CN111647613B

CN111647613B - Haematococcus willi Twpec 1 gene, application thereof and method for cultivating high-yield rice

Info

Publication number: CN111647613B
Application number: CN202010573462.8A
Authority: CN
Inventors: 林拥军; 陈太钰
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-06-22
Filing date: 2020-06-22
Publication date: 2021-11-26
Anticipated expiration: 2040-06-22
Also published as: CN111647613A

Abstract

The invention provides a Haematococcus willebrand Twpec 1 gene and application thereof and a method for cultivating high-yield rice, belonging to the technical field of plant genetic engineering, wherein the nucleotide sequence of the Haematococcus willebrand Twpec 1 gene is shown as SEQ ID No. 1. The invention provides a Haichia wegiana TwPEPC1 gene which has the function of improving the yield of rice and overcomes the defect of double-cell C₄C of plant origin₄Dependence of the gene on the floral ring type structure. Experimental results show that the Haichia wegiana TwPEPC1 gene is expressed in rice, the activity of PEPC enzyme of a transgenic plant is improved by 2-3 times compared with that of a raw rice plant, the photosynthesis rate is obviously improved, and the yield is obviously improved.

Description

Haematococcus willi Twpec 1 gene, application thereof and method for cultivating high-yield rice

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a Haematococcus williamsii TwPEPC1 gene, application thereof and a method for cultivating high-yield rice.

Background

As the population grows, the total amount of food demand by humans continues to rise, while the area of cultivated land decreases due to urbanization, which requires higher yield per unit of crop (Surridge, 2002). C₄Plant ratio C₃Plants have higher photosynthetic efficiency, greater biosynthetic capacity, higher NUE and WUE and broader adaptability, but most important crops such as rice, wheat, potato and soybean are C₃Plants (Von cammerer, 2003). Thus using transgenic technology at C₃Expression of C in crops₄The related gene (PEPC in particular) is also increased C₃One of the potential strategies for crop yield (Zhang inspired, 2009; Hibberd et al.，2008；Zhu et al.，2010a；Zhu et al.，2010b)。

Although most of C₄The plants all have a rosette-type structure, C₄The core metabolic pathway is accomplished in mesophyll cells and bundle sheath cells, but it has also been found in some organisms, such as, for example, Alternaria welchii (Thalasiosia weissflogii) and Hydrocotyle verticillata (Hydrilla verticillata). Alternaria williamsii (Thalassiosira weissflogii) is a species of Alternaria williamsii and belongs to the genus Alternaria in classification. The annual carbon fixation of the Haichia willebrand accounts for more than 25 percent of the inorganic carbon fixation amount of the ocean and reaches 1x10¹⁶Grams (Granum et al, 2005). The enzyme activity inhibitor 3, 3-dichloro-2-dihydroxy methyl phosphate-2-allyl alcohol (DCDP) of PEPC can greatly reduce photosynthetic efficiency of Haematococcus williamsii and high concentration CO₂And a low concentration of O₂Can restore its photosynthetic efficiency, and is in C₃This change was not observed in the form of Haematococcus welshii Chlamydomonas. More and more research results show that the Haematococcus williamsii does have a CCM mechanism and C₄Type photosynthetic physiological properties (Reinfelder et al, 2000). Waterweed (hydranthus verticillata) is a freshwater aquatic plant native to southeast asia. The waterweed is an inducible, unicellular and non-rosette structure C₄A plant. Under the conditions of short sunlight and low temperature, the waterweed leaf shows a classical C₃A type organism; but when the living conditions change to low concentrations of soluble CO₂Or at high temperature, the waterweed leaf induces a CCM mechanism with typical C₄Physiological and biochemical characteristics of plants (Reiskind J B et al, 1997). Soluble CO at low concentrations₂And at high temperature with C₄The activities of the relevant important enzymes, such as PEPC, NADP-ME and PPDK, were increased 10 to 16-fold, and asparagine and alanine aminotransferases were also rapidly induced (Salvucci and Bowes, 1981; Magnin et al, 1997).

PEPC is C₄One of the most important enzymes in the core cycle, which directly catalyze HCO₃ ^-Carboxylation with PEP produces OAA with concomitant release of Pi, whose activity is mainly regulated by phosphorylation of PEPCK (Walker and leewood,1996). PEPCs are widely found in living organisms, including algae, cyanobacteria, photosynthetic (heterotrophic) bacteria, fungi, yeasts, protozoa, plants, and animals (Kai et al, 2003). At C₃In plants, PEPC primarily provides additional OAA for the tricarboxylic acid cycle, and studies have shown that PEPC is also involved in amino acid uptake in rice (Masumoto et al, 2010). On the protein structure C₄PEPC-type activity is regulated by phosphorylation and dephosphorylation of a conserved Ser residue near the N-terminus (Nimmo, 2003); the results of the study show that C₄PEPC-type activity is also simultaneously activated by glucose-6-phosphate and inhibited by L-aspartate (Kai et al, 1999); while⁷⁷⁴"C" for Ser pair maintenance of Flaveria PEPC₄"characteristics are very critical (shooting et al, 2000). Corn C₄The PEPC type gene has a total length of about 6.8kb, consists of 10 exons and 9 introns, and has a cDNA length of about 2.9kb and encodes 970 amino acid residues (Lepinie et al, 1993).

At the end of the last century, there were many references to C₄PEPC at C₃Reports of heterologous expression in plants. Hudspeth and Grula (1992) were the earliest to convert corn-derived C₄The overexpression of PEPC in tobacco, results show that PEPC activity is increased by about 2.2-fold in the cytoplasm of transgenic plants compared to non-transgenic plants, but is still much lower than the endogenous PEPC activity of maize (Hudspeth et al, 1992). CO of transgenic tobacco plants of maize PEPC₂Assimilation efficiency and CO₂There is little change in photosynthetic properties such as compensation points (Kogami et al, 1994). In the transgenic rice of corn PEPC (containing a corn gene self-promoter, an exon and an intron), the PEPC enzyme activity is greatly improved to 110 times of the original activity, the endogenous PEPC activity level of a corn plant can be basically reached, but CO₂The assimilation rate was also not significantly changed, and the increase in PEPC activity decreased the photorespiration rate, which also indicates that maize C₄The gene can be used in C of rice and the like₃Correct transcription, splicing and translation in plants (Ku et al, 1999).

In the report, the exogenous PEPC gene is derived from the double-cell C₄The photosynthetic plants, such as corn,the effect of a gene depends on its specific "rosette" type organization, and it cannot exert the corresponding C in a single cell₄And meanwhile, the gene may have species regulation and modification specificity, so that the yield of the PEPC transgenic plant is not improved well.

Disclosure of Invention

In view of the above, the invention aims to provide a Haematococcus williamsii TwPEPC1 gene, application thereof and a method for cultivating high-yield rice, which can obviously improve the yield of rice.

In order to achieve the above purpose, the invention provides the following technical scheme:

the nucleotide sequence of the Haichia westernii TWPPC 1 gene is shown as SEQ ID No. 1.

The invention also provides application of the Haematococcus wegiae TwPEPC1 gene in the technical scheme in improving the yield of rice.

