CN100338215C - Amylopectase type starch debranching enzyme gene promoter and its application - Google Patents

Abstract

The present invention discloses an amylopectase type amylum gene promoter debranching enzymes and an application thereof, and the promoter has the following nucleotide sequences: SEQ ID No. 1 in a sequence table or a nucleotide sequence capable of being hybridized with a DNA sequence limited by SEQ ID No. 1 in the sequence table under extremely strict conditions. The amylopectase type amylum gene promoter debranching enzymes can start a reporter gene gusA gene to be specifically expressed in seeds, which shows that the promoter can enable the purpose gene to be specifically expressed in seeds of plants. In addition, the promoter exerts important action in maize seed modification and a plant biological reactor.

Description

A kind of Amylopectase type starch debranching enzyme gene promoter and application thereof

Technical field

The present invention relates to a kind of Amylopectase type starch debranching enzyme gene promoter and application thereof.

Background technology

Along with the continuous innovation of develop rapidly, plant genetic analysis and the gene engineering of molecular biology of plants, transgenic plant are all significant in fundamental research and production practice.Especially the research and development of transgenic plant bio-reactor makes the plant can be with extremely low cost mass production foreign protein, for the mankind provide a safety and a cheap production system more, compare with production systems such as microbial fermentation, zooblast and transgenic animal, it has many potential advantages and great commercial value.

Plant bioreactor is meant that with plant suspension cell, a certain tissue and organ or whole strain plant be the albumen that factory's mass production has critical function.From 1986 between nineteen ninety, people have set up plant expression system and have successfully expressed human growth hormone's fusion rotein, Interferon, rabbit and human serum albumin.Afterwards, along with the development of technology, scientist is gradually deep for the research of plant bioreactor, mainly shows three aspects: at first be the popularity of using.From produce plantibody to oral vaccine to important pharmaceutical protein, the complexity of its molecule and modification degree are all improving.Transgene tobacco is successfully expressed the heavy chain and the light chain gene of immunoglobulin (Ig) and has been assembled into since the function antibody before the more than ten years, plant can produce complete IgG and IgA molecule, secretor type IgG and IgA molecule, bi-specific antibody, dissimilar antibody such as film grappling antibody.The oral vaccine of having realized at present comprises bacterial vaccine, virus vaccines, parasite vaccine etc.; The secondth, can be used as the floristic expansion of reactor.From initial model plant tobacco, potato till now, tomato, corn, rape, soybean, Arabidopis thaliana, banana, papaya, cowpea, spinach, clover, overgrown with weeds green grass or young crops etc.The expression amount with the reorganization avidin of transgenic corns production of Elizabeth E Hood report accounts for 2% of extractive total soluble protein in the seed, and expression amount is the highest in all transgenic corns of expressing foreign protein at present; The 3rd realizes the technique improvement of plant bioreactor.As, improving protein expression level, people are synthetic complicated eukaryotic protein needs translation post-treatment or the subunit assembling in chloroplast(id), as sIgA; The copy number of foreign gene that is incorporated in the tobacco chloroplast genome can reach 10000 copies of each cell, and the ratio that corresponding recombinant protein accounts for whole soluble proteinss also brings up to 47%.

The research of transgenic plant bio-reactor is widened this notion of agricultural greatly, broken through the traditional agriculture category, but make foreign gene stable integration in plant, and can be specific expressed in specific organ or cell, a very important precondition is that suitable promotor will be arranged.Promotor commonly used in the plant genetic engineering can be divided three classes by its mode of action and function: constitutive promoter, organizing specific type promotor and inducible promoter.Tissue-specific promoter can make expression of gene only limit to some specific organ or tissue position, and reduces the negative impact to plant.

At present, the seed specific promoters of finding in plant mainly contains: prolamine gene promoter, peanut seed legumin legA gene promoter, paddy rice gluten gluA and gluB gene promoter and zein spirit-soluble gene promotor etc.

Many relevant enzyme are arranged in the route of synthesis of W-Gum, wherein W-Gum debranching enzyme enzyme has two types: a kind of is Starch debranching enzyme type debranching enzyme enzyme (the pullulanase-type DBEs), and a kind of is isoamylase type debranching enzyme enzyme (the isoamylase-type DBEs).ZPU1 is a kind of Amylopectase type starch debranching enzyme, in different corn tissues, detect the mRNA of Zpu1 genetic transcription, discovery exists in the seed endosperm after 20 days in a large number in the corn pollination, and has only the expression of trace in embryo and fringe, but does not express in leaf and root.The regulating and controlling sequence that regulation and control Zpu1 gene is described may be endosperm-specific or seed-specific.And this gene only expresses in endosperm, rataria and fringe, also promptly only expresses in germinal tissue, shows that may there be the functional area relevant with reproduction in the regulating and controlling sequence of this gene.

Summary of the invention

The purpose of this invention is to provide a kind of Amylopectase type starch debranching enzyme gene promoter.

