (2003) Infect Immun 71(4) 2262-2265; Fig. 1). The converse was also correct in that antibodies made against recombinant EspA EHEC reacted with intact EHEC EspA filaments but did not cross-react with EspA filaments of EHEC.

We sought to determine the molecular basis of the lack of cross reactivity. Sequence alignment of EspA polypeptides from different strains revealed that the both carboxy and amino termini are highly conserved while the central region (a ino acids 95 to 128) is variable. Within this variable region we have identified a hyper variable region (amino acids 117-128) (Neves et al., (1998) FEMS Microbiol Lett 169 73-80; Fig. 2). We hypothesised that the hyper variable region determines the antigenicity of the filaments.

1. A polynucleotide encoding an EspA polypeptide with a FLAG epitope at amino acid position 117 from the N-terminus

We have incorporated into the EspA sequence a FLAG tag at position 117 amino acids from the N-terminus (Fig. 3).

A recombinant polypeptide encoding EspA polypeptide with a FLAH epitope was synthesised using overlapping PCR.

A first pair of primers [NcoLEspA-forw (5' -CAT GCC ATG GAT ACA TCA

'ACT ACA GCA TC-3', Ncol site is underlined), EspA-Flagl l7-rev (5'-AAT TTT ATC ATC ATC ATC TTT ATA ATC GTC ATT GCG AGG ATC ATT

TAT ATA TG-3', Flag tag sequence is in bold)] was used to amplify DΝA encoding the 117 amino acids from Ν-tenninus of the EspA pofypeptide (Genbank AAC38394), using a reverse primer which sequence contains a Flag tag (DYKDDDDK) fused in 3' of those 117 amino acids.

A second pair of primers [EspA-Flagl l7-forw (5'-GAC GAT TAT AAA GAT GAT GAT GAT AAA ATT ACA ATA AGT GGT ATT GAC-3', Flag tag sequence is in bold), EspA-Bglll-rev (5'-GAA GAT CTT TAT TTA CCA AGG GAT ATT CCT G-3', BgKl site is underlined)] was used to amplify DNA encoding 75 amino acids in C-terminus of the EspA polypeptide (Genbank AAC38394), using a forward primer which sequence contains a Flag tag (DYKDDDDK) fused in 5 ' of those 75 amino acids.

The amplification of the two fragments was carried out using PCR conditions of: 30 cycles of denaturation (1 min at 94 °C), annealing (1 min at 58 °C), and extension (1 min at 74 °C using Deep Vent from New England Biolabs). Amplified fragments were gel -purified and an equal quantity of each mixed together. The DNA mix was then denatured at 100 °C for 10 min and the reaction allowed to cool slowly at room temperature. Deoxynucleoside triphosphate, Klenow, Klenow buffer and water were added to make a reaction to a final volume of 20 μl. The reaction mix was incubated at 37 °C overnight to allow synthesis of double stranded DNA. The whole fragment (encoding an EspA filament containing a Flag tag inserted between amino acid 117 and 118) was then PCR amplified using NcoI-EspA-forw / EspA-Bglll-rev primers, Ncol / 2?g II digested and cloned into Ncol / BgHl digested pB AD-myc/his C vector to produce pB AD-EspA Flagl 17 vector.

2. Assay for biological activity of an EspA polypeptide with a FLAG epitope at position 117

In order to assay the biological activity of this recombinant polypeptide (EspA with a FLAG tag inserted after amino acid 117), the pBAD-EspA Flagl 17 vector was transfonned into^' electrocompetent UMD872 cells (EPEC strain- E2348/69 ΔEspA, Kenny et al. Molecular Microbiology (1996), 20(2), 313-323). The UMD872 / pBAD-EspA Flagl 17 EPEC bacterial strain was then used to infect HEp2 cells and look at pedestal formation using the Fluorescent Actin Staining method (FAS, Knutton et al., (1989) Infection and Immunity 57: 1290-8). A FAS positive assay indicates the capacity of the strain to form A/E lesions and therefore the ability of the recombinant polypeptide to complement the EspA mutation of the UMD872 strain.

Insertion of the FLAG tag into EspA at 177 amino acids from the N-terminus did not affect filament fonnation or function. EspA filaments were still able to mediate protein translocation into infected using the method described above.

The FLAG epitope destroyed the antigenicity of the filaments so that anti EspA antiserum did not recognise the tagged EspA filaments on the EPEC cell surface (Fig. 4). However, anti FLAG antiserum also failed to recognise the recombinant EspA filament.

3. EspA polypeptide with further epitopes at amino acid position 117

We then inserted further epitopes at amino acid position 117 of EspA.

Epitope: Amino acid sequence

4 histidines tag (4 aa): HHHH -6 histidines tag (6 aa) : HHHHHH 10 histidines tag (10 aa): HHHHHHHHHH

VSV-G tag (ll aa): YTDIEMNRLGK ^'

HA tag (9 aa): YPYDVPDYA c-myc tag (10 aa) : EQKLISEEDL

The synthesis of the recombinant polypeptides (EspA, Genbank AAC38394, with 4 histidines insertion after aa 117; EspA, Genbank AAC38394, with 6 histidines insertion after aa 117; EspA, Genbank AAC38394, with 10 histidines insertion after aa 117; EspA, Genbank AAC38394, with VSV-G tag insertion after aa 117; EspA, Genbank AAC38394, with HA tag insertion after aa 117; EspA, Genbank AAC383 4, with c-myc tag insertion after aa 117) was performed as described in section 1 using specific primers detailed in table 1 and 2.

Table 1

Table 2

Primers name Nucleotide sequence (5' to 3') (tag sequence in bold, restriction site underlined)

NcoI-EspA- CAT GCC ATG GATACATCAACTACA GCATC forw

EspA-Pstl-rev AAA CTG CAGTTATTTACCAAG GGATATTCC

EspA-Bglll- GAA GAT CTT TAT TTA CCA AGG GAT ATT CCT G rev

EsρA-4hisll7- AATATG GTGATGGTGGTCATT GCGAGGATC ATTTAT rev ATATG

EspA-6hisll7- AATATGGTGATGGTGATG GTGGTCATT GCGAGGATC rev ATTTATATATG

EspA- AATATGGTGATGGTGATG GTGATG GTGATGGTG 10hisll7-rev GTCATT GCGAGGATCATTTATATATG

EspA- AAT CTT ACC CAG GCG GTT CAT TTC GAT ATC AGT VSVG117-rev GTA GTCATT GCGAGGATCATTTATATATG

EspA-HA117- AAT AGC GTA GTC TGG GAC GTC GTA TGG GTA GTC rev ATT GCG AGG ATC ATT TAT ATA TG

EspA-c- AAT CAGATC TTC TTC AGA AAT AAGTTT TTGTTC GTC mycll7-rev ATT GCG AGG ATC ATT TAT ATA TG

EspA-4hisll7- GAC CAC CAT CAC CATATTACAATAAGT GGTATT GAC forw

EspA-6hisll7- GAC CAC CAT CAC CAT CAC CAT ATTACAATAAGT GGT forw ATT GAC

EspA- GAC CAC CAT CAC CAT CAC CAT CAC CAT CAC CATATT 10hisll7- forw ACAATAAGT GGTATT GAC

The EspA porypeptides having histidine, VSV-G, HA and c-myc epitope tags (which vary in size between 4 and 11 amino acids) gave similar results to that of the EspA-FLAG polypeptide discussed in the previous section. Hence the EspA polypeptide can tolerate insertion into the hypervariable region of the polypeptide at amino acid position 117 from the N-terminus without affecting it biological activity. The insertion disrupts the native antigenicity of the EspA polypeptide and also that of the epitope.

