CA3103433A1

CA3103433A1 - Novel fish virus

Info

Publication number: CA3103433A1
Application number: CA3103433A
Authority: CA
Inventors: Havard Aanes; Magnus Andreas DEVOLD; Linda RAMSEVIK TEIGENE; Vidar Teis ASPEHAUG; Kristoffer Alnes Royset; Meritxell DIEZ PADRISA; Teresa GARZON; David COCKERILL
Original assignee: Patogen As
Current assignee: Patogen As
Priority date: 2018-06-15
Filing date: 2019-06-14
Publication date: 2019-12-19
Also published as: NO344698B1; CL2020003238A1; EP3807403A1; NO20180836A1; WO2019240596A1

Abstract

The invention relates to a novel fish virus, an isolated nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 2 and 3, sequences being complementary to SEQ ID NO: 2 and 3, and variants thereof being at least 70 % identical thereof. The invention also relates to a method for detection of the nucleic acid, primers, probes, a vector and a host cell, a DNA vaccine, a recombinant protein, a recombinant vaccine, an antibody and a diagnostic kit.

Description

Novel Fish Virus The present invention relates to a novel virus, and the use of this virus for vaccines and prophylactic treatment for the disease caused by the virus. The invention also relates to nucleic acid sequences, amino acid sequences, primers and primer pairs, probes, diagnostic kits and methods for diagnostic according to the preamble of the independent patent claims Background Fish are an increasingly important source of food and income; global annual consumption is projected to rise from 110 million tons in 2010 to more than million tons in 2030. However, the emergence of infectious diseases in aquaculture threatens production and may also impact wild fish populations.
There is thus a need for a rapid method to detect and identify virus and/or bacteria causing disease, and vaccine development to monitor infections and avoid outbreak.
Another object of the invention is to provide challenge methods using a virus for testing susceptibility of animals, with the purpose of testing for instance efficacy of a vaccine or functional feed, or resistance towards disease. Yet another object of the present invention is to develop further treatment to treat infected fish.
Finally, there is an object to use a virus in breeding programs to obtain animals that are resistant to a virus.
The objects above are met by the invention as defined in the independent enclosed claims. Further features are given in the independent claims.
During summer 2017 it was discovered particularly high mortality in several cages in a fish farm in Scotland. A novel fish virus was characterized from samples of the fish.
The novel virus was isolated in a salmon farm with high losses caused by disease.
The virus shows unique characters and 28% similarity to unclassified Fisavirus1, that has previously been identified in Carp (Cyprinus carpio) (Reuter 2016). The

2 sequence of Fisavirus is 8712 NT long and relates to Posavirus (Porcine stool associated virus), and it is assumed that the host of Fisavirus could be the Nematoda phylum (Reuter 2016). Nematodes (Nematoda) belong to the most frequent and the most important parasites of fishes in the freshwater, brackish-water and marine environments throughout the world (Moravec 2007). Small numbers of nematodes often occur in healthy fish, but high numbers cause illness or even death (Roy P. Yanong). Thus it is expected that the novel virus may have a broad range of hosts among fish and shellfish, such as shrimp, carp, tilapia, seabass and salmon, among others.
The invention relates to the new virus isolated from Atlantic salmon. The virus comprises a ribonucleic acid genome having at least 70% sequence identity with SEQ ID NO 2 or 3, and variants and fragments thereof.
In one embodiment, the virus of the invention further comprises a ribonucleic acid genome having at least 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID

NO 2 or 3, and variants and fragments thereof.
According to another aspect of the invention, it relates to an isolated nucleic acid sequence originating from the virus. The sequence is selected from the group consisting of SEQ ID No 2 and 3 and sequences complementary to any of SEQ ID
No 2 and 3, and variants thereof being at least 70% identical.
The isolated nucleic acid sequence may further be at least 80%, preferably 90%, more preferably 95 % identical with any of the sequences SEQ ID No 2 or 3, or any sequences being complementary to SEQ ID No 2 or 3.
In another aspect of the invention, it relates to a nucleic acid sequence having a sequence selected from the group consisting of SEQ ID No 4-12, and sequences being complementary to SEQ ID No 4-12 Such a nucleic acid may be

