CN100340673C - Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification - Google Patents
Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification Download PDFInfo
- Publication number
- CN100340673C CN100340673C CNB2005100238059A CN200510023805A CN100340673C CN 100340673 C CN100340673 C CN 100340673C CN B2005100238059 A CNB2005100238059 A CN B2005100238059A CN 200510023805 A CN200510023805 A CN 200510023805A CN 100340673 C CN100340673 C CN 100340673C
- Authority
- CN
- China
- Prior art keywords
- primer
- hiv
- rna
- test kit
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a PCR fluorescent quantitative detection kit which can carry out real-time detection to human immunodeficiency virus HIV-1 by multiple primers, which belongs to the technical field of a diagnostic reagent. The kit comprises lysate, a silica gel adsorption column, washing liquid, primers, a probe, working standard substance, an enzyme mixture, a contrast agent, etc., wherein the primer is selected from a conservative sequence of the code HTV gene gag area in the mode of multiple primer combination, an MGB-Taqman probe is adopted as the probe, and the gradient dilution of the in vitro transcription RIA of the HIV-1 gag gene is adopted as the working standard substance. The kit in the present invention has favorable detection sensitivity. The present invention can be used by matching with a fluorescent quantitative PCR device, can carry out qualitative and quantitative detection to the HIVRNA in the specimen of clinical blood serum or plasma, and can detect the curative effect of the HIV-1 drug resistance.
Description
Technical field
The invention belongs to the diagnostic reagent technical field, be specifically related to a kind of PCR-fluorescence quantitative detection kit that utilizes multi-primers that human immunodeficiency virus HIV-1 is detected in real time.
Background technology
Human immunodeficiency virus HIV-1 is the retrovirus of a gene order height variation, and the known viruse hypotype surpasses 11 kinds at present, and the main epidemic strain of China is A, B, B/C, D and E hypotype.And hypotype such as A, E and B, C, D and other hypotypes differ greatly on the gag district gene order that amplification is taked usually, are difficult to find the gag sequence on all four than long segment.Therefore the common PCR detection technique is difficult amplifies all gene hypotypes, and its consequence is to produce quantitatively inaccurate between omission or various hypotype.
Round pcr is born in the eighties in last century, is applied to diagnostic nucleic acid with pcr amplification+agarose electrophoresis pattern at first, and commonly used is fluorescent quantitative PCR technique at present.The used probe of fluorescent quantitative PCR technique can be divided into hydrolysis probes and hybridization probe two classes.Hydrolysis probes i.e. Taqman probe the most widely at present; Hybridization probe then mainly contains molecular beacon (MolecularBeacons) and based on double cross probe (FRET Hybridization Probes) of fluorescent energy resonance transfer system etc.The RT-PCR amplification then is a form of taking " single stage method ", and promptly reverse transcription and pcr amplification carry out in same reaction tubes successively, adopts the combination of AMV reversed transcriptive enzyme and general T aq enzyme, carries out reverse transcription and pcr amplification in same reaction solution.
The Taqman technical development is in the nineties initial stage, ripe in nineteen ninety-five, propose by American AB I company, its ultimate principle is in the common PCR system, add one with target fragment two primers in sequence complementary fluorescence labeling probe, 5 ' end mark fluorescent reporter group of this probe, 3 ' end mark fluorescent quenching group claims the Taqman probe.When probe is complete, because the effect of quenching group, reporter group can not produce fluorescence, when the target fragment exists, label probe is combination with it, in the PCR process, when primer extension during to the label probe combining site, because the Taq enzyme has 5 '-3 ' end exonuclease activity, the fluorescence report group of satisfying probe 5 ' end downcuts (hydrolysis).Because reporter group separates with quenching group, the cancellation effect is removed, and reporter group can send fluorescent signal, and its power is constantly strengthened with the pcr amplification process, and is directly proportional with the quantity of PCR product.Record fluorescent signal through specific fluorescence analyser, but the variation of the logarithmic phase of Real-time and Dynamic quantitative observation pcr amplification, linear phase and plateau.
MGB (Minor Groove Binder) is the another kind of probe that is different from Taqman probe, hybridization probe and molecular beacon.Common Taqman probe is at 5 ' end mark fluorescent reporter group (as FAM etc.), at 3 ' end mark fluorescent quenching group (as TMARA), and the MGB probe connects a peptide modified thing again at 3 ' end of common Taqman probe, and its effect can improve fluorescence and template bonded Tm value (the long probe of average 15bp can improve 18 ℃) greatly.Therefore, compare with common Taqman probe, can make the contraction in length of probe, the position of reporter group and quenching group is nearer, and cancellation is effective, and the fluorescence background of reaction solution is low, and resolving power improves; And short probe also is convenient to comprise in the HIV-1gag gene regions design of highly variation the fluorescent probe of various hypotypes; Higher Tm value also improved and non-specific pairing between difference, improved the specificity that detects.
