CN100339480C - Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application - Google Patents
Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application Download PDFInfo
- Publication number
- CN100339480C CN100339480C CNB2005100830357A CN200510083035A CN100339480C CN 100339480 C CN100339480 C CN 100339480C CN B2005100830357 A CNB2005100830357 A CN B2005100830357A CN 200510083035 A CN200510083035 A CN 200510083035A CN 100339480 C CN100339480 C CN 100339480C
- Authority
- CN
- China
- Prior art keywords
- plant
- salt
- gene
- sequence
- wild
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses a salt and drought resistant gene from mustard salt and a coded protein thereof. The gene has one of the following nucleotide sequences of a DNA sequence of SEQ ID No. 1 in a sequence list, and a nucleotide sequence which can be hybridized with the DNA sequence limited by SEQ ID No. 1 in the sequence list under the high precision condition. The coded protein of the gene has an amino acid residue sequence of SEQ ID No. 2 in the sequence list. The salt and drought resistant gene has an important function in breeding plants with enhanced salt resistance (such as rice, wheat, etc.).
Description
Technical field
The present invention relates in the plant to coerce relevant gene and proteins encoded and application, particularly salt tolerant, anti-drought gene and a proteins encoded thereof in the salt mustard and its application in cultivating salt tolerant, drought resistance raising plant with anti-.
Background technology
Studies show that some close relatives of Arabidopis thaliana have extremely strong resistance of reverse, and the suitable genetic manipulation that carries out.Wherein, halophytes-salt mustard is very similar to Arabidopis thaliana, and the gene order homology can reach 70-90%, not only has the gratifying form of genetics model plant, growth characteristics and genetic characteristics, and also the high salt concentration to seawater has stronger tolerance.Therefore, still not a kind of excellent hereditary pattern plant of salt mustard, a kind of especially resource plant that separates excellent salt tolerant, gene related to drought tolerance for research plant nature salt tolerant mechanism.
Summary of the invention
The salt tolerant, anti-drought gene and the proteins encoded thereof that the purpose of this invention is to provide a salt mustard.
Salt tolerant provided by the present invention, anti-drought gene, name is called ST6-66, derives from cress salt mustard (Thellungiella halophila), is one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 1 dna sequence dna;
2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.
The rigorous condition of described height be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.
SEQ ID № in the sequence table: 1 by 695 based compositions, and its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 50-583 bit base.
Salt tolerant of the present invention, the coded albumen (ST6-66) of anti-drought gene also belong to protection scope of the present invention.It is to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence.SEQ ID № in the sequence table: 2 are made up of 177 amino-acid residues.
Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.
Arbitrary segmental primer is to also within protection scope of the present invention among the amplification ST6-66.
Utilize plant expression vector, salt tolerant of the present invention, anti-drought gene are imported vegetable cell, can obtain transgenic cell line and transfer-gen plant high salt, arid tolerance enhanced.
Described plant expression vector comprises the double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described plant expression vector also can comprise 3 ' end untranslated zone of foreign gene, promptly comprise the polyadenylic acid signal and any other participated in mRNA processing or the dna fragmentation of genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor, and the non-translational region of inducing (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein gene) 3 ' end to transcribe as the Agrobacterium crown-gall nodule all has similar functions.
When using ST6-66 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter, as cauliflower mosaic virus (CAMV) 35S promoter, root specific expression promoter etc., they can use separately or be used in combination with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.
For the ease of transgenic plant cells or plant being identified and screening, can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in plant, to express, have the antibiotic marker thing (gentamicin marker, kantlex marker etc.) of resistance or anti-chemical reagent marker gene (as anti-weedkiller gene) etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.
Carry ST6-66 of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated by using, and the plant transformed cell or tissue is cultivated into plant.By the plant transformed host both can be monocotyledonss such as paddy rice, wheat, also can be dicotyledonss such as Arabidopis thaliana, soybean, rape.
By resulting transgenic arabidopsis plant after transforming salt tolerant provided by the present invention, anti-drought gene ST6-66 is carried out the environment stress test, prove that this gene can significantly improve the salt tolerance of plant after changing plant over to.The present invention provides the foundation for degeneration-resistant and anti-retrocorrelation expression of gene in the artificial controlling plant, will play an important role in cultivating resistance and resistance of reverse enhanced plant (particularly farm crop such as paddy rice, wheat, rape).
