CN1769446A - Gene deleting system for transgenic plant safety control and plant expression vector containing same - Google Patents

Abstract

The invention relates to a gene deletion system for controlling the safety of gene-converted plants, including two synthetic specificity recognition sites loxP-FRT fused by loxP and FRT between which there is a polyclonal bit dots sequence for inserting into aim genes which is needed to be leaded into plants, lead the gene deletion system into a plant tissue specificity starting subsequences to construct plant expressing carriers which could delete outside-resource genes completely inside special plant organs, the rate of said system deletion could reach 100% and be used to prepare safe gene-converted plants.

Description

Be used for the gene knock out system of transgenic plant safety control and contain its plant expression vector

Technical field

The present invention relates to a kind of high efficiency gene deletion system that solves the transgenic plant biological safety, specifically, relate to based on the Cre/loxP site-specific recombinase that derives from zymic FLP/FRT and bacteriophage (Site specific recombinase) system.

The invention still further relates to the plant expression vector that contains this gene knock out system.

Background technology

The plant transgenic technology that eighties of last century grows up the nineties, along with technology reaches its maturity, uses increasingly extensive, this technology has become increases crop yield, improve an important means of crop quality.At present, worldwide, the cultivated area of genetically modified crops increases sharply, and transgenic technology is day by day remarkable to the benefit that the mankind bring.

Although transgenic plant have brought huge interests to the mankind, transgenic technology is considered to one of effective means of human this contradiction that solves that land resources falls sharply and population sharply expands, but because the time of this technological development and utilization is very short, human very limited to its biological safety understanding, in the scientific circles and the public, a lot of people feel misgivings to the security of plant transgenic technology, think that the present mankind can't make correct evaluation to the transgenic technology potentially dangerous.Particularly calendar year 2001 David and Ignacio publish thesis on " Nature " and point out, transgenic corns can be transferred to its nearly edge species with foreign gene by pollen, have started one about the whether arguement of safety of transgenic plant in worldwide.

At present, people mainly concentrate on the worry of transgenic plant biological safety: 1. foreign gene may bring adverse influence to ecotope and species diversity.Diffusion as transgenic plant pollen or seed causes gene escape (Gene flow), foreign gene is transferred in weeds or the nearly edge species, and foreign gene (as the Bt gene) is to the injury of non-target organism, and these cause catastrophic consequence all may for the eubiosis and species diversity.2. genetically modified food is to the potential hazard of human health.As the health of some desinsections, antifungal genes and allergen protein possibility harm humans, and antibiotics resistance gene escapes into potentially dangerous that constitutes in the human pathogenic micro-organism or the like.

In order to eliminate the worry of the public to the transgenic plant biological safety, in recent years, some biotechnologys such as cotransformation technology (Komari, T.et al, Plant J.1996,10:165-174.), site-specific recombinase technology (Lyzniik, L.A.et al, Plant Cell Rep.2003,21:925-932) waiting, priority is applied in the control of transgenic plant biological safety.But there is following shortcoming in these technology of hitherto reported:

1. present these technology major concern is that reporter gene in the transgenic plant (as gus gene or GFP gene) or resistant maker gene (as NPTII gene or Bar gene etc.) are removed, and to external source goal gene such as other improvement crop quality, increase crop yield and raising crop resistances, after finishing its function, from transgenic plant, do not delete, these foreign genes still may escape into occurring in nature, ecotope and human health are constituted a threat to, and the public also will exist the worry of transgenic plant and food safety thereof.2. the efficient of foreign gene is all lower in the above-mentioned technology deletion transgenic plant, can only delete the foreign gene in the transgenic plant to a certain extent, can't satisfy genetically modified crops field big area and discharge the genetically modified requirement of the efficient deletion in back, can not thoroughly solve the biological safety problem in the transgenic plant.3. in addition, these technology often need could realize the deletion to foreign gene in the transgenic plant by methods such as hybridization approach or twice transformation, obtain the plant of no foreign gene, and this process cycle is oversize, poor operability.Therefore, existing gene elmination technology all can not satisfy the needs of transgenic plant safety control.

Comparatively speaking, in these technology, derive from site-specific recombinase system being most widely used in plant of microorganism, its deletion efficiency is also higher relatively.At present, the site-specific recombinase system that has obtained more application on plant comprises: (the Odell of Cre/loxP system that 1) derives from bacteriophage P1 (Bacteriophage P1), J.et al, Mol.Gen.Genet.1990,223:369-378.).2) come from yeast (Saccharomyces cerevisiae) 2 μ plasmids the FLP/FRT system (Lloyd, A.M.et al.Mol.Gen.Genet.1994,242:653-657.).All recombinase systems are finished the required element of regrouping process and are only comprised: the site (Recognitionsite) of recombinase (Recombinase) and this recombinase energy specific recognition, its principle of work is also very simple, process is: recombinase identification and in conjunction with specific recognition site corresponding in the transgenic plant genome, form so-called Holliday structure, the oh group that comes from recombinase C-end tyrosine residues produces nucleophillic attack, destroy the phosphate bond at asymmetric 8bp sequence two ends in the recognition site, then, participate in 4 monomer generations of recombinase protein fat group-transfer reaction of recombining reaction, genomic dna unwinds respectively, reconnect again, finish regrouping process (Voziyanov, Y.et al, Nucleic AcidsRes.1999,27:930-941.).

Generally, the site-specific recombinase system is different according to recognition site direction and position, can produce 3 kinds of effects, be respectively: 1. when a pair of reversal of identification site is positioned at the two ends of goal gene, under the effect of corresponding recombinase, all genes between recognition site will be inverted, i.e. inversion (Inversion).2. when a pair of recognition site in the same way is positioned at the two ends of goal gene, its corresponding recombinase will be deleted all foreign genes and the recognition site between the recognition site, in genome, only stay next recognition site at last, reorganization (Recombination) that Here it is.If 3. recognition site lays respectively on the karyomit(e) different in the cell, so under the effect of corresponding recombinase, article two, the exchange of chromosome segment can take place in the position of recognition site in karyomit(e), produces the karyomit(e) of heterozygosis, and this effect just is called location swap (Translocation).

The Cre recombinase is a member in the intergrase family, and its genetic expression is the protein molecule of a 38kD size, it can specific recognition site loxP, regulate the intramolecularly (excision, reversal connection) in loxP site and the specificity of intermolecular (integration) and recombinate.LoxP is the dna sequence dna of one section 34bp, and two ends are inverted repeats of two 13bp, and there is an asymmetric interval region of 8bp the centre, and the Cre recombinase excises the dna fragmentation between two inverted repeats with after the identification of asymmetric interval region combines.This process does not need other any cofactor.

Utilize recombinase Cre/loxP system that the microbiotic marker gene is deleted several modes that mainly contain, the mode of main the earliest employing hybridization is, recombinase gene imported in the transgenic plant that contain recognition site and antibiotic marker gene go, thus the delete flag gene.1991, reports such as Dale placed marker gene NPTII between two loxP sites, by expressing the Cre recombinase gene, marker gene NPTII can be excised from the transgenic plant genome.Russell etc. (1992) and Srivastava etc. (1999) had the report of success afterwards.This method need be introduced recombinase gene in the acceptor gene group, also must separate with the heredity of sexual generation after rejecting marker gene through hybridization, removal recombinase gene, so complicated operation, test need chronic.

As improvement, recombinase gene Cre, recognition site loxP and marker gene are placed on the same expression vector, the Cre expression of gene is subjected to the control of tissue-specific promoter or chemical inducible promoter, and marker gene just can be deleted in any tissue or any stage of transgenic plant growth.Zuo etc. (2001) adopt chemically inducible promoter to obtain a Cre/loxP automatic deleting system, equally, (2003) such as Hoff etc. (2001) and Zhang utilize the heat shock protein promotor to start the Cre expression of gene, have also deleted marker gene respectively in Arabidopis thaliana and maize calli automatically.Compare with crossing system, automatic deleting system has following tangible advantage: 1) the Cre expression of gene is at the T of transgenic plant ₀In generation, just can express, and simplified schedule of operation, saved the time.2) the Cre gene is only just expressed in needs in the automatic deleting system, and the time of expressing is very short, the injury of having avoided Cre gene length time great expression that plant is caused.3) this be present unique can be in the asexually propagated plant kind deletion system of delete flag gene.

Mlynarova and Nap have reported one with the new deletion system that Cre/loxP deletes automatically and twice transformation combines in 2003, in this system, Cre expression of gene amount is restricted.They find behind the transformation of tobacco that a spot of Cre genetic expression is enough to satisfy the needs of delete flag gene, and with respect to constitutive expression, its deletion efficiency is higher.