4. EspA polypeptide with a FLAG epitope inserted at amino acid position 126 from the N-te minus

We prepared a polynucleotide encoding an EspA polypeptide with an FLAG epitope at position 126 using the PCR-based method described in above section 1. The PCR primers used are shown in Table 3.

Table 3

We also prepared a polynucleotide molecule encoding an EspA polypeptide with an FLAG epitope at position 126 using an inverse-PCR technique. Here the pBAD-EspA Flagl26 vector was used as template in the PCR reaction. The PCR primers used are shown in Table 4.

Table 4

The primers were designed to introduced a restriction site (AatU gacgtc, in 3 ' of the tag) into the self-ligated inverse-PCR product, which was used as a selective marker to differentiate specific PCR products from the others. DNA amplification was carried out throught 30 cycles of denaturation (1 min at 94 °C), annealing (1 min at 60 °C), and extension (6 min at 74 °C, using Deep Vent from New England Biolabs). The PCR product was then used in a kinase reaction in order to add a phosphate at the 5' extremities of the PCR product, which will be required for self-ligation of the product. The recombinant polypeptide will be:

mdtsttasva sanaststsm aydlgsmskd dvidlfnklg vfqaailmfa yrtryqaqsdls iakfadmnea skesttaqkm anlvdakiad vqsssdknak aqlpdevisy indprnditi sgidni- further polypeptide - DV naq lgagdlqtvk aaisakannl tttvnnsqle iqqmsntlnl Itsarsdmqs lqyrtisgis lgk ' i.e. 126 amino acids from the N-terminus of the EspA polypeptide provided in

Genbank accession number AAC38394. 'DV is an Aatll site inserted by the reverse-PCR method.

Insertion of the FLAG tag in this position did not affect EspA filament fonnation or •function as detennined using the methods set out above in section 2.

Antibody to EspA filaments failed to recognise the EspA filaments comprising an EspA polypeptide having a FLAG epitope at amino acid position 126. However, anti FLAG antibodies did stain the tagged EspA filaments on the bacterial cell surface (Fig. 6). These results demonstrate that the EspA polypeptide can tolerate insertion into the hypervariable region of the pofypeptide at amino acid position 126 from the N- terminus without affecting it biological activity. The insertion disrupts the native antigenicity of the EspA polypeptide, however the antigenicity of the further polypeptide is conferred on the recombinant EspA polypeptide.

Hence these results show that we can display peptides on the EspA filaments that are presented on the surface and accessible for antibodies.

EspA polypeptide with further epitopes at amino acid position 126

We then inserted influenza and RSV-derived epitopes at amino acid position 126 of EspA.

Epitope: Amino acid sequence:

Influenza epitope: TYQRTRALV RSV epitopes : AICKRLPNKKPGKKT (called RSV-G epitope)

SYIGSINNI (called RSV-M2 epitope)

We prepared a polynucleotide molecule encoding an EspA polypeptide with influenza or RSV epitopes at position 126 using the inverse-PCR technique set out in section 4 above. The pBAD-EspA Flagl 26 vector was used as template in the PCR reaction. The PCR primers used are shown in Table 5.

Table 5

The insertion of influenza and RSV epitopes having sizes of 9 and 15 amino acids at position 126 of the EspA polypeptide were tolerated by the EspA polypeptide, i.e. the EspA polypeptide retained its competency to assemble into biologically active EspA filaments.

Example 2: Use of a vaccine comprising a recombinant polypeptide of the invention.

An attenuated pathogenic cell according to the invention is prepared such that the cell comprises a recombinant polypeptide having an antigen derived from Lawsonia intracellularis. The attenuated pathogenic cell is a strain of E. coli common to pigs.

A vaccine is prepared comprising the attenuated pathogenic cell having the said antigen. The vaccine is administered to pigs that have, or are at risk of developing, enteropathy caused by Lawsonia intracellularis. The pigs subsequently have a reduced probability of developing enteropathy or show an increased probability of recovery from the disorder.

Example 3. Molecular basis of antigenic polymorphism of EspA filaments: development of a peptide display technology.

We further investigated whether the hyper^' variable region determines the antigenicity of EspA filaments and the possible application of EspA filaments for peptide display. The data generated are set out below.

Introduction Type III secretion systems (TTSSs) are macromolecular proteinaceous structures commonly found on the surface of Gram-negative pathogens and used to inject virulence factors into target eukaryotic cells (1). Enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli, two important human enteric pathogens (2,3), use the TTSS to translocate effector proteins involved in colonisation of the mucosal surfaces via formation of distinct attaching and effacing (A/E) lesions. A/E lesions are characterised by localised destruction of brush border microvilli and intimate attachment of the extra-cellular bacteria to the host cell plasma membrane (4,5). In addition, the translocated effectors induce drastic re-organisation of host cell cytoskeletal actin micrpfilament (5), microtubule (MT) (6) and intermediate filament (IF) networks (7,8). The structural EPEC and EHEC TTSS proteins and several effectors are encoded by a pathogenicity island termed the locus of enterocyte effacement (LEE) (9,10); a number of type III effectors that are carried on prophages and translocated by the LEE-encoded TTSS have recently been identified (11).

The TTSS apparatus is a multi-component channel assembled from the products of approximately 20 genes, which are conserved wilhin Gram-negative pathogens. The morphology of the TTSS apparatus (termed the needle complex, NC) of Salmonella, Shigella, and EPEC has been observed by electron microscopy (12- 15). The TTSS NC resembles the architecture of the hook-basal body complex of flagellar TTSSs (16-18). Both the NC and the basal body consist of a succession of inner and outer membrane protein rings connected via a periplasmic lipoprotein (19-22), which constitute the base from which a needle-like extension or flagellar hook extend beyond the bacterial membranes (16,18).