Fluorescent quantitative PCR technique based on the TaqMan probe is a kind of method of detection by quantitative virus copy number.A Germany ATRUS company and a China Shenzhen basic bio-engineering corporation have developed the test kit that detects relative disease with aforesaid method.But ATRUS company is a cover pcr amplification and detection reagent combination, and corresponding sample disposal reagent and scheme are not provided.And a basic company just adopts the RT-PCR two-step approach to increase, and is examined sample and only limit to blood plasma.
Summary of the invention
The objective of the invention is to propose a kind of qualitative and detection by quantitative that can be used for the HIV RNA in clinical serum or the plasma specimen, also can be used for the PCR-fluorescence quantitative detection kit of the detection of auxiliary diagnosis that HIV-1 infects and anti-HIV-1 medication effect.
The PCR-fluorescence quantitative detection kit of the human immunodeficiency virus HIV-1 that the present invention proposes, it comprises lysate, silica gel adsorption column, washings, elutriant, primer, probe, working standard, enzyme mixture and contrast agents, wherein, described lysate is the guanidine thiocyanate solution of virion in cracking serum and the plasma specimen, described washings contains ethanolic soln, and containing guanidine thiocyanate solution and Tris solution, described elutriant contains 0.04%NaN
3The sterilization distilled water of no Rnase, described primer is selected from the conserved sequence in coding HIV gene gag district, described probe is the MGB-Taqman probe, described working standard is the grade dilution that contains HIV-1 gag gene in vitro transcribe rna, and described enzyme mixture is reversed transcriptive enzyme, DNA cloning enzyme and dNTP.
In the test kit of the present invention, described washings comprises washings A that contains the thiocyanic acid guanidine and the washings B that contains Tris.
In the test kit of the present invention, described silica gel adsorption column adopts the negative pressure of vacuum method for extracting to carry out purified virus RNA as the nucleic acid purification post.
The RNA method for extracting nucleic acid that the present invention takes the nucleic acid purification post to add the negative pressure extraction plant is handled sample.The principle of this technology be utilize viral nucleic acid and other nucleic acid or protein under different condition with the difference of silica gel adsorption column binding ability, with non-viral nucleic acid class Impurity removal, the elution of virus that will still be adsorbed on the silica gel adsorption column with low-solids water or water gets off again by negative pressure extracting assembly and washing with alcohol liquid.The former all kinds of scientific researches molecular biology reagent that is applied to of this technology, after now being applied to this diagnostic reagent, avoided on the one hand using toxic reagents such as phenol chloroform, Virahol in the traditional method, introduced mechanized operation on the other hand, reduced manual operation resultant disadvantageous effect.Described negative pressure extracting assembly can be made up of the interface that a negative pressure forms system's (as vacuum unit) and one or several and silica gel adsorption column, can use this silica gel adsorption column purification system.
Because the HIV virus subtype is numerous, the gene order variation is complicated, often is difficult to increase all hypotypes of HIV of a pair of primer.Therefore increase the gene order that will produce quantitative inaccurate consequence, especially A, A/E hypotype and other hypotypes such as B/C, D between omission or various hypotype when differing greatly with a pair of primer, this technological deficiency can be more obvious.Therefore, in the test kit of the present invention, described primer and probe sequence come from the gag district of HIV gene order, through with a plurality of HIV strains of known array carry out BLAST relatively after, choose conservative region.
Through sequence relatively, design two upstream primers, match with downstream primer respectively.Wherein upstream primer primer 1 matches be used to increase B, C, D hypotype with downstream primer primer 3; And upstream primer primer 2 and 3 pairings of downstream primer primer, the A that is used to increase, E hypotype.
Primer sequence can be selected following correlation combiner for use:
Combination A.
Primer 1 (F): 5 '-taa aca tag tgg ggg gac acc a-3 ' (being designated as SEQ.ID.NO.1)
Primer 2 (F): 5 '-taa aca cag tgg ggg gac atc a-3 ' (being designated as SEQ.ID.NO.2)
Primer 3 (R): 5 '-ttc ctg cta tgt cac ttc ccc t-3 ' (being designated as SEQ.ID.NO.3)
Combination B.
Primer 1 (F): 5 '-g ggg aca tca agc agc cat gca aat-3 ' (being designated as SEQ.ID.NO.4)
Primer 2 (F): 5 '-g ggg aca cca ggc agc aat gca aat-3 ' (being designated as SEQ.ID.NO.5)
Primer 3 (R): 5 '-tac tag tag ttc ctg cta tgt cac ttt c-3 ' (being designated as SEQ.ID.NO.6)
Combination C.