Amylopectase type starch debranching enzyme gene promoter provided by the present invention, be the promotor of the Amylopectase type starch debranching enzyme Zpu1 gene in the W-Gum route of synthesis, have following nucleotide sequence: SEQ ID № in the sequence table: 1 or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

The rigorous condition of described height is washed film with the solution that contains 1 * SSC, 0.1%SDS for the hybridization back under 65 ℃.

Have SEQ ID № in the sequence table: the promotor name of 1 nucleotide sequence is called zpu1P-4, by 516 based compositions.

The carrier, clone and the host bacterium that contain Amylopectase type starch debranching enzyme gene promoter of the present invention all belong to protection scope of the present invention.

The arbitrary segmental primer of the promotor of the present invention that increases is to also belonging to protection scope of the present invention.

Experimental results show that, it is specific expressed in seed that Amylopectase type starch debranching enzyme gene promoter of the present invention can start reporter gene gusA gene, illustrate that it can make goal gene specific expressed in the seed of plant, this promotor will play a significant role in corn seed improvement and plant bioreactor.

Description of drawings

The segmental electrophoretogram that is used to sieve the storehouse that Fig. 1 obtains for the RT-PCR amplification

Fig. 2 A is the X-ray sheet scintigram that the hybridization in first round screening corn gene group library is developed

Fig. 2 B is the X-ray sheet scintigram that second hybridization of taking turns screening corn gene group library is developed

Fig. 2 C is the X-ray sheet scintigram that the hybridization in third round screening corn gene group library is developed

Fig. 2 D is the X-ray sheet scintigram that the hybridization in four-wheel screening corn gene group library is developed

Fig. 2 E screens the X-ray sheet scintigram of the mono-clonal hybridization development that obtains for checking third round and four-wheel

Fig. 3 A is the restriction enzyme digestion and electrophoresis collection of illustrative plates of lambda DNA

Fig. 3 B is the hybridization collection of illustrative plates after lambda DNA enzyme is cut

Fig. 4 for the Zpu1 that obtains with pcr amplification because of promoter sequence zpu1P-4

Fig. 5 is building up to collection of illustrative plates synoptic diagram on the carrier for expression of eukaryon pBI121 for the zpu1P-4 fragment

Embodiment

Materials and methods

1, bacterial strain and plasmid

Intestinal bacteria (E.coli) DH5 α, Agrobacterium LBA4404 all available from the host bacterium LE392 of vast company, lambda particles phage available from Clontech company.

2, toolenzyme and biochemical reagents

Various restriction enzymes, pGEM ^@T-Easy support agent box is available from Promega company; It is Time Inc. available from the sky that general T aq enzyme and Trizol RNA extract test kit in a small amount, and the ExTaq enzyme is available from Takara company; The dNTP mixture is given birth to the worker available from Shanghai; T ₄Dna ligase is available from Takara company and BioLabs company; Naphthylacetic acid (NAA), penbritin (Amp), kantlex (Km), Streptomycin sulphate (Sm) and Reflin (Cef) available from glad through company of section; Isotropic substance α- ³²P dCTP is available from the inferior brightness in Beijing biotech firm; Nitrocellulose filter is available from Amersham company.4-methyl umbellate form ketone (4-MU), 4-methyl umbellate form keto acyl-beta-glucuronic acid acid anhydride enzyme (4-MUG) are all given birth to the worker available from Shanghai.

3, substratum

LB liquid nutrient medium (1 liter): 10g NaCl, 5g yeast extract, 10g Tryptones, pH7.0

LB solid medium (1 liter): 1 liter of liquid LB substratum adds 15g agar

YEB liquid nutrient medium (1 liter): 1g yeast extract, 10g peptone, 0.5g MgSO ₄7H ₂O, 5g sucrose, pH 7.5

YEB solid medium (1 liter): 1 liter of YEB liquid nutrient medium adds 15g agar

MS minimum medium (1 liter): the MS macroelement, the MS trace element, the MS organism, the basal component of each component is with reference to Murashige, T﹠amp; Skoog, F. is at 1962 MS medium component (Murashige, the T﹠amp that deliver; Skoog, F.A revised medium for rapid growth and bioassays with tobacco tissueculture.Physiol.Plant.1962,15:473-497)

MS salts solution: only contain MS macroelement and trace element

MS solid medium: add 30g sucrose in 1 liter of MS minimum medium, 8g agar, pH5.6-5.8

Tobacco differentiation solid medium: add 30g sucrose in 1 liter of MS minimum medium, 8g agar, 3mg 6-BA, 0.2mgNAA, pH 5.6-5.8

Tobacco root induction substratum: 1 liter of MS minimum medium adds 30g sucrose, 8g agar, pH5.6-5.8

4. the required solution in screening-gene group library

1)20×SSC

175.3g NaCl(3.0M)

88.2g trisodium citrate (0.3M)

Transfer pH to 7.0 with NaOH, be settled to 1 liter, room temperature preservation is standby.