In the FLP/FRT system, the recognition site of recombinase is made of three multiple 13bp base fragments, two fragment base directions wherein are identical, another fragment is then opposite with these two segmental directions, separated by asymmetric 8bp introns (Spacer) between these two portions, the direction of whole recognition site is by this introns decision.The FLP recombinase specific recognition FRT recombinase site of 48kD, the directivity of FRT determined the FLP recombinase with it in conjunction with after, dna fragmentation is recombinated or is squeezed.

The FLP/FRT system at first by Lyznik etc. in being applied to the transient expression system of corn and paddy rice in 1993, in their experiment, one of them engineered vector includes the uidA gene, but there is the dna fragmentation of one section 1.31kb that it is separated between its promotor and the encoding sequence, this gene is not expressed, a FRT recognition site is arranged respectively, when the FLP recombinase acts on two in the same way behind the recognition site at these fragment two ends, to cut away this fragment, gus reporter gene just can be expressed.Another engineered vector then only includes adh1 promotor or Ubiquitin promotor and FLP recombinase.When the FLP gene under the adh1 promotor starts, two carriers are poured in the protoplastis by the cotransformation mode, the activation recovering of gus protein positive control 10%.If done the time spent when the FLP gene by the Ubiquitin promotor, the activity of gus gene can reach 60%～90%.In addition, when the tumor-necrosis factor glycoproteins among the recognition site FRT was 3 (48bp), the expression of gus gene can reach 25%～50%, if but the tumor-necrosis factor glycoproteins among the FRT when only being two (37bp), the activity of gus gene high all the better (60%～90%).

1994, Lloyed and Davies were transformed into FLP/FRT site-specific recombinase system stability in the tobacco and go.Express the plant and the plant hybridization that has the FRT recognition site of FLP recombinase, at T ₁In generation, the deletion efficiency of recombinase is 70%.In the genetic stability of maize cell transforms, Lyznik etc. (1996) find to change FLP gene and FRT recognition site over to plant jointly by twice transformation, in the callus that obtains, have only 1 expression that gus gene is arranged in 4, illustrate that the efficient of recombinating in this method for transformation is lower.Luo etc. (2000) adopt the method for hybridization, and the FLP recombinase gene is imported in the Arabidopis thaliana, have obtained very high deletion efficiency.

At present, existing site-specific recombinase system exists following significant disadvantages:

The one, in these systems, recombinase gene generally all passes through to transform again or the method for hybridization imports plant, this has just brought problem, when recombinase gene is finished its function, after the fragment removal with the needs deletion, recombinase gene itself also is unnecessary, it need be deleted from transgenic plant, certainly, by the isolating mode of descendant inheritting, it also is possible obtaining there is not the plant of recombinase gene, but so very time-consuming, and is that just has been difficult to agamic plant variety for transgenic plant material.For the Cre/loxP system, in order to overcome this shortcoming, Gleave etc. have obtained the transfer-gen plant of no Cre gene by the instantaneous expression in tobacco of Cre gene.In this piece of writing report, the author is not having under the situation of antibiotic-screening, from 773 strain regrowths, has obtained two strains and has contained the loxP site, but do not had the transfer-gen plant of Cre gene.Though this method can because this method efficient is low, and need do twice transformation, limit the application of this method in actual production greatly not having to have obtained the transfer-gen plant of no recombinase gene under hybridization and the isolating situation of offspring really.

Another potential problem is, our recombinase gene also not fully aware of at present has much adverse influences to plant on earth in the great expression of transgenic plant.Such as at present certainly the Cre gene in potato and petunia, express and can suppress its growth significantly, in tobacco, also have recently similar report (Coppoolse, E.R.et al, Plant Mol.Biol.2003,51:263-279.).But we also do not know at present, is this influence to exist the toxic action that is produced to cause because Cre albumen is a large amount of? still because its influence that on gene level, is caused.If the former, along with not expressing or weak expression of Cre gene, this murder by poisoning will disappear thereupon; But if the latter, this influence may be just more permanent.

More crucial problem is, existing site-specific recombinase system, what mainly consider is how to delete the marker gene in the transgenic plant, reporter gene, for goal gene and recombinase gene itself, not deleted, and the efficient of these recombinase system deletion foreign genes is all not high enough, is difficult to satisfy in the extensive genetically modified crops that discharge in field, delete foreign gene fully, this has limited the application of site-specific recombinase system in actual production greatly.

Former study is found, although recombinase system Cre/loxP and FLP/FRT derive from different microorganisms, but the basic structure of recognition site loxP and FRT is closely similar, and the both is asymmetric intervening sequence (Spacer) formation by the inverted repeats of 2 13bp in two ends and a middle 8bp.Lauth etc. (Lauth, M.et al., Nucleic Acids Res.30:115-128) discover, with the two ends that loxP and FRT place goal gene respectively, under the effect of recombinase Cre or FLP, can improve the efficient of recombinase protein identification and deletion.

Summary of the invention

In view of above situation, in order to obtain gene knock out system efficiently, solve transgenic plant biological safety problem, realization obtains the purpose of non-transgenic product by transgenic plant, the present invention is based on the site-specific recombinase deleting technique, at the low problem of transgenosis deletion efficiency that this technology exists at present, make up new high efficiency gene deletion system in transgenic plant.In view of the above, made up a fusion recognition site loxP-FRT who comprises recognition site loxP and FRT, obtained a brand-new gene knock out system, wish that this system can strengthen identification, combination and the cutting action of recombinase protein to the recognition site sequence, improve site-specific recombinase system deletion efficiency to foreign gene in transgenic plant.

One object of the present invention is to provide a kind of high efficiency gene deletion system that is used for transgenic plant safety control, it contains the Cre/loxP of site-specific recombinase system and the FLP/FRT of fusion, and this system can thoroughly delete the foreign gene in its particular organization or the organ in the specific etap that transgenic plant grow.

Another object of the present invention is to provide a fused specificity recognition site nucleotide sequence loxP-FRT, and it comprises the loxP sequence (shown in SEQ ID NO.1) of 34bp and the FRT sequence (shown in SEQ ID NO.2) of 48bp at least; Further, consider and work as two recognition sites together, because recombinase is in conjunction with occupying certain position, if recognition site directly is connected in this case, will influence next recombinase and be attached to recognition site, therefore can between loxP and FRT, insert a spacer segment sequence, and the joint efficiency of raising recombinase, in a specific embodiment of the present invention, inserted the intervening sequence of a 4bp, be built into the specific recognition site sequence shown in SEQ ID NO.3.

A further object of the present invention is to provide a kind of plant expression vector that contains said gene deletion system, it is connected the said gene system of deleting and is built into plant expression vector with tissue-specific promoter's gene of plant, can delete foreign gene in specific plant organ.

Another purpose of the present invention is to provide a kind of method for preparing safe transgenic plant.

According to an aspect of the present invention, a kind of gene knock out system that is used for transgenic plant safety control comprises: two fusion specific recognition site loxP-FRT in the same way, between two specific recognition sites, comprise one section multiple clone site sequence, described multiple clone site is used for inserting the target gene sequences that various needs import plants, for example reporter gene, screening-gene and need be transformed into endophytic foreign gene.

In a specific embodiments of the present invention, adopt the method for artificial chemosynthesis to obtain one section nucleotide sequence loxP-FRT-MCS-loxP-FRT, this sequence comprises two fusion specific recognition site loxP-FRT in the same way, comprise one section multiple clone site (Multiple Cloning Sites, MCS) sequence therebetween.Fusion recognition site loxP-FRT is 86bp altogether, comprising the FRT sequence of the loxP sequence of 34bp, 48bp and between two recognition sites the intervening sequence of 4bp, sequence is inserted into this nucleotide sequence on the plasmid vector pBIN19 shown in SEQ ID NO.4.

Simultaneously, the present invention has also made up fusion gene 35S-GUS ∷ NPTII-Nos, and this fusion gene segment is inserted in the segmental multiple clone site of loxP-FRT-MCS-loxP-FRT.In the fusion gene that makes up, GUS is as reporter gene, and NPTII is as screening-gene.

According to a further aspect in the invention, in order to control the expression of recombinase gene in the specified plant organ, thereby can on purpose from specific plant tissue organ, delete foreign gene, the invention provides the plant expression vector that contains gene knock out system of the present invention.By being inserted, tissue-specific promoter's sequence of plant certain organs is built into plant expression vector of the present invention in the gene knock out system of the present invention, these tissue-specific promoters include but not limited to: the early stage specific expressed promotor of pollen specific promoter, floral organ and embryo also comprises root-specific promoter, leaf specificity promoter or the like other plant specificity promoter.