The present invention will be further described below in conjunction with specific embodiment.
Description of drawings
Figure 1A is the physical map of carrier pCB2004
Fig. 1 is for to coerce the ST6-66 transformant of processing and the growing state of wild-type Arabidopis thaliana through 100Mm NaCl
Fig. 2 is for to coerce the ST6-66 transformant of processing and the growing state of wild-type Arabidopis thaliana through 150Mm NaCl
Fig. 3 is for to coerce the ST6-66 transformant of processing and the biomass statistics of wild-type Arabidopis thaliana through 100Mm NaCl, 150Mm NaCl
Fig. 4 is for to coerce the ST6-66 transformant of processing and the surviving rate statistics of wild-type Arabidopis thaliana through 100Mm NaCl, 150Mm NaCl, 165Mm NaCl and 180Mm NaCl
Fig. 5 A for coerce through the soil that contains 250Mm NaCl treatment S T6-66 transformant and wild-type Arabidopis thaliana in growing state
Fig. 5 B is ST6-66 transformant and the growing state of wild-type Arabidopis thaliana in salt-free edatope
Fig. 6 is respectively through containing 0Mm NaCl and containing the ST6-66 transformant of 250Mm NaCl soil treatment after 9 days and the lotus tongue diameter statistics of wild-type Arabidopis thaliana
The statistics of seed grain number in the fruit pod that Fig. 7 is tied for the ST6-66 transformant after containing 250Mm NaCl soil treatment respectively and wild-type Arabidopis thaliana
The growing state of drought stress plant after 20 days that Fig. 8 carries out in soil for ST6-66 transgenic arabidopsis and wild-type Arabidopis thaliana
The drought stress that Fig. 9 carries out in soil for ST6-66 transgenic arabidopsis and wild-type Arabidopis thaliana lotus tongue diameter statistics after 15 days
Plant strain growth situation after the drought stress that Figure 10 carries out in soil for ST6-66 transgenic arabidopsis and wild-type Arabidopis thaliana recovers after 20 days to water three days
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment.
The acquisition of embodiment 1, salt mustard resistant gene of salt ST6-66
One, the structure in salt mustard cDNA library
Extract the total RNA of salt mustard, reverse transcription obtains the complete genomic cDNA of salt mustard, and (Marvin's is beautiful for Wang Zonggui, Zheng Wenling for the method (Gateway Technology) of employing high flux construction carrier; Gateway cloning system: the new development of DNA recombinant technology. Chinese biological engineering magazine (2003), the 23rd the 7th phase of volume), with salt mustard cDNA elder generation recombinant clone to pDONR207 carrier (Invitrogen company), obtain Entry cDNA library, and then shuttled back and forth to the plant overexpression binary vector pCB2004 (physical map is shown in Figure 1A) that contains 35S promoter in whole cDNA library with recombinant clone, obtain salt mustard cDNA library.Above-mentioned recombining reaction carries out according to the experiment guide that Invitrogen provides fully.
Two, salt mustard cDNA library is transformed the wild-type Arabidopis thaliana
Shuttled back and forth in binary vector pCB2004 in the salt mustard cDNA library that step 1 makes up, electricity is converted into Agrobacterium C58, adopts the Arabidopis thaliana inflorescence to soak the extensive arabidopsis thaliana transformation of method (floral dip method) (Steven J.Clough and AndrewF.Bent:Floral dip:a simplified method forAgrobacterium-mediatedtransformation of Arabidopsis thaliana.The Plant Journal:Volume 16 Issue6 Page 735-December 1998) that flower transforms.
Three, the screening of arabidopsis thaliana salt-tolerance transformant
1, the establishment in Arabidopis thaliana transformant storehouse
The conversion that extensive sowing step 2 obtains in soil has the seed of the Arabidopis thaliana transformant in salt mustard cDNA library, behind seed germination about 5 days, surface sprinkling concentration is 0.2% weedicide (glufosinate ammonium, commercial Liberty by name, France Aventis crop science company) screening, is contrast with the wild-type Arabidopis thaliana.Can observe the transformant plant after about 1 week and the wild-type plant has significant difference, the wild-type plant can not survive under 0.2% weedicide glufosinate condition, and the transformant plant is unaffected, can normal growth.With 200 strain transformant plant is that kind is received by a unit.