.A unique feature of EPEC and EHEC TTSSs is the presence of a hollow filamentous extension to the NC called the EspA filament (23,24), which binds • directly to the EscF needle (25). EspA filaments are homo-polymer made of the translocator protein EspA (26,27), although a second translocator protein, EspD, is essential for EspA filament biogenesis (23). In the same way that the NC and hook-basal body are closely related structures, the three-dimensional structure of EspA (26) and flagellar (28) filaments are comparable. Although the two filaments differ in size (outer diameter of c. 120 and 240 A, inner central channel of c. 25 and 20 A for EspA and flagellar filament, respectively), the helical symmetry and packing of the subunits fonning the filamentous structures are very similar. - Moreover, elongation of both flagellar and EspA filaments occurs at the tip of the growing structures (29,30).

Flagellin is organised into four linearly connected domains named DO, Dl, D2 and D3 (28); antigenic polymorphism within the D3 domain of flagellin fonns the basis to flagellar filament H serotypes (31). Similarly, EspA filaments from different EPEC and EHEC clones show antigenic polymorphism, e.g. polyclonal antisera raised against recombinant EspA polypeptide from EPEC 0127:H6 reacted specifically with EspA filaments from this and related strains while no immunological cross-reactivity was observed with , EspA filaments from other strains including EHEC 0157:H7; likewise, ESPAE_HEC antiserum reacted with the homologous EspA filaments but did not recognise EspA filaments of EPEC 0127:H6 (32). The aims of this study were to determine the molecular basis of the antigenic polymorphism of EspA filaments and to exploit this information for development of an EspA filament-based peptide delivery system.

RESULTS

Sequence analysis:, identification of a hypervariable region within EspA

Multiple amino acid sequences alignment from different EHEC and EPEC serotypes revealed that while the N-tennini (amino acids 1 to .98, numbering based on the E2348/69 (0127:H6) EspA sequence) and C-termini (amino acids 132 to 192) of EspA are conserved (85%) and 95% identity respectively, between EPEC 0127:H6 and EHEC 0157:H7), the central region (amino acids 99 to 131) is variable (59% identity) (Fig. ^• 7a-b) and could resemble the surface-exposed D3 domain of flagellin 28. Within the variable region, hypervariable region_. HV2 (amino acid 117 to 129) and HV1 (amino acid 123 to 129) seem to tolerate even greater amino acid variability (30%) and 14% identity, respectively). Recent structure characterisation of EspA in complex with its chaperone CesAB showed the central region of EspA as unstructured and likely to constitute the hydrophilic surface-exposed loop 33.

Antigenic exchange of ESPA_EPEC into ESPAEHEC In order to test the hypothesis that the central region of EspA is responsible for the antigenic polymorphisms between EspA filaments, i.e. lack of cross -reactivity between ESPA_EPEC and ESPA_EH_EC immune sera (32), we replaced both HV2 and HV1 of ESPA_EPE_C with the respective ESPAEHEC sequences generating EspA_EPEC→EHEC-HV2 and EspA_EpEC-EHEC-Hvι, respectively (Fig. 7b). The modified espAzp _C genes were cloned in plasmid pSAlO under the IPTG inducible Ptαc promoter generating plasmids pICC316 (ESPAEPEC->EHEC-HV2) and pICC317 (ESPAE_PE_C-_→EHE_C-HV_I) (Table 6). Each construct was then transformed into UMD872 (E2348/69 espA mutant) and expression of the modified EspA proteins was confirmed by Western blotting (Fig. 8a).

Detection of EspA filaments by immuno-fluorescence staining was done using ESP E_PEC and ESPA_EH_EC immune sera following infections of HEp-2 cells with UMD872(pICC316), UMD872(pICC317), EPEC and EHEC (Fig. 8a and 8c); this was done because EspA filaments are stabilised and easily detected once they are engaged with plasma membranes. Unexpectedly, EspA filaments formed by ESPAE_PE_C-_→EHEC-HV2 and ESPAEPEC-→EHEC-HVI were recognised by both antisera (Fig. 8 a) whereas wild type EspA_EpEC and ESPAEHEC filaments were exclusively recognised by their respective antisera (Fig. 8c). These results show that both hypervariable regions, although not sufficient for total antigenic swap, contribute to antigenic specificity.

In order to identify additional sequences that might contribute to the antigenic . polymorphism, we searched the alignment for other amino acid changes. We ^' noted that position 109 is occupied by serine in ESPAEPEC-_OI27_:H₆ and its closely related serotype EspA_EPEc-os5:H6, while in ESPAEHEC-OI₅7:H7 and EspA_EpEC-055:H7

(which is believed to be the ancestor of EHEC 0157:H7, (34)) this position is occupied by aspartate (Fig. 7a- 7b). Accordingly, a S109D .substitution was _.

^' introduced . into each of the native espA^p^c, spAB?EC→ΕHEC-HV2 and

clones, generating plasmids pICC318 espAswm), pICC319 (ejpi_Si09D-EPEC→EHEC-HV2) and pICC320

(Table 6). The constructs were transformed into UMD872 and protein expression confirmed by Western blotting (Fig. 8b). Using EspA_EPEc and EspA_EHEc immune sera for immuno-fluorescence staining f infected Hep-2 cells revealed that substituting S 109 to D 109 in the native ESPAE_PEC resulted in dual antigenicity of the EspA_Sιo_9D filament as it was recognised by both EPEC and EHEC antisera (Fig. 8b). However, combining the S109D substitution with the swap of HV2 or HVl resulted in a total conversion of the antigenicity of EspA_Ep_Ec into ESPAEHE_C-

These results elucidated the molecular basis of EspA filaments antigenic polymorphism.

The hypervariable region is dispensable for EspA filament biogenesis hi order to investigate the role the hypervariable domains might play in EspA filament assembly, the nucleotides encoding HV2 (amino acids ITISGIDNINAQ -

were deleted from the gene sequence (Fig 7c), generating plasmids pICC321 and pICC322, respectively (Table 6). The constructs were transformed into UMD872 and secretion of truncated proteins confirmed by Western blotting (Fig. 9). In order to determine if ESPA_ΛH 2 and ESPA_ΛHV_I can polymerise into biologically active filaments, Hep-2 cells were infected with UMD872(pICC321) and UMD872(pTCC322) and EspA filament staining was performed using EspA_Ep_Ec immune sera (Fig 9). In parallel, FAS tests were carried out to assess if EspA filaments assembled from the truncated proteins were capable of protein translocation. Although deletion of the FfV2 had a detrimental effect on EspA filament polymerisation, as observed by the formation of abortive filaments on the bacterial surface, and hence on actin accumulation underneath the attached bacteria, deletion of HVl was tolerated as EspA_ΔHVi protein polymerised to form typical and biologically active EspA filaments (Fig. 9)_; These results show that the six amino acids constituting HVl are dispensable for EspA filament biogenesis and function while the larger, 12 amino acids, deletion is not permissive.