3 used as a primer for instance for PCR or a probe for instance for identification of a nucleic acid sequence or gene.
According to another aspect of the invention, a method for detection of a virus in a biological sample is provided. The method comprises the following steps:
a) preparing a sample comprising nucleic acid sequences isolated from the biological sample for a reverse transcription reaction, b) subjecting the mixture of a) to a polymerase chain reaction with a primer pair, wherein each primer of said primer pair comprises at least 10 nucleotides and hybridizes to a nucleic acid sequence selected from the group consisting of SEQ ID
No 2-12, sequences being complementary to SEQ ID No 2-12, and variants being at least 70 % identical with any of the sequences, c) determining whether the binding of the nucleotide sequences to nucleotide sequences in the biological sample and amplification of the sequence between them have occurred indicating the presence of virus in the sample tested.
In a preferred embodiment, the primers of the method above are selected from a group consisting for SEQ ID No 2-12, preferably SEQ ID NO 7-12.
In step b) of the method above, the primers may further hybridize to a nucleic acid being at least 80%, preferably 90%, more preferred 95 % or 100 % identical with the sequences SEQ ID No 2-12, or any sequences being complementary to SEQ ID No 2-12.
According to another aspect of the invention, another method for detection of a virus in a biological sample is provided. The method comprises the following steps:
a) preparing a sample comprising nucleic acid sequences isolated from the biological sample for a reverse transcription reaction, b) sequencing the mixture of a), and c) comparing the resulting sequence with a sequence selected of the group consisting of SEQ ID No 2 and 3 and sequences being complementary to SEQ ID

4 NO 2 and 3, wherein 70 % identity indicates the presence of virus in the biological sample tested.
Further, in step c) of the method above, 80%, 90%, 95% or 100% identity may be required to confirm the presence of virus in the biological sample.
In a preferred embodiment, the sequencing of the mixture in the method above is performed by a method selected from the group consisting of Next Generation Sequencing, preferably IIlumina (Solexa) sequencing, Roche 454 sequencing, Ion Torrent or SOLiD sequencing (Goodwin S, et al., (2016) Coming of age: Ten years of next-generation sequencing technologies. Nature reviews, Genetics, 17, 333-351).
The invention also relates to use of a nucleic acid sequence comprising at the least 10 contiguous nucleotides of any of the sequences 2-12, or 10 contiguous nucleotides being complementary of any of the sequences 2-12, for confirming the presence of the virus in a biological sample. In yet another embodiment it is used a nucleic acid sequence having a sequence selected from the group of SEQ ID No 2 and 3 and sequences being complementary to the any of the sequences SEQ ID No 2 and 3, for confirming the presence of the virus in a biological sample.
The methods and uses above may be used to confirm that the virus is present in the biological samples, but it may also be used to confirm that the virus is not present in the biological samples. Further, it may be used to monitor a fish population, for instance for disease/sickness control. Information in this regard, desirable with methods for identifying other diseases and/or sicknesses, may be valuable information as to if or when the fish population should be treated. The biological samples to be analysed are preferably from dead fish, but may also be samples removed from live fish without harming the fish.
Another aspect of the invention relates to a vector comprising nucleic acid sequences according to the present invention, and host cells comprising said vectors.

According to yet another aspect of the invention, DNA vaccines are provided comprising a nucleic acid sequence selected from the group consisting of SEQ
ID
No. 2 and 3, sequences being complementary to sequences of SEQ ID No 2 and 3,

5 and variants thereof being at least 70% identical with any of the sequences SEQ ID
No. 2 and 3 or sequences being complementary to variants of SEQ ID No 2 and 3.
The nucleic acid sequence of the DNA vaccine may further be at least 80%, preferably 90%, more preferably 95 % identical with any of the sequences SEQ
ID
No 2 and 3, or any sequences being complementary to SEQ ID No 2 and 3.
Another aspect of the invention relates to recombinant proteins encoded by a nucleic acid sequence selected from the group consisting of SEQ ID No. 2 and 3, and variants thereof being at least 70 %, 80 %, preferably 90%, more preferably 95 %
identical with any of the sequences SEQ ID No. 2 and 3. In one aspect the amino acid sequence of the recombinant protein is given in SEQ ID No 1.
The present invention also provides a recombinant vaccine comprising at least one of the recombinant proteins according to the present invention.
The immunogenic composition may further comprise at least one excipient, additive or adjuvant, and may be administrated orally, by immersion or by intraperitoneal or intramuscular injection.
The immunogenic composition may be a monovalent vaccine or combined with other relevant antigens.
The invention also relates to use of the immunogenic composition described above in the manufacture of a vaccine for the treatment or prophylaxis of infection in an animal.

6 The invention also relates to use of the immunogenic composition described above in the manufacture of a functional feed or additive to a functional feed for the treatment or prophylaxis of infection in an animal.
Furthermore, according to another aspect of the invention, it is provided an antibody that recognises and binds to a recombinant protein according to the present invention.
The invention also relates to challenge methods using a virus as defined above for testing susceptibility of animals, with the purpose of testing for instance efficacy of a vaccine or functional feed, or resistance towards disease. The invention also relates to use of the virus in breeding programs to obtain animals that is resistant to the virus as defined above.
The invention also relates to a diagnostic kit, which may be used to decide whether a sample comes from an organism being infected by the virus according to the invention. The kit may comprise at least one primer sequence selected from the group consisting of SEQ ID NO 4-12, sequences being complementary to SEQ ID
NO 4-12, and variants being at least 90 % identical with any of these sequences. In another embodiment, the diagnostic kit may in addition or instead comprise an antibody or a recombinant protein.
Finally, the present invention relates to the use of the nucleic acid sequences having a sequences selected from the group consisting of SEQ ID NO 2 and 3, sequences being complementary to SEQ ID NO 2 and 3, and variants thereof being at least %, 80 %, preferably 90%, more preferably 95 % identical with any of these sequences, for the preparation of DNA vaccine, recombinant vaccine or a live recombinant microorganism.
The present invention relates to isolated nucleic acid sequences and variants thereof being at least 70% identical with the isolated nucleic acid sequences. The term "%
identity" is to be understood to refer to the percentage of nucleotides that two or