2)20×SSPE

175.3g NaCl(3.0M)

27.6g SODIUM PHOSPHATE, MONOBASIC (0.2M)

40ml 0.5M EDTA (final concentration 0.02M)

Transfer pH to 7.4 with NaOH, be settled to 1 liter, room temperature preservation is standby.

3)50×Denhardt’s solution

5.0g ficoll (Ficoll)

5.0g polyvinylpyrrolidone (Polyvinylpyrrolidone)

5.0g BSA (component V)

Add water and be settled to 500ml ,-20 ℃ of preservations are standby.

4)20％SDS

5) 10 * lambda dilution buffer liquid

58.3g NaCl(0.1M)

24.65g MgSO4·7H ₂O(0.1M)

350ml 1.0M Tris-HCl (pH7.5) (final concentration 0.35M)

5.PCR primer

P277：5’CGCACAGGGGTTCTTGTTGGA 3’

P950：5’CAACCAACCAAGTTCGTGTGC 3’

P37F：5’AAGCTTGTGTGACATAGTTATCCACGAACC 3’

P38R：5’GGATCCTTGCGTCCGCGTTTGGATTC 3’

P45F：5’CAGGAAGTGATGGAGCATCAG 3’

P46R：5’TCGTGCACCATCAGCACGTTA 3’

It is synthetic that above primer is given birth to the worker by Shanghai.

The clone of embodiment 1, corn pullulanase type starch debranching enzyme Zpu1 gene 5` flanking sequence

One, the preparation of probe

CDNA sequence (Accession no.AF080567) according to Zpu1 gene among the GenBank designs a pair of primer (P277 and P950).Extract test kit with Trizol RNA and extract the back 28 days total RNA of corn seed of pollination, extraction step is by the method operation that provides in the test kit.The total RNA of corn seed with extraction is a template, carries out reverse transcription.

Get 1 μ L Oligo (dT) ₁₈Being added to 10 μ L concentration is in the total rna solution of 200ng/uL, 70 ℃, be placed on cooled on ice 5 minutes in 5 minutes, and add following composition then:

Reagent volume

5 * reverse transcription damping fluid, 5 μ L

DNTP mixture (every kind of 10mM) 2.5 μ L

RNasin ribonuclease inhibitor (concentration is 50U/uL) 1 μ L

AMV ThermoScript II (30U/ μ L) 3 μ L

The DEPC treating water is settled to 25 μ L

The reaction conditions that is set as follows with reference to Promega company AMV Reverse Transcriptase working instructions: room temperature 10min, 42 ℃ of 60min, 70 ℃ of 10min, ice bath 2min.Being template with synthetic cDNA first chain then, is that primer carries out pcr amplification with P277 and P950.

Reaction system is:

Reagent volume

10 * damping fluid, 5 μ L

DNTP mixture (every kind of 10mM) 1 μ L

Primer P277 (concentration is 10 μ M) 1 μ L

Primer P950 (concentration is 10 μ M) 1 μ L

Ex-Taq(5U/μL) 1μL

Reverse transcription product (concentration is 10ng/uL) 5 μ L

Aqua sterilisa is settled to 50 μ L

Reaction conditions:

94℃ 5min；

94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 1min (10 circulations);

94 ℃ of 1min, 59 ℃ of 30s, 72 ℃ of 1min (30 circulations);

72℃ 10min；

4 ℃ of preservations.

The amplified production that obtains is carried out agarose gel electrophoresis, and the result shows that amplification obtains a fragment about 600bp as shown in Figure 1, with the probe of this fragment as screening corn gene group library.Among Fig. 1, M is 1kb laddermarker; 1 is purpose fragment (shown in the arrow).

Two, screening corn gene group library obtains Zpu1 gene 5` flanking sequence

1, corn gene group library

Corn gene group library is available from Clontech company, and catalog number (Cat.No.) is FL1032D.

2, the mensuration of library titre

1), single spot of a host bacterium of picking (LE392) in 10ml LB liquid nutrient medium (containing 10mM MgSO4,0.2% maltose), shaken overnight under 200rpm, 37 ℃ of conditions makes OD ₆₀₀Reach about 2.0.

2), the dilution of library phage

A. from the corn gene group library of buying, get 2 μ L lambda particles phage original seeds and be added to (Dilution1=1: 500) in 1ml 1 * lambda dilution buffer liquid.

B. from Dilution1, take out 20 μ L and be added to (Dilution2=1: 25000) in 980 μ L, 1 * lambda dilution buffer liquid.

C. add 100 μ L, 1 * lambda dilution buffer liquid at six test tubes, 200 μ L host bacterium add dilution phage Dilution2:0 μ L, 5 μ L, 10 μ L, 50 μ L, 100 μ L and 250 μ L then respectively.

3), with above-mentioned six pipes 37 ℃ of water-baths about 20 minutes.

4) add 4ml dissolved 0.7%LB top layer substratum (about 50 ℃), then, fully be taped against on the 15%LB solid plate behind the mixing, the fast rotational culture dish makes the top layer substratum be uniformly distributed in whole flat board.