Primer 1 (F): 5 '-g ggg aca tca agc agc cat gca aat-3 ' (being designated as SEQ.ID.NO.4)
Primer 2 (F): 5 '-tag tag ttc ctg cta tgt cac ttc c-3 ' (being designated as SEQ.ID.NO.7)
Primer 3 (R): 5 '-ttc ctg cta tgt cac ttc ccc t-3 ' (being designated as SEQ.ID.NO.3);
In above-mentioned 3 kinds of combinations, primer 1 and primer 3 pairings, be used to increase B, C, D hypotype, primer 2 and primer 3 pairings, the A that is used to increase, E hypotype.
Aforesaid combination all can the efficient amplification such as carry out to hypotypes such as HIV-1A, B, C, D, E, avoids the omission between hypotype.But three's combination is compared, and combination A effect aspect detection sensitivity, fluorescence signal-to-noise performance is better.
In the test kit of the present invention, internal reference product P1, P2, P3, P4, P5 select for use A, B/C, C, D, the E hypotype of HIV-1 C-type virus C (from the U.S. respectively, relatively confirm through gp41 env sequence), for clearly embodying each to the amplification situation of primer to different subtype HIV-1 virus, use primer 1/ primer 3 (mainly detecting the B/C hypotype), primer 2/primer 3 (mainly detecting the A hypotype) and primer 1-primer 2/primer 3 (multi-primers) to increase respectively to above-mentioned 5 parts of samples, and adopt identical MGB fluorescent probe to detect.Accompanying drawing 1,2,3,4,5 has been represented respectively the comparison with P1 (HIV-1A hypotype), P2 (HIV-1B/C hypotype), P3 (HIV-1C hypotype), P4 (HIV-1D hypotype), P5 (HIV-1E hypotype), comparative result shows, the result is better with A, D, the E hypotype of primer 2/primer 3 combination amplification HIV-1, amplification B/C, C hypotype is relatively poor, and P3 (HIV-1, C) also omission; With primer 1/ primer 3 combination amplification B/C, the result is better for the D hypotype, the result is general for amplification C hypotype, amplification A, E hypotype are relatively poor; And the combination of employing primer 1-primer 2/primer 3 (multi-primerses), the result of the above-mentioned 5 parts of different hypotype samples that increase is relatively good.Show that adopting the mode of multi-primers combination is effective to detecting each virus subtype sample of HIV-1.
Test kit of the present invention adopts the method for multiplex PCR, promptly selects for use manyly to primer in the RT-PCR amplified reaction, at increase the respectively goal gene of different subtype of the gene order of different subtype, makes reaction solution to carry out equivalence to each hypotype of HIV-1 and increases.
In the test kit of the present invention, the sequence of described MGB-Taqman probe is: 5 '-FAM-acc atc aat gag gaagc-TAMRA (MGB)-3 ' is designated as SEQ.ID.NO.8.
This technology is used for the corresponding relation that detection by quantitative is based on CT and template amount.The cycle number of fluorescent signal arrival detection threshold is called the CT value of sample, the i.e. point of crossing of amplification curve and detection threshold line.The starting template amount of the size of CT value and sample becomes the logarithm inverse ratio, uses the CT value and the corresponding known template amount banknotes-system typical curve of the quantitative contrast of synchronous amplification.According to the CT value of sample to be measured, just can on typical curve, extrapolate corresponding starting template amount.
The pcr amplification of test kit of the present invention detects and adopts (the reference: DNA/RNA Real-TimeQuantitative PCR-Rev.B Applied Biosystems) of real-time fluorescence quantitative PCR technology, can realize that each takes turns circulation and all can detect the first order fluorescence signal, the quantivative approach of employing is outer typical curve quantivative approach.This quantivative approach is to calculate the amplification sensitivity index Ct value of each sample, and the typical curve that quantitatively contrasts according to test kit obtains quantitative result again.Be provided with the working standard (positive working standard) and a negative control of 4 parts of different quantities level levels simultaneously, be used for the operation and the quantitative Analysis of quality control reagent box.
Test kit of the present invention is to contain 0.05%NaN
3The negative contrast of PHS of HIV-1 RNA feminine gender, be quantitative contrast with the non-infectious HIV-1 in-vitro transcription RNA that contains different copy numbers.And 4 parts of working standards are the RNA in-vitro transcription thing that contains the HIV gene, in advance with making its HIV rna gene copy number roughly respectively 10 after the RNA diluted
6, 10
5, 10
4, 10
3About copy/ml.There is some difference for the HIV rna gene copy number of every batch of working standard, needs definite value in the preparation.The strong positive contrast of test kit of the present invention contains has an appointment 2 * 10
6The non-infectious HIV-1 in-vitro transcription RNA of copy/ml, weak positive control contains has an appointment 2 * 10
4The non-infectious HIV-1 in-vitro transcription RNA of copy/ml.