In a specific embodiments of the present invention, from the rape genome, cloned the BGP promotor by PCR method, before being inserted into the FLP-Nos fragment, obtain BGP-FLP-Nos, again this segment introducing plasmid vector pBIN19 is gone up in the multiple clone site of artificial synthesized sequence, obtain final plant expression vector, with its called after pLF-BGP-FLP-GN.The pLF-BGP-FLP-GN carrier is transformed agrobacterium tumefaciens, and transformation of tobacco.With pollen specific promoter BGP and FLP gene fusion, can delete system's specifically expressing in the pollen of transgenic plant by controlling gene, with all foreign genes in the deletion transgenic plant pollen.

In another specific embodiments of the present invention, adopt similar approach, clone one and come from arabidopsis gene group floral organ and the early stage specific expressed promotor PAB5 of embryo, before being inserted into the FLP-Nos fragment, the PAB5-FLP-Nos segment is being introduced in the multiple clone site of artificial synthesized sequence on the plasmid vector pBIN19, obtain plant expression vector, with its called after pLF-PAB5-FLP-GN.The PAB5 promotor is fused to the upstream of recombinase FLP gene, can controlling gene deletion system in the pollen of transgenic plant and seed specifically expressing, with all foreign genes in deletion transgenic plant pollen and the seed.

In accordance with a further aspect of the present invention, the method for the transgenic plant of preparation safety comprises that gene knock out system of the present invention, tissue-specific promoter and foreign gene are built into plant expression vector to be transformed plant and obtain safe transgenic plant.

Adopt means such as GUS tissue staining, PCR evaluation and Southern hybridization that transfer-gen plant of the present invention is detected, determine the copy number of transgenic plant foreign gene.In addition, different tissues to transgenosis pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant carries out GUS dyeing respectively, discovery is in the root of transfer-gen plant, stem, leaf, transgenosis can normal expression, illustrate that recombinase gene FLP expresses in vegetative organ under pollen and seed specific promoters driving, expression of exogenous gene is not affected.By the gus gene in transgene tobacco pollen and the seed is detected, in transgenosis pLF-BGP-FLP-GN tobacco pollen, the presentation of results behind the GUS tissue staining, foreign gene is deleted fully.And in transgenosis pLF-PAB5-FLP-GN tobacco the result behind pollen and the seed GUS tissue staining, illustrate that in transgenic plant pollen and seed foreign gene is equally all deleted fully.

For the further thorough deletion of conclusive evidence foreign gene, transgenosis pLF-BGP-FLP-GN plant pollen and wild-type tobacco to be hybridized, filial generation GUS tissue staining shows do not have foreign gene to exist.Similarly, transgenosis pLF-PAB5-FLP-GN plant is distinguished selfing, and hybridize with wild-type, the GUS tissue staining is carried out in selfing and filial generation respectively, the result does not find expression of exogenous gene.The above results shows that in transgenosis pLF-BGP-FLP-GN plant, transgenosis is deleted specifically at the pollen genome, and in the pollen and seed of transgenosis pLF-PAB5-FLP-GN plant, transgenosis is all thoroughly deleted.

By to pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN gene knock out system the deletion efficiency in transgene tobacco add up, both deletion efficiencies of statistical result showed have all reached 100%.

In addition, in order to prove conclusively whether thoroughly deletion of foreign gene, to adopt Southern hybridization and PCR to detect to the transgenic plant after the deletion respectively, the result does not find the detection signal of foreign gene.Further the remaining sheet that pcr amplification is obtained carries out sequence verification, and the result shows, the transgenic plant genome only residual a loxP-FRT fusion recognition site.

Therefore, the present invention has successfully made up gene knock out system and has comprised the plant expression vector of this deletion system, and this deletion system is much higher than the deletion efficiency of existing gene knock out system.

In order to understand essence of the present invention better,,, describe in detail but do not limit the present invention by description to better embodiment of the present invention below in conjunction with accompanying drawing.

Brief description of drawings

Fig. 1 is the electrophoretogram of pcr amplification artificial synthesized sequence FRT-MCS-FRT and loxPFRT-MCS-loxPFRT

Wherein, swimming lane 1, FRT-MCS-FRT fragment, 161bp; Swimming lane 2, loxPFRT-MCS-loxPFRT fragment, 237bp; Swimming lane MM:DNA marker;

Fig. 2 is the electrophoretogram of pcr amplification pollen specific promoter BGP and floral organ and the early stage specificity promoter PAB5 of embryo

Wherein, swimming lane 1 is pollen specific promoter BGP; Swimming lane 2 is the early stage specificity promoter PAB5 of floral organ and embryo; The negative contrast of CK, water is as template;

Fig. 3 is the electrophoretogram of pcr amplification CaMV 35S promoter, gus gene and NPTII-Nos gene fragment

Wherein, swimming lane MM:DNA marker, swimming lane 1 is the CaMV 35S promoter; Swimming lane 2 is a gus gene; Swimming lane 3 is the NPTII-Nos gene fragment;

Fig. 4 is a pLF-GN plasmid structure iron;

Fig. 5 is a pF-BGP-FLP-GN plasmid structure iron;

Fig. 6 is a pLF-BGP-FLP-GN plasmid structure iron;

Fig. 7 is a pLF-PAB5-FLP-GN plasmid structure iron;

Fig. 8 is the result of PCR checking transgenosis pF-BGP-FLP-GN and pLF-BGP-FLP-GN plant

Wherein, MM, dna molecular Marker; The negative contrast of CK; Swimming lane 10, positive control; Swimming lane 1,2,3,4,5 is represented the PCR detected result of the transgenosis pF-BGP-FLP- GN plant plant 2,5,6,10,12 that the GUS coloration result is positive respectively; Swimming lane 6,7,8,9 is respectively the PCR detected result of the transgenosis pLF-BGP-FLP- GN plant plant 2,4,6,9 that the GUS coloration result is positive.

Fig. 9 is the result of PCR molecule checking transgenosis pLF-PAB5-FLP-GN plant

Wherein, MM, dna molecular Marker; CK, negative control; Swimming lane 6, positive control; Swimming lane 1,2,3,4,5,7,8,9,10 is represented the PCR detected result of the transgenosis pLF-PAB5-FLP- GN plant 1,2,4,5,9,11,13,15,16 that the GUS coloration result is positive respectively;

Figure 10 is Southern hybridization checking transgenosis pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant result

Wherein, A:MM, dna molecular marker; Electrophoretogram after the genomic dna that electrophoretogram after the genomic dna that F2, F4, F6 are respectively transgenosis pLF-BGP-FLP- GN plant plant 2,4,6 is cut by the HindIII enzyme, F9, F11 are respectively transgenosis pLF-PAB5-FLP-GN plant plant 9,11 is cut by the HindIII enzyme; WT is for the wild-type plant, as negative control.B:MM, dna molecular marker; F2, F4, F6, F9, F11 are respectively transgenosis pLF-BGP-FLP-GN and pLF-PAB5-FLP- GN plant plant 2,4,6 and 9,11, and WT is the wild-type plant, as negative control.The result shows that plant 2 is that multiple copied T-DNA segment is inserted, and plant 4,6,9 is single copy, and plant 11 is two copies.Dna probe is the endonuclease bamhi of gus gene;

Figure 11 is the expression of gus gene in transgenosis pLF-BGP-FLP-GN tobacco different tissues

Wherein, (A) blade (crosscut); (B) stem (crosscut); (C) root; (D) spend (rip cutting);

Figure 12 is the expression of gus gene in transgenosis pLF-PAB5-FLP-GN tobacco different tissues

(A) blade (crosscut) wherein; (B) stem (crosscut); (C) root; (D) spend (rip cutting);

Figure 13 is transgenosis pLF-GN, pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant T ₀The microscopic examination result of seville orange flower powder GUS dyeing back different times

Wherein, A is the flower in tobacco period 7; B, the flower in tobacco period 12; C, transgenosis pLF-GN plant T ₀For 7 o'clock pollen GUS tissue staining in period; D, transgenosis pLF-GN plant T ₀For 12 o'clock pollen GUS tissue staining in period; E, transgenosis pLF-BGP-FLP-GN plant T ₀For 7 o'clock pollen GUS tissue staining in period; F, transgenosis pLF-BGP-FLP-GN plant T ₀For 12 o'clock pollen GUS tissue staining in period; G, transgenosis pLF-PAB5-FLP-GN plant T ₀For 7 o'clock pollen GUS tissue staining in period; H, transgenosis pLF-PAB5-FLP-GN plant T ₀For 12 o'clock pollen GUS tissue staining in period;

Figure 14 is transgenosis pLF-GN, pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN tobacco T ₀GUS tissue staining result for plant and wild-type filial generation seedling