5), room temperature left standstill 10 minutes, treat the top layer culture medium solidifying after, be inverted at 37 ℃ and cultivate 6-7hr.

6), add up the plaque that grows on each flat board, according to the titre (pfu/ml) in following formula calculating library.

The titre that six flat boards are recorded average into: 1.22 * 10 ⁸Pfu/ml.The titre in library is greater than 10 ⁸Pfu/ml is so this library can be used for screening.

3, screen the library with dna probe

1) preparation of bed board host bacterium;

The single bacterium colony of the host bacterium LE392 of inoculation lambda particles phage is in LB liquid nutrient medium (MgSO ₄10mM, maltose 0.2%), 37 ℃, 200rpm, shaking culture is to OD ₆₀₀Be 2.0, take out standby.

2) lambda particles phage infects host bacterium and bed board

Get in the mixture that top layer substratum that 15ml dissolves is added to phage after infecting and host bacterium, fully mixing is layered on rapidly on the preprepared 1.5% LB solid plate equably.Room temperature left standstill 10 minutes, treat the top layer culture medium solidifying after, be inverted to cultivate 3-8hr at 37 ℃.When phage is long when the edge has just contacted with each other between different plaques, take out flat board and be put in 4 ℃, prepare against the commentaries on classics film of back.

3) absorption of plaque original position is fixed to nitrocellulose filter

A. the suitable nitrocellulose filter of size (more smaller) of clip than culture dish.On every film, cut three asymmetric breach, and with pencil label on film.

B. will number identical film with flat board and be put into gently on the plate culture medium, not produce bubble as far as possible.

C. be inserted in three asymmetric indentation, there that on film, shear in advance with the sterilization toothpick, as film return mark.Uncover nitrocellulose filter carefully with aseptic nipper after 2 minutes, be adsorbed with one of phage and face up, be put on the clean filter paper, room temperature is dried.

D. the air dried film is put 5min respectively respectively in sex change liquid (1.5M NaCl, 0.5M NaOH) and neutralizer (1.5M NaCl, 0.5M Tris-HCl PH8.0).Forward the middle rinsing of 2 * SSC (0.3M NaCl, 0.03M trisodium citrate) then to once, film is put on the clean filter paper, room temperature is dried.

E.80 ℃, baking film 2hr, be put in after wrapping with preservative film 4 ℃ standby.

4) prehybridization

Press following one-tenth assignment system prehybridization solution:

Composition	Final concentration
		Methane amide SSPE Denhardt ' s solution SDS sex change salmon sperm dna	50％ 5× 5× 0.1％ 100μg/ml

After pre-assorted liquid prepares, pre-assorted liquid is put in the film taking-up that is stored in 4 ℃, 42 ℃, 40rpm is more than the prehybridization 4hr.

5) label probe

The dna probe of getting 4 μ L concentration and be 20ng/ μ L adds in the 26 μ L water, sex change 5min in boiling water, and then ice bath 5min adds following composition then successively:

5 * mark damping fluid, 10 μ L

DATP, dGTP, dTTP (every kind of 1.5mM) 2 μ L

BSA(10mg/ml) 2μL

Klenow fragment (5U/ μ L) 1 μ L

α- ³²P-dCTP(10μCi/μL) 5μL。

After adding mentioned component, about 37 ℃ of mark 4hr.Wherein, the composition of 5 * mark damping fluid is as follows:

250mM Tris-HCL (pH8.0), 25mM MgCl ₂, 10mM DTT, 1M HEPES (pH6.6) and 26A ₂₆₀U/ml is 6 base deoxynucleotides at random.

6) hybridization

The probe that mark is good sex change 10min in boiling water is adding in the prehybridization solution after the cooling rapidly on ice.At 42 ℃, hybridization is 16-20 hour under the 40rpm condition.

7) wash selecting of film and pressure X-ray sheet and positive colony

After hybridization finishes, add and wash film buffer 1 (2 * SSC, 0.5% SDS), 42 ℃, 40rpm washes 1hr.And then (0.2 * SSC), 65 ℃, 40rpm respectively washes 1hr to use buffer 2 (1 * SSC, 0.1% SDS) and buffer 3 respectively.After washing the film end,, be pressed under the X-ray sheet after with preservative film film being wrapped up then with the most of liquid on the clean filter paper suction striping.On film, mark the position of positive spot according to image on the X-ray sheet.And then film is put on the culture plate of reference numeral the toothpick alignment on breach and the flat board.Choose the substratum that contains positive spot according to the label on the film and put into the 1.5ml centrifuge tube, add 1ml sterilization 1 * lambda diluent, room temperature is placed 1-2hr, phage is diffused out from substratum, 12000rpm is centrifugal 10 minutes then, collects supernatant liquor, is used for the next round screening.Through 5 take turns the screening and the checking, obtain 10 positive monoclonals (Fig. 2 A-Fig. 2 E) altogether.