Owing to pcr amplification is subject to the failure of increasing of multiple factor affecting, the test kit user of service is drawn detect the negative wrong conclusion of sample.For avoiding the test kit user of service to draw above-mentioned false judgment, during forming, uses the optimum of test kit of the present invention internal reference amplification quality control system.The internal reference RNA that promptly adds particular sequence in lysate passes through cracking, purifying, amplification jointly, detects each step with sample.Described internal reference RNA is the in-vitro transcription RNA segment that a clone has HIV primer complementary sequence, and its sequence is SEQ.ID.NO.11.
The underscore of SEQ.ID.NO.9 partly is the complementary sequence of HIV primer, interior can the photograph carried out augmentation detection synchronously with sample to be measured in a reaction system, detect the fluorescent probe mark HEX fluorescence of internal reference amplified production, detection signal can be distinguished mutually with the FAM fluorophor that detects HIV, HIV detects when negative, if internal reference is positive, illustrate that the pcr amplification reaction in the reaction system normally carries out, the HIV negative result is credible, if internal reference is also negative, illustrate that the pcr amplification reaction in the reaction system receives inhibition, the HIV negative result is insincere, needs repetition measurement.Adopt the quality control method of this internal reference can effectively avoid the false negative detected result of pcr amplification in detecting.
In the test kit of the present invention, the preparation method who contains HIV-1gag gene in vitro transcribe rna in the described working standard comprises the steps:
1) use forward primer IF2:3 '-gct ttc agc cca gaa gta a-5 ' and reverse primer IR2:3 '-gatagg tgg att atg tgt c-5 ' to carry out RT-PCR amplification HIV RNA positive sample, obtain the amplified production of 282bp:
2) extension amplification outcome makes up HIV-1 positive control plasmid in pGEM-T (Promega Cat.A3600) carrier:
3) HIV-1 positive control plasmid is transformed in the escherichia coli DH5a, and called after pTIPC bacterial strain is stored in-70 ℃;
4) purifying is removed DNA, and identifies RNA.
101 parts of HIV-1RNA positive samples that comprise HIV-1B ', B, C, B '/C, E hypotype of test kit of the present invention and the parallel detection of the NASBA test kit of BioMerieux company, preliminary survey coincidence rate 97.1%, repetition measurement coincidence rate 99.0%, dependent equation LOG (test kit of the present invention)=0.88LOG (NASBA)+0.58, r=0.80, P＜0.001, both results are remarkable positive correlation, except that individual samples, the detection by quantitative difference is all in 1 LOG.
This test kit has good detection sensitivity, to HIV-1B, B ', C, D hypotype recall rate 100%, to E hypotype recall rate 94%.Check through clinical unit, the lowest detection limit of this product reaches 160 copy/ml.To general crowd's sample, this product specificity reaches 100%, to HBV and HCV infected specimen non-false positive.
Test kit of the present invention comprises that to whole experiment extracting, reverse transcription reaction and pcr amplification carry out complete monitoring, utilizes extracting working standard (RNA) to avoid with positive serum as the risk of quality inspection product and improve the accuracy of actual quality inspection product simultaneously.
Test kit of the present invention need cooperate quantitative real time PCR Instrument to use, and recommends to use the Lightcycler type PCR instrument of Switzerland Roche company.
Description of drawings
Adopt the comparison of different combination of primers amplification different subtypes:
Fig. 1, with the comparison of P1 (HIV-1A hypotype);
Fig. 2, with the comparison of P2 (HIV-1B/C hypotype)
Fig. 3, with the comparison of P3 (HIV-1C hypotype);
Fig. 4, with the comparison of P4 (HIV-1D hypotype)
Fig. 5, with the comparison of P5 (HIV-1E hypotype)
Among the figure, A: primer 1, primer 2/primer 3
B: primer 2/primer 3
C: primer 1/ primer 3
Embodiment
The extraction of embodiment 1 HIV nucleic acid RNA
The pretreatment is bigger for the influence of pcr amplification, consider the susceptibility of detection and the practicality of clinical manipulation, select supporting nucleic acid post method for extracting extraction serum of nucleic acid purification post and vacuum negative pressure device or the nucleic acid RNA in the plasma specimen, its nucleic acid purification principle, step are as follows:
(1) adopt contain the thiocyanic acid guanidine lysate with various albumen in the sample and nuclease sex change, simultaneously the HIV RNA in the HIV virion is discharged, settling agent guarantees that the RNA of trace precipitates;
(2) through 70 ℃ of reactions 10 minutes, the agent of disinthibiting will may cause in the reaction solution that the RT-PCR downtrod foreign protein that increases digests;
(3) postdigestive reaction solution is added on the nucleic acid extraction post, through negative pressure extracting, HIV RNA is adsorbed onto on the nucleic acid extraction film (pellosil) in the reaction solution, and remaining reaction liquid passes pellosil, flows in the waste liquid cylinder;
(4), wash remaining impurities on the pellosil off through twice washing;
(5) high speed centrifugation is removed ethanol residual in the film (ethanol can influence the RT-PCR amplification);
(6) elutriant with less salt is added on the pellosil, and middling speed is centrifugal, and the HIV RNA that is adsorbed onto on the film is eluted in the collection tube, and the collection liquid that elutes is exactly purified HIV RNA solution, can be used as template, is used for subsequently RT-PCR amplification, detection.