2, high throughput method primary dcreening operation salt tolerant transformant plant
Used seed all carries out the surface sterilization processing with the following method in following each experiment: at room temperature sterilized 15 minutes with 50% thimerosal (Guangzhou Blue Moon Co., Ltd), use purified rinse water 4-5 time through sterilization again.
To place 3 days down at 4 ℃ through the seed of disinfectant step 1 results, so that the seed germination unanimity.Then planting seed is made its germination on MS minimum medium (containing 2% sucrose, 1.5% agar powder, pH value 5.8, high-temperature steam sterilization 15 minutes), the seed germination growth conditions is: 22 ℃, and illumination cultivation.After the germination, it is seeded in high flux screening salt tolerant transformant on the MS substratum that contains 220mM NaCl and 25mg/L weedicide glufosinate, each culture dish is broadcast 3,000 seeds again.Treat plant strain growth after 10 days, in soil, and individual plant is received kind with the transformant plantlet of transplant of surviving.
3, the multiple sieve of salt tolerant transformant
To each possible salt tolerant transformant, after choosing its about 25 to 30 seeds and carrying out surface sterilization, be seeded on the saliferous MS substratum of different concns with the method for above-mentioned steps 2, salt concn is between 0-200mM NaCl.Corresponding data is observed and write down to seed growth after about one week, observe after 10 days, the plant quantity of statistics survival, calculate survival plant quantity and dead plant quantity, ratio is higher than 3: 1 the segregation ratio that meets between the two, may be salt-resistance strain, the survival plant be moved into contain on the MS substratum of 25mg/L weedicide glufosinate, week back observation seedling survival condition.If seedling is all survived, show that the salt-tolerance character and the anti-herbicide gene of above-mentioned possible salt-resistance strain is chain, meet the screening requirement.At last, transplant above salt-resistance strain in soil, individual plant is received and is planted, and seed is preserved standby.
Four, the acquisition of salt tolerant, anti-drought gene ST6-66
Insert the upstream and downstream sequences Design primer amplification cDNA sequence in site according to salt mustard cDNA in carrier pCB2004, primer sequence is as follows:
Omega：5’TTTTTACAACAATTACCAACAACAACAA3’；
attB2：5’-TACAAGAAAGCTGGGTTTTTTTTTTTT-3’
The genomic dna of the salt tolerant transformant that the extraction step three screening obtains, and as template, under the guiding of primer Omega and attB2, carry out pcr amplification, the 50uLPCR amplification system is 0.25uL ExTaq polysaccharase (precious biotechnology (Dalian) company limited), 2uL genomic dna, 10*PCR damping fluid 5uL, dNTPs 100uM, primer each 25uM in upstream and downstream is supplemented to 50uL with distilled water with reaction system again.The salt mustard cDNA that changes over to round pcr amplification.The PCR reaction conditions is: first 95 ℃ of 1min, 66 ℃ of 1min again, last 72 ℃ of 2min, totally 40 circulations.After reaction finishes, the PCR product is checked order, sequencing result shows that this gene has the SEQ ID № in the sequence table: 1 nucleotide sequence, by 695 based compositions, its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 50-583 bit base.Go up and arabidopsis gene group genome sequence carries out sequence alignment at website TAIR (www.arabidopsis.org), comparison result shows this gene and the homogenic homology of Arabidopis thaliana up to 79%, with this salt tolerant, anti-drought gene called after ST6-66.