4, lambda bacteriophage dna extracts

1) with 10 positive monoclonals difference bed boards, each two 200mm flat board in positive colony shop.When the surface of each flat board is almost completely covered by plaque, take out lambda dilution buffer liquid (20mM Tris-HCl pH7.4,100mM NaCl, 10mM MgSO dull and stereotyped and directly adding 15ml ₄), room temperature is placed 1-2hr, and phage is diffused out from the substratum of upper strata.

2) lambda dilution buffer liquid is moved into from culture dish in the 50ml centrifuge tube, 4 ℃, the centrifugal 20min of 8000rpm removes bacterial debris.

3) supernatant is moved in the new centrifuge tube, add RNaseA (final concentration is 2 μ g/ml), DNase (final concentration is 1 μ g/ml), 37 ℃ of digestion 30min.

4) add PEG8000 (final concentration is 10%), NaCl (final concentration is 1M) is in lambda dilution buffer liquid, and abundant mixing is more than the ice bath 1hr.

5) 4 ℃, 11000rpm, centrifugal 10min.Abandon supernatant, collect phage particle on the tube wall.

6) add the resuspended phage of 1ml 1 * lambda dilution buffer liquid, and resuspended back phage branch is installed to (500 μ L/ pipe) in the 1.5ml centrifuge tube.Add RNaseA to final concentration 1ug/ml in every pipe, DNaseI is to final concentration 5ug/ml, and 37 ℃ digest 20min.

7) add EDTA to final concentration 20mM, stop enzyme reaction; Adding Proteinase K to final concentration then is 100 μ g/ml, destroys bacteriophage coat protein, simultaneously RNase A and DNase is digested, and adds SDS to 0.5%, 65 ℃ of water-bath of final concentration 1 hour.

8) equal-volume phenol, chloroform extracting twice, the chloroform extracting once.

9) supernatant adds isopyknic Virahol, precipitation lambda DNA.

10) 70% washing with alcohol precipitation is dissolved in an amount of TE after draining, the electrophoresis detection that takes a morsel, and all the other-20 ℃ of preservations are standby

5, Lambda phage DNA restriction analysis and subclone sequencing fragment

The lambda bacteriophage dna of getting in 10 positive colonies 1 carries out single endonuclease digestion and double digestion analysis with plurality of enzymes, and their combination is as follows: 1.HindIII+BamHI, 2.HindIII+EcoRV, 3.EcoRV, 4.HindIII+SmaI, 5.SmaI, 6.HindIII+PstI, 7.PstI, 8.HindIII+PvuII, 9.EcoRI, 10.HindIII, 11.HindIII+SalI, 12.HindIII+EcoRI.

The single endonuclease digestion system:

10 * damping fluid, 5 μ L

Lambda DNA 30μL

Restriction enzyme 6 μ L

Aqua sterilisa is settled to 50 μ L.

The double digestion system:

10 * damping fluid, 5 μ L

Lambda DNA 30μL

Restriction enzyme I 5 μ L

Restriction enzyme II 5 μ L

Aqua sterilisa is settled to 50 μ L.

Enzyme is cut the product electrophoresis, hybridized with the probe that screens the library after changeing film, and concrete steps are as follows:

1, electrophoresis and commentaries on classics film

1) with enzymolysis completely the every pipe of DNA add 5 μ l, 10 * loading buffer (70% glycerine, 0.5 * TBE, 0.2%SDS, 20mM EDTA, 0.2% tetrabromophenol sulfonphthalein), mixing.Sample in 1 * TAE (0.8% sepharose makes under the 100v voltage that in the 40cm electrophoresis chamber all samples enters gel from the point sample hole for 40mM Tris-acetate, 1mMEDTA) electrophoretic buffer, then under the 30v constant voltage, electrophoresis 16h.

2) gel behind the electrophoresis is cut unnecessary glue limit, and cut a little angle, place 0.25M HCl jog 15min to show direction.

3) disk is added 0.4M NaOH solution, frame lastblock sheet glass, on put 4 layers of thieving paper of being wider than gel, two is dipped in the liquid, between filter paper bubble can not be arranged.

4) glue with distilled water flushing after, the point sample hole places downwards on the filter paper, drains bubble therebetween, puts the water proof bar around the blob of viscose well.

5) (Hybond-N+ Amersham), is laid on the glue after placing 0.4MNaOH evenly to soak into, and repaves four filter paper with the identical size of film, all bubble can not be arranged therebetween to cut the nitrocellulose filter of the big 1mm of long-width ratio blob of viscose.

6) addend layer paper handkerchief pressed a sheet glass and 750g weight on it, inhaled seal 20～24 hours.

7) after the suction seal finishes, mark in pencil, (0.3M NaCl, 0.03M citric acid pH7.0) soaked 10 minutes 2 * SSC.

8) film is moved on the filter paper, super clean bench dries up.

9) film is sandwiched between filter paper and the two blocks of glass, dried by the fire 1～2 hour in 80 ℃ of baking ovens, with the preservative film parcel, 4 ℃ of preservations are standby.

2, hybridization

Hybridizing method used when hybridizing method after the commentaries on classics film finishes and screening corn gene group library is identical, and hybridizing used probe also is probe used when screening the library.Results of hybridization is shown in Fig. 3 B.