Concrete extraction steps is as follows:
Getting 100 μ l samples adds 100 μ l and is mixed with the lysate of settling agent and the 20 μ l agent of disinthibiting, 70 ℃ were reacted 10 minutes, add 110 μ l dehydrated alcohols, in the nucleic acid purification post on whole liquid immigration negative pressure devices, open negative pressure, drain liquid in the post, respectively wash once with 500 μ l washings A, B respectively, 14000rpm removed residual washing lotion in centrifugal 1 minute then.Finally, get the nucleic acid-templated RT-PCR reaction that is used for subsequently of the HIV RNA that elutes with 50 μ l elutriant wash-outs.
The form of " single stage method " is then adopted in the RT-PCR amplification of this test kit, and promptly reverse transcription and pcr amplification carry out in same reaction tubes successively, adopts the combination of AMV reversed transcriptive enzyme and general T aq enzyme, carries out reverse transcription and pcr amplification in same reaction solution.This RT-PCR amplification pattern cooperates real-time fluorescence detecting pattern, just can avoid adding a cover in the amplification way, operation such as application of sample, really accomplishes the stopped pipe detection, can effectively avoid the pollution of amplified production.According to the analytical results of the data such as annealing temperature of primer, the temperature cycle when having specified test kit on the LightCycler of Roche company pcr amplification instrument, to move.
The real-time fluorescence detecting pattern of Taqman probe is adopted in the detection of pcr amplification product, and the MGB-Taqman probe of design in the goal gene of pcr amplification, a synthetic flag F AM fluorophor joins in the RT-PCR reaction solution, carries out real-time fluorescence and detects.
According to above-mentioned RT-PCR pattern, determine that the reaction volume on the LightCycler of Roche company amplification instrument is 20 μ l (10 μ l reaction solutions+10 μ l are nucleic acid-templated), and consider the stability of test kit, AMV reversed transcriptive enzyme, Taq enzyme and fluorescent probe separated with the PCR reaction solution deposit remix during use.Determine the blending ratio between three chief components of RT-PCR augmentation detection reagent in the test kit thus.
The preparation and the assembling of embodiment 3 each component of test kit
Test kit comprises sample disposal unit and nucleic acid amplification detection by quantitative unit.
The method of negative pressure column purification requires to cooperate negative pressure extracting assembly to use behind the sample disposal unit employing guanidine thiocyanate lytic virus.Its composition comprises:
1. lysate: 6M GTC (guanidine thiocyanate), 1M Tris;
2. silica gel adsorption column;
3. washings A:6M GTC (guanidine thiocyanate), 1M Tris;
4. washings B:1M NaCL, 1M Tris;
5. settling agent;
6. the agent of disinthibiting;
7. elutriant: 10%NaN
3, the DEPC purified water.
Nucleic acid amplification detection by quantitative unit adopts the quantitative fluorescent PCR principle, requires to cooperate quantitative real time PCR Instrument to use.Its composition comprises:
1.PCR reaction solution: DEPC purified water, 10 * Buffer, 25mMdNTP, (sequence 5 '-taa aca tag tgg ggg gac acc a-3 ' (SEQ.ID.NO.1), 5 '-taa acatag tgg ggg gac acc a-3 ' is (SEQ.ID.NO.2) for 50 μ M primers (F), 50 μ M primers (R) (sequence 5 '-ttc ctg cta tgt cac ttc ccc t-3 ' (SEQ.ID.NO.3)), 50% glycerine, 100mMDTT, 25mM MgCL2, the PCR toughener, protective material I;
2. enzyme mixture: 40 μ/μ l Rnasin, 10 μ/μ l AMV, 5 μ/μ l TaqE, 1 μ g/ μ l BSA, protective material II, Storage Buffer B;
3. probe: 50 μ M Taqman probes (sequence 5 '-FAM-acc atc aat gag gaagc-TAMRA (MGB)-3 ' (SEQ.ID.NO.8)), DEPC purified water;
4. negative control: 10%NaN
3, negative serum;
5. quantitatively contrast: the copy number that obtains through dilution is respectively the non-infectious in-vitro transcription RNA of 2 * 106 copy/ml, 2 * 104 copy/ml.