Wherein, A: the GUS dyeing of transgenic plant pLF-GN self progeny seedling; B: transgenic plant pLF-GN (male parent) and the GUS of wild-type tobacco (female parent) filial generation seedling dye; C: the GUS dyeing of transgenosis pLF-BGP-FLP-GN plant self progeny seedling, the recombinase that contains loxPFRT fusion recognition site is deleted system; D: the GUS dyeing of transgenic plant pLF-PAB5-FLP-GN self progeny seedling; E: transgenic plant pLF-BGP-FLP-GN (male parent) and the GUS of wild-type tobacco (female parent) hybridization seedling dye; F: transgenic plant pLF-PAB5-FLP-GN (male parent) and the GUS of wild-type tobacco (female parent) filial generation seedling dye.Used transfer-gen plant is single copy plant in the experiment;

Figure 15 be transgenosis pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant and with the Southern results of hybridization of wild-type filial generation

Wherein, among F4 and the F6 genomic dna from the T of transgenosis pLF-BGP-FLP- GN plant plant 4 and 6 ₀Generation; It is 4,6,9 T that F4 * WT, F6 * WT, F9 * WT represent transgenosis pLF-BGP-FLP-GN plant strain respectively ₀In generation, as hybridization of female parent, extracted the result that the filial generation genomic dna is done the Southern analysis as male parent and wild-type; It is 11 T that F11 * WT represents transgenosis pLF-PAB5-FLP-GN plant strain ₀In generation, as hybridization of female parent, extracted the result that the filial generation genomic dna is done the Southern analysis as male parent and wild-type; WT is a wild-type tobacco, as negative control;

Figure 16 is the T of pcr amplification transgenosis pLF-BGP-FLP-GN ₀Plant and with the wild-type tobacco filial generation in remaining segmental agarose gel electrophoresis result

Wherein, wt-A is a wild-type tobacco with the result of genomic dna before blooming as the template pcr amplification, and genomic dna was as the result of template pcr amplification before F4-A, F6-A, F9-A were respectively and bloom with transgenosis pLF-BGP-FLP- GN plant plant 4,6,9.Wt-B is a wild-type tobacco with the back genomic dna of blooming as the result of template pcr amplification, and F4-B, F6-B, F9-B are respectively with transgenosis pLF-BGP-FLP- GN plant plant 4,6,9 and the wild-type tobacco filial generation genomic dna result as the template pcr amplification;

Figure 17 is the sequential structure synoptic diagram of the FRT-MCS-FRT of structure;

Figure 18 is the sequential structure synoptic diagram of the loxPFRT-MCS-loxPFRT of structure.

The embodiment of invention

The used test materials of the present invention is commercially available purchase product if no special instructions.

The structure of [embodiment 1] plant expression vector

1, the segmental clone of FRT-MCS-FRT and loxPFRT-MCS-loxPFRT

In order to obtain FRT-MCS-FRT segment (MCS is multiple clone site Multiple Cloning Sites), synthetic following primer sequence:

Primer sequence:

P ₁：5′>GCGAATTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCGGTACCTAT<3′

P ₂：5′>GTCGACGTAGAGCTCGACTCGAGAAGGATCCTTCCCGGGGAAGTTCCTATACTTTCTAGAGAATA<3′

P ₃：5′>GGAACTTCGGAATAGGAACTTCGCTAGCGGC<3′

P ₄：5′>TCTCTAGAAAGTATAGGAACTTCGAATTCGC<3′

P ₅：5′>GGATCCTTCTCGAGTCGAGCTCTACGTCGACATAGGTACCGAAGTTCCTATTCCGAAGTTCCTAT<3′

P ₆：5′>GCCGCTAGCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCCCGGGAA<3′

The sequential structure of FRT-MCS-FRT sees also shown in Figure 17.

In order to obtain the loxPFRT-MCS-loxPFRT segment, synthesize and have two loxP-FRT fusion recognition site sequences in the same way, between two sites, contain a multiple clone site sequence (MCS), detailed process and sequence are as follows:

Primer sequence:

P ₁：5′>GCGAATTCATAACTTCGTATAGCATACATTATAC-GAAGTTATGACCGAAGTTCCTATACTTTCTAGAG<3′

P ₂：5′>AATAGGAACTTCGGAATAGGAACTTCGGTACCTA-TGTCGACGTAGAGCTCGACTCGAGAAGGATCCTT<3′

P ₃：5′>CCCGGGATAACTTCGTATAGCATACATTATACGAA-GTTATCTGAGAAGTTCCTATACTTTCTAGAGAA<3′

P ₄：5′>TAGGAACTTCGGAATAGGAACTTCGCTAGCGGC<3′

P ₅：5′>TATAATGTATGCTATACGAAGTTATGAATTCGC<3′

P ₆：5′>TAGGTACCGAAGTTCCTATTCCGAAGTTCCTATT-CTCTAGAAAGTATAGGAACTTCGGTCATAACTTC<3′

P ₇：5′>CGTATAATGTATGCTATACGAAGTTATCCCGGGA-AGGATCCTTCTCGAGTCGAGCTCTACGTCGACA<3′

P ₈：5′>GCCGCTAGCGAAGTTCCTATTCCGAAGTTCCTAT-TCTCTAGAAAGTATAGGAACTTCTCAGATAACTT<3′

The sequential structure of loxPFRT-MCS-loxPFRT sees also shown in Figure 180, and nucleotide sequence is shown in SEQID NO.4.

According to above-mentioned sequence and primer, after the mode by synthetic obtains complete sequence, annealing, and with the primer at two ends as amplimer, (Invitrogen USA) carries out pcr amplification with the Platimum Pfx archaeal dna polymerase of high-fidelity.Reacted constituent:

Artificial-synthetic DNA's product (25ng/ μ L) 2 microlitres

DNTP (each 10mM) 2 microlitres

Magnesium chloride (5mM)+10 times damping fluid 2 microlitres

Upstream primer, downstream primer (each 100 μ M) 2 microlitres

Platimum Pfx archaeal dna polymerase 2U

10 times of damping fluid 5 microlitres of archaeal dna polymerase

Total reaction volume 50 microlitres

The pcr amplification condition is as follows:

94 ℃, 1min slowly is annealed to 20 ℃ then under the room temperature, places 10min.94 ℃ then, 1min, 58 ℃, 1min, 72 ℃, 30s, 20 circulations.Last 72 ℃ are extended 10min.Pcr amplification has obtained the guiding fragment of about 240bp, and introduces corresponding restriction enzyme site, and gel electrophoresis the results are shown in Figure 1 after the amplification.

The PCR product through a small amount of glue reclaim test kit (Qiagene, USA) behind the purifying, with the EcoRI/NheI double digestion, clone then in pUCm-T (Takara, USA).Identify the positive colony of acquisition check order again (PE company, 377 sequenators with the EcoRI/NheI double digestion; University of Connecticut, USA) checking, correct plasmid called after pUC-F and pUC-LF check order.

2, the clone of pollen specific promoter BGP

According to (Xu such as Xu, H.et al, Mol.Gen.Genet.1993,239, the synthetic respectively two pairs of primers of report 58-65), upstream primer is: 5 ' GCGGTACCTATCATTCCTTTAATTTCAAGG＜3 ' (KpnI), downstream primer is: 5 ' GTCTGCAGTTGGAGAGGAGATGGGTTG＜3 ' (PstI), from rape (Brassica napus) genome, pcr amplification goes out pollen specific promoter BGP.

Reacted constituent:

Genomic dna (25ng/ μ L) 2 microlitres

DNTP (each 10mM) 2 microlitres

Magnesium chloride (5mM)+10 times damping fluid 2 microlitres

Upstream primer, downstream primer (each 100 μ M) 2 microlitres

Platimum Pfx archaeal dna polymerase 2U

10 times of damping fluid 5 microlitres of archaeal dna polymerase

Total reaction volume 50 microlitres

Reaction parameter:95 ℃, 5 minutes.94 ℃, 1 minute, 56 ℃, 1 minute, 72 ℃, 1 minute, 35 circulations.72 ℃ are extended 10min.

The gel electrophoresis of amplification back the results are shown in Figure 2, the PCR product after a small amount of glue reclaims the test kit purifying, with the KpnI/PstI double digestion, clone then in pBlue-FLP-Nos (O ' Gorman, S.et al, Science, 1991,1251:1351-1355).Identify the positive colony of acquisition check order again (PE company, 377 sequenators with the KpnI/PstI double digestion; University of Connecticut, USA) checking, the plasmid called after pBlue-BGP-FLP-Nos that checks order correct.