Enzyme is cut the result as shown in Figure 3A, and enzyme is cut the result and shown that used several restriction enzymes are cut the enzyme of lambda bacteriophage dna and all compare fully that the bands of different sizes all separate substantially.The results of hybridization of endonuclease bamhi is shown in Fig. 3 B, the fragment that shows the signal of mixing out in the product of being cut by HindIII, EcoRV, SmaI, HindIII+SalI, HindIII+PvuII and EcoRI enzyme is all bigger, include long promoter region, can select the endonuclease bamhi of one of them enzyme to reclaim, carry out the subclone analysis.(among Fig. 3 A and Fig. 3 B, M is 1kb ladder marker; 1.HindIII+BamHI, 2.HindIII+EcoRV, 3.EcoRV, 4.HindIII+SmaI, 5.SmaI, 6.HindIII+PstI, 7.PstI, 8.HindIII+PvuII, 9.EcoRI, 10.HindIII, 11.HindIII+SalI, 12.HindIII+EcoRI).

In the zone of the about 1kb of initiator codon of the downstream of probe distance z pu1 gene a HindIII point of contact is arranged as can be known according to known cDNA sequence, the restriction enzyme site that an EcoRI is arranged among probe is about the about 300bp of initiator codon of probe distance z pu1 gene.Cutting results of hybridization by the enzyme of Fig. 3 A and Fig. 3 B has the fragment of signal bigger in the HindIII single endonuclease digestion product as can be known, though may comprise long promoter region, is difficult for being connected on the sequencing vector.By HindIII and EcoRI two cut and the result about 3～5kb of the fragment that obtains that EcoRI singly cuts as can be known that EcoRI singly cuts about, it is also long that such length is easy to connect and comprise the zone of promotor.Though it is it is suitable that the fragment length of other endonuclease digestions also has, inconsistent with the restriction enzyme site on the sequencing vector.Therefore the fragment of being cut by the EcoRI enzyme is reclaimed in decision.Cut λ DNA several times with the EcoRI enzyme again then, determined target stripe about about 3.7kb, reclaimed this fragment at last and be connected on the sequencing vector pGEM-3zf, served the order-checking of Hai Lianzhong company.Sequencing result shows that this 3.7kb fragment total length is 3603bp, and it is the 5` flanking sequence of Zpu1 gene A TG upstream that 2267bp is wherein arranged, and other 1332bp sequence is the Zpu1 genome sequence.Compare among the sequence submission GenBank with 3603bp, wherein exon sequence and cDNA sequence homology are 100% in the 1332bp sequence.Illustrate that resulting 2267bp sequence really is the 5` flanking sequence of Zpu1 gene.

The clone of embodiment 2, zpu1P-4 promotor and Construction of eukaryotic thereof and transformation of tobacco

One, the clone of zpu1P-4 promotor and Construction of eukaryotic thereof

1, amplification zpu1P-4 promotor from Zpu1 gene 5` flanking sequence

The 5` flanking sequence of the Zpu1 gene that obtains according to order-checking has designed 2 primer P37F and P38R.With the 3.7kb sequence that is connected on the sequencing vector is template, amplifies a fragment about 500bp by the pcr amplification method from Zpu1 gene 5` flanking sequence.

Amplification system:

10×buffer ·5μL

DNTP mixture (every kind of 10mM) 1 μ L

P37F(10μM) 1μL

P38R(10μM) 1μL

Taq enzyme (5U/ μ L) 0.5 μ L

Template (concentration is 10ng/ μ L) 0.5 μ L

Aqua sterilisa is settled to 50 μ L

Amplification condition is:

94℃ 10min

94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 1min (30 circulations)

72℃ 10min

4 ℃ of preservations.

The result as shown in Figure 4, the fragment called after zpu1P-4 that will obtain with primer P37F and P38R amplification (sequence 1,516bp).Among Fig. 4, M is 1kb ladder marker; 1 is zpu1P-4 (shown in the arrow).

The zpu1P-4 fragment that amplifies is connected to pGEM ^@On the T-Easy sequencing vector, serve the order-checking of Hai Lianzhong company.The 5` flanking sequence of the 2267bpZpu1 gene of sequencing result and gained compares, and consistence is 100%, shows that mispairing does not appear in amplification.

2, Construction of eukaryotic

According to the restriction enzyme site of primer P37F and P38R two ends design, with HindIII and BamHI with the zpu1P-4 fragment from pGEM ^@The T-Easy carrier downcuts, and enzyme is cut the back zpu1P-4 fragment that reclaims and linked to each other with the pBI121 carrier segments that the BamHI enzyme is cut through HindIII.To connect product and transform in the DH5a bacterial strain, extract plasmid DNA, and cut evaluation, utilize primer P37F and P38R PCR to identify the connector of zpu1P-4 fragment and pBI121 carrier with HindIII and BamHI enzyme.With the carrier called after that builds: pBI121-zpu1P-4 (its synoptic diagram as shown in Figure 5).