The invention also provides a method for cultivating high-yield rice by the Haematococcus wegiae TwPEPC1 gene in the technical scheme, which comprises the following steps:

(1) electrically transforming the Haichia wegiana TwPEPC1 gene into escherichia coli, carrying out amplification culture, and extracting plasmids to obtain cloned plasmids;

(2) digesting the cloning plasmid in the step (1) by using Kpn I single enzyme to obtain a cloning plasmid gene fragment, digesting the vector pC1300s by using Kpn I single enzyme to obtain a linear vector pC1300s, constructing the cloning plasmid gene fragment in the linear vector pC1300s to obtain a transformation vector, and introducing the transformation vector into agrobacterium to obtain a transformation strain;

(3) infecting the rice callus with the transforming strain of the step (2), and culturing the infected rice callus to obtain the high-yield rice.

Preferably, the method for obtaining the Haichia wegiana TwPEPC1 gene comprises the following steps: the DNA of the pseudonannochloropsis nandina gene is used as a template, and the degenerate primer pair is utilized to carry out PCR amplification to obtain the Welch nannochloropsis twPEPC1 gene.

Preferably, the degenerate primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID No. 3; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 4.

Preferably, the agrobacterium of step (2) comprises agrobacterium EHA 105.

Preferably, the infection in step (3) comprises: soaking the rice callus in OD₆₀₀And (3) adding the agrobacterium tumefaciens suspension with the value of 0.8-1.0 for 25-35 min.

Preferably, the rice callus in step (3) comprises rice embryogenic callus.

Preferably, the rice variety comprises medium flower 11 rice.

The invention provides a Haematococcus willebrand TwPEPC1 gene, wherein the nucleotide sequence of the Haematococcus willebrand TwPEPC1 gene is shown in SEQ ID No. 1. The invention designs a degenerate primer pair, obtains the Haichia wegiana TwPEPC1 gene, and overcomes the defect of double-cell C₄C of plant origin₄Dependence of the gene on the floral ring type structure. Experimental results show that the Haichia wegiana TwPEPC1 gene is expressed in rice, the activity of PEPC enzyme of a transgenic plant is improved by 2-3 times compared with that of a raw rice plant, the photosynthesis rate is obviously improved, and the yield is obviously improved.

Drawings

FIG. 1 is a diagram of pC1300s overexpression vector;

FIG. 2 is a graph showing the result of southern blotting hybridization;

FIG. 3 is a diagram of seed germination experiments, wherein the left, middle and right are diagrams of seed germination experiments of negative, heterozygous and homozygous families, respectively;

FIG. 4 is a diagram showing RT-PCR expression level detection;

FIG. 5 is a graph showing the results of PEPC relative to the enzyme activity;

FIG. 6 is a diagram showing the growth of the plants in the seedling stage, from left to right, including wild-type rice, high-yielding rice family 1, high-yielding rice family 19 and high-yielding rice family 46.

Detailed Description

The invention provides a Haematococcus williamsii TWPEC 1 gene, wherein the nucleotide sequence of the Haematococcus williamsii TWPEC 1 gene is shown as SEQ ID No.1, and specifically comprises the following steps:

ATGCTCTCCAATATGCTGGCTGAAGTGGTAAAGAAGGAGAATCCGGCTGTTTACGATCTATACACTACATTTCGTAGACTTGGAATGAAGAGAGCCGCCAATCCAGACGATCCAACCCCCTTCGAAGAAATGAAAAAGCTGGCCTATGATATCTCTCCCCACGATGCGCTTGGCGTCATGAAAACATTTTCCATCGCACTCAACTTAGTTAATGCTGCCGAAGTACATCACCGCATGCGTCTCGTTCGTAAAAATGAACATGCCGATGATACTCATCATATTGGTCCATTGCCAATGATCGAAGATAGCATTCGTGGAACCATGGAGATTTTGCTGGAGGATGATGGGGTGAGCCCAGATAGCATTTTTGCAGAGTTGATGAGTCAAAAATGTGAGATTGTATTGACGGCACATCCTACGGAGGTTAATCGCAAAACCATTATCAGGAAGTACCGCAATATTTCGGAATTGTTGGCACATTTGGAACGGCCTGATCTCCATCCTTTTGAATGTGCCGAGGCATTAAACAACTTGCGAGGAATCATTGCTGCGATTTGGGGATCTGATGAAATTAGACGTGTCAAACCAACGGTTCAGAAAGAAGCTGCTGGAGGGTGTGCTGTCATTGAATCTGTTCTTTGGGATGCGGTTCCGTCATATCTTCGCAAGCTCGATGCACAATGCCGCGTTACGCTCGGAAAGAAGCTACCTGTGGATGTTACCCCTGTAAAATTCGCCTCTTGGATAGGAGGAGATCGTGATGGAAATCCTAACTGTACTCCTGCTGTGACTCAAGAGGTTCTTGCTTACCAGAAACTCCGCGCTGCCAAGATGTTTTTGAATGACCTCAACTTCTTGTATTCTGAGTTGGCAATTTCCAGCCGATTCTCTCCAGAGCTAGAAGCACTCGCCGCCACAATTGAGAATTCCGACGACGAGCTCGAGAAGTACCGCCGCGTTATTGGCCATCTTCGCCGTCGTTTAGTTCGAACTGTCAAGGATTGTGAAGCCAAACTGCAATCTCTGGCGAAATCTCCTGAAACGTTGTCCGCCGAAGCTGCATTTGGAGCACTTGAAGGATGGGAAGATGTGGAACCAATCATGAAAACTGATGACTTGATGGCTCCTTTGAAGGTAATCTATGAGAGTTTGGTGACGACAGGATTTGAATTGGTGGCAGATGGACGCGTTTCGGATATTATTCGCCGCGTTGCAATCTTCGGGTTGACACTGGTGCCTCTCGATATTCGTGAGGAGTCTACTAAACATACTTTGGCTTTGGATGCAATTACTCGCCATCTGGGCATTGGAAGTTACAAGGAATGGGACGAAACAGCAAGGTTGAGCTGGTTACAATCTGAGTTGACGAGTCGACGCCCTCTTTTTCGCATAAGAGATGTTGAAAATAATTTGCTTGGGTTGGATCCTGATGTGATCAAGACTTTGATGGTATTCAAAGTAGCATCTGAGCAGGAACCGGAATCTCTGGGAGCATATGTCATTAGTCAGGCAACAAGTGCAAGCGATGTATTGGCAGTGATGTTATTGCAAAAGCAGTTTGGAATGACAAAGGCCACTGGCAAATTAATGCGTGTTGTGCCGTTGTTTGAGACTCTCGATGATTTAACTGGGTCACCGAAGCAACTCCAAACTCTTTTTGGGATCACGAGCTACATGGATGCGATCAACCGCAAACAAGAGGTAATGGTTGGATACTCTGATAGTGCAAAAGATGCAGGAAGACTCGCGGCTTGCTGGGCACAATACACTGCACAAGAAGCTATGGCGAAAGTGGCGGACAAATTTGGTGTCGAGCTGACTTTTTTCCATGGCAAGGGTGGAACTGTTGGACGAGGAGGCAACCCTGCTCTCTATCGCGCCATTCTATCCCATCCCCCAAACACTATCAATGGACGTTTCCGCGTCACTGAGCAAGGAGAAATGATCAGGCAGAACTTTGGCTCATTGGAAATCGCTGAGAGGTCATTGGATATTTACACAGCTGCATTGTTGAGAGAGCGCTTCACCAAGCATATCGAGCCGAAGCAAAAATGGAGAGATCAAATGCAACGAGTCTCCGAAGCCTCGTGTTCGAACTACCGATATCTTGTTCGAGAGGATCCACGATTTGTGCCATACTTCAGGCAGGCAACACCAGAGCTGGAGCTTGGTATATTGAACATCGGCAGTCGACCGGCCAAGCGTAATCCTAAGGGTGGTGTCGAAAGTCTGAGAGCCATTCCATGGACCTTTGCATGGGCTCAAACTCGTATGCACCTTTCAGCTTGGCTTGGTGTCGGTGCAGGGCTCAATTCTGAAAATGAAGAAGACAGAGCTACGTTGCGTGAAATGTACGAGGAGTGGCCATGGTTCAGAGAAATCATCAGTCTCATTTCCATGCTGGTATCTAAGACAGACTTTTCCATCACCAAGAACTACGACGAACTCCTTGTAGATCCAGATTTGATGAGTCTTGGCGACGAAGTGAGGACGATGCTCGTTGAAACTCGACAAGCTGTGATTGACGTGTCAGGATCTAAAGACATCAGCGGACCTCATGTTCAGTTGATGCGTGCTTCTTCAATGATTCGCAATCCCTACGTTGATAGTATCAATGTTGTGCAAGCGGAGCTTTTAAAGGTGTTGCGTGCGATGCCCGCCGATGACTCTTCTGACTTGACTCCAGAGTTAAAAGAAATCAAGAAAGTTCGTATCGATGCCCTGCTCTTGTCAATCAAGGGAATTGCTCAAGGAATGAAAAACAGTGGATAA。