Make up the overexpression carrier of ST6-66 with the method for embodiment 1, ST6-66 is cloned among the overexpression binary vector pCB2004 that contains 35S promoter, obtain the overexpression carrier of ST6-66, called after pCB2004/ST6-66.After order-checking is identified correctly, change pCB2004/ST6-66 over to Agrobacterium with electrotransformation, use inflorescence method for transformation (floral dip method) to transform wild-type Arabidopis thaliana plant again.Then transfer-gen plant is carried out the salt tolerant experiment, method is: select a wherein strain transfer-gen plant (called after ST6-66), its seed is seeded in respectively contains 100Mm NaCl, 150Mm NaCl, on the MS solid medium of 165Mm NaCl and 180Mm NaCl, with the wild-type Arabidopis thaliana is contrast, under normal condition, cultivate, observe and record germination and growing state, the result is as depicted in figs. 1 and 2 (among the figure, that the black line left side is sowed is transfer-gen plant ST6-66, that the black line right side is sowed is wild-type plant (WT)), coerce down at 100mM NaCl, the rejection ratio wild-type (WT) that transformant (ST6-66) growth is subjected to is low, and under 150mM NaCl condition of salt stress, the wild-type growth obviously is suppressed, the upgrowth situation of transformant then significantly is better than wild-type, shows that salt tolerance strengthens.Measure transformant (ST6-66) and the biomass of wild-type (WT) under above-mentioned different concns salt stress, the result as shown in Figure 3, the biological value of transformant is significantly higher than wild-type, shows that its salt resistance significantly strengthens than wild-type.Statistics is coerced the surviving rate of plant down in last different salt concn, and the result is no more than in salt concn under the situation of 150mM NaCl as shown in Figure 4, and surviving of plant is unaffected, transformant and wild-type indifference; When NaCl concentration reached 165mM, the wild-type surviving rate was reduced to 20%, and transformant also remains on 80%; When salt concn during to 180mM, wild-type is dead fully, and the survival rate of transformant approximately also can remain on 40%.
The ST6-66 transfer-gen plant ST6-66 that embodiment 2 is obtained and the planting seed of wild-type Arabidopis thaliana (WT) are in soil, cultivate under the same conditions, to be generated be about for 2 weeks after, two kinds of Arabidopis thaliana plant are moved to proceed in the soil that contains 0mM NaCl (contrast) and contain 250mM NaCl to cultivate, observe and write down its growing state, the growing state of plant after salt stress handled for 1 week is shown in Fig. 5 A and Fig. 5 B, and the transformant salt tolerance significantly is better than the wild-type plant.After above-mentioned salt stress is handled 9 days, measure lotus tongue diameter, the result as shown in Figure 6, the wild-type plant growth obviously is suppressed, its plant size is significantly less than transformant.Also more remarkable to the influence of seed production after above-mentioned salt stress is handled, but the influence that wild-type is subjected to is even more serious, as shown in Figure 7, behind salt stress, each seed number in really pressing from both sides of transformant is significantly higher than wild-type.
The drought stress experiment that embodiment 4, ST6-66 transgenic arabidopsis carry out in soil
With the planting seed of ST6-66 transfer-gen plant ST6-40 and wild-type Arabidopis thaliana (contrast WT) in soil, cultivate under the same conditions, waited to grow to 10 days big hour, implement drought stress, not watering in continuous 20 days, is contrast with the ST6-40 and the wild-type Arabidopis thaliana of growing under the normal condition.The result as shown in Figure 8, here withering appears in the wild-type plant, and the slight phenomenon of here withering only appears in transfer-gen plant, shows that ST6-66 expresses in Arabidopis thaliana, not only can strengthen its salt tolerance, also can strengthen its drought tolerance.Drought stress was handled after 15 days, measured lotus tongue diameter, the result as shown in Figure 9, the wild-type plant growth obviously is suppressed, its plant size is significantly less than transformant ST6-66.
After handling 20 days, begin to pour water and recover to test through drought stress.Through 3 days the recovery of watering, as shown in figure 10, transformant obviously was returned to the normal growth level, but the wildness plant is except that there being a strain to be returned to the basic normal condition, and all the other plant are all normal less than replying, and arid causes death.
Extract the RNA of ST6-66 transfer-gen plant and wild-type Arabidopis thaliana, and be template with two kinds of RNA respectively, under the guiding of primer attB1:5 '-acaagtttgtacaaaaaagcaggct-3 ' and primer attB2:5 '-tacaagaaagctgggtttttttttttt-3 ', carrying out RT-PCR detects, with Tubulin is with reference to (primer sequence of amplification Tubulin is: β-tubulinP1:5 '-CGTGGATCACAGCAATACAGAGCC-3 ' and β-tubulinP2:5 '-CCTCCTGCACTTCCACTTCGTCTTC-3 '), transfer-gen plant ST6-66 can amplify ST6-66 as a result,, show ST6-66 change over to behind the Arabidopis thaliana can be under the 35S promoter effect overexpression.