Two, transformation of tobacco

A large amount of plasmid DNA of extracting the expression vector (pBI121-zpu1P-4) that makes up, get 20 μ L (about 1ug) and transform Agrobacterium LBA4404 competent cell, go up at 28 ℃, YEB substratum (containing kantlex Km 100ug/ml, Streptomycin sulphate Sm 125ug/ml) and to cultivate two days.Respectively select two clones and do bacterium liquid PCR evaluation, all amplify target stripe.

The Agrobacterium that will contain expression vector is inoculated in YEB substratum (containing kantlex Km 100ug/ml, Streptomycin sulphate Sm 125ug/ml), and 28 ℃ of shaking culture are to OD ₆₀₀Be 0.6-0.8, centrifugal 10 minutes of room temperature (4000rpm).Precipitate with MS salts solution (pH 7.0) suspension, and be diluted to 20-50 times of original volume.Get tobacco aseptic seedling blade, cut blade edge and master pulse, blade is cut into about 0.4 * 0.6cm ²About size, put into the bacterium liquid for preparing and soak 5-10min, blot surperficial bacterium liquid with aseptic filter paper, change in the MS solid medium that the surface is covered with one deck filter paper (contain 3mg/L 6-BA, 0.2mg/L NAA, pH 5.8) 28 ℃ of dark cultivations over to.After three days, change in the MS screening culture medium (contain 3mg/L 6-BA, 0.2mg/L NAA contains kantlex 100ug/ml, Reflin 250ug/ml, pH 5.8) 28 ℃ of illumination cultivation, illumination every day 12-16 hour over to.Per 2 all subcultures are once lost the blade and the callus of flavescence at every turn, and big callus cuts into fritter, and behind 2-3 subculture, the callus of cultivation differentiates seedling successively.Seedling is transferred in the bottled MS solid medium of can (contain kantlex Km 100ug/ml, Streptomycin sulphate Sm 125ug/ml, pH 5.8), 28 ℃ of illumination cultivation, treat that its root system development fully after, be transplanted in the greenhouse.

The detection of the Molecular Detection of embodiment 3, tobacco transgenic progeny and zpu1P-4 promoter activity

One, the Molecular Detection of tobacco transgenic progeny

1, the total DNA of tobacco extracts in a small amount

Get about tobacco young leaflet tablet 150mg in the 1.5ml centrifuge tube grinding powder.Add 65 ℃ of preheatings of 800 μ L the SDS lysis buffer (0.1M Tris-HCl, 0.05M EDTA, 0.5M NaCl, 1%SDS), the vibration mixing.65 ℃ of water-baths 20 minutes add 250 μ L 5M KAc, ice bath 5 minutes, centrifugal 10 minutes of 4 ℃, 12000rpm.Get supernatant in another 1.5ml centrifuge tube, centrifugal again 5 minutes of 4 ℃, 12000rpm.Change supernatant over to another clean centrifuge tube, add 600 μ L Virahols, abundant mixing, centrifugal 15 minutes of 4 ℃ of 12000rpm.Use 70% ethanol washing and precipitating 2 times at last, after the vacuum-drying, add 80 μ L sterilization redistilled water dissolving DNA.

2, PCR detects

According to a pair of primer P45F of the sequences Design of gusA gene and P46R, primer is detected the transgene tobacco DNA that extracts with the SDS method with this.Wherein, the PCR reaction system is composed as follows:

10 * damping fluid, 2.5 μ L

DNTP mixture (every kind of 10mM) 0.5 μ L

P45F (concentration is 10uM) 0.5 μ L

P46R (concentration is 10uM) 0.5 μ L

Taq enzyme (concentration is 5U/uL) 0.5 μ L

The total DNA of transgene tobacco (concentration is 20ng/uL) 1 μ L

Aqua sterilisa is settled to 25 μ L.

The PCR detected result shows that it is 72% that ratio is counted in the positive tobacco plant and the strain of tobacco plant to be detected.

Two, the detection of the promoter activity of Amylopectase type starch debranching enzyme gene

The tobacco plant that the PCR detected result is positive extracts the total protein of its stem, leaf and seed, detection by quantitative gusA gene coded protein β-Pu Taotanggansuanmei (activity of β-Glucuronidase), concrete steps are as follows:

1, the making of typical curve

With reaction terminating liquid (0.2mol/L Na ₂CO3) 4-MU (4-methyl umbelliferone) is mixed with 0.00,6.25,12.50,50.00,100.00,250.00,500.00, the series standard concentration of 1000.00pmol, by measuring their fluorescence intensity, make a typical curve.

2, the mensuration of total protein extraction and protein concentration

1) gets the 0.1g material in the 1.5ml centrifuge tube, add liquid nitrogen, grinding powder.

2) add 600 μ L zyme extract (0.05M PH7.0 phosphoric acid buffer, 0.1% SDS, 0.01M PH8.0EDTA, 20% methyl alcohol, 0.1%Triton X-100,0.1% mercaptoethanol), at 4 ℃ of centrifugal 10min of 13000rpm, get supernatant in a new centrifuge tube ,-20 ℃ of preservations are standby.