Insertion of peptide sequences into the EspA hypeiyariable region The crystal structure of the CesAB-EspA complex showed that the variable region forms a hydrophilic, surface exposed, loop (33). In flagellin, the loop responsible for antigenicity has been targeted for insertion of foreign epitopes for mucosal delivery via live attenuated bacteria (35,36). We therefore investigated if EspA would tolerate insertions into its variable region. In order to select an appropriate insertion site the hydrophobicity / hydrophilicity properties of the variable region (Fig. 10a) was analysed according to the Kyte-Doolittle hydrophobicity scale (37). As a result Dl 17/1118, located within HV2 (Fig. 7d), was selected as an insertion site for the hydrophilic Flag tag sequence (DYKDDDDK) since the hydrophobicity plot of EspAiπ-fiag-ns only differs from native EspA by an enlarged, pre-existing, hydrophilic region (Fig. 10b). The recombinant espAπ_7- i_ag- ₁₁₈ was cloned into plasmid pSAlO (generating plasmid pICC323, Table 6), transformed into UMD872 and expression of the protein confirmed by Western blotting (data not shown). HEp-2 cells were infected with UMD872(pICC323) and fonnation of EspA filaments monitored by immuno-fluorescent staining using

EspA_Ep_EC ήnmune sera and commercial Flag monoclonal antibodies.

UMD872(pICC323) produced EspAπ _-flag-118 filaments that were recognised by the ESPA_EP_EC immune sera (Fig. Ila). In addition, ^• commercial anti-Flag antibodies specifically labelled the recombinant filaments, while the native ESPAE_PE_C or EspA_EHEc filaments, used as negative controls, were not labelled (Fig. lib). However, although UMD872(pICC323) produced biologically active^' filaments (as concluded from a positive FAS test result), they appear shorter than wild-type filaments, which could result from EspAiπ-aag-πs being less stable than wild-type EspA filaments. These results provide proof of principle for the peptide _. ^■ display ability of EspA filaments although the selected insertion site might not be optimal.

In order to optimise the stability and display of heterogeneous peptides on the surface of EspA filaments, a second insertion site, between amino acids, 1126 and N127 (Fig. 7d), was tested in silico and showed broadening of a pre-existing hydrophilic region (Fig. 10c). The recombinant espAizβ-ύ_ag-m was cloned into pSAlO (generating ρICC324 plasmid, Table 6), fransfonned into UMD872 and expression of the protein was confirmed by Western blotting (data not shown). Following infection of HEp-2 cells with UMD872(pICC324) formation of EspAi₂₆-_fi_ag-i₂₇ filaments was determined by immuno-fluorescent staining using ESPA_EPEC immune sera and the commercial Flag antibodies (Fig. Ila). Both ESPAE_PE_C and commercial anti-Flag antibodies labelled EspAι₂6-fiag-i27 filaments; the labelling and filament length being superior to the one observed with espAnn- _flag-ii₈. These results show that foreign epitopes inserted into the HVl region are better tolerated and displayed.

Various other epitope tags, including 6, 8, or 10 X Histidine, HA, c-myc and VSV-G have been tested in both inserted sites with similar results (data not shown). The upper limit of the number of amino acids was not yet defined although to date up to 20 amino acids have been successfully inserted into both sites.

Immunogenicity of displayed epitopes

In order to determine the reactivity of polyclonal antibodies made against recombinant EspA,- espA_\\η.^_g._\n was subcloned into pET28a (generating pICC325, Table 6) for generation of a C-terminal His tagged protein. Following purification EspAι₁ -_fi_ag-i₁₈-His was used to raise rabbit polyclonal antibodies which were tested for reactivity with recombinant and native EspA filaments. To this end, the EspA -_fi_ag-ns immune sera was used to stain Hep-2 cells infected^' with wild-type EHEC and EPEC, UMD872(pICC323) and UMD872(pICC324). The EspAι₁ „_fiag-ιi₈ immune sera labelled both EspAiπ-flag-πs and EspA_126-flag-12 filaments (Fig. ,11a), whereas no labelling was observed for' wild-type EPEC or EHEC EspA filaments. (Fig. lib). This _. result shows that the flag epitope has become the iimnuno-dominant antigen within the recombinant EspA. In addition, it provides further evidence that the variable region within EspA is displayed on the surface and responsible for the antigenic .polymorphism between the filaments.

DISCUSSION 3

The EspA filament and flagellum are homologous structures believed to have evolved from a common ancestor. The homology between the two systems spans their structural parameters (26,28), their mechanism of polymerisation (29,30) and their ability to secrete effector proteins through their respective secretion apparatus (38,53,30).In addition, both polymers seem to be highly polymorphic (28,32,39), suggesting that they are under similar selective pressure.

In this study we have determined the molecular basis of the antigenic polymorphism of EspA filaments. Alignment of EspA sequences revealed conserved N- and C- tenninal regions (~ 80-90% identity) surrounding a central, more variable, region (less than 30%> identity) (40,41). Structural characterization of the CesAB-EspA complex revealed that the central region of EspA fonns an unstructured loop, likely to constitute a surface-exposed domain playing a role in EspA polymorphism (32,33), which is very similar to that observed in flagellin. Flagellin is organised into four linearly connected domains named DO, Dl, D2 and D3. The N-terminal part of the protein, facing the inside of the flagellar filament, starts with DO, Dl, D2 and D3, then, as the protein folds on itself, comes back through D2, Dl and DO at the C-terminaiend, in order for each domain to connect in antiparallel pairs (28). Flagellin genes are highly conserved at the amino acid level of their N- and C-terminal ends (DO and Dl) (> 90%). The homology decreases towards the middle region of the flagellin, corresponding to D3 domain, in which a hypervariable segment with less than 30% amino acid identity has been identified (42,43). The flagellin hypervariable region forms a surface-exposed domain that encodes the epitope of flagellar antigens responsible for the antigenic variability in flagella (43,46). The two main antigens of Gram-negative bacteria are flagellin and the O .polysaccharide (47), know respectively as the H and O antigens, and both are highly polymorphic. Polymorphisms within EspA would

^• indicate possible interactions- between EspA filaments and the host immune system, suggesting EspA as a possible target for vaccine development (32,48).