3, the clone of the early stage specificity promoter PAB5 of floral organ and embryo

According to (Belostotsky D.A.et al. such as Belostotsky, Plant Cell 1996, report 8:1261-1275), synthetic respectively two pairs of primers, upstream primer is: 5 ' GGCGGTACCCTAGAAAGAGAACCAGGGAC＜3 ' (KpnI), downstream primer is: 5 ' CGGCTGCAGCCCCGAATTCCAGATGCAAC＜3 ' (PstI), from Arabidopis thaliana (Arabidopsis tanefacien) genome, pcr amplification goes out pollen specific promoter PAB5.

Reacted constituent is except template DNA is Arabidopis thaliana DNA, and other all are same as the composition of amplification BGP promotor, and reaction conditions is also basic identical.

The gel electrophoresis of amplification back the results are shown in Figure 2, the PCR product with the KpnI/PstI double digestion, is cloned in pBlue-FLP-Nos after a small amount of glue reclaims the test kit purifying then.Identify the positive colony of acquisition check order again (PE company, 377 sequenators with the KpnI/PstI double digestion; University of Connecticut, USA) checking, the plasmid called after pBlue-PAB5-FLP-Nos that checks order correct.

4, the acquisition of 35S-GUS-NPTII-Nos fusion gene

With reference to patents such as Fabijanski (Fabijanski, S.F., Robert, L et al, WO 0159086 andGenBank Accession No.M26402:GUS ∷ NPTII fusion.2001), make up gus gene and NPTII gene Fusion gene.

Detailed process is: at first according to the report (Chen of Chen etc., P.Y.et al, Mol.Breed.2003,11:287-293), synthetic respectively two pairs of primers, upstream primer is: 5 ' GGTCTAGAATGATTGAACAAGATGGATT-G＜3 ' (containing XbaI), downstream primer is: 5 ' GGGTCGACAGACTCCCCGATCTAGTAAC-ATAGTA＜3 ' (containing SalI and SacI).Adopting above-mentioned primer, is template with the pBI121 plasmid DNA, and (Invitrogen USA) carries out pcr amplification to the Platimum Pfx archaeal dna polymerase of usefulness high-fidelity.

Reacted constituent is except template DNA is plasmid pBI121, and other all are same as the composition of amplification BGP promotor.

Reaction parameter:95 ℃, 5 minutes.94 ℃, 1 minute, 57 ℃, 1 minute, 72 ℃, 1.5 minutes, 20 circulations.72 ℃ are extended 10min.

Gel electrophoresis the results are shown in Figure 3 after the amplification, the PCR product is after a small amount of glue reclaims the test kit purifying, the NPTII-nos fragment is encased on the pBluescript II KS (+) by the XbaI/SacI restriction enzyme site, identify with the XbaI/SacI double digestion, the positive colony that obtains is sequence verification again, the clone's called after pBlue-NPTII-Nos that checks order correct.

Adopt above-mentioned same method, mode by pcr amplification obtains the gus gene fragment, according to the synthetic following primer of the report of Chen etc., upstream primer is: 5 ' GGTCIAGAATGTTACGTGGTG-TAGAAACC＜3 ' (XbaI), downstream primer is: 5 ' GGGGATCCTCATTGTTTGCCTCCC-TGCT＜3 ' (BamHI).Adopting above-mentioned primer, is template with the pBI121 plasmid DNA, and (Invitrogen USA) carries out pcr amplification to the Puf archaeal dna polymerase of usefulness high-fidelity.

Reacted constituent is except template DNA is plasmid pBI121, and other all are same as the composition of amplification BGP promotor.

Reaction parameter: 95 ℃, 5 minutes.94 ℃, 1 minute, 57 ℃, 1 minute, 72 ℃, 1.5 minutes, 20 circulations.72 ℃ are extended 10min.

At last by pcr amplification CaMV 35S constitutive promoter, the synthetic pcr primer thing, upstream primer is: 5 ' CCCTCGAGCCAGTATGGACGATTCAAGGC＜3 ' (XhoI), downstream primer is: 5 ' CCGGATCCCGTGTTCTCTCCAAATGAAATG＜3 ' (BamHI).With the pBI121 plasmid DNA is template, and (Invitrogen USA) carries out pcr amplification to the Platimum Pfx archaeal dna polymerase of usefulness high-fidelity.

Reacted constituent is except template DNA is plasmid pBI121, and other all are same as the composition of amplification BGP promotor.

Reaction parameter:95 ℃, 5 minutes.94 ℃, 1 minute, 56 ℃, 1 minute, 72 ℃, 1 minute, 20 circulations.72 ℃ are extended 10min.

Gel electrophoresis the results are shown in Figure 3 after the amplification, the PCR product is after a small amount of glue reclaims the test kit purifying, the gus gene fragment is encased on the pBlue-GUS ∷ NPTII by the XhoI/BamHI restriction enzyme site, identify with the XhoI/BamHI double digestion, the positive colony that obtains is sequence verification again, and called after pBlue-35S-GUS ∷ NPTII.Contain an XhoI and SalI site respectively at these fusion gene two ends, so that next step structure.

5, the structure of plant expression vector

With the two enzymes of EcoRI/NhEI FRT-MCS-FRT and loxPFRT-MCS-loxPFRT fragment are downcut from middle carrier pEGFP-F and pEGFP-LF respectively, insert plant vector pBIN19 (Bevan, M.Binary, Nucl.Acids Res.1984,12, corresponding site 8711-8721), GUS ∷ NPTII fusion gene is being downcut with XhoI/SalI from carrier pBlue-35S-GUS ∷ NPTII, be inserted in FRT-MCS-FRT and the loxPFRT-MCS-loxPFRT fragment intermediary multiple clone site (MSC), (loxP is abbreviated as L to obtain carrier pF-GN and pLF-GN, FRT is abbreviated as F, and 35S-GUS ∷ NPTII is abbreviated as GN), the plasmid structure iron is seen Fig. 4.

PBlue-BGP-FLP-Nos from the middle carrier downcuts the BGP-FLP-Nos gene fragment with the two enzymes of KpnI and SalI, be inserted between the KpnI and SalI restriction enzyme site of the GUS ∷ NPTII fusion gene front on carrier pF-GN and the pLF-GN, obtain plant expression vector pF-BGP-FLP-GN and pLF-BGP-FLP-GN, the plasmid structure iron is seen Fig. 5 and Fig. 6.Similarly, downcut the PAB5-FLP-Nos fragment with KpnI and SalI from middle carrier pBlue-PAB5-FLP-Nos and be inserted between the KpnI and SalI restriction enzyme site of the GUS ∷ NPTII fusion gene front on the carrier pLF-GN, obtain plant expression vector pLF-PAB5-FLP-GN plasmid structure iron and see Fig. 7.

Adopt the frozen-thawed method to be transformed among the agrobacterium tumefaciens LBA 4404 each plasmid.

The acquisition of [embodiment 2] transgenic tobacco plant

The seed disinfection method:

Clear water soaks half an hour, 70% alcohol disinfecting 30 seconds, and 10% chlorine bleach liquor soaked 15 minutes, was using rinsed with sterile water 3-4 time; Seed after the sterilization places on the 1/2MS solid medium, cultivates into aseptic seedling in 25 ℃ illumination box, gets blade and transforms.

The cultivation of agrobacterium tumefaciens:

At first from-80 ℃ of cryopreservation bacterial strains, draw dull and stereotyped, on flat board, choose single bacterium colony, place liquid YEB+50mg/L kantlex substratum, on 28 ℃ of (200 rev/mins) shaking tables, cultivated 28-36 hour, take out 200 μ l bacterium liquid in 20ml liquid YEB+50mg/L kantlex substratum, continue to cultivate 4-6 hour, to OD ₆₀₀Value about=0.8,6000 rev/mins of centrifugal 10 minutes collection thalline are abandoned supernatant, and thalline suspends with the 1/2MS liquid nutrient medium, is used for tobacco and transforms.

Tobacco transforms:

Adopting leaf dish method to transform, is 0.5cm with the blade cuts explant after sterilizing in Bechtop ²About, the explant that cuts is put into bacterium liquid soaked about 10 minutes, inhale the bacterium liquid on defoliation sheet surface with aseptic filter paper.

Blade is changed in the MS solid medium of antibiotic-free, place camera bellows to cultivate 2-3 days, then blade is changed over to the screening culture medium that contains the 50mg/L kantlex (in the MS solid medium+100mg/L cephalo enzyme element+1.0mg/LBA+0.1mg/LNAA), 25 ℃ of illumination is to select under 2000～10000lux condition to cultivate, the time of selecting to cultivate was approximately for 3～4 weeks, per during this time two weeks are changed once fresh screening culture medium, produce until resistant buds and plant, go blade wherein to be used for further detection.