The preparation of embodiment 4 working standards
(1) comprises the bigger segmental amplification of test kit HIV-1 goal gene
At goal gene (151bp) the outside design a pair of primer (IF2/IR2) of test kit design, this can increase to primer and comprise the big fragment (282bp) of test kit testing goal gene, and this fragment can be used to prepare the in-vitro transcription thing that comprises the Hiv-1 goal gene.Sequence is:
IF2：3’-gct?ttc?agc?cca?gaa?gta?a-5’(SEQ.ID.NO.9)
IR2：3’-gat?agg?tgg?att?atg?tgt?c-5’(SEQ.ID.NO.10)
Use forward primer IF2:3 '-gct ttc agc cca gaa gta a-5 ' and reverse primer IR2:3 '-gatagg tgg att atg tgt c-5 ' to carry out RT-PCR amplification HIV RNA positive sample, obtain the amplified production of 282bp.
(2) extension amplification outcome
Extension amplification outcome in pGEM-T (Promega Cat.A3600) carrier, is made up HIV-1 positive control plasmid.
(3) in-vitro transcription
The HIV-1 positive control plasmid that obtains is transformed in the escherichia coli DH5a, and called after pTIPC bacterial strain is stored in-70 ℃.After getting this bacterial strain and containing a large amount of cultivation of LBA nutrient solution of 1%Amp, prepare a large amount of plasmids with the plasmid extraction test kit (Wizard plus Maxipreps DNA Purification System) of Promega company.Cut evaluation (Apal+Sacl double digestion) through enzyme, the 2%Agarose electrophoresis is seen the purpose fragment of about 350bp.The above-mentioned a large amount of plasmids that prepare are cut into shape material grain with the restriction endonuclease Sal of Promega company, reclaim test kit with glue and enzyme is cut product carry out purifying.Shape material grain behind the purifying is transcribed into RNA with the Riboprobe Combination System (use t7 rna polymerase) of Promega company with it.
(4) purifying is removed DNA
Handle the above-mentioned HIV-1 in-vitro transcription RNA that obtains with Dnase, the dna profiling that digestion is wherein remaining.Rnase Mini Kit with QIAGEN company is further purified the transcript RNA that obtains then.The RNA that purifying obtains measures through ultraviolet spectrophotometer, OD260/OD280=1.95.
(5) RNA identifies
The A.RNA electrophoresis
Identify through 1.4% sepharose formaldehyde electrophoresis and to contain purpose RNA band
The evaluation that B.RT-PCR amplification and DNA remove is carried out the RT-PCR amplification with primer to HIV in-vitro transcription RNA, with the RNA behind the purifying according to 1: 10
4, 1: 10
5, 1: 10
6Multiple dilution, first group carry out reverse transcription earlier after, on LightCycler, increase again, second group is then directly carried out fluorescent PCR with first group simultaneously, detected result shows the existence that has detected among the RNA behind the purifying less than DNA.
According to disclosure of the present invention; those skilled in the art need not too much test and can implement the present invention's test kit of nucleic acid amplification (PCR) detection by quantitative human immunodeficiency virus (HIV) copy number that utilizes required for protection, and produce a desired effect.Embodiment disclosed by the invention only describes the present invention, but is not to be construed as limiting the invention.Those skilled in the art are with conspicuous similar surrogate or transformation; or substitute preparation described here at preparation relevant chemically or on the physiology with some; or associated viscera of the present invention changed; but do not exceed spirit of the present invention, scope and thought, all fall into the scope of protection of present invention.