These analogies between EspA and flagellin internal sequence variability together with structural similarities of the two polymers, strongly suggest that the variable region is surface-exposed and determines the antigenicity of the filaments. To investigate these hypotheses, we attempted to switch the antigenicity of the EspA_Ep_£c filament into the ESPA_EH_EC filament by swapping the hypervariable regions. Initial amino acid exchanges resulted in EspA filaments with a dual EPEC/EHEC antigenicity, confirming that the region identified is surface-exposed and involved in the antigenic EspA polymorphism. Conversion of EspA_Ep_EC into EspA_EHEC was completed when an additional single point mutation (S 109D) was superimposed on the HVl region swap. Unexpectedly, the S109D single point mutation on its own was sufficient to produce EspA filaments of dual antigenicity recognized by both EPEC/EHEC antibodies. However, previous studies reported that not all EPEC and EHEC serotypes produce EspA filaments that can be labeled with either ESPAEPEC-OI27:H6 or ESPAEHEC-OI57:H7 sera, although they all contain either a serine or an aspartate residue at position 109 (32,40), reflecting the complexity of the antigenic polymorphism that is exhibited by the EspA filaments.

In flagellin, the surface-exposed D3 domain is known to tolerate insertions of natural and artificial amino acid sequence without affecting flagella assembly and bacterial motility (35,36,39,45,49,50). Recently, four new espA-li e genes, named cseB 1 to 4, have been identified following analysis of the Chromobacterium violaceum type three secretion genes clusters (41). Two of the genes appear to have an- internal insertion between the conserved N- and C-terrήinal regions, suggesting that EspA has a natural tolerance for sequence insertion. In this report, we have shown that peptide- sequences can indeed be inserted into the hypervariable region of EspA_Ep_Ec without interfering with filament biogenesis and

^■ protein translocation. In our studies, various tags have been used and so far. up to

20 amino acids have been successfully inserted and tolerated. Of major interest is

^' the fact that insertion of a Flag tag into the hypervariable region of EspA not only allowed, detection of the recombinant EspA_flag filaments with commercial Flag antibodies, but additionally polyclonal antisera made using Es^'pA_flag as antigen, specifically labeled the recombinant filaments without any detectable cross- reactivity with the native EspA filaments. The fact that EspA_flag filaments, were labeled with the polyclonal ESPA_EPEC antiserum suggests that insertion of the flag epitope caused a conforrnational change that exposed a secondary epitope. Indeed, in denaturing conditions, such as Western blot, polyclonal ES AEPEC, ESPAEHEC and EspA_flag antisera are cross-reactive with all three corresponding proteins, confirming that antibody specificity is conforrnational in nature (data not shown).

The results presented in this report provide experimental support to the hypothesis that the hypervariable region of EspA is the dominant, surface-exposed, antigen. In addition, the study shows that short peptides, displayed by EspA filaments, are presented on the surface and accessible for antibodies. These observations could have a considerable impact for future uses of EspA filaments as a peptide display system for mucosal delivery via live attenuated bacteria, in a similar way that flagellar filaments have been used to display surface epitopes (28,35,36,39,51,52). The advantages of using EspA as a delivery system include the facts that EspA filaments are major virulence factors and that EPEC and EHEC are extra-cellular, lumenal and, in some large farm animals, commensal bacteria that target the Peyer's patch mucosa and hence are likely to elicit an effective immune response. Studies to detennine the potential usefulness of EspA filament peptide display technology for delivery of heterogonous antigen of mucosal pathogens are underway in our laboratory.

MATERIALS AND METHODS

Strains and growth conditions The bacterial strains used in this study are listed in Table 6. Bacteria were grown in Luria Bertani (LB) medium or in Dulbecco's Modified Eagle's Medium (DMEM, Sigma) supplemented with ampicillin (100 μg/ml) and kanamycin (50 μg/ml) as required.

Construction ofespAEPEC→EHEC-HVl and espAEPEC→EHEC-HV2 genes

In order to exchange the antigenicity of ESPAEPEC into EspA_EH_EC EPEC HVl and HV2 were replaced with EHEC HVl and HV2, respectively. The _Hvi gene was engineered by overlapping PCR. Two EspA fragments, whose sequences overlap each other at the HVl position, were PCR-amplified from E2348/69 genomic DNA using the primer pairs [EspA-Fwl / ESPAEPEC→EHE_C-HVI- Rv] and [ESPA_EPEC-_→EH_EC-_HVI-₂-FW / EspA-Rvl] (Table 7). The two PCR fragments were gel-purified (Qiagen) and equal quantities of each were mixed together. DNA was denarurated at 95°C for 5 min and allowed to cool down slowly at room temperature to allow single- stranded DNA of each fragments to bind and overlap. Synthesis of double- stranded DNA was performed at 37°C in presence of Klenow enzyme and 1 μl of the Klenow reaction was used as a template to PCR-amplify full-length e-?p _EPEc— E_HEC-H_VI using [EspA-Fwl / EspA-Rvl] primers (Table 7). The EcoΕl I Pstϊ digested PCR product was then cloned in pSAlO under the IPTG inducible tac promoter, creating the pICC317 vector (Table 7).

The e-?p^_EPEc-→_EHEc-HV2 gene was engineered as described above, using [EspA- Fwl / EspA_EPEc_→EHEC-_HV2-Rv] and [EspA_Ep_Ec→EHEC-Hvι-2-Fw / EspA-Rvl] primers to PCR-amplify the overlapping fragments (Table 7). Full-length eψ-4_EPBc-→_EH_EC-H 2 was PCR-amplify with [EspA-Fwl / EspA-Rvl] primers (Table 7). The PCR product was EcoRI / Pstl digested and cloned in pSAlO, generating pICC316 plasmid (Table 6). All constructs were checked by DNA sequencing using an automated DNA sequencer (ABI 377).

Construction of EPEC espAAHVl and espAAHV2 genes

The pICC285 plasmid (pSAlO-EspAEpεc (29,30)) was used as template to amplify espA_tfivi and es A^wi genes by inverse-PCR, using the primer pairs [EspA_ΔHvι- Rv / EspA_Δκvι-₂-Fw] and [EspA_{ΔH 2}-Rv / EspA_ΔHvι-2-Fw], respectively (Table 7). PCR products were selected from the original DNA template by incubation with Dpnl at 37°C for 1 h. The inverse-PCR fragments were then circularised to create pICC322 and pICC321 vectors, respectively (Table 6). Correct circularisation of the plasmids was checked by Aatll digestion, whose restriction site had been created at the ligation site. All constructs were checked by DNA sequencing using ^' an automated DNA sequencer (ABI 377). Construction of espAl 17-flagl 18 and espA126-flag-l 27 genes The

and esp/li26-fiag-i27 genes were engineered using overlapping PCR as described above. The primer pairs [EspA-Fwl / EspA_{11 -}fiag-ιi₈-Rv] and [EspAπv-_flag-ns-Fw / EspA-Rvl], [EspA-Fwl / EspA₁₂6-fiag-i27-Rv] and [EspAι_26- _fi_ag-i₂₇-Fw / EspA-Rvl] (Table 7), were used to PCR-amplify the corresponding overlapping fragments for

respectively. Full- length genes were amplified from the respective Klenow reactions, using [EspA- Fwl / EspA-Rvl] primers (Table 7), EcoRI / P digested and cloned in pSAlO, generating pICC323 and pICC324 vectors, respectively (Table 6). All constructs were checked by DNA sequencing using an automated DNA sequencer (ABI 377).