In the present invention, the method for obtaining the thalassiosira wegiana TwPEPC1 gene preferably comprises: the DNA of the pseudonannochloropsis nandina gene is used as a template, and the degenerate primer pair is utilized to carry out PCR amplification to obtain the Welch nannochloropsis twPEPC1 gene. The method for extracting the DNA of the pseudonandina gene is not particularly limited, and can be obtained by adopting an extraction method which is conventionally adopted by a person skilled in the art. The invention preferably designs a degenerate primer pair by using the pseudo-micro-sea chain algae gene DNA and the N-terminal conserved sequence (SEQ ID No.2) of the PEPC protein thereof.

In the invention, the DNA of the pseudo-micro-sea chain algae gene comprises a pseudo-micro-sea chain algae TpPEPC2 gene, and the nucleotide sequence of the pseudo-micro-sea chain algae TpPEPC2 gene is shown as SEQ ID No.2, and specifically comprises the following steps:

ATGCTCTCCAACATGCTCGCGGAGGTTGTACTCAAGGAAAACCCCGTGGTGTACGATTACTACACGAGATTTCGCAAGTTGGGTATGGACCGCGCCGCAAATCCCGATGATACGGCGCCGTTTGAGGAGATGAAGAAGCTGGCGTATGATATTAACCCTCGCGATACTCTGGGAGTGATGAAGACGTTTTCGATCGCATTGAATTTGGTGAATGCTGCGGAGGTTCATCATCGTATTCGGTTGGTGAGGGTGAGTGAGTTGAAAGATGACGTCAATCATATTGGACCGCTGCCGATGGTGGAAGATAGTATTCGTGGTACTATGGAGATTTTGTTGGAGGGGGATTGTGATGATAAGGATAAGTTGTTTGAGAGGTTGACTACGCAAAAGTGTGAGATTGTGCTGACGGCCCATCCCACAGAGGTTAATAGGAAGACAATCATTAGCAAGTACCGTAAGATTTCAGAACTCCTCGCTTACATGGAACGTCCCGATCTTCACCCCTTTGAACGTGCGGAGGCGGTAAACAACTTGCGTGGTATCATCTCTGCTATCTGGGGTGCCGACGAGATCAGGCGTGTCAAGCCCACGGTACAAAAAGAAGCAGCCGGAGGATGTGCTGTCATTGAATCCGTCCTCTGGGACGCCGTACCCTCCTACCTCCGTAAACTCGACGCTCAATGCCGTGTCACCCTCGGTAAAAAGTTCCCCGTTGACGCTACACCCATTAAGTTTGCCTCGTGGATTGGAGGTGATCGCGACGGTAACCCCAACTGTACCCCTGAGGTTACGTTGGAGGTGGTAACACGTCAAAGGCTACGTGCGGCAAAGATGTTTTTGAATGATCTCAACATGTTGTATTCGGAGTTGGCAATCTCTAGTCGTTTCTCAAAAGAGTTGGAGGCATTGGCTGCTAGTGTAAAAAAATCAGACGACAACCGTGAGAAGTACCGCCGTGTGATTGGTCATTTGCGTCGTCGTCTAGTACGCACGGTGAAGGAGTGTGAGGCCAAGCTTCACACTCTTACCGACACGTCCGAAGTTCAGCTTGCGTCTGCGGAAAGTGCCTTTGGAAGTTTGCAGGGATGGGAGGATGTGGAACCAATCATCAAATCGGAGGAGTTGATGACTCCGCTGAGGATCATGTACGATTCGTTGGTAGAAACCGGATTTGAGCTGGTGGCAGATGGACACGTTTCTGATATCATCAGGAGGGTAGCTGTCTTTGGTATGACGTTGGTTCCTTTGGATATCCGCGAGGAGTCAACTCGGCACACAATAGCCATTGATGCAATCACTCGTCATTTGGGTATTGGAAGTTACAAGGAATGGGACGAAGAAGCTCGTTTGAACTGGCTTCAATCAGAATTAAACAACAAACGTCCTCTTTTCAGAATCCGTGACATTGAGGATAACTTGCTCGGCCTTGACCCTGATAATCGGAAGACGTTGATGGTATTCAAAGTAGCTTCTGAGCTTGACTCCGAGAGTTTGGGTGCTTATGTTATTAGTCAAGCAAATACTGCTAGTGACGTCTTGTTAGTGATGTTACTGCAGAAGCAGTTCGGAATGACTGAAAAGAACGGAAAGCTCATGAGGGTTGTACCCCTCTTTGAGACTCTTACCGACTTGACAAACTCGCCTGCGCAACTCGAGAGACTCTTCAGCATCACCAATTATTTGGGTGCTATCAACGGTAAGCAGGAGGTCATGGTTGGATACTCTGACTCTGCAAAGGATGCTGGACGACTTGCTGCATGCTGGGCTCAATACACTGCACAGGAGGCCATGGCAAACGTGGCAGACAGATACGGCGTTGAACTTACTTTCTTCCACGGAAAAGGAGGAACCGTCGGAAGAGGAGGCAACCCAGCTCTTTATCGCGCCATCCTATCTCATCCTCCCAACACAATCAACGGACGTTTCAGAGTAACTGAGCAAGGAGAGATGATTCGTCAAAACTTTGGTTCTTTGGAGATTGCCGAGCGGACTCTTGATATCTACACTGCTGCGTTGTTGAGGGAGTCTTTCACCAAGAGGGTTGAACCTAAACAGGAATGGAGAGATCAGATGGAACGTGTTTCTGAGGTGTCGTGTGCTGCCTACAGGCACACTGTTCGAGATGACCCGCGCTTCGTCCCCTATTTCCGCCAGGCGACCCCTGAGTTGGAACTTGGCAGATTGAATATTGGATCTCGCCCCGCCAAACGCAATCCTAAGGGAGGTGTTGACAGTTTGAGAGCTATTCCGTGGACATTCGCTTGGGCACAGACTCGTATGCATCTTTCTGCTTGGCTCGGAGTTGGCGATGGTCTCAGATCAGATAACGAAGAAGACATGAAGACTTTGCAGGAGATGTATGAACAGTGGCCCTGGTTCCGTGAGATCATCAGCTTGATCTCAATGCTTGTGAGTAAGACCGACTTTTCTATCACGAAGAACTATGACGATCTTCTCGTGGATTCCAATCTGAGGAGTCTCGGGGATGAAGTGAGGAACAAACTTGTGGAGACACGTCAGGCAGTGATTGACGTTTCTGGAGCAACGGATATCAGTGGACCTCATGTTCAATTGATGCGAGCGTCCTCTACTATTCGCAATCCGTATGTCGACAGTATCAACGTAGTTCAAGCGGAAATCTTGAAAGTATTGCGTTCAATGCCCGAGGACGACTCACCTGATCTCACTCCAGAATTAAGGACGATCAAGAACTGTCGTACTGACGCTTTGTTGTTGTCCATTAAGGGCATTGCTCAGGGAATGAAGAACAGTGGATAG。