GUS detects:

Transgenic plant material (blade, stem, root etc.) is thinly sliced, put into fresh configuration the X-Gluc staining fluid (Promega, USA) in, 37 ℃ the insulation 1～12 hour.After treating fully dyeing, decolour 2～3 times, be white in color to control material (wild-type plant) with 75% (v/v) alcohol.Pollen and seed are owing to wrapping by stratum corneum and planting skin, and the X-Gluc staining fluid is difficult to soak into, and in order to dye fully, generally, behind the adding X-Gluc dye liquor, vacuumize earlier 5～10 minutes, carry out the GUS tissue staining by above program again.

PCR detects:

Extract plant genome DNA, adopt the CTAB method, process is as follows:

With the young leaflet tablet grind into powder behind the liquid nitrogen flash freezer, be transferred in the centrifuge tube of 10ml, the CTAB that adds 65 ℃ of preheatings extracts damping fluid (0.1g/ml), concuss mixing.65 ℃ of water-baths 45 minutes are put upside down mixing therebetween 2～3 times.Add and the isopyknic phenol of extraction damping fluid: chloroform: primary isoamyl alcohol (25: 24: 1), vortex mixing 3～5 minutes, 6000 rev/mins then, centrifugal 15 minutes of normal temperature is transferred to supernatant liquor in the one new centrifuge tube.Add 2/3 times to the Virahol of supernatant liquor volume, fully room temperature is placed more than 2 hours behind the mixing.Visible white flocks in centrifuge tube, the useable glass rod is chosen, and puts into the alcohol rinsing 2～3 times of 75% (v/v); Also can centrifugal 10 minutes collecting precipitations of direct 10000 rev/mins of room temperatures, with the alcohol washing precipitation of 75% (v/v).After the dry air, add an amount of TE dissolution precipitation and promptly obtain genomic dna.The total dna content of electrophoresis detection plant.PCR detects the NPTII resistant gene in the regeneration plant, synthetic its two ends primer, and upstream primer is: 5 '-AGGCTATTCGGCTATGACTGG-3 ', downstream primer: 5 '-TCGGGAGCGGCGATACCGTA-3 '.

Reacted constituent is except template DNA is the transgene tobacco genomic dna, and other all are same as the composition of amplification BGP promotor.

Reaction parameter: 95 ℃, 5 minutes; 94 ℃, 1 minute, 56 ℃, 1 minute, 72 ℃, 1 minute, 40 circulations.72 ℃ are extended 10min.

Transgenosis pF-BGP-FLP-GN, pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN tobacco PCR detect the results are shown in Figure 8 and Fig. 9.

The Southern hybridization analysis:

For proving that further foreign gene has imported in the transgenic plant, choose 5 T in transgenosis pLF-BGP-FLP-GN and the pLF-PAB5-FLP-GN plant respectively ₀Carried out Southern hybridization checking for plant, determined that simultaneously these several plant foreign genes insert the copy number in the transgene tobacco genome.Adopt CTAB method commonly used to extract 10 μ g plant genome DNAs and cut with the abundant enzyme of restriction enzyme HindIII, electrophoresis on 1.0% (w/v) sepharose then, agarose electrophoresis the results are shown in Figure 10-A.Change film, prehybridization, hybridize, wash film and radioautograph by the high salt method of " molecular cloning experiment guide " (calendar year 2001, third edition) again.With the GUS fragment of pBI121 plasmid DNA, isotropic substance α on usefulness RadPrime random primer labeling kit (GibcoBRL) mark- ³²P obtains dna probe.Transgenosis pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN5 plant Southern results of hybridization seen Figure 10-B.

Owing on carrier pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN, there is the restriction enzyme site of two HindIII, one of them site is positioned in the middle of the FLP gene, another is between CaMV 35S promoter and GUS::NPTII fusion gene, size is 2.2kb, so, when with the GUS fragment during as probe, in all transfer-gen plant Southern results of hybridization, all should there be signal in position at 2.2kb, as shown in Fig. 9-B.In plant 2, also have 4 bands at least, illustrate on this plant genome, have at least the foreign gene of 4 copies to insert.In plant 4,6 and 9,1 band is respectively arranged, be illustrated as single copy.Plant 11 has 2 bands, then is two copies.In the wild-type plant, do not detect any hybridization signal.Above result conforms to the PCR detected result with GUS dyeing, illustrates that foreign gene has imported in the genome of transgene tobacco really.

Expression of exogenous gene analysis in [embodiment 3] transfer-gen plant

1, the expression analysis of gus gene in the transgenosis pLF-BGP-FLP-GN tobacco

Choose pollen specific promoter BGP control site-specific recombinase FLP expression of gene, in theory, in transgenosis pLF-BGP-FLP-GN plant, the recombinase FLP gene of BGP promotor control should only be expressed in mature pollen, the deletion foreign gene.Therefore, before the transgenic plant pollen maturation all should be able to detect the great expression of gus reporter gene (control of CaMV 35S promoter) in a organized way.Whether have the tissue specific expression feature in order to detect promotor BGP, choose T in the transgenosis pLF-BGP-FLP-GN tobacco plant 4 respectively ₀Root, stem, leaf and prematurity floral organ official rank material for plant carry out the GUS tissue staining, and what show among Figure 11 is the GUS coloration result of pLF-BGP-FLP-GN transgenic plant different tissues.

2, the expression analysis of gus gene in the transgenosis pLF-PAB5-FLP-GN tobacco

Whether has the early stage tissue expression specificity of good pollen, ovary and embryo in order to detect the pAB5 promotor, the site-specific recombinase deletion system of pAB5 promotor control imported in the tobacco express, the expression of gus gene in each tissue of transgenic plant is detected.That Figure 12 shows is transgenosis pLF-PAB5-FLP-GN plant GUS tissue staining result.As can be known from Fig. 12, in root, stem, leaf and the floral organ of transgenic tobacco plant 8, all detected the great expression of gus gene, illustrate that the T-DNA fragment has been inserted in the genome of transgene tobacco really in the pLF-PAB5-FLP-GN carrier, the existence of pLF-PAB5-FLP-GN deletion system does not influence the normal expression of gus reporter gene in tissues such as transgenic plant root, stem, leaf even flower, proves that the pAB5 promotor has higher tissue expression specificity.

The deletion analysis of foreign gene in [embodiment 4] transfer-gen plant pollen

1, the deletion analysis of foreign gene in the transgenosis pLF-BGP-FLP-GN tobacco pollen

In the single copy of transgenosis pLF-GN plant plant, since there is not the site differential recombination enzyme gene to exist, and the period that is expressed in 7 of gus gene (Figure 13-C) very high, most pollen all are blue behind the GUS tissue staining, (during Figure 13-D), the expression amount of gus gene is still very high in period 12.T transgenosis pLF-BGP-FLP-GN plant plant ₀In the seville orange flower powder, recombinase FLP gene has pollen specific promoter BGP control, there is fusion recognition site loxP-FRT simultaneously, although (expression of gus gene is equally very high during Figure 13-E) in period 7, but (do not observe blue pollen among Figure 13-F) in period 13, explanation is in the middle and later periods of pollen maturation, because pollen specific promoter BGP guiding recombinase FLP genetic expression, this recombinase can work rapidly, foreign genes such as GUS on the pollen genome are deleted fully, gus protein is degraded in the cell, so behind the GUS in period 12 tissue staining, do not detect the existence of blue pollen.

2, the deletion analysis of foreign gene in the transgenosis pLF-PAB5-FLP-GN tobacco pollen

T transgenosis pLF-PAB5-FLP-GN plant plant ₀In the seville orange flower powder, recombinase FLP gene has pollen specific promoter PAB5 control, there is fusion recognition site loxP-FRT simultaneously, although (expression of gus gene is equally very high during Figure 13-G) in period 7, but (do not observe blue pollen among Figure 13-H) in period 12, explanation is in the middle and later periods of pollen maturation, because pollen specific promoter PAB5 guiding recombinase FLP genetic expression, this recombinase can work rapidly, foreign genes such as GUS on the pollen genome are deleted fully, gus protein is degraded in the cell, so behind the GUS in period 12 tissue staining, do not detect the existence of blue pollen.

The result of [embodiment 5] transfer-gen plant and wild-type filial generation GUS tissue staining

According to Mendelian's classical genetics theory, if transgenosis T-DNA fragment is inserted in the Plant Genome, at T with single copy ₁In generation, will show 3: 1 separation ratio, therefore, in the offspring that the selfing of transgenosis pLF-GN plant obtains, the GUS tissue staining should have 75% seedling to be dyed blueness in theory, and in pLF-BGP-FLP-GN plant self progeny, because the existence of site-specific recombinase system, then should there be 50%～75% seedling can dye blueness, concrete quantity is by the deletion efficiency decision of pLF-BGP-FLP-GN system.With pLF-PAB5-FLP-GN plant self progeny in, because it is specific expressed in pollen and seed that promotor PAB5 can drive recombinase FLP, therefore, in the self progeny, should have 0%～75% seedling can dye blueness, concrete quantity is by the deletion efficiency decision of pLF-PAB5-FLP-GN system.

In order to prove conclusively transgene tobacco T ₀Whether the conclusion that the GUS tissue staining obtains in the seville orange flower powder is credible, with transgenosis transgenosis pLF-GN, pLF-BGP-FLP-GN and the single copy of pLF-PAB5-FLP-GN plant plant T ₀The pollen and the wild-type tobacco in generation are hybridized, and obtain the seed of filial generation, and the seedling after these seeds and their sproutings is carried out the GUS tissue staining.In theory, deleted if the gus gene in the pollen genome does not have, blueness (expression product of gus gene) just should be observed in filial generation seedling dyeing back so.If the single copy of pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant T ₀After plant and wild-type hybridization, because the existence of deletion system, in the filial generation seedling, blue seedling quantity should reduce or not have blue seedling behind the GUS tissue staining.

A, C, D show the result of transgenosis pLF-GN, pLF-BGP-FLP-GN and pLF-PAB5-FLP-GN plant self progeny seedling GUS tissue staining respectively among Figure 14, and its Smalt seedling ratio is respectively: 75%, 50% and 0%.When with the pollen of single copy transgenic plant during, in transgenosis pLF-GN plant hybridization offspring, should there be 50% seedling to have gus gene (figure B) with wild-type hybridization; In the filial generation of transgenosis pLF-BGP-FLP-GN plant, infer that about 0～50% seedling has gus gene.The result who obtains in the experiment does not then observe blue seed in Figure 14-E as shown in Figure 14-E, illustrate to have high deletion efficiency by pLF-BGP-FLP-GN, excises the foreign gene in the filial generation genome more thorough.Figure 14-D and-F in the result of GUS tissue staining show, no matter be transgenosis pLF-PAB5-FLP-GN plant pollen and wild-type tobacco hybridization (figure D), still transgenosis pLF-PAB5-FLP-GN plant selfing (figure F), all do not detect blue seedling, illustrate that the pAB5 promotor can both start recombinase FLP expression of gene specifically in transgenic plant pollen and ovary, delete foreign gene efficiently.

The deletion efficiency analysis of foreign gene in [embodiment 6] transfer-gen plant

1, the deletion efficiency analysis of foreign gene in transgenosis pLF-GN, pF-BGP-FLP-GN and the pLF-BGP-FLP-GN tobacco

In transgene tobacco pollen, delete the efficient of foreign gene in order to obtain pF-BGP-FLP-GN and pLF-BGP-FLP-GN system, more single fusion recognition site FRT and fusion recognition site loxP-FRT are to the influence of recombinase system deletion efficiency, respectively transfer-gen plant (as male parent) and wild-type (as female parent) are hybridized, and to the seedling GUS tissue staining of filial generation, by statistics to the white seedling of indigo plant, obtain the deletion efficiency of these systems in transgene tobacco pollen, the part statistics is shown in Table 1.

The comparison of table 1. different loci specificity recombinase system deletion efficiency

Hybridization	Strain system	Blue GUS (+)	White GUS (-)	Deletion efficiency (%)
					Wild-type (female parent) * pLF-GN (male parent)	3 8 10	463 343 310	454 125 332	0 0 0
Wild-type (female parent) * pF-BGP-FLP-GN (male parent)	2 6 9 10 12 16	127 214 54 306 251 176	349 166 428 197 214 228	46.5 ND 77.5 18.9 28.1 ND
					Wild-type (female parent) * pLF-BGP-FLP-GN (male parent)	2 4 6 9 11 17	2,016 0 0 0 0 2,135	9,057 25,883 9,904 22,057 16,989 3,664	63.6 100 100 100 100 49.3

Annotate: if when transfer-gen plant be single the copy, filial generation deletion efficiency %=(white seedling number-blue seedling number)/(blue seedling number+white seedling number) * 100%.If transfer-gen plant has two copies, deletion efficiency %=(3 * white seedling number-blue seedling number)/3 * (blue seedling number+white seedling number) * 100% then.ND represents that deletion efficiency is not added up in this plant.

The result shows that in transgenosis pLF-GN (male parent) * wild-type (female parent) filial generation, although there is the fusion recognition site, owing to there is not recombinase gene, deletion efficiency all is 0 in each plant.In the filial generation of pFBFGN (male parent) * wild-type (female parent), BGP promotor guiding FLP recombinase gene is expressed, and recognition site be its corresponding FRT, and deletion efficiency has reached 18.9%～77.5% respectively in homophyletic not is.And show that in the result of pLF-BGP-FLP-GN (male parent) * wild-type (female parent) filial generation GUS dyeing statistics plant 4,6 and 9 seedling also count down to more than 20,000, and do not find blue seedling, these plant all be single transgenic plant that copy.The result of GUS tissue staining in the with good grounds table 1, Km resistance screening and Southern hybridization as can be known, plant 11 be two copy transfer-gen plants, but hybridizes with wild-type, behind the seedling GUS tissue staining, statistical result showed, deletion efficiency also reaches 100%.And plant 2 inserts for multiple copied, and its deletion efficiency only is 63.5%.The transfer-gen plant that deletion efficiency is minimum is a plant 17, has only 49.3%.

2, the deletion efficiency analysis of foreign gene in the transgenosis pLF-PAB5-FLP-GN tobacco

In transgenosis pLF-PAB5-FLP-GN plant, promotor PAB5 is specific expressed in pollen, ovary and body early embryo, in order to detect the deletion efficiency of pLF-PAB5-FLP-GN system in transgenic plant pollen and ovary, respectively with transgenosis pLF-PAB5-FLP-GN plant as male parent and wild-type as hybridization of female parent, simultaneously also with wild-type as male parent and transgenosis pLF-PAB5-FLP-GN plant as hybridization of female parent.Because promotor PAB5 guiding FLP specific gene expression, foreign gene all may be deleted in transgenic plant pollen or ovary.In order to detect the deletion efficiency of recombinase in different tissues, the filial generation seed is sprouted respectively, the GUS tissue staining is added up the deletion efficiency in each plant then, and it the results are shown in Table 2.

Statistical result showed in the table 2, the deletion efficiency diversity ratio between each plant of transgenosis pLF-PAB5-FLP-GN plant is bigger.Deletion efficiency is minimum in the plant 9, in pollen and ovary, be respectively 19.8% and 30.7%, in plant 2, although the result of pollen of transgenic plant and wild-type tobacco hybridization shows, foreign gene is deleted in pollen fully, but the deletion efficiency in its ovary is not high, only reaches 69.7%.But in plant 8 and plant 12, no matter be that transgenic plant are as male parent and wild-type hybridization, still it is hybridized with wild-type as maternal, behind the offspring seedling GUS tissue staining, individuality counts near 15, all do not find blue plant at 000 o'clock, and do not find blue seedling (result does not show) among their self progenies yet, PAB5 promotor guiding recombinase FLP genetic expression is described, in the pollen and seed of transgenosis pLF-PAB5-FLP-GN plant, foreign gene 100% ground can both be deleted.

The statistics of deletion efficiency in each plant of table 2. transgenosis pLFABFGN plant

Hybridization	Strain system	Blue GUS (+)	White GUS (-)	Deletion efficiency (%)
					Wild-type (female parent) * pLF-PAB5-FLP-GN (male parent)	2 3 5 8	0 306 1,267 0	12,450 6,528 5,916 14,462	100 91.1 65.3 100

	9 12 16	4520 0 2,045	6,754 14,675 8,624	19.8 100 61.8
					Wild-type (female parent) * pLF-PAB5-FLP-GN (male parent)	2 3 5 8 9 12 16	1,332 68 2,468 0 3,165 0 1,570	7,452 8,395 6,890 14,836 5,821 14,254 7,844	69.7 98.4 47.3 100 30.7 100 66.6

Annotate: deletion efficiency %=(white seedling number-blue seedling number)/(white seedling number+blue seedling number) * 100%.F: male parent, M: female parent.

The segmental detection of remaining external source in [embodiment 7] transgenic plant pollen genome

1, Southern hybridization detects

GUS tissue staining by transgenosis pLF-BGP-FLP-GN tobacco and wild-type filial generation, there has not been gus protein in these transfer-gen plant filial generations of tentative confirmation, infer that thus gus gene may be deleted from transgenosis pLF-BGP-FLP-GN plant pollen genome.Whether credible for The above results, extract transgenosis pLF-BGP-FLP-GN plant plant T respectively ₀The genomic dna of the genomic dna in generation and transgenosis pLF-BGP-FLP-GN plant and wild-type tobacco filial generation is done Southern hybridization with the gus gene segment as dna probe, obtains the result of Figure 15.