Construction of espAl 17-flagl 18-His gene

In order to purify recombinant ΕspAn _-flagll8 protein,

was PCR- amplified from pICC323 (Table 6) using the [EspA-Fw2 / EspA-Rv2] primers (Table 7). Primers were designed to generate an in-frame fusion protein with the six Histidines carboxy-terminal tag present on the pET28-a expression vector. The PCR product was Ncol / EcoRI digested before ligation into pΕT28-a, generating pICC325 plasmid (Table 6), where expression of the gene is driven by the LPTG- inducible_. T7 promoter. The pICC325 plasmid was transformed into competent BL21 cells for protein expression and purification.

Site-directed Mutagenesis

Site-directed mutagenesis of the espA gene was performed using the QuickChange site-directed mutagenesis kit (Stratagene) following manufacturer's instructions. The complimentary mutagenesis oligonucleotide pair (EspAsιo_9D-Fw / EspAsιo_9D- Rv), incorporating single amino acid substitution (S109D), was used on double- stranded pICC285, pICC316 or pICC317 vectors to create pICC318, pICC319 and pICC320 plasmids, respectively (Table 6), using temperature cycling (95°C for 30 sec, then 16 cycles of 95°C for 30 sec, 55°C for 1 min and 68°C for 5 min, ^' followed for an additional 5 min extension)^'. Correct incorporation of the mutation was monitored by DΝA sequencing using an automated DΝA sequencer (ABI 377). Mutated plasmids were transformed into competent UMD872 cells (espA mutant) for further analysis.

Preparation of EspAl 17-flag-l 18 polyclonal antiserum In order to produce polyclonal antibodies made against recombinant EspA,

was subcloned into pET28-a (generating pICC325, Table 6) for generation of a C-terminal His tagged protein. EspAi π.flag-πs-His was purified from induced BL21(pICC325) culture as previously described (32). The purified protein was sent to Co aLab UK to generate polyclonal EspAiπ-_flag-πs antiserum as described in (32).

Preparation of protein samples and Western blot analysis

EPEC bacteria were grown in DMEM at 37°C for 7 h in presence of 1 mM IPTG. Bacterial cells from identical optical density cultures were concentrated 10-folds and culture supematants were concentrated 100-folds using TCA precipitation and samples were analysed by Western blotting using polyclonal rabbit ESPAE_PE_C antibody as previously described (23).

Bacterial infection of HEp-2 cells and immuno-fluorescence analysis Sub-confluent monolayers of HEp-2 cells on glass coverslips were incubated in DMEM supplemented with 2% fetal calf serum for 3h at 37°C, 5% C02 with a 1:100 dilution of an overnight LB culture, in the presence of 1 mM IPTG. Non- adherent bacteria were removed, the cells fixed in 4% formalin for 20 min and stained for actin (FAS test) and EspA filaments as previously described (23). EspA filaments were stained with either polyclonal rabbit ESPA_EPEC-O_I27:H₆, polyclonal rabbit EspA_EHEC-85-i70, polyclonal rabbit EspAEPEC- -fiag-iis or commercial monoclonal mouse Flag (Sigma) antisera diluted 1:100 for 45 min. Following 3 washes, coverslips were labelled for 45 min with 1:100 goat anti- rabbit (GAR) or goat anti-mouse (GAM) Alexa 488 fluorescent conjugates (Molecular Probes). Cellular actin was stained following cell membrane pemieabilisation with a 5 μg/ml solution of phalloidin-FITC (Sigma). Coverslips were mounted and examined on a Leica DMRE microscope, equipped with a digital camera system. A positive fluorescence actin staining (FAS) test (A/E lesion formation) was indicated by actin accumulation beneath adherent bacteria (53).

Table 6 Strains and plasmids used in this study.

Table 7 primers used in this study

REFERENCES ^'

1. Hueck, C. J. (1998). Microbiol. Mol. Biol. Rev. 62, 379-433. 2. Chen, H. D. & Frankel, G. (2005). FEMS Microbiol. Rev. 29, 83-98. 3. Nataro, J. P. & Kaper, J. B. (1998). Clin. Microbiol. Rev. 11, 142-201.

4. Frankel, G., Phillips, A. D., Rosenshine, I., Dougan, G., Kaper, J. B. & Knutton,

5. (1998). Mol. Microbiol. 30, 911-921.

5. Knutton, S., Lloyd, D. R. & McNeish, A. S. (1987). Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect. Immun. 55,

69-77.

6. Matsuzawa, T., Kuwae, A., Yoshida, S., Sasakawa, C. & Abe, A. (2004).. EMBO J. 23, 3570-3582.

7. Batchelor, M., Guignot, J., Patel, A., Cummings, N., Geary, J., Knutton, S., Holden, D. W., Connerton, I. & Frankel, G. (2004). EMBO Rep. 5, 104-110.

8. Viswanathan, V. K., Lukic, S., Koutsouris, A., Miao, R., Muza, M. M. & Hecht, G. (2004). Cell. Microbiol. 6, 987-997.

9. Elliott, S. J., Wainwright, L. A., McDaniel, T. K., Jarvis, K. G., Deng, Y. K., Lai, L. C, McNamara, B. P., Donnenberg, M. S. & Kaper, J. B. (1998). Mol. Microbiol. 28, 1-4.

10. McDaniel, T. K., Jarvis, K. G., Donnenberg, M. S. & Kaper, J. B. (1995). Proc. Natl. Acad. Sci. USA, 92, 1664-1668.

11. Garrnendia, J., Frankel, G. & Crepin, V. F. (in press). Infect. Immun.

12. Blocker, A., Gounon, P., Larquet, E., Niebuhr, K., Cabiaux, V., Parsot, C. & Sansonetti, P. (1999). J. Cell. Biol. 147, 683-693.

13. Marlovits, T. C, Kubori, T., Sukhan, A., Thomas, D. R., Galan, J. E. & Unger, V. M. (2004). Science, 306, 1040-1042.

14. Sekiya, K., Ohishi, M., Ogino, T., Ta ano, K., Sasakawa, C. & Abe, A. (2001). Supermolecular structure of the enteropathogenic Proc. Natl. Acad. Sci. USA, 98, 11638-11643. .

15. Daniell, S. J., Takahashi, N., Wilson, R., Friedberg, D., Rosenshine, I., Booy, F. P., Shaw, R. K., Knutton, S., Frankel, G. & Aizawa, S. (2001). Cell. Microbiol. 3, 865-871 ^:

16. Aizawa, S. I. (2001). FEMS Microbiol. Lett. 202, 157-164. - . 17. Macnab, R, M. (2003). Anmi. Rev. Microbiol. 57, 77-100.

18. Tanipakaki, A., Fadouloglou, V., Gazi, A., Panopoulos, N. & Kokkinidis, M. (2004). Cell. Microbiol. 6, 805-816. 19. Crepin, V. F., Prasam an, S., Shaw, R. K., Wilson, R. K., Creasey, E., Abe, C. M., Knutton, S., Frankel, G. & Matthews, S. (2005). Mol. Microbiol. 55, 1658- 1670.

20. Kimbrough, T. G. & Miller, S. I. (2000). Proc. Natl. Acad. Sci. USA, 97, 11008-11013.

21. Allaoui, A, Sansonetti, P. & Parsot, C. (1992). J. Bacteriol. 174, 7661-7669.

22. Ueno, T., Oosawa, K. & Aizawa, S. (1994). J. Mol. Biol. 236, 546-555.

23. Knutton, S., Rosenshine, I., Fallen, M. J., Nisan, I., Neves, B. C, Bain, C, Wolff, C, Dougan, G. & Frankel, G. (1998). EMBO J. 17, 2166-2176. 24. Ebel, F., Podzadel, T., Rohde, M., Kresse, A. U., Kramer, S., Deibel, C, Guzman, C. A. & Chakraborty, T. (1998). Mol. Microbiol. 30, 147-161.

25. Wilson, R. K, Shaw, R. K., Daniell, S., Knutton, S. & Frankel, G. (2001). Cell. Microbiol. 3, 753-762.

26. Daniell, S. J., Kocsis, E., Morris, E., Knutton, S., Booy, F. P. & Frankel, G. (2003). Mol. Microbiol. 49, 301-308.

27. Delahay, R. M., Knutton, S., Shaw, R. K., Hartland, E. L., Pallen, M. J. & Frankel, G. (1999). J. Biol. Chem. 274, 35969-35974.

28. Yonekura, K., Maki-Yonekura, S. & Namba, K. (2003). Nature, 424, 643-650.

29. Emerson, S. U., Tokuyasu, K. & Simon, M. I. (1970). Science, 169, 190-192. ^' 30. Cr^'epin, V. F., Shaw, R. K., Abe, C. M., Knutton, S. & Frankel, G. (2005). J. bacteriol. 187, 2881-2889. .

31. lino, T. (1969). Bacteriol. Rev, 33, 454-475.

32. Neves, B. C, Shaw, R. K., Frankel, G. & Knutton, S. (2003). Infect. Immun. 71, 2262-2265. 33. Yip, C. K, Finlay, B. B. & Strynadka, N. C. (2004). Nat. Struct. Mol. Biol. 12, ' 75 - 81. ^•

34. Reid, S. D., Herbelin, C. J., Bumbaugh. A, C, Selander, R. K! & Whittam, T. . S. (2000). Nature, 406, 64-67.

35. Newton, S. M., Jacob, C. O. & Stocker, B.^'A. (1989). Science, 244, 70-72. 36. Wu, J. Y., Newton, S., Judd, A., Stocker, B. & Robinson, W. S. (1989). Proc.

Natl. Acad. Sci. USA, 86, 4726-4730.

37. Kyte, J. & Doolittle, R. F. (1982). J. Mol. Biol. 157, 105-132. 38. Young, G. M., Schmiel, D. H. & Miller, V. L. (1999). Proc. Natl. Acad. Sci. USA, 96, 6456-6461.

39. Wang, L., Rothemund, D., Curd, H. & Reeves, P. R. (2003). J. Bacteriol. 185, 2936-2943. 40. Neves, B. C, Knutton, S., Trabulsi, L. R., Sperandio, V., Kaper, J. B., Dougan, G. & Frankel, G. (1998). FEMS Microbiol. Lett. 169, 73-80.

41. Betts, H. J., Chaudhuri, R. R. & Pallen, M. J. (2004). Trends Microbiol. 12, 476-482.

42. Wei, L. N. & Joys, T. M. (1985). J. Mol. Biol. 186, 791-803. 43. Joys, T. M. (1985). J. Biol. Chem. 260, 15758-15761.

44. Kuwajima, G. (1988). J. Bacteriol. 170, 485-488.

45. Frankel, G., Newton, S. M., Schooinik, G. K. & Stocker, B. A. (1989). Mol. Microbiol. 3, 1379-1383.

46. Namba, K., Ya ashita, I. & Vonderviszt, F. (1989). Nature, 342, 648-654. 47. Gross, R. J., Scotland, S. M. & Rowe, B. (1976). Lancet, 1, 629-631.

48. Potter, A. A., Klashinsky, S., Li, Y., Frey, E., Townsend, H., Rogan, D., Erickson, G., Hinkley, S., Klopfenstein, T., Moxley, R. A., Smith, D. R. & Finlay, B. B. (2004). Vaccine, 22, 362-369.

49. He, X. S., Rivkina, M., Stocker, B. A. & Robinson, W. S._.(1994). J. Bacteriol. 176, 2406-2414.

50. Kuwajima, G. (1988). J. Bacteriol. 170, 3305-3309.

51. Westerlund-Wikstrom, B. (2000). Int. J. Med. Microbiol. 290, 223-230.

52. Tanskanen, J., Korhonen, T. K. & Westerlund-Wikstrom, B. (2000). Appl. Environ. Microbiol. 66, 4152-4156. 53. Knutton, S., Baldwin, T., Williams, P. H. & McNeish, A. S. (1989). Infect. Immun. 57, 1290-1298.

54. Perna, N. T et al (2001). Natøe,^'409, 529-533.

55. Levine, M. M., Berquist, E. J., Nalin, D. R., Waterman, D. H., Hornick, R. B., Young, C. R., Stoman, S. & Rowe, B. (1978). Lancet, i, 1.19-122. 56. Tzipori, S., Karch, H., Wachsmuth, K. I., Robins-Browne^ R. M., O'Brien, A. D., Lior, H., Cohen, M. L., Smithers, J. & Levine, M. M. (1987). Infect. Immun. 55, 3117-3125. 57. Kenny, B., Lai, L. C, Finlay, B. B. & Donnenberg, M. S. (1996). Mol. Microbiol. 20, 313-323.

58. Schlosser-Silverman, E., Elgrably-Weiss, M., Rosenshine, I., Kohen, R. & Altuvia, S. (2000). J. Bacteriol. 182, 5225-5230.

Claims

Claims:

1. A recombinant polypeptide comprising an EspA polypeptide and one or more further polypeptide(s) inserted within the EspA polypeptide, wherein said recombinant polypeptide is competent to assemble into EspA filaments.