in the present invention, the degenerate primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID No. 3; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 4.

In the invention, the nucleotide sequence of the upstream primer is shown as SEQ ID No.3, and is specifically shown as follows:

GGTACCATG CTC TCCAAYATGYTG GCW GAR GTW GT；

wherein Y represents C or T, R represents A or G, and W represents A or T;

the nucleotide sequence of the downstream primer is shown as SEQ ID No.4, and is specifically shown as follows:

GGTACC TTATCCACT GTTTTT CATTCC TTGAGC。

the method for electrically transforming the Haematococcus wegiae TwPEPC1 gene into the Escherichia coli is not particularly limited, and the conventional method for introducing the gene into the Escherichia coli is adopted. In the present invention, the Escherichia coli preferably includes Escherichia coli DH5 α.

In the present invention, in step (2), the Kpn I single enzyme is obtained from promega, and the reaction system and the digestion conditions during the Kpn I single enzyme digestion are referred to promega specifications.

The method for introducing the transformation vector into the agrobacterium is not particularly limited, and the conventional method for transferring the expression vector into the agrobacterium is adopted. In the present invention, the agrobacterium preferably comprises agrobacterium EHA 105.

In the present invention, the infection in step (3) preferably includes: and (3) soaking the rice callus in the suspension of the agrobacterium tumefaciens for 25-35 min, and preferably for 30 min. OD of suspension of Agrobacterium according to the invention₆₀₀The value is preferably 0.8 to 1.0, more preferably 0.9.

In the present invention, the rice callus preferably includes rice embryogenic callus. In the present invention, the variety of rice preferably includes medium flower 11 rice.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Cloning of the Haematococcus wegiae Twppc 1 Gene

Preparing materials: the culture condition of the Haematococcus williamsii is 22 ℃, the illumination intensity is 3000lux, and the light-dark ratio is 16h/8 h.

The nutrient solution comprises the following components: NaNO₃ 74.8mg/L，NaH₂PO₄4.4mg/L, vitamin mother liquor 1ml (vitamin B10.1g/L, vitamin B120.5 mg/L, vitamin H0.5 mg/L, microelement mother liquor 1ml (EDTA-Na)₂ 4.360 g/L，FeCl₃.6H₂O 3.150g/L，CuSO₄.5H₂O 0.010g/L，ZnSO₄.7H₂O 0.022g/L，CoCl₂.6H₂O 0.010g/L，MnCl₂.4H₂O 0.180g/L，Na₂MoO₄.2H₂O0.006 g/L), pH 8.0, medium prepared with seawater, sterilized at 121 ℃ for 15min and used.

The method comprises the following steps:

(1) extraction of RNA from Haematococcus wegiae:

the RNA of Haematococcus williamsii was obtained by the Trizol Reagent (Invitrogen, Carisbad, Calif., USA). The RNA of the Haematococcus williamsii can be subjected to subsequent tests after the quality is qualified through 0.8% agarose gel electrophoresis detection and concentration measurement (two main bands of 18S and 28S are clear and have no tailing, and OD260/OD280 is 1.8-2.0).

(2) Reverse transcription of RNA into cDNA

The kit used for reverse transcription is M-MLV from Promega corporation, and the specific procedures are described in the specification. And (2) carrying out reverse transcription on the RNA of the Haematococcus willebrand obtained in the step (1) to obtain cDNA of the Haematococcus willebrand, and storing the cDNA of the Haematococcus willebrand in a refrigerator at the temperature of-20 ℃.

(3) PCR amplification

A TpPEPC2 sequence (shown as SEQ ID No.2) of the pseudo-micro-sea chain algae (Thalasiosia pseudo-onana) is used as a template, a degenerate upstream primer (the nucleotide sequence of the upstream primer is GGT ACC ATG CTC TCC AAYATG YTG GCW GAR GTW GT) is designed by using an N-terminal conserved sequence of the PEPC protein of the pseudo-micro-sea chain algae, and a downstream primer (the sequence is GGT ACC TTA TCC ACT GTT TTT CAT TCC TTG AGC) is designed by using a TpPEPC 1 sequence of the sea chain algae of Welch. And (3) PCR reaction conditions: 94 ℃ for 5min, 94 ℃ for 30sec, 56 ℃ for 30sec, 72 ℃ for 3min, 30 cycles, 72 ℃ for 7 min. 10. mu.l of the PCR product was detected by 0.8% agarose electrophoresis. The remaining PCR product was used for cloning. The kit used was the T-Vctor system from Promega. The reaction system is 5.0 μ l, which is as follows: PCR product 1.9. mu.l, T-Vctor 0.3. mu.l, 2 XBuffer 2.5. mu.l, T₄ ligase 0.3μl。

(4) Obtaining a cloning plasmid

And (3) carrying out water bath on the PCR product at the low temperature of 16 ℃ for 10h, then carrying out electro-transformation on the PCR product into escherichia coli DH5 alpha, recovering the product for 40min at 37 ℃, coating the product on a flat plate containing Amp, IPTG and X-gal, culturing the product overnight at 37 ℃, and selecting white spots to carry out amplification culture by using an LB culture medium containing Amp. Extracting the plasmid of the shake bacteria to obtain a clone plasmid. Positive clones were screened by a single cleavage with Kpn I. The enzyme cutting system is 20.0 mu l, which is as follows: plasmid 3.0. mu.l, 10 XK buffer 2.0. mu.l, Kpn I0.1. mu.l, ddH₂O14.8. mu.l, reacted at 37 ℃ for 4 hours, and the cleaved product was detected by 0.8% agarose electrophoresis. ABI373 for selection of positive clones0 for sequencing. The sequencing result shows that the corresponding amino acid sequence has a PEPC conserved domain.