Sequence table
<160>2
<210>1
<211>695
<212>DNA
＜213〉cress salt mustard (Thellungiella halophila)
<400>1
gcaggctggg?gatccaacaa?aaaaaaaact?atattcagcg?agaaaaaaaa?aaccaaaaga 60
tgaacttcat?ctctgatcag?gaaaaaaaac?tctccaaccc?gaaaacggcg?gagccggagc 120
acatcaagcc?cgtcgaagga?accgaaacaa?ccaaaaaacc?agcttcctcc?gccgaggtct 180
gggctggggc?caagattgta?cccaaagctg?ctcaagccgc?agctcgtaac?gaatccgaca 240
aactcgacaa?gggtaaagtc?gccggagcca?gcgttgatat?cttaaacgcc?gccgagaagt 300
acggtaagct?cgatgaaaaa?agcggtgttg?gtcagtacct?cgagaaggcc?gagaagtttc 360
tcaacgagta?cgaatctaca?cactctactt?ccggcgccgg?tgctcctcct?ccggcggcgg 420
caagtcatga?tgatccggcg?gcggcgagtc?atgaggagcc?ggcagctaaa?aaagccattg 480
aaaagtctgg?tggtggtttg?ggaggttatg?caaagatggc?tcagggtttc?atgaagggat 540
ttgtgatctt?tatttgtagt?tttattcatg?cgcgtaataa?taagattaaa?taactaagtc 600
cgctatttag?aaattatgtt?ggatcgttaa?gtatggccgt?atgatgaaat?aataactttt 660
ggagatcttc?aaaaaaaaaa?aaaaaaaaaa?aaaaa 695
<210>2
<211>177
<212>PRT
＜213〉cress salt mustard (Thellungiella halophila)
<400>2
Met?Asn?Phe?Ile?Ser?Asp?Gln?Glu?Lys?Lys?Leu?Ser?Asn?Pro?Lys?Thr
1 5 10 15
Ala?Glu?Pro?Glu?His?Ile?Lys?Pro?Val?Glu?Gly?Thr?Glu?Thr?Thr?Lys
20 25 30
Lys?Pro?Ala?Ser?Ser?Ala?Glu?Val?Trp?Ala?Gly?Ala?Lys?Ile?Val?Pro
35 40 45
Lys?Ala?Ala?Gln?Ala?Ala?Ala?Arg?Asn?Glu?Ser?Asp?Lys?Leu?Asp?Lys
50 55 60
Gly?Lys?Val?Ala?Gly?Ala?Ser?Val?Asp?Ile?Leu?Asn?Ala?Ala?Glu?Lys
65 70 75 80
Tyr?Gly?Lys?Leu?Asp?Glu?Lys?Ser?Gly?Val?Gly?Gln?Tyr?Leu?Glu?Lys
85 90 95
Ala?Glu?Lys?Phe?Leu?Asn?Glu?Tyr?Glu?Ser?Thr?His?Ser?Thr?Ser?Gly
100 105 110
Ala?Gly?Ala?Pro?Pro?Pro?Ala?Ala?Ala?Ser?His?Asp?Asp?Pro?Ala?Ala
115 120 125
Ala?Ser?His?Glu?Glu?Pro?Ala?Ala?Lys?Lys?Ala?Ile?Glu?Lys?Ser?Gly
130 135 140
Gly?Gly?Leu?Gly?Gly?Tyr?Ala?Lys?Met?Ala?Gln?Gly?Phe?Met?Lys?Gly
145 150 155 160
Phe?Val?Ile?Phe?Ile?Cys?Ser?Phe?Ile?His?Ala?Arg?Asn?Asn?Lys?Ile
165 170 175
Lys
Claims (6)
1, the salt mustard salt tolerant, anti-drought gene, its base sequence is shown in SEQ ID NO:1.
The proteins encoded of the described salt tolerant of 2 claims 1, anti-drought gene, its aminoacid sequence is shown in SEQ ID NO:2.
3, the expression vector that contains the described salt tolerant of claim 1, anti-drought gene.
4, the transgenic cell line that contains the described salt tolerant of claim 1, anti-drought gene.
5, the host bacterium that contains the described salt tolerant of claim 1, anti-drought gene.
6, a kind of method of cultivating salt tolerant, drought-resistant plant is to utilize plant expression vector that the described salt tolerant of claim 1, anti-drought gene are imported vegetable cell, obtains high salt, arid tolerance enhanced transgenic cell line and transfer-gen plant; Described is Arabidopis thaliana by the plant transformed host.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100830357A CN100339480C (en) | 2005-07-12 | 2005-07-12 | Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100830357A CN100339480C (en) | 2005-07-12 | 2005-07-12 | Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1727482A CN1727482A (en) | 2006-02-01 |
| CN100339480C true CN100339480C (en) | 2007-09-26 |
Family
ID=35927005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100830357A Expired - Fee Related CN100339480C (en) | 2005-07-12 | 2005-07-12 | Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100339480C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979407B (en) * | 2010-10-14 | 2012-08-22 | 北京市农林科学院 | Plant drought and salt tolerance-related protein TaCRF2 and coding gene thereof and application |
| CN102140133B (en) * | 2010-12-22 | 2012-08-22 | 北京市农林科学院 | Protein ErABF1 related to drought resistance and salt tolerance of plant and encoding gene and application thereof |
| CN102154321B (en) * | 2011-03-09 | 2013-08-07 | 中国科学技术大学 | Method for breeding stress-resistance transgenic rice |
| CN102250900B (en) * | 2011-06-29 | 2013-01-30 | 北京师范大学 | Thellungiella salsuginea COR15a gene promoter and application thereof |
| CN102517325B (en) * | 2011-12-20 | 2013-07-31 | 中央民族大学 | Application of Thellungiella halophila ThPER42 gene |
| CN102517324B (en) * | 2011-12-20 | 2013-07-10 | 中央民族大学 | Application of Thellungiella halophila ThPER32 gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448511A (en) * | 2002-04-02 | 2003-10-15 | 张洪霞 | Salt tolerance gene MGX4 and method of breeding its salt tolerance drought resistant plant variety |
-
2005
- 2005-07-12 CN CNB2005100830357A patent/CN100339480C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448511A (en) * | 2002-04-02 | 2003-10-15 | 张洪霞 | Salt tolerance gene MGX4 and method of breeding its salt tolerance drought resistant plant variety |
Non-Patent Citations (1)
| Title |
|---|
| 植物抗旱耐盐基因工程研究及应用前景 刘国花等，世界农业，第7卷 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1727482A (en) | 2006-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1314944A (en) | Stress tolerance and delayed senesence in plants | |
| CN101955521B (en) | Plant stress tolerance associated protein, and coded genes and application thereof | |
| CN100339480C (en) | Halotolerant, drought resistance gene from Thellugiella halophila, coded protein and application | |
| CN107383179B (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN1324137C (en) | Salt resistant and drought resistant gene of Thellugielkla halophila and its coded protein and use | |
| CN1887903A (en) | Nitrate transport protein of diatom and its coding gene and application | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN104480120B (en) | Plant salt tolerance related gene PpSIG2 and its encoding proteins and application | |
| CN100349916C (en) | PHD transcription factor of soybean and its coding gene and usage | |
| CN100378221C (en) | Salt resistant gene of salt mustard and its coding protein and application thereof | |
| CN1940072A (en) | Antiglyphosate gene and its use | |
| CN104561036B (en) | Plant salt tolerance related gene PpSIG1 and its encoding proteins and application | |
| CN108409844B (en) | Application of protein TaNRT2.5 in regulation and control of plant yield | |
| CN1296383C (en) | Plant DREB transcription factor and its coding gene and uses | |
| CN1908011A (en) | Plant inverse-resistant zinc finger protein, coding gene and application thereof | |
| CN100368542C (en) | Salt resistant gene from salt mustard and its coding protein and application thereof | |
| CN1807627A (en) | Barbadosnut salt induced transcription factor and its coding gene and uses | |
| CN107326030A (en) | A kind of WRKY transcription factors of low potassium tolerance of regulation and control and its application | |
| CN102351950A (en) | Rice drought-tolerance related transcription factor gene OsWTF1, and coding protein and application thereof | |
| CN100368543C (en) | Salt resistant gene from salt mustard and its coding protein and application thereof | |
| CN1727483A (en) | Derive from salt tolerant, anti-drought gene and a proteins encoded thereof and the application of salt mustard | |
| CN1919867A (en) | Soybean Trihelix transcription factor, encode gene and application thereof | |
| CN103361361B (en) | Desiccation tolerance and resurrection related gene BdBCP1 from resurrection plant Boea densihispidula and application thereof | |
| CN106397557A (en) | Sweet potato adversity-tolerant associated protein IbFBA2, coding gene, recombinant vector and application | |
| CN111647613B (en) | Haematococcus willi Twpec 1 gene, application thereof and method for cultivating high-yield rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070926 Termination date: 20110712 |