Show among Figure 15 that F4 and F6 are the T of transgenosis pLF-BGP-FLP-GN plant plant 4 and plant 6 ₀For the Southern results of hybridization, with the results of hybridization comparison among Figure 10-B, both hybridization signals are similar, illustrate that twice Southem results of hybridization repeatability is fine, reliable experiment result.Adopt same dna probe, to transgenosis pLF-BGP-FLP- GN plant 4,6,9 and transgenosis pLF-PAB5-FLP-GN plant 11 respectively with the wild-type filial generation, and wild-type tobacco is done Southern hybridization, the result does not observe any probe signals (shown in Figure 15), illustrates that the FLP recombinase gene has not been present in the pollen genomes of transgenic plant (the FLP gene fragment is as hybridization probe).This result confirms that from molecular level all foreign genes are thoroughly deleted once more from transgene tobacco pollen genome.

2, PCR detects

According to the result of Figure 14, in transgenosis pLF-BGP-FLP- GN plant plant 4,6,9, foreign gene is deleted from transgenic plant pollen genome.In order further to have detected the residual dna fragmentation of all exogenous genetic fragments and the deleted back of foreign gene thereof before not deleting in the transgenosis pLF-BGP-FLP-GN plant, determine T-DNA size deleted in the transgenic plant pollen genome, between T-DNA two ends border sequence and loxPFRT fusion recognition site sequence, designed a pair of primer respectively, with transgenosis pLF-BGP-FLP-GN plant T ₀Generation bloom preceding and with the genomic dna of wild-type filial generation be template, pcr amplification obtains the result of Figure 16.

As can be known from Fig. 16, if with transgenosis pLF-BGP-FLP-GN plant T ₀For the template of genomic dna before blooming as pcr amplification, can obtain respectively a 7.3kb (Figure 16-F4-A ,-F6-A ,-F9-A) amplified production, wherein the 7.3kb fragment is represented fusion recognition site loxPFRT sequence, BGP-FLP-nos and 35S-GUS ∷ NPTII-nos fragment.And with transgenic plant and wild-type tobacco filial generation genomic dna template as pcr amplification, because 35S-GUS ∷ NPTII-nos gene, recombinase gene and a fusion recognition site loxPFRT between the fusion recognition site sequence have deleted in the site-specific recombinase system, so the result that pcr amplification obtains includes only a fusion recognition site sequence and comes from structure sequence on the T-DNA fragment, size be about 220bp (Figure 16-F4-B ,-F6-B ,-F9-B).Above result shows that once more in transgenosis pLF-BGP-FLP- GN plant plant 4,6,9 pollen genomes, the external source functional gene is deleted.

3, remaining T-DNA fragment sequence is analyzed among the transgenosis pLF-BGP-FLP-GN plant hybridization offspring

According to former study (Gwang Lee et al., 1998), in the FLP/FRT system, behind recombinase FLP specific recognition its site FRT, with the excision of the dna fragmentation between two sites, remainder reconnects, an only residual recognition site on the transgenic plant genome.Adopted loxPFRT fusion recognition site in this experiment, obtained the recombinase deletion system all more much higher than the site-specific recombinase system-kill efficient of existing report.For the fusion recognition site is discerned and combined to the reason of making this system-kill efficient raising clear whether with recombinase protein, and concrete cutting position is relevant, at first extract the transgenic plant genomic dna of having deleted foreign gene, T-DNA sequences Design primer according to two ends, fusion recognition site, carry out pcr amplification, the results are shown in shown in Figure 16 of amplification is after the amplified fragments of the about 220bp of size in 4 reclaims respectively, clones with strain wherein, sequencing analysis.

From sequencing result as can be known, in transgenosis pLF-BGP-FLP-GN plant and wild-type tobacco filial generation, the nonfunctional area sequence at only surplus really next loxPFRT fusion recognition site and T-DNA two ends, another one loxPFRT fusion recognition site, 35S-GUS ∷ NPTII-nos fusion gene and BGP-FLP-nos are deleted fully.Similar in the residual DNA fragment of being left behind recombinase protein identification and the cutting fusion recognition site and the FLP/FRT system of former report.Also further from the molecular level conclusive evidence, in the pollen genome of transgenosis pLF-BGP-FLP-GN tobacco, all external source functional genes are deleted really for above result.

Above detailed description of the present invention does not limit the present invention, and those skilled in the art can make various changes and distortion according to the present invention, and these changes and distortion all should belong to the scope of claims of the present invention.

05P101397.ST25.txt

SEQUENCE?LISTING

＜110〉Southwestern University

＜120〉be used for the gene knock out system of transgenic plant safety control and contain its plant expression vector

<130>CQ302-05P101397

<160>4

<170>PatentIn?version?3.1

<210>1

<211>34

<212>DNA

＜213〉bacteriophage P1 (Bacteriophage P1)

<220>

<221>misc_feature

<222>(1)..(34)

＜223〉loxP site sequence

<400>1

ataacttcgt?atagcataca?ttatacgaag?ttat 34

<210>2

<211>48

<212>DNA

＜213〉yeast (Saccharomyces cerevisiae)

<220>

<221>misc_feature

<222>(1)..(48)

＜223〉FRT site sequence

<400>2

gaagttccta?tactttctag?agaataggaa?cttcggaata?ggaacttc 48

<210>3

<211>86

<212>DNA

＜213〉artificial sequence (artificial)

<220>

<221>misc_feature

<222>(1)..(86)

＜223〉fused specificity recognition site loxP-FRT

<400>3

ataacttcgt?atagcataca?ttatacgaag?ttatgaccga?agttcctata?ctttctagag 60

aataggaact?tcggaatagg?aacttc 86

<210>4

<211>237

<212>DNA

＜213〉artificial sequence (artificial)

<220>

<221>misc_feature

<222>(1)..(237)

＜223〉gene knock out system

<400>4

gcgaattcat?aacttcgtat?agcatacatt?atacgaagtt?atgaccgaag?ttcctatact 60

ttctagagaa?taggaacttc?ggaataggaa?cttcggtacc?tatgtcgacg?tagagctcga 120

ctcgagaagg?atccttcccg?ggataacttc?gtatagcata?cattatacga?agttatctga 180

gaagttccta?tactttctag?agaataggaa?cttcggaata?ggaacttcgc?tagcggc 237

Claims (11)

1, a kind of gene knock out system that is used for transgenic plant safety control comprises

Two loxP and FRT fused specificity recognition site loxP-FRT in the same way comprise one section multiple clone site sequence, wherein between described two specific recognition sites

Described loxP is the recognition site that derives from the Cre site-specific recombinase of bacteriophage, described FRT is the recognition site that derives from zymic FLP site-specific recombinase, described loxP-FRT is merged by loxP recognition site sequence and FRT recognition site sequence and forms, and described multiple clone site is used for inserting the target gene sequences that various needs import plant.

2, the described gene knock out system of claim 1 is characterized in that described specific recognition site loxP-FRT comprises the loxP sequence of 34bp and the FRT sequence of 48bp at least, respectively shown in SEQ ID NO.1 and SEQ ID NO.2.

3, the described gene knock out system of claim 1 is characterized in that in the described fused specificity recognition site, also comprises a spacer segment sequence between loxP sequence and FRT sequence.

4, the described gene knock out system of claim 3 is characterized in that described fused specificity recognition site has the nucleotide sequence shown in the SEQ ID NO.3.

5, the described gene knock out system of claim 1 is characterized in that it has the sequence shown in the SEQ ID NO.4.

6, the plant expression vector that contains the described gene knock out system of claim 1.

7, the described plant expression vector of claim 6 is characterized in that in described plant expression vector, further introduces a plant tissue specificity promoter sequence in the multiple clone site of gene knock out system.

8, the described plant expression vector of claim 7 is characterized in that described plant tissue specificity promoter sequence is pollen specific promoter sequence or floral organ and the early stage specificity promoter sequence of embryo.

9, a kind of fused specificity recognition site sequence, the recognition site loxP that origin comes from the Cre site-specific recombinase of bacteriophage merges formation with the recognition site FRT that derives from zymic FLP site-specific recombinase, it comprises the loxP sequence of 34bp and the FRT sequence of 48bp at least, respectively shown in SEQ ID NO.1 and SEQ ID NO.2.

10, a kind of method for preparing safe transgenic plant comprises the described gene knock out system of claim 1, plant tissue specificity promoter are built into plant expression vector with the foreign gene that need import plant and transform plant and obtain safe transgenic plant.

11, the purposes of the described gene knock out system of claim 1 in the preparation transgenic plant.

Images