Example 2

Construction of Haematococcus wegiae Twppc 1 Gene transformation vector

(1) Enzyme digestion vector pC1300s

The pC1300s vector is obtained by transforming pCAMBIA1300 (the vector is a vector disclosed by CAMBIA company), and the 35s promoter and 35s ployA vector map and the information of the multiple cloning site are respectively introduced into the two ends of the multiple cloning site, which are shown in figure 1. The method comprises the steps of performing single enzyme digestion of pC1300s by Kpn I, performing dephosphorylation reaction after the enzyme digestion is linear by electrophoresis detection, recovering a reaction product by using a UNIQ-10 column type DNA glue recovery kit (produced by Shanghai Biotechnology engineering service Co., Ltd.) according to a promega specification, performing electrophoresis detection on the enzyme digestion integrity, and storing in a refrigerator at the temperature of-20 ℃.

(2) Twpec 1 cloning plasmid

Sequencing by single enzyme digestion with Kpn I to obtain correct TA cloning plasmid, separating the digested product by 0.8% agarose electrophoresis, recovering the target band by UNIQ-10 column type DNA gel recovery kit (produced by Shanghai Bioengineering service Co., Ltd.), detecting the integrity of the digested product by electrophoresis, and storing in a refrigerator at-20 deg.C.

(3) Construction of transformation vectors

The TwPEPC1 recovered by enzyme digestion is constructed on a vector pC1300s (see FIG. 1) and is electrically transformed into Escherichia coli DH5 alpha. After enzyme digestion detection and sequencing, the constructed vector is introduced into an agropine type agrobacterium tumefaciens EHA105 strain (the strain is an agrobacterium strain disclosed by CAMBIA company) to form a transformation strain.

Example 3

Agrobacterium-mediated genetic transformation

The agrobacterium-mediated genetic transformation method mainly refers to a method shown in an agrobacterium-mediated genetic transformation operation manual published in a national key laboratory of crop genetic improvement of university of agriculture in Huazhong (Linyujun and the like, establishment of an agrobacterium-mediated high-efficiency transgenic system of Danjiang No. 8, a crop academic newspaper, 2002, 28 (3): 294-. The transformation receptor is embryogenic callus induced by mature seeds of the rice variety 'Zhonghua 11'. The callus with hygromycin resistance is obtained through pre-culture, infection, co-culture and screening, and the transgenic plant is obtained through differentiation, rooting, seedling hardening and transplanting.

(1) Reagent and solution abbreviations

The names and abbreviations of the main reagents involved in the preparation of the medium according to the present invention are as follows:

6-BA (6-BenzylaminoPurine, 6-benzyladenine);

CN (Carbenicillin );

KT (Kinetin );

NAA (Napthalene acetic acid, naphthylacetic acid);

IAA (Indole-3-acetic acid, indoleacetic acid);

2,4-D (2, 4-dichlorphenoxyacetic acid, 2,4-Dichlorophenoxyacetic acid);

AS (acetosyringone);

CH (Casein enzymic Hydrolysate, hydrolyzed Casein);

HN (Hygromycin B, Hygromycin);

DMSO (Dimethyl Sulfoxide);

N₆max(N₆macronutrient component solution);

N₆mix(N₆a solution of trace element constituents);

MSmax (MS macronutrient component solution);

MSmix (MS trace element composition solution).

(2) Main solution formulation

1)N₆Culture medium macroelement mother liquor (prepared according to 10 times of concentrated solution (10X)):

the reagents are dissolved one by one, and then distilled water is used for fixing the volume to 1000ml at room temperature.

2) N6 culture medium microelement mother liquor (prepared according to 100 times of concentrated solution (100X)):

the above reagents were dissolved at room temperature and made up to 1000ml with distilled water.

3) Iron salt (Fe)_2-EDTA) stock solution (prepared as 100 times concentrate (100X):

3.73g of disodium ethylene diamine tetraacetate (Na)₂EDTA·2H₂O) and 2.78gFeSO₄·7H₂Dissolving O respectively, mixing, diluting with distilled water to 1000ml, warm bathing at 70 deg.C for 2h, and storing at 4 deg.C for use.

4) Vitamin stock solution (prepared as 100X concentrate):

adding distilled water to a constant volume of 1000ml, and storing at 4 ℃ for later use.

5) MS culture medium macroelement mother liquor (prepared according to 10X concentrated solution):

6) MS culture medium microelement mother liquor (prepared according to 100X concentrated solution):

7) Preparation of 2,4-D stock solution (1 mg/ml):

weighing 2,4-D100mg, dissolving with 1ml 1N potassium hydroxide for 5min, adding 10ml distilled water to dissolve completely, diluting to 100ml, and storing at room temperature.

8) Preparation of 6-BA stock solution (1 mg/ml):

weighing 6-BA 100mg, dissolving with 1ml 1N potassium hydroxide for 5min, adding 10ml distilled water, dissolving completely, diluting to 100ml, and storing at room temperature.

9) Preparation of stock solution (1mg/ml) of Naphthylacetic acid (NAA):

weighing NAA 100mg, dissolving with 1ml 1N potassium hydroxide for 5min, adding 10ml distilled water, dissolving completely, diluting to 100ml, and storing at 4 deg.C.

10) Preparation of Indoleacetic acid (IAA) stock solution (1 mg/ml):

weighing IAA100mg, dissolving with 1ml 1N potassium hydroxide for 5min, adding 10ml distilled water to dissolve completely, diluting to 100ml, and storing at 4 deg.C.

11) Preparation of glucose stock solution (0.5 g/ml):

weighing 125g of glucose, dissolving with distilled water to a constant volume of 250ml, sterilizing, and storing at 4 ℃ for later use.

12) Preparation of AS stock solution:

0.392g of AS is weighed, added with 10ml of DMSO for dissolving, and subpackaged into 1.5ml of centrifuge tubes for storage at 4 ℃ for later use.

13) Preparing a 1N potassium hydroxide stock solution:

5.6g of potassium hydroxide is weighed, dissolved by distilled water to be constant volume to 100ml, and stored at room temperature for later use.

(3) Culture medium formula for rice genetic transformation

1) Induction medium

Adding distilled water to 900ml, adjusting pH to 5.9 with 1N potassium hydroxide, boiling to 1000ml, packaging into 50ml triangular flask (25 ml/bottle), sealing, and sterilizing by conventional method (such as 121 deg.C for 25min, the following method for sterilizing culture medium is the same as that for the present culture medium).

2) Subculture medium

Adding distilled water to 900ml, adjusting pH to 5.9 with 1N potassium hydroxide, boiling, diluting to 1000ml, packaging into 50ml triangular flask (25 ml/bottle), sealing, and sterilizing.

3) Pre-culture medium

Adding distilled water to 250ml, adjusting pH to 5.6 with 1N potassium hydroxide, sealing, and sterilizing as above.

The medium was dissolved by heating and 5ml of glucose stock solution and 250. mu.l of AS stock solution were added before use and dispensed into petri dishes (25 ml/dish).

4) Co-culture medium

5) Suspension culture medium

Adding distilled water to 100ml, adjusting pH to 5.4, packaging into two 100ml triangular bottles, sealing, and sterilizing according to the above method.

1ml of sterile glucose stock solution and 100. mu.l of AS stock solution were added before use.