Sequence table
SEQ.ID.NO.1：5’-taa?aca?cag?tgg?ggg?gac?gtc?a-3’。
SEQ.ID.NO.2：5’-taa?aca?tag?tgg?ggg?gac?acc?a-3’。
SEQ.ID.NO.3：5’-ttc?ctg?cta?tgt?cac?ttc?ccc?t-3’。
SEQ.ID.NO.4：5’-g?ggg?aca?tca?agc?agc?cat?gca?aat-3’。
SEQ.ID.NO.5：5’-g?ggg?aca?cca?ggc?agc?aat?gca?aat-3’。
SEQ.ID.NO.6：5’-tac?tag?tag?ttc?ctg?cta?tgt?cac?ttt?c-3’。
SEQ.ID.NO.7：5’-g?ggg?aca?tca?agc?agc?cat?gca?aat-3’。
SEQ.ID.NO.8：5’-FAM-acc?atc?aat?gag?gaa?gc-TAMRA(MGB)-3’。
SEQ.ID.NO.9：3’-gct?ttc?agc?cca?gaa?gta?a-5’。
SEQ.ID.NO.10：3’-gat?agg?tgg?att?atg?tgt?c-5’。
SEQ.ID.NO.11：
TAAACACAGTGGGGGGACATCATTCTATTCGAGATCTCCTCGACACCGCCTCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGTTCACCTCACCATACAGCACTCAGGCAAGCTATTCTGTGTTGGGGTGAGTTGATGAATCTGGCCACCTGGGTGGGAAGTAATTTGGAAGACCCAGCATCCAGGGAATTAGTAGTCAGCTATGTCAATGTTAATATGGGCCTAAAAATCAGACAACTATTGTGGTTTCACATTTCCTGTCTTACTTTTGGAAGAGAAACTGTTCTTGATATTTGGTATCTTTTGGAGTGTGGATTCGCACTCCTCCAGCTTACAGACCACCAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGAGGCAGGTCCCCTAGAAGAA
AGG GGAAGTGACATAGCAGGAA
Claims (7)
1, the fluorescence quantitative detection kit of a kind of human immunodeficiency virus HIV-1, it is characterized in that comprising lysate, silica gel adsorption column, washings, elutriant, primer, probe, working standard, enzyme mixture and contrast agents, wherein, described lysate is the guanidine thiocyanate solution of virion in cracking serum and the plasma specimen, described washings contains ethanolic soln, and containing guanidine thiocyanate solution and Tris solution, described elutriant contains 0.04%NaN
3The sterilization distilled water of no Rnase, described probe is the MGB-Taqman probe, its sequence is: 5 '-FAM-acc atc aat gag gaagc-TAMRA (MGB)-3 '; Described working standard is the grade dilution that contains HIV-1 gag gene in vitro transcribe rna, and described enzyme mixture is reversed transcriptive enzyme, DNA cloning enzyme and Dntp, and described primer is selected from the conserved sequence in coding HIV gene gag district, and is a kind of of following combination:
Combination A:
Primer 1 (F): 5 '-taa aca cag tgg ggg gac ate a-3 ',
Primer 2 (F): 5 '-taa aca tag tgg ggg gac acc a-3 ',
Primer 3 (R): 5 '-ttc ctg cta tgt cac ttc ccc t-3 ',
Combination B:
Primer 1 (F): 5 '-g ggg aca tca agc agc cat gca aat-3 ',
Primer 2 (F): 5 '-g ggg aca cca ggc agc aat gca aat-3 ',
Primer 3 (R): 5 '-tac tag tag ttc ctg cta tgt cac ttt c-3 ',
Combination C:
Primer 1 (F): 5 '-g ggg aca tca agc agc cat gca aat-3 ',
Primer 2 (F): 5 '-tag tag ttc ctg cta tgt cac ttc c-3 ',
Primer 3 (R): 5 '-ttc ctg cta tgt cac ttc ccc t-3 ',
In above-mentioned 3 kinds of combinations, primer 1 and primer 3 pairings, be used to increase B, C, D hypotype, primer 2 and primer 3 pairings, the A that is used to increase, E hypotype.
2, test kit according to claim 1 is characterized in that said silica gel adsorption column adopts negative pressure of vacuum method for extracting purified virus RNA.
3, test kit according to claim 1 is characterized in that internal reference product P1, P2, P3, P4, P5 select A, B/C, C, D, the E hypotype of HIV-1 C-type virus C respectively for use.
4, test kit according to claim 1 is characterized in that to contain 0.05%NaN
3The negative contrast of PHS of HIV-1 RNA feminine gender, be quantitative contrast with the non-infectious HIV-1 in-vitro transcription RNA that contains different copy numbers; 4 parts of working standards are the RNA in-vitro transcription thing that contains the HIV gene, in advance with making its HIV rna gene copy number roughly respectively 10 after the RNA diluted
6, 10
5, 10
4, 10
3About copy/ml.
5, test kit according to claim 1 is characterized in that strong positive contrast contains to have an appointment 2 * 10
6The non-infectious HIV-1 in-vitro transcription RNA of copy/ml, weak positive control contains has an appointment 2 * 10
4The non-infectious HIV-1 in-vitro transcription RNA of copy/ml.
6, test kit according to claim 1 is characterized in that the working standard that contains HIV-1gag gene in vitro transcribe rna is prepared by following step:
(1) uses forward primer IF2:3 '-gct ttc agc cca gaa gta a-5 ' and reverse primer IR2:3 '-gat agg tgg att atg tgt c-5 ' to carry out RT-PCR amplification HIV RNA positive sample, obtain the amplified production of 282bp;
(2) extension amplification outcome makes up HIV-1 positive control plasmid in the pGEM-T carrier;
(3) HIV-1 positive control plasmid is transformed in the escherichia coli DH5a, and called after pTIPC bacterial strain is stored in-70 ℃;
(4) purifying is removed DNA, and identifies RNA.