2. The recombinant polypeptide according to claim 1 wherein the EspA polypeptide is an E. coli EspA polypeptide.

3. The recombinant polypeptide according to any one of the previous claims wherein the EspA polypeptide is an EPEC or EHEC polypeptide.

4. - The recombinant polypeptide according to any one of the previous claims wherein the EspA polypeptide is that polypeptide sequence provided in

Genbank accession number AAC38394 or AAL06381.

5. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is inserted within a variable domain.

6. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is inserted within a hypervariable domain.

7. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is inserted at a position equivalent to 117 to 126 amino acids from the N-terminus of an EspA polypeptide provided in Genbank accession number AAC38394.

8. ^' The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is inserted 117 amino acids from the N- terminus of an EspA polypeptide provided in Genbank accession number AAC38394.

9. The recombinant polypeptide according to any one of claims 1 to 7 wherein the further polypeptide is inserted 126 amino acids from the N- terminus of an EspA polypeptide provided in Genbank accession number AAC38394.

10. The recombinant polypeptide according to any one of the previous claims wherein a section of the EspA polypeptide is deleted.

11. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is antigenic.

12. The recombinant polypeptide according to claim 11 wherein the recombinant polypeptide comprises the antigenicity of the further polypeptide.

13. The recombinant polypeptide according to any of the previous claims wherein the further polypeptide disrupts the native antigenicity of the - EspA polypeptide.

14. The recombinant polypeptide according to any one of claims 11 to 13 wherein the further polypeptide is a viral, bacterial or anήnal antigen.

15. The recombinant polypeptide according to claim 14 wherein the further polypeptide is a viral or bacterial pathogen antigen.

16. The recombinant polypeptide according to claim 15 wherein the further polypeptide is an influenza antigen.

17. The recombinant polypeptide according to claim 15 wherein the further polypeptide is a RSV antigen.

18. The recombinant polypeptide according to claim 15 wherein the further polypeptide is a Mycobacterium tuberculosis antigen.

19. The recombinant polypeptide according to claim 15 wherein the further pofypeptide is a Lawsonia intracellularis antigen.

20. The recombinant polypeptide according to any one of claims 11 to 19 wherein the further polypeptide comprises two or more antigens.

21. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide comprises between 6 and 17 amino acids.

22. The recombinant polypeptide according to any one of the previous claims wherein the further polypeptide is linked with the EspA polypeptide via one or more cleavable linker(s).

23. A polynucleotide encoding a recombinant polypeptide according to any one of the previous claims.

24. A vector suitable for expressing a polypeptide in a host cell comprising a polynucleotide according to claim 23.

25. An EspA filament comprising a recombinant polypeptide according to any one of the previous claims.

26. A cell comprising a recombinant polypeptide according to any one of the previous claims and/or a polynucleotide according to clann 23 and/or a vector according to claim 24 and/or an EspA filament according to claim 25, ' .

27. The cell according to claim 26 wherein the cell is a prokaryotic cell.

28. The cell according to any one of the previous claims wherein the cell is an extracellular pathogen.

29. The cell according to any one of the previous claims wherein the cell is a strain of E. coli.

30. The cell according to any one of the previous claims wherein said E. coil strain is ΕHΕC or ΕPΕC.

31. The cell according to any one of the previous claims wherein said cell is an attenuated pathogen.

32. The cell according to any one of the previous claims wherein a gene encoding a native ΕspA polypeptide has been deleted.

33. The cell according to any one of the previous claims wherein said polynucleotide or vector encodes, or the ΕspA filament comprises, an antigenic recombinant polypeptide according to any one of claims 11 to 22.

34. The cell according to any one of the previous claims wherein said cell further comprises an ΕspA chaperone polypeptide.

'35. A method of producing a recombinant -polypeptide according to any one of the previous claims comprising:

a) providing a suitable host cell comprising a polynucleotide according to claim 23 and/or a vector according to claim 24; and,

b) expressing said vector in said host cell so as to produce the recombinant polypeptide; and, optionally, c) recovering said recombinant polypeptide from the host cell and/or the medium in which the host cell is grown.

36. The method of claim 35 wherein said recombmant polypeptide is recovered from optional step c) in the form of EspA filaments.

37. A method of preparing an attenuated pathogenic cell according to any one of claims 31 to 34 comprising:

a) providing a suitable attenuated pathogenic cell comprising a polynucleotide according to claim 23 and/or a vector according to claim 24; and,

c) recovering said cell from the medium in which the cell is grown.

^•

38. The method according to any one of the previous claims wherein said polynucleotide or vector encodes an antigenic recombmant polypeptide according to any one of claims 11 to 22.

39. The method according to any one of the previous claims wherein a gene encoding a native EspA polypeptide has been deleted from said suitable attenuated pathogenic cell.

40. A vaccine comprising a recombinant polypeptide according to any one of claύns 11 to 22 and/or a recombinant polypeptide obtained the method of clann 38 and/or an EspA filament according to claim 25 and/or an EspA filament obtained by the method of claim 36.

41. A vaccine comprising an attenuated pathogenic cell according to claim 33 or 34 or obtained by the method of claim 38.

42. A vaccine according to claim 40 or 41 further comprising an adjuvant.

43. A pharmaceutical composition comprising a vaccine according to any one of claims 40 to 42 and a pharmaceutically acceptable carrier.

44. A recombinant polypeptide according to any one of the previous claims, a polynucleotide according to claim 23, a vector according to claim 24, an

EspA filament according to claim 25, a cell according to any one of the previous claims, a vaccine according to any one of the previous claims or a pharmaceutical composition according to claim 43 for use in medicine.

45. Use of a recombinant polypeptide according to claim 18 or a polynucleotide or vector according to claim 23 or 24 when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to any one of claims 33, 34 and 40 to 42 when comprising said recombinant polypeptide in the manufacture of a medicament ^' for the prevention or treatment of tuberculosis.

46. Use of a recombinant polypeptide according to claim 19 or a polynucleotide or vector according to claim 23 or 24 when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition ' according to any one of claims 33, 34 and 40 to 42 when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of proliferative enteropathy.

47. Use of a recombinant polypeptide according to claim 16 or a polynucleotide or vector according to claim 23 or 24 when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition accordmg to any one of claims 33, 34 and 40 to 42 when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of influenza.

48. Use of a recombinant polypeptide according to claim 17 or a polynucleotide or vector according to claim 23 or 24 when encoding said recombinant polypeptide or a cell, vaccine or pharmaceutical composition according to any one of claims 33, 34 and 40 to 42 when comprising said recombinant polypeptide in the manufacture of a medicament for the prevention or treatment of any disorder caused by RSV infection.

49. Any novel subject matter disclosed herein.