6) Selection medium

Adding distilled water to 250ml, adjusting pH to 6.0, sealing, and sterilizing by the above method.

Pre-use lysis medium was added to 250. mu.l HN (50mg/ml) and 400. mu.l CN (250mg/ml) and dispensed into petri dishes (25 ml/dish). (Note: the concentration of carbenicillin in the first selection medium was 400 mg/liter, and the concentration of carbenicillin in the second and subsequent selection media was 250 mg/liter).

7) Pre-differentiation culture medium

Adding distilled water to 250ml, adjusting pH to 5.9 with 1N potassium hydroxide, sealing, and sterilizing as above.

Pre-use lysis medium, 250. mu.l HN (50mg/ml) 250. mu.l CN (250mg/ml), dispensed and poured into Petri dishes (25 ml/dish).

8) Differentiation medium

Distilled water was added thereto to 900ml, and 1N potassium hydroxide was added to adjust the pH to 6.0.

Boiling, adding distilled water to 1000ml, packaging into 50ml triangular flask (50 ml/bottle), sealing, and sterilizing.

9) Rooting culture medium

Distilled water was added to 900ml, and the pH was adjusted to 5.8 with 1N potassium hydroxide.

Boiling, adding distilled water to 1000ml, packaging into raw tube (25 ml/tube), sealing, and sterilizing.

(4) Agrobacterium-mediated genetic transformation procedure

1) Callus induction

a. Removing husk from mature middle flower 11 rice seed, treating with 70% ethanol for 1min, and 0.15% mercuric chloride (HgCl)₂) Sterilizing the surface of the seeds for 15 min;

b. washing the seeds with sterilized water for 4-5 times;

c. placing the seeds on an induction medium;

d. the inoculated culture medium is placed in a dark place for culturing for 4 weeks at the temperature of 25 +/-1 ℃.

2) Callus subculture

The bright yellow, compact and relatively dry embryogenic calli were selected and placed on subculture medium for 2 weeks in the dark at 25 + -1 deg.C.

3) Preculture

Compact and relatively dry embryogenic calli were selected and placed on pre-culture medium for 2 weeks in the dark at 25 + -1 deg.C.

4) Agrobacterium culture

a. Agrobacterium EHA105 (a strain from an Agrobacterium strain publicly used by CAMBIA corporation) was pre-cultured for 2 days at 28 ℃ in LA medium with a corresponding resistance selection (see, preparation of LA medium, J. SammBruke et al, molecular cloning instructions, third edition, King Dongsaike et al (ed.), science Press, 2002, Beijing);

b. and transferring the agrobacterium to a suspension culture medium, and culturing for 2-3 h on a shaking table at 28 ℃.

5) Infection with Agrobacterium

a. Transferring the pre-cultured callus to a sterilized bottle;

b. adjusting the suspension of Agrobacterium to OD₆₀₀0.8～1.0；

c. Soaking the callus in the agrobacterium tumefaciens suspension for 30 min;

d. transferring the callus to sterilized filter paper and sucking to dry;

e. then placing the mixture on a co-culture medium for culturing for 3 days at the temperature of 19-20 ℃.

6) Callus wash and selection culture

a. Washing the callus with sterilized water until no agrobacterium is visible;

b. soaking in sterilized water containing 400mg/L Carbenicillin (CN) for 30min

c. Transferring the callus to sterilized filter paper and sucking to dry;

d. transferring the callus to a selective culture medium for selective culture for 2-3 times, 2 weeks each time.

7) Differentiation

a. Transferring the resistant callus to a pre-differentiation culture medium and culturing for 5-7 days in a dark place;

b. transferring the pre-differentiation cultured callus to a differentiation culture medium, and culturing under the illumination (1500-2000 lux) at the culture temperature of 26 ℃.

8) Rooting

Cutting off roots generated during differentiation; then transferring the strain to a rooting culture medium to culture for 2-3 weeks under illumination (1500-2000 lux), wherein the culture temperature is 26 ℃.

9) Transplanting

Residual culture medium on the roots is washed off, seedlings with good root systems are transferred to a greenhouse, and meanwhile, moisture is kept moist in the first few days, and high-yield rice is obtained.

10) Selfing propagation

And (3) detecting the copy number of the high-yield rice by southern blotting, and selecting single-copy high-yield rice for selfing propagation.

As shown in the Southern blotting hybridization result chart of FIG. 2, the high-yielding

rice families

1, 19 and 46 are single-copy families.

Example 4

Germination test

After selfing seed husking of the single-copy high-yield rice in example 3, the rice was sterilized with 75% by volume of ethanol for 5min and then treated with 0.1% mercuric chloride for 15 min. Washing 3-4 stools with sterile water, inoculating the stools to 1/2MS culture medium containing hygromycin, and culturing the stools in an illumination culture room at 25 ℃ for 10 days to calculate the germination rate. According to Mendelian's law of inheritance, the germination rates of negative, heterozygous and homozygous families are close to 0%, 75% and 100%.

As can be seen from the seed germination experimental plot of FIG. 3, the ratios of hygromycin resistant seeds for the negative, heterozygous and homozygous lines were about 0%, 75% and 100%, respectively.

Example 5

RT-PCR expression level detection

(1) Selection of materials

Control group 1: leaf blade of wild type middle flower 11 rice at tillering stage;

treatment group 1: high yielding

rice pedigrees

1, 19 and 46 leaves at the tillering stage.

(2) RT-PCR expression level detection

Taking leaves at the tillering stage of rice, extracting RNA and then carrying out a conventional reverse transcription experiment. And detecting the content of RNA by using RT-PCR technology. As shown in the RT-PCR expression level test chart of FIG. 4, the Haematococcus wegiae TwPEPC1 gene was expressed in high-yielding

rice cultivars

1, 19 and 46.

Example 6

PEPC enzyme activity assay

(1) Selection of materials

Control group 2: leaf blade of wild type middle flower 11 rice at tillering stage;

treatment group 2: high-

yield rice pedigrees

1, 19 and 46 leaves in the full-tillering stage.

(2) Enzyme activity assay

Taking 5cm long leaf blade in tillering stage, adding 500 μ l of 4 deg.C precooled protein extract (100mM Tris, 10mM MgCl)₂1mM EDTA, 5mM DTT, 10% glycerol and 5% PVP, pH 7.5) and grinding into homogenate, centrifuging at 10000g for 5min, and collecting supernatant as total protein.

Protein quantification by Coomassie light was performed and approximately 20. mu.g of total protein was added to 200. mu.l of PEPC enzyme-activated reaction solution (50mM Tris, 10mM NaHCO)₃，10mM MgCl₂0.1mM EDTA, 1mM DTT,3U MDH, 0.2mM NADH, 2mM PEP, pH 7.5). The reaction temperature is 30 ℃ and the absorbance value of NADH of the reaction solution at 340nm is detected by a microplate reader every minute. The enzyme activity of PEPC is represented by the rate of NADH consumption.

As can be seen from the results of the relative activity of PEPC enzyme in FIG. 5, the PEPC enzyme activities of

families

1, 19 and 46 of high-yielding rice were all improved, wherein the activity of family 19 was the highest, consistent with the results in example 5.

Example 7

Photosynthesis determination, biomass and yield examination of high-yield rice plants

(1) Selection of materials

Control group 3: wild type rice plants;

treatment group 3: high-

yield rice families

1, 19 and 46.

(2) Determination of photosynthesis and agronomic characters of high-yield rice plants

A randomized block trial was designed with 3 replicates per material, and 12 x 2-24 plants per replicate. And measuring the photosynthesis rate of the leaves in the tillering stage. Meanwhile, water and fertilizer management is carried out under normal cultivation conditions until the mature period, overground part materials are collected, and the seeds are tested by individual plants after being dried in the sun.

The results of the photosynthesis rates of the control group 3 and the treatment group 3 are shown in Table 1.

TABLE 1 measurement results of photosynthesis rates of control group 3 and treatment group 3

As can be seen from Table 1, the photosynthesis rates of the plants of

families

1, 19 and 46 containing the Haichia wegiana TwPEPC1 gene of the present invention were significantly increased as compared with those of the plant of control group 2.

The results of the agronomic trait results for control group 3 and treatment group 3 are shown in table 2.

TABLE 2 agronomic trait results for control group 3 and treatment group 3

As can be seen from Table 2, the plants of line 1, line 19 and line 46 containing the Haichia wegiana TwPEPC1 gene of the present invention have significant advantages in plant height, organism weight and single plant yield over the plants of control group 3.

As can be seen from the growth map of the plants at the seedling stage in FIG. 6, the biomass of the treated group 3 was higher than that of the control group, and the high-yielding rice families 1 and 9 were the highest, consistent with the results of examples 5 and 6.

In conclusion, the Haematococcus wegiae TwpPC 1 gene was expressed in three families of high-yielding

rice

1, 9 and 46, wherein the expression level of the No. 19 family was the highest and the expression level of the No. 46 family was the lowest. Meanwhile, the relative enzyme activity result of PEPC is similar to the RT-PCR result. The seedling growth results show that the Haematococcus wegiae TwPEPC1 gene can obviously improve the biological yield of the transgenic rice. The agronomic trait results also showed that family 19 had higher yields than control 2.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> Thalassiosira wegiana TwPEPC1 gene, application thereof and method for cultivating high-yield rice

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2772

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgctctcca atatgctggc tgaagtggta aagaaggaga atccggctgt ttacgatcta 60

tacactacat ttcgtagact tggaatgaag agagccgcca atccagacga tccaaccccc 120

ttcgaagaaa tgaaaaagct ggcctatgat atctctcccc acgatgcgct tggcgtcatg 180

aaaacatttt ccatcgcact caacttagtt aatgctgccg aagtacatca ccgcatgcgt 240

ctcgttcgta aaaatgaaca tgccgatgat actcatcata ttggtccatt gccaatgatc 300

gaagatagca ttcgtggaac catggagatt ttgctggagg atgatggggt gagcccagat 360

agcatttttg cagagttgat gagtcaaaaa tgtgagattg tattgacggc acatcctacg 420

gaggttaatc gcaaaaccat tatcaggaag taccgcaata tttcggaatt gttggcacat 480

ttggaacggc ctgatctcca tccttttgaa tgtgccgagg cattaaacaa cttgcgagga 540

atcattgctg cgatttgggg atctgatgaa attagacgtg tcaaaccaac ggttcagaaa 600

gaagctgctg gagggtgtgc tgtcattgaa tctgttcttt gggatgcggt tccgtcatat 660

cttcgcaagc tcgatgcaca atgccgcgtt acgctcggaa agaagctacc tgtggatgtt 720

acccctgtaa aattcgcctc ttggatagga ggagatcgtg atggaaatcc taactgtact 780

cctgctgtga ctcaagaggt tcttgcttac cagaaactcc gcgctgccaa gatgtttttg 840

aatgacctca acttcttgta ttctgagttg gcaatttcca gccgattctc tccagagcta 900

gaagcactcg ccgccacaat tgagaattcc gacgacgagc tcgagaagta ccgccgcgtt 960

attggccatc ttcgccgtcg tttagttcga actgtcaagg attgtgaagc caaactgcaa 1020

tctctggcga aatctcctga aacgttgtcc gccgaagctg catttggagc acttgaagga 1080

tgggaagatg tggaaccaat catgaaaact gatgacttga tggctccttt gaaggtaatc 1140

tatgagagtt tggtgacgac aggatttgaa ttggtggcag atggacgcgt ttcggatatt 1200

attcgccgcg ttgcaatctt cgggttgaca ctggtgcctc tcgatattcg tgaggagtct 1260

actaaacata ctttggcttt ggatgcaatt actcgccatc tgggcattgg aagttacaag 1320

gaatgggacg aaacagcaag gttgagctgg ttacaatctg agttgacgag tcgacgccct 1380

ctttttcgca taagagatgt tgaaaataat ttgcttgggt tggatcctga tgtgatcaag 1440

actttgatgg tattcaaagt agcatctgag caggaaccgg aatctctggg agcatatgtc 1500

attagtcagg caacaagtgc aagcgatgta ttggcagtga tgttattgca aaagcagttt 1560

ggaatgacaa aggccactgg caaattaatg cgtgttgtgc cgttgtttga gactctcgat 1620

gatttaactg ggtcaccgaa gcaactccaa actctttttg ggatcacgag ctacatggat 1680

gcgatcaacc gcaaacaaga ggtaatggtt ggatactctg atagtgcaaa agatgcagga 1740

agactcgcgg cttgctgggc acaatacact gcacaagaag ctatggcgaa agtggcggac 1800

aaatttggtg tcgagctgac ttttttccat ggcaagggtg gaactgttgg acgaggaggc 1860

aaccctgctc tctatcgcgc cattctatcc catcccccaa acactatcaa tggacgtttc 1920

cgcgtcactg agcaaggaga aatgatcagg cagaactttg gctcattgga aatcgctgag 1980

aggtcattgg atatttacac agctgcattg ttgagagagc gcttcaccaa gcatatcgag 2040

ccgaagcaaa aatggagaga tcaaatgcaa cgagtctccg aagcctcgtg ttcgaactac 2100

cgatatcttg ttcgagagga tccacgattt gtgccatact tcaggcaggc aacaccagag 2160

ctggagcttg gtatattgaa catcggcagt cgaccggcca agcgtaatcc taagggtggt 2220

gtcgaaagtc tgagagccat tccatggacc tttgcatggg ctcaaactcg tatgcacctt 2280

tcagcttggc ttggtgtcgg tgcagggctc aattctgaaa atgaagaaga cagagctacg 2340

ttgcgtgaaa tgtacgagga gtggccatgg ttcagagaaa tcatcagtct catttccatg 2400

ctggtatcta agacagactt ttccatcacc aagaactacg acgaactcct tgtagatcca 2460

gatttgatga gtcttggcga cgaagtgagg acgatgctcg ttgaaactcg acaagctgtg 2520

attgacgtgt caggatctaa agacatcagc ggacctcatg ttcagttgat gcgtgcttct 2580

tcaatgattc gcaatcccta cgttgatagt atcaatgttg tgcaagcgga gcttttaaag 2640

gtgttgcgtg cgatgcccgc cgatgactct tctgacttga ctccagagtt aaaagaaatc 2700

aagaaagttc gtatcgatgc cctgctcttg tcaatcaagg gaattgctca aggaatgaaa 2760

aacagtggat aa 2772

<210> 2

<211> 2778

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgctctcca acatgctcgc ggaggttgta ctcaaggaaa accccgtggt gtacgattac 60