7, test kit according to claim 1 is characterized in that adding in the described lysate internal reference RNA that classifies SEQ.ID.NO.11 in order as.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100238059A CN100340673C (en) | 2005-02-03 | 2005-02-03 | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100238059A CN100340673C (en) | 2005-02-03 | 2005-02-03 | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1680598A CN1680598A (en) | 2005-10-12 |
| CN100340673C true CN100340673C (en) | 2007-10-03 |
Family
ID=35067345
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100238059A Active CN100340673C (en) | 2005-02-03 | 2005-02-03 | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100340673C (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100419089C (en) * | 2006-10-09 | 2008-09-17 | 卫生部北京医院 | Nucleotide sequence for fast inspecting HIV virus, its method and extra-diagnostic reagent kit |
| CN101323883B (en) * | 2008-06-23 | 2011-01-12 | 淮安市第四人民医院 | Primer arm TaqMan-MGB probe PCR hepatitis b virus detection method and reagent box thereof |
| CN103045756A (en) * | 2012-01-16 | 2013-04-17 | 中山大学达安基因股份有限公司 | Reagent kit of detecting human immunodeficiency virus type 1 by fluorescence quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) |
| CN106119413B (en) * | 2016-07-01 | 2020-03-20 | 浙江省疾病预防控制中心 | AIDS virus multiple fluorescence PCR detection kit and detection method |
| CN109777891A (en) * | 2019-03-19 | 2019-05-21 | 上海邦耀生物科技有限公司 | A kind of combination and detection method of the primer pair detecting gag gene and fluorescence probe |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1191975A (en) * | 1997-01-17 | 1998-09-02 | 霍夫曼-拉罗奇有限公司 | Gag gene primers for detection of HIV-1 |
| CN1271020A (en) * | 1999-02-02 | 2000-10-25 | 奥索临床诊断有限公司 | Effective test HIV-1 and HIV-2 oligonucleotide reverse transcirpt initiator and its using method |
| CN1515687A (en) * | 2003-01-12 | 2004-07-28 | 虹 王 | HIV-1/HUV2 universal probe and primer PCR detection technique |
-
2005
- 2005-02-03 CN CNB2005100238059A patent/CN100340673C/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1191975A (en) * | 1997-01-17 | 1998-09-02 | 霍夫曼-拉罗奇有限公司 | Gag gene primers for detection of HIV-1 |
| CN1271020A (en) * | 1999-02-02 | 2000-10-25 | 奥索临床诊断有限公司 | Effective test HIV-1 and HIV-2 oligonucleotide reverse transcirpt initiator and its using method |
| CN1515687A (en) * | 2003-01-12 | 2004-07-28 | 虹 王 | HIV-1/HUV2 universal probe and primer PCR detection technique |
Non-Patent Citations (1)
| Title |
|---|
| 多引物嵌套式聚合酶链式反应在艾滋病病毒感染诊断中的应用 吴守丽 等，中国性病艾滋病防治，第8卷第4期 2002 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1680598A (en) | 2005-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021174674A1 (en) | Composition, kit and method for detecting and typing coronaviruses | |
| EP3882364B1 (en) | Dual detection kit for 2019 novel corona virus | |
| CN111334615B (en) | Novel coronavirus detection method and kit | |
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| CN100340673C (en) | Fluorescent quantitative detecting kit of human immune deficiency virus HIV-1 nucleic acid amplification | |
| CN111334614A (en) | Method for detecting novel coronavirus by RT-qPCR technology | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN102586473A (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN1164767C (en) | Fluorescent quantitative PCR kit for rapid and quantitative detecting hog choleravirus and hog cholera lapinized vaccine and its use | |
| CN117467803A (en) | Primer and probe combination for detecting corn noctuid HzNV-1 virus and application thereof | |
| CN113186321A (en) | Absolute fluorescence quantitative PCR (polymerase chain reaction) detection method for blastocyst protozoa | |
| CN116555456B (en) | Detection method and application of mycobacterium tuberculosis Ag85B mRNA | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| CN104831000A (en) | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) kit for cherry virus detection and detection method | |
| CN114774590A (en) | Double-target combination, primer combination, reagent, kit, method and application for detecting African swine fever virus | |
| CN113755620A (en) | Nucleic acid detection kit for rapidly detecting two leishmania and application thereof | |
| CN1904069A (en) | Measles virus fluorescent augmentation detection kit and detection method | |
| CN102676690B (en) | Reagent kit, method, primers and probe for quantitative detection of nucleic acid of swine fever virus | |
| CN113549709A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN113293235B (en) | Primer for frog virus detection and application thereof | |
| CN111004868A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting goat intranasal tumor virus | |
| CN103882150A (en) | Primer, probe and real-time fluorescent PCR (polymerase chain reaction) method for detecting TTSuV II (torque teno sus virus II) | |
| CN102417935B (en) | Nucleic acid quantitative determination kit, detection method, primers and probes for Newcastle disease virus (NDV) | |
| CN117947219A (en) | Primer and probe combination for detecting noctuid TnCLV virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |