CN100334212C - Prokaryotic secreation vector for expressing infused E.coli heat-labile enterotoxin B subunit - Google Patents

Abstract

The present invention relates to a carrier used for pronucleus secretion and fusion expression of a heat-labileenterotoxin B subunit (E. coli heat-labileenterotoxin B subunit, LT-B) of escherichia coli, which is a closed-loop plasmid using pET32a as a basic skeleton. A nucleotide sequence of the human source escherichia coli heat labileenterotoxin B ylidene (LT-B) is inserted between the first restricted enzyme cutting site NdeI after RBS of pET32a and NocI in the polycloning site region to construct pET-LTB. When the expression carrier of the present invention is used, the pronucleus secretory expression of LT-B can be realized, the defects formed by the expression of inclusion body are overcome, and simultaneously, a mucosa vaccine can be formed by the fusion expression with protective antigen protein to be convenient for inoculation.

Description

A kind of carrier that is used for prokaryotic secretion, amalgamation and expression coli heat-sensitive toxin B subunit

Technical field

The present invention relates to a kind of prokaryotic expression coli heat-sensitive toxin B subunit (E.coli heat-labile enterotoxin Bsubunit, carrier LT-B), particularly a kind of carrier that is used for prokaryotic secretion, amalgamation and expression LT-B of being used for.

Background technology

(E.coli heat-labile enterotoxin LT) is made up of two subunits of A, B the coli heat-sensitive enterotoxin, and wherein avirulent B subunit (LT-B) has stronger immunogenicity, and stronger mucosal immunity activity is particularly arranged.When therefore the multiple clone site district behind LT-B did not have the goal gene insertion, expressed protein can produce the antibody of Chinese People's Anti-Japanese Military and Political College's enterobacteria temperature-sensitive enterotoxin, thereby can be used as the vaccine composition of prevention " turista " and cub diarrhoea.

The LT-B prokaryotic expression is many with the inclusion body form at present, and this brings difficulty for expression product (target protein LT-B) purifying.In addition, LT-B is a kind of generally acknowledged mucosal immunity incitant, with the protective antigen albumen of its amalgamation and expression in, can be used as the mucosal immunity activity that mucosal adjuvant improves vaccine, thereby change the route of inoculation of vaccine.Therefore; how to realize LT-B and express (overcoming the defective of inclusion body expression-form) with the proteic prokaryotic secretion of the protective antigen of its fusion; can be the technical issues that need to address of the present invention with other protective antigen protein fusion expression (form mucosal vaccine, be convenient to carry out preventive vaccination) again simultaneously by mucous membrane.

Summary of the invention

The objective of the invention is to, provide a kind of and can realize the prokaryotic secretion of LT-B, the carrier of amalgamation and expression.

The present invention is said to realize that it is the closed loop plasmid of basic skeleton with pET32a (available from NOVGE company) that the prokaryotic secretion of LT-B, the carrier of amalgamation and expression (pET-LTB) are one, the nucleotide sequence that inserts coli heat-sensitive toxin B subunit (LT-B) between the NocI in first restriction enzyme site NdeI behind the RBS of pET32a and multiple clone site district makes up and forms, and its structure as shown in Figure 1.

Wherein: the front end of the nucleotide sequence of LT-B has initiator codon ATG and complete signal peptide sequence, the terminal terminator codon of removing, and directly link to each other with thereafter multiple clone site.

The building process of pET-LTB is as follows:

1. synthetic primer

Synthetic of the present invention upstream and downstream primer is respectively: P1:5 '-GCG CAT ATGAAT AAA GTA AAA TGT TATGTT-3 '; P2:5 '-GTC CCA TGGGTT TTC CAT ACT GAT TGC CGC-3 '.In primer P1, introduced Nde I restriction enzyme site.Introduced the NocI restriction enzyme site among the primer P2.

2. the pET32a carrier is gone in the LT-B gene clone

The LT-B gene clone is from pathogenic colon bacillus E.coli O6:H16 (LT ⁺, ST ⁺).The full gene of LT-B that goes out through the high-fidelity pcr amplification at first is cloned into pGEM (available from Promega company), after checking order correctly, go into the pET32a carrier of cutting with same enzyme with Nde I and the site-directed subclone of Noc I, can obtain pET-LTB (building process is referring to Fig. 2)

PET-LTB carrier of the present invention still has promotor, terminator and other element of plasmid pET32a, thereby it not only has the expression and purification advantage of original carrier, and has the characteristic that merges secreting, expressing with LT-B.That is: pET-LTB both can directly express this proteantigen of LT-B, the goal gene that also can be used for single and a plurality of polyphones inserts and expression, as long as goal gene contain with the pET-LTB carrier on identical restriction enzyme site, just can be according to engineered ordinary method, with goal gene (can be the minigene fragment of chemosynthesis, also can be the product of pcr amplification) insert the pET-LTB carrier, behind the transformed into escherichia coli, can obtain the secretion type expression that goal gene and LT-B merge mutually.

Characteristics of the present invention and advantage are as follows:

At first, LT-B itself is very strong immunogen, can stimulate the antibody that produces Chinese People's Anti-Japanese Military and Political College's enterobacteria heat-sensitive toxin by the pET-LTB expression vector at the LT-B of expression in escherichia coli small-molecular peptides product, has the effect that LT enterotoxigenic escherichia coli diarrhoea is produced in prevention.

Secondly; LT-B is a kind of generally acknowledged mucosal immunity incitant; with the protective antigen albumen of its amalgamation and expression in, can be used as the immunocompetence that mucosal adjuvant improves vaccine, can carry out preventive vaccination by mucosal route such as oral, nose sprays thereby make through the vaccine of injection inoculation.

The 3rd, the multiple clone site district of pET-LTB carrier can carry out intergenic connection easily, therefore also can be used as the ideal carrier of many antigens and LT-B amalgamation and expression.

The 4th, LT-B can be used as one of expressing fusion protein and detects and purification tag in pET-LTB, be beneficial to the detection of expression and the purifying of purpose antigen protein.

The 5th, the signal peptide of LT-B has the effect that expressed target protein is secreted into the colibacillus periplasm chamber, simultaneously have 6 * HIS purification tag again at the target protein end, this has overcome the problem of common intestinal bacteria with inclusion body formal representation and expression product purification difficult to a great extent.

Description of drawings

Fig. 1 .pET-LTB structural representation.

Fig. 2. be pET-LTB building process synoptic diagram.

Fig. 3. the electrophorogram of identifying for the double digestion of the pcr amplification of LT-B and pET-LTB expression vector,

Wherein: the pcr amplification electrophorogram as a result of lane1 and 2 expression LT-B (A)? (B) electrophorogram that the double digestion of lane1 and 2 expression pET-LTB expression vectors is identified in

Fig. 4 is the complete sequence determination result of LT-B in pGEM-LTB.

Fig. 5 is complete sequence determination and the MCS analytical results of LT-B in pET-LTB.

Fig. 6 is that the pericentral siphon liquid SDS-PAGE and the Western-blot of BL21 (DE3)/pET-LTB abduction delivering identifies

Wherein: lane1 is a standard molecular weight albumen; Lane2 and 3 is for being expressed in protein in the pericentral siphon liquid; Lane4 is the Western-blot qualification result.

Fig. 7 is that BL21 (DE3)/pET-LTB-EGFP abduction delivering is identified in the SDS-PAGE of pericentral siphon liquid

Wherein lane1 is a standard molecular weight albumen, and the positive E.coli BL21 of lane2-3 (DE3) is secreted into the protein of pericentral siphon through abduction delivering; The negative E.coli BL21 of lane4 (DE3) goes into cell pyrolysis liquid protein behind abduction delivering.Wherein the arrow direction is the LTB-EGFP of abduction delivering in pericentral siphon liquid.

Embodiment

Structure and application in order to further specify expression vector pET-LTB are further elaborated with reference to the following example and accompanying drawing so that the structure of pET-LTB and use to explain more detailed, clear, but do not limit protection scope of the present invention.

Embodiment 1

The structure of pET-LTB:

The pET32a expression vector that is made up by NOVGE company is present molecular biology and the genetically engineered laboratory prokaryotic vectors that utilize more, its expression effect is better usually, easy handling, therefore, we select it near the nearest initiator codon ATG of ribosome bind site (RBS), and be the insertion site of LT-B gene with first restriction enzyme site Noc I (CCATGG) in the NdeI (CATATG) that comprises this codon and multiple clone site district, and these two sites also are non-existent in the LT-B gene, so also removed the unnecessary sequence of some among the pET32a, simultaneously the LT-B gene order that contains signal peptide sequence is inserted pET32a, thereby obtained the pET-LTB expression vector.Concrete construction process is as follows:

1, design of primers:

Restriction enzyme site according to increasing needs and will introducing designs and synthesizes following primer:

Upstream primer P1:5 ' GCG CAT ATGAAT AAA GTA AAA TGT TAT GTT-3 ' (introducing Nde I restriction enzyme site);

Downstream primer P2:5 ' GTC CCA TGGGTT TTC CAT ACT GAT TGC CGC-3 ' (introducing Noc I restriction enzyme site).

2, produce the clone of enterotoxigenic escherichia coli LT-B gene complete sequence

With pathogenic colon bacillus E.coli O6:H16 (LT ⁺) bacterium colony of the collection of cultivating, in the 1.5ml centrifuge tube, add aseptic double-distilled water 50 μ l, 100 ℃ boil 5 minutes after, centrifugal 10 minutes of 1200g, getting supernatant 5 μ l is template, carry out pcr amplification with P1 and P2 primer respectively, amplification system is: contain 10 * amplification buffer, the 10 μ l of magnesium ion, 4 * dNTPs (10mmol), 1.5 μ l, each 1 μ l (25pmol/l) of upstream and downstream primer (P1 and P2).TapDNA polysaccharase (5U/ μ l) 1 μ l adds aqua sterilisa to 100 μ l.Pcr amplification reaction: after 95 ℃ of pre-sex change in 5 minutes, with 94 ℃ of sex change 50 seconds, annealed 30 seconds for 57 ℃, 72 ℃ were extended 30 seconds, and after totally 30 circulations, 72 ℃ were extended 7 minutes, and were cooled to 4 ℃.Agarose gel electrophoresis through 1% adds DNA Marker DL-2000 confirm that the purpose band is arranged after, with PCR product fast purifying test kit (the clean biotech firm of Hangzhou Wei Te product) by specification method purifying in a small amount.

3, LT-B inserts pGEM-T vector

Plasmid pGEM is available from Promega company.According to the operation of " molecular cloning ", the pGEM carrier is gone in the LT-B gene clone, construction recombination plasmid pGEM-LTB.

Purpose fragment behind the purifying is after adding end reaction (+A Tailing), be connected with pGEM-T vector, linked system is: the LT-B tailing product 2 μ l behind the purifying, pGEM-T vector 1 μ l, 2 * T4 DNA connects damping fluid 5 μ l, the T4DNA ligase enzyme 1 μ l of 12u/ μ l, water 1 μ l, 14 ℃ of water-baths are spent the night.Connecting 42 ℃ of 90 seconds transformed competence colibacillus bacillus coli DH 5 alphas of product, is to cultivate 17-20 hour at the LB/Amp that scribbles IPTG/X-gal.

Adopt indigo plant/hickie sieve method, choose the white colony of growth from the LB/Amp plate, after bacterium colony PCR evaluation amplifies the band of about 370bp, extract plasmid and carry out sequencing, the result is as follows, find that by analysis the LT-B complete sequence that contains initiator codon, signal peptide, mature peptide and terminator codon correctly inserts pGEM-T vector carrier, promptly pGEM-LTB successfully constructs.

......

aataaagtaaaatgttatgttttatttacggcgttactatcctctctatgtgcatacggagctcccc

agtctattacagaactatgttcggaatatcgcaacacacaaatatatacgataaatgacaagatactatcatatacggaatcg

atggcaggtaaaagagaaatggttatcattacatttaagagcggcgcaacatttcaggtcgaagtcccgggcagtcaacat

atagactcccaaaaaaaagccattgaaaggatgaaggacacattaagaatcacatatctgaccgagaccaaaattgataaa

ttatgtgtatggaataataaaacccccaattcaattgcggcaatcagtatggaaaac

......

4, the structure of expression vector pET-LTB and evaluation

With plasmid pGEM-LTB is template, carry out pcr amplification with P1 and P2 primer respectively, amplification system is: 10 * amplification buffer, the 10 μ l that contain magnesium ion, 4 * dNTPs (10mmol), 1 μ l, each 1 μ l of upstream and downstream primer (P1 and P2), above-mentioned plasmid template 1 μ l, pfu archaeal dna polymerase (5U/ μ l) 1 μ l adds aqua sterilisa to 100 μ l.

Pcr amplification reaction is ditto described, totally 30 circulations.With a small amount of PCR product purification test kit (the clean biotech firm of Hangzhou Wei Te product) by specification method purifying.The PCR product of purifying and pET32a plasmid are all cut with Nde I and NocI enzyme.The enzyme system of cutting is: 5 μ l, 10 * enzyme cutting buffering liquids (K), and water 21 μ l, 10 * BSA, 5 μ l, the tight thing 30 μ l of purifying, each 2.5 μ l (10 units/μ l) of NdeI and Noc I enzyme add water to 50 μ l, 37 ℃ of water-baths 5 hours.Enzyme is cut after product and is separated with agarose gel electrophoresis respectively.Reclaiming test kit (the clean biotech firm of Hangzhou Wei Te product) by specification method with centrifugal a small amount of glue reclaims.

Insert connection, linked system is: LT-B fragment 5 μ l behind linear plasmid pET32a 2 μ l, the double digestion behind the double digestion, and 10 * T4DNA connects damping fluid 1 μ l, and T4 dna ligase (12u/ μ l) 1 μ l adds water to cumulative volume 10 μ l, and 14 ℃ of water-baths are spent the night.

Bacillus coli DH 5 alpha is preserved for this chamber, behind the recovery activation refrigerated bacterial strain, presses the CaCl of " molecular cloning " (Science Press, second edition) ₂Method prepares competence; Get competent cell 100 μ l, add and connect product 5 μ l, rotate gently, in ice bath, placed 30 minutes with the mixing content, forward to immediately in 42 ℃ of water-baths and placed 2 minutes, every then pipe adds the not LB substratum of added with antibiotic of 0.5ml, in 37 ℃ of water-baths after 15 minutes, and 37 ℃ of shaking table jogs 45 minutes, get 100 μ l and transform thalline, evenly coat on the Agar Plating that contains 100mg/ml ammonia benzyl, after room temperature is dried, be inverted overnight incubation for 37 ℃.

Choose the bacterium colony of growth from plate, the extraction plasmid carries out enzyme and cuts evaluation, cuts with Nde I and Noc I enzyme, and the double digestion system is the same, the result that agarose gel electrophoresis with 1.0% is identified visible (shown in Fig. 3-B), except that the carrier of about 5kb, also can see the purpose band of 370bp, sequencing result and creation analysis result are as follows, the result shows, the LT-B fragment pET32a carrier of really having packed into, promptly pET-LTB successfully constructs, and has so far finished the structure and the evaluation of this carrier system.

taatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatata

catatgaataaagtaaaatgttatgttttatttacggcgttactatcctctctatgtgcatacggagctccccagtctattacaga

actatgttcggaatatcgcaacacacaaatatatacgataaatgacaagatactatcatatacggaatcgatggcaggtaaa

agagaaatggttatcattacatttaagagcggcgcaacatttcaggtcgaagtcccgggcagtcaacatatagactcccaa

aaaaaagccattgaaaggatgaaggacacattaagaatcacatatctgaccgagaccaaaattgataaattatgtgtatgga

ataataaaacccccaattcaattgcggcaatcagtatggaaaacccatggctgatatcggatccgaattcgagctccgtcga

caagcttgcggccgcactcgagcaccaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctga

gttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggtttttg

5, the pericentral siphon solinocrine of pET-LTB carrier in intestinal bacteria expressed and identified

Conversion has the e. coli bl21 (DE3) (available from U.S. Stratagene company) of pET-LTB carrier, change 42 ℃ of inducing culture 2.5 hours 30 ℃ of cultivations over to after 2 hours, preparation colibacillus periplasm solinocrine protein solution is done polyacrylamide gel electrophoresis (SDS-PAGE), resolving gel concentration is 15%, " molecular cloning " seen in operating process, the result has an engrain band at the 17kd place shown in figure (6), show that inserting LT-B has obtained expressing efficiently.The proteic preparation method of colibacillus periplasm solinocrine is the osmotic shock method (Modified Osmotic Shock) of improvement: the bacterium liquid 100ml behind abduction delivering is through 8000g, 4 ℃ centrifugal 10 minutes, collect thalline, wash 2 times with above-mentioned condition with the deionization sterilized water after, with the CaCl of 4 ℃ of 5mM ₂Suspension was left standstill 5 minutes, and what add 4 ℃ of 8ml pH8.0 contains 33mM Tris.HCl (pH8.0) and 5mM Na ₂The sucrose solution of EDTA 20% (w/v), nurture is 10 minutes behind the mixing, and through 8000g, 4 ℃ are centrifugal 10 minutes, remove supernatant, with cell suspension in the deionization sterilized water of 4 ℃ of 8ml 10 minutes, with 8000g, 4 ℃ centrifugal 10 minutes, collect supernatant, both for containing the proteic solution of pericentral siphon solinocrine.

Embodiment 2

The fusion of goal gene EGFP and LT-B and secretion expression

1. the insertion of goal gene

With pattern albumen---enhancing property green fluorescent protein (EGFP) gene be inserted as example, the EGFP gene that is implemented on the pGEM-T-egfp is adopted EcoR I and XhoI double digestion, carrier pET-LTB is also adopted same enzyme double digestion, make gene and carrier after enzyme is cut be connected to the pET-LTB/EGFP expression vector then, operations such as conversion, abduction delivering are all described with embodiment 1 example then.

2. the PCR of expression plasmid identifies

With the EGFP gene is example, with pET-LTB/EGFP behind the purifying is masterplate, with Pegfp1 is forward primer, Pegfp2 is that reverse primer carries out pcr amplification, and amplification system is: contain 10 * amplification buffer, the 10 μ l of magnesium ion, 4 * dNTPs (10mmol), 1 μ l, each 1 μ l of upstream and downstream primer (Pegfp1 and Pegfp2), above-mentioned plasmid template 1 μ l, Taq archaeal dna polymerase (5U/ μ l) 1 μ l adds aqua sterilisa to 100 μ l.Pcr amplification reaction: after 94 ℃ of sex change in 5 minutes, with 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, totally 30 the circulation.Amplified production is electrophoresis on 1.0% sepharose, can amplify the special band of about 720bp, proves that the EGFP gene has inserted in the pET-LTB expression vector.

3. the SDS-PAGE of genetic expression identifies

With pattern albumen EGFP is example, the qualification process of genetic expression is as follows: get and insert EGFP expression carrier pET-LTB/EGFP, according to embodiment 1 method transform, cultivation and IPTG inducing culture, the whole cell of centrifugal collection is adopted the osmotic shock method of implementing 1 routine described improvement, get and be secreted into pericentral siphon chamber liquid and carry out SDS-PAGE, gum concentration is 12%, qualification result such as Fig. 7.District band LTB-EGFP has an engrain band at about 38KDa place, consistent with EGFP with the theoretical molecular after the LT-B fusion, and in the intestinal bacteria whole cell lysate expressing protein that does not carry expression vector that contrasts with it, but do not see this proteic expression in the corresponding position.

4.LT-B-EGFP the Western Blotting of fusion rotein identifies

Above and the albumen LT-B amalgamation and expression is carried out the SDS-polyacrylamide gel electrophoresis, comprising without inductive BL21 cell pyrolysis liquid as negative control.When the SDS-PAGE electrophoresis finishes, cut out and contain proteic gel to be transferred, cut 6 onesize Whatman 3mm filter paper and IPVDF, carry out mark for one jiao at pvdf membrane with soft pencil.They are floated on the ddH2O horizontal plane, be dipped in 5min in the water after wetting, drive away the bubble on the film, be soaked in again in the transfering buffering liquid (39mmol/L glycine, 48mmol/LTris, 0.037%SDS, 20% methyl alcohol).On plastic stent, stack wetted sponge, 3 metafiltration paper, gel, PVDF, 3 metafiltration paper and sponges successively, make filter paper, gel and PVDF alignment, and no bubble exists between each layer; Plastic stent is clamped in the insertion electrotransfer groove; Pvdf membrane one side joint anode, gel one side joint negative electrode adds transfer liquid (39mmol/L glycine, 48mmol/LTris.Cl, 0.037%SDS, 20% methyl alcohol) and did not have gel, and with 30V～35V voltage, 4 ℃ are shifted 14～16h.Transfer finishes, and isolated target protein is transferred on the pvdf membrane by semi-dry transfer apparatus (Bio-RadLaboratories).Film was sealed 1 hour with sealing damping fluid (containing 5% skim-milk among the PBST).Carry out three washings, washed 10 minutes with PBST at every turn, educated 1 hour with a temperature resistance under the room temperature afterwards.After same three washings, incubation is 1 hour in by two anti-goat anti-mouse IgG 11: 1000 diluents of horseradish peroxidase-labeled.After three washings, film is sent to the darkroom exposure after handling with ECL Western Blotting detection reagent (Amersham Pharmacia Biotech.) again.Western Blotting result as shown in Figure 6.

The result show be cloned into LT-B in the constructed carrier system among the embodiment after, in pericentral siphon liquid, obtained higher expression level, and preserve its original antigenic activity well, and after having introduced pattern albumen EGFP, has the effect of expressed fusion protein.This be LT-B with other protective antigen gene amalgamation and expression, produce mucosal immunity reference on checking and the method be provided.The practice significance of also having verified constructed expression vector system thus is worth with exploitation.

SEQUENCE?LISTING(1)

＜110〉East China University of Science

＜120〉a kind of carrier that is used for prokaryotic secretion, amalgamation and expression coli heat-sensitive toxin B subunit

＜130〉specification sheets

<140>200510028084.0

<141>2005-07-25

<160>1

<170>PatentIn?version?3.1

<210>1

<211>375

<212>DNA

＜213〉artificial sequence

<400>1

atgaataaag?taaaatgtta?tgttttattt?acggcgttac?tatcctctct?atgtgcatac 60

ggagctcccc?agtctattac?agaactatgt?tcggaatatc?gcaacacaca?aatatatacg 120

ataaatgaca?agatactatc?atatacggaa?tcgatggcag?gtaaaagaga?aatggttatc 180

attacattta?agagcggcgc?aacatttcag?gtcgaagtcc?cgggcagtca?acatatagac 240

tcccaaaaaa?aagccattga?aaggatgaag?gacacattaa?gaatcacata?tctgaccgag 300

accaaaattg?ataaattatg?tgtatggaat?aataaaaccc?ccaattcaat?tgcggcaatc 360

agtatggaaa?actag 375

SEQUENCE?LISTING(2)

＜110〉East China University of Science

＜120〉a kind of carrier that is used for prokaryotic secretion, amalgamation and expression coli heat-sensitive toxin B subunit

＜130〉specification sheets

<140>200510028084.0

<141>2005-07-25

<160>1

<170>PatentIn?version?3.1

<210>1

<211>652

<212>DNA

＜213〉artificial sequence

<400>1

taatacgact?cactataggg?gaattgtgag?cggataacaa?ttcccctcta?gaaataattt 60

tgtttaactt?taagaaggag?atatacatat?gaataaagta?aaatgttatg?ttttatttac 120

ggcgttacta?tcctctctat?gtgcatacgg?agctccccag?tctattacag?aactatgttc 180

ggaatatcgc?aacacacaaa?tatatacgat?aaatgacaag?atactatcat?atacggaatc 240

gatggcaggt?aaaagagaaa?tggttatcat?tacatttaag?agcggcgcaa?catttcaggt 300

cgaagtcccg?ggcagtcaac?atatagactc?ccaaaaaaaa?gccattgaaa?ggatgaagga 360

cacattaaga?atcacatatc?tgaccgagac?caaaattgat?aaattatgtg?tatggaataa 420

taaaaccccc?aattcaattg?cggcaatcag?tatggaaaac?ccatggctga?tatcggatcc 480

gaattcgagc?tccgtcgaca?agcttgcggc?cgcactcgag?caccaccacc?accaccactg 540

agatccggct?gctaacaaag?cccgaaagga?agctgagttg?gctgctgcca?ccgctgagca 600

ataactagca?taaccccttg?gggcctctaa?acgggtcttg?aggggttttt?tg 652

Claims (1)

1, a kind of prokaryotic secretion, amalgamation and expression coli heat-sensitive toxin B subunit (E.coli heat-labile enterotoxinB subunit of being used for, LT-B) carrier, it is characterized in that, said carrier is to be the closed loop plasmid of basic skeleton with pET32a, the nucleotide sequence that inserts coli heat-sensitive toxin B subunit (LT-B) between the Noc I in first restriction enzyme site Nde I behind the RBS of pET32a and multiple clone site district makes up and forms, i.e. pET-LTB;

Wherein: wherein the nucleotide sequence of LT-B is that the clone is from pathogenic colon bacillus E.coli O6:H16 LT ⁺, ST ⁺, through primer P1:5 '-GCG CAT ATGAAT AAA GTA AAA TGT TAT GTT-3 ', P2:5 '-GTC CCA TGGGTT TTCCAT ACT GAT TGC CGC-3 ' pcr amplification and getting, the front end of the nucleotide sequence of LT-B has initiator codon ATG and complete signal peptide sequence, the terminal terminator codon of removing, and directly link to each other with thereafter multiple clone site.

Images