tacacgagat ttcgcaagtt gggtatggac cgcgccgcaa atcccgatga tacggcgccg 120

tttgaggaga tgaagaagct ggcgtatgat attaaccctc gcgatactct gggagtgatg 180

aagacgtttt cgatcgcatt gaatttggtg aatgctgcgg aggttcatca tcgtattcgg 240

ttggtgaggg tgagtgagtt gaaagatgac gtcaatcata ttggaccgct gccgatggtg 300

gaagatagta ttcgtggtac tatggagatt ttgttggagg gggattgtga tgataaggat 360

aagttgtttg agaggttgac tacgcaaaag tgtgagattg tgctgacggc ccatcccaca 420

gaggttaata ggaagacaat cattagcaag taccgtaaga tttcagaact cctcgcttac 480

atggaacgtc ccgatcttca cccctttgaa cgtgcggagg cggtaaacaa cttgcgtggt 540

atcatctctg ctatctgggg tgccgacgag atcaggcgtg tcaagcccac ggtacaaaaa 600

gaagcagccg gaggatgtgc tgtcattgaa tccgtcctct gggacgccgt accctcctac 660

ctccgtaaac tcgacgctca atgccgtgtc accctcggta aaaagttccc cgttgacgct 720

acacccatta agtttgcctc gtggattgga ggtgatcgcg acggtaaccc caactgtacc 780

cctgaggtta cgttggaggt ggtaacacgt caaaggctac gtgcggcaaa gatgtttttg 840

aatgatctca acatgttgta ttcggagttg gcaatctcta gtcgtttctc aaaagagttg 900

gaggcattgg ctgctagtgt aaaaaaatca gacgacaacc gtgagaagta ccgccgtgtg 960

attggtcatt tgcgtcgtcg tctagtacgc acggtgaagg agtgtgaggc caagcttcac 1020

actcttaccg acacgtccga agttcagctt gcgtctgcgg aaagtgcctt tggaagtttg 1080

cagggatggg aggatgtgga accaatcatc aaatcggagg agttgatgac tccgctgagg 1140

atcatgtacg attcgttggt agaaaccgga tttgagctgg tggcagatgg acacgtttct 1200

gatatcatca ggagggtagc tgtctttggt atgacgttgg ttcctttgga tatccgcgag 1260

gagtcaactc ggcacacaat agccattgat gcaatcactc gtcatttggg tattggaagt 1320

tacaaggaat gggacgaaga agctcgtttg aactggcttc aatcagaatt aaacaacaaa 1380

cgtcctcttt tcagaatccg tgacattgag gataacttgc tcggccttga ccctgataat 1440

cggaagacgt tgatggtatt caaagtagct tctgagcttg actccgagag tttgggtgct 1500

tatgttatta gtcaagcaaa tactgctagt gacgtcttgt tagtgatgtt actgcagaag 1560

cagttcggaa tgactgaaaa gaacggaaag ctcatgaggg ttgtacccct ctttgagact 1620

cttaccgact tgacaaactc gcctgcgcaa ctcgagagac tcttcagcat caccaattat 1680

ttgggtgcta tcaacggtaa gcaggaggtc atggttggat actctgactc tgcaaaggat 1740

gctggacgac ttgctgcatg ctgggctcaa tacactgcac aggaggccat ggcaaacgtg 1800

gcagacagat acggcgttga acttactttc ttccacggaa aaggaggaac cgtcggaaga 1860

ggaggcaacc cagctcttta tcgcgccatc ctatctcatc ctcccaacac aatcaacgga 1920

cgtttcagag taactgagca aggagagatg attcgtcaaa actttggttc tttggagatt 1980

gccgagcgga ctcttgatat ctacactgct gcgttgttga gggagtcttt caccaagagg 2040

gttgaaccta aacaggaatg gagagatcag atggaacgtg tttctgaggt gtcgtgtgct 2100

gcctacaggc acactgttcg agatgacccg cgcttcgtcc cctatttccg ccaggcgacc 2160

cctgagttgg aacttggcag attgaatatt ggatctcgcc ccgccaaacg caatcctaag 2220

ggaggtgttg acagtttgag agctattccg tggacattcg cttgggcaca gactcgtatg 2280

catctttctg cttggctcgg agttggcgat ggtctcagat cagataacga agaagacatg 2340

aagactttgc aggagatgta tgaacagtgg ccctggttcc gtgagatcat cagcttgatc 2400

tcaatgcttg tgagtaagac cgacttttct atcacgaaga actatgacga tcttctcgtg 2460

gattccaatc tgaggagtct cggggatgaa gtgaggaaca aacttgtgga gacacgtcag 2520

gcagtgattg acgtttctgg agcaacggat atcagtggac ctcatgttca attgatgcga 2580

gcgtcctcta ctattcgcaa tccgtatgtc gacagtatca acgtagttca agcggaaatc 2640

ttgaaagtat tgcgttcaat gcccgaggac gactcacctg atctcactcc agaattaagg 2700

acgatcaaga actgtcgtac tgacgctttg ttgttgtcca ttaagggcat tgctcaggga 2760

atgaagaaca gtggatag 2778

<210> 3

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtaccatgc tctccaayat gytggcwgar gtwgt 35

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtaccttat ccactgtttt tcattccttg agc 33

Claims

1. A kind of Haematococcus welshii (A. weshii)Thalassiosira weissflogii ) TwPEPC1Gene characterized in that said Haematococcus williamsiiTwPEPC1The nucleotide sequence of the gene is shown in SEQ ID No. 1.

2. The Thalassiosira wegiana of claim 1TwPEPC1The application of the gene in improving the rice yield.

3. Use of the Haematococcus wegiae of claim 1TwPEPC1The method for breeding high-yield rice by using the gene is characterized by comprising the following steps:

(1) the method comprising culturing the Haematococcus wegiana of claim 1TwPEPC1Electrically transforming the gene into escherichia coli, performing amplification culture, and extracting plasmids to obtain cloned plasmids;

(3) infecting the rice callus with the transforming strain in the step (2), and culturing the infected rice callus to obtain the high-yield rice.

4. The method of claim 3, wherein said Thalassiosira wegianaTwPEPC1The gene obtaining method comprises the following steps: PCR amplification is carried out by taking the gene DNA of the Haematococcus williamsii as a template and utilizing degenerate primers to obtain the Haematococcus williamsiiTwPEPC1A gene.

5. The method of claim 4, wherein the degenerate primers comprise an upstream primer and a downstream primer;

the nucleotide sequence of the upstream primer is shown as SEQ ID No. 3;

the nucleotide sequence of the downstream primer is shown as SEQ ID No. 4.

6. The method of claim 3, wherein the Agrobacterium of step (2) comprises AgrobacteriumEHA105。

7. The method of claim 3, wherein the infecting at step (3) comprises: soaking the rice callus in OD₆₀₀And (3) adding the agrobacterium tumefaciens suspension with the value of 0.8-1.0 for 25-35 min.

8. The method according to claim 3 or 7, wherein the rice callus of step (3) comprises rice embryogenic callus.

9. The method of claim 3, wherein the rice variety comprises medium flower 11 rice.