3) get supernatant, measure proteic content with the Coomassie brilliant blue G250 method.

3, the enzymatic reaction of β-Pu Taotanggansuanmei and fluorescent quantitation thereof

1) gets the supernatant that 50 μ L contain GUS, join in the detection liquid (2mmol/L 4-MUG solution) of 37 ℃ of preheatings of 450 μ L, rapidly abundant mixing.

2) take out 50 μ L at once and join 950 μ L reaction terminating liquid (0.2mol/L Na ₂CO3), with 0 point of this pipe as enzymatic reaction.

3) from reaction solution, take out 50 μ L at 10min, 20min, 30min, 45min and 60min respectively, change in the reaction terminating liquid of 950 μ L.

4) after enzymatic reaction finishes, under excitation wavelength 365nm, emission wavelength 455nm, measure the fluorescent value of different time points with spectrophotofluorometer.

5) according to the total protein of fluorescent value of measuring and participation reaction, obtain the GUS activity, the MU/ protein content (unit: pmol 4-MU.min that the GUS activity=the unit time internal reaction generates ^-1.mg ^-1Albumen).

(β-Glucuronidase) determination of activity result such as table 1 shown in table 2 and the table 3, show: the sequence (zpu1P-4) of (1) Zpu1 gene start codon ATG upstream 516bp is enough to start reporter gene gusA and expresses β-Pu Taotanggansuanmei.(2) expression amount of gusA gene in seed is higher 9 times than the expression amount in leaf, than high 20 times in the stem, proves absolutely that the zpu1P-4 promotor is a seed specific promoters.

Table 1, zpu1P-4 promoters driven gusA gene are expressed in tobacco leaf

Carrier		GUS activity(pmol 4-MU.mg -1.min -1)
										10min	20min	30min	45min	60min	Mean value
	pBI121-zpu1P-4	1	4.098	3.917	5.514	5.068	4.999	4.719									11.302

	2	7.710	9.993	8.015	11.537	11.471	9.745
									3	23.154	31.206	33.344	33.600	29.438	30.148
	4	0.330	0.514	0.397	1.358	0.379	0.596

Table 2, zpu1P-4 promoters driven gusA gene are expressed in tobacco stem

Carrier		GUS activity(pmol 4-MU.mg -1.min -1)
										10min	20min	30min	45min	60min	Mean value
	pBI121-zpu1P-4	1	10.41	16.26	17.17	18.43	17.84	16.022									5.108
2									0.00	5.55	4.22	4.57	2.29	3.326
		3	0.00	1.41	1.38	1.72	0.90	1.084
4									0.00	0.00	0.00	0.00	0.00	0.000

Table 3, the expression of zpu1P-4 promoters driven gusA gene in tobacco seed

Carrier		GUS activity(nmol 4-MU.mg-1.min-1)
										10min	20min	30min	45min	60min	mean
	pBI121-zpu1P-4	1	7.22	12.41	10.36	10.08	14.45	10.902									100.955
2									250.20	273.01	237.49	282.12	293.05	267.173
		3	45.53	55.52	62.86	62.54	68.55	59.000
4									65.86	70.32	64.34	65.66	67.54	66.744

Sequence table

<160>1

<210>1

<211>516

<212>DNA

＜213〉Zea corn (Zea mays L.)

<400>1

gtgtgacata gttatccacg aaccaaacag acctttaatg gtgttttgaa tagttttagt 60

ccataaacca aacatgatag ggactaaatt ttagtctcct aactaaatgt tagtcattga 120

actaaaggaa ccaaacggat accaatactc aatgtatgga aaagacgaga aatcaataac 180

tttatcaaat atgagaacca gccgtgaaga catggcagaa taaaaaaaac aaagcaaaag 240

agctggatat accttaacgg ggaagtcttg acgaaaacaa cattacgtgt atagaaatga 300

gaagataaag aaaagagata agatggccac ggtagctatt agccaaacaa gcactcttct 360

agttcttccg tttctcactt tctcttcctg agaatctccc ctttatatga ataatataaa 420

tgtcacataa gtaaataaac aaataaatca atcaatatta ctacgaagct gtcctcaccg 480

ccttctctct ccctccgaat ccaaacgcgg acgcaa 516

Claims (6)

1, a kind of Amylopectase type starch debranching enzyme gene promoter, its base sequence is shown in SEQ ID NO:1.

2, the carrier that contains the described Amylopectase type starch debranching enzyme gene promoter of claim 1.

3, the clone that contains the described Amylopectase type starch debranching enzyme gene promoter of claim 1.

4, the host bacterium that contains the described Amylopectase type starch debranching enzyme gene promoter of claim 1.

5, the application of the described Amylopectase type starch debranching enzyme gene promoter of claim 1 in the corn seed improvement.

6, the application of the described Amylopectase type starch debranching enzyme gene promoter of claim 1 in plant bioreactor.

Images