7 more sequences or fragments thereof contains that are the same. The term "at least 70 % identical" thus means that at least 70 % of the nucleotides over the entire sequences which are compared, are identical. A specified percentage of nucleotides can be referred to as e.g. 70% identical, 80% identical, 85% identical, 90%
identical, 95% identical, 99% identical or more over a specified region when compared and aligned for maximum correspondence. The skilled person will acknowledge that various means for comparing sequences are available.
The term "variants thereof" used in respect of the nucleic acid sequences and recombinant proteins according to the present invention, is to be understood to encompass nucleic acid sequences and recombinant proteins that only differs from the isolated sequences SEQ ID No. 1, 2, and 3 by way of some amino acid or nucleotide additions, deletions or alteration that have little effect, if any, on the functional activity of the claimed sequences. The skilled person will acknowledge .. that modifications of a protein encoding nucleotide sequence may be introduced which does not alter the amino acid sequence, e.g. the substitution of a nucleotide resulting in that the triplett affected by the substitution still codes for the same amino acid. Such alterations may be introduced to adapt the nucleic acid sequence to the codons preferably used by a host cell and thus to enhance the expression of a desired recombinant protein. Furthermore, the addition of nucleic acid sequences coding polypeptides which facilitates purification may be added without affecting the activity of the resulting recombinant protein.
The skilled person will further acknowledge that also alterations of the nucleic acid .. sequence resulting in modifications of the amino acid sequence of the recombinant protein it encodes may have little, if any, effect on e.g. the proteins' ability to induce protection against the virus if the alteration does not have any impact on the resulting three dimensional structure of the recombinant protein. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for

8 glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a recombinant protein with substantially the same functional activity as the protein encoded by the nucleotide sequence SEQ
ID No. 2 or 3 and thus to be expected to constitute a biologically equivalent product.
Nucleotide changes which result in alteration of the N-terminal or C-terminal portions of the protein molecule would also not be expected to alter the functional activity of the protein. Each of the proposed modifications is well within the routine skills in the art, as is determination of retention of biological activity of the encoded products.
Therefore, where the terms "nucleic acid sequences of the invention" or "recombinant protein of the invention" are used in either the specification or the claims each will be understood to encompass all such modifications and variations which result in the production of a biologically equivalent protein.
Thus, the present invention encompasses recombinant proteins and variants thereof which differ in respect of amino acid substitutions, addition or deletions compared with the protein of SEQ ID No 1, and proteins being encoded by the sequence SEQ
ID No. 2 or 3.
The primers and probes according to the present invention, will hybridize under stringent conditions with the sequence in question. The term "hybridizing under stringent conditions" refers to conditions of high stringency, i.e. in term of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acids having a high frequency of complementary base sequences. Stringent hybridization conditions are known to the skilled person (see e.g. Green M.
R., Sambrook, J., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 4th edition, 2012).
The precise conditions for stringent hybridization are typically sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent

9 conditions are selected to be about 5 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50%
of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50%
of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60 C. for longer probes, primers and oligonucleotides.
Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
The term "antigen" when used in connection with the present invention is to be understood to refer to a recombinant protein or fragment thereof according to the invention being able to induce protection against the virus in fish or to be able to bind to an antibody which recognise and bind to the virus.
The term "vaccine" as used herein refers to a material that can produce an immune response that blocks the infectivity, either partially or fully, of an infectious agent, which in respect of the present invention is the virus affecting fish such as e.g.
salmonids. Thus, when administering the vaccines of the invention to a fish, the fish becomes immunised against the disease caused by the virus. The immunising component of the vaccine may be e.g. DNA as in a DNA vaccine, RNA as in a RNA
vaccine, a recombinant protein or fragment thereof according to the present invention, or a live recombinant microorganism. The vaccines may be administered by immersion, orally or by intraperitoneal or intramuscular injection. The vaccines may be monovalent vaccine to protect against the virus, or combined with other antigens to multivalent vaccines.
The present invention also provides short nucleotide sequences having a length of at least 10 nucleotides. These sequences may be primers or probes useful in polymerase chain reaction techniques to be used as diagnostic tools. The terms "primer" and "probes" as used herein refers to an oligonucleotide either naturally occurring or produced synthetically which is significantly complementary to a virus target sequence and thus capable of hybridizing to nucleic acid sequences of the 5 present invention. When a "primer pair" or "primer set" is being used, it is generally one forward and one reverse primer, and the sequence between the primers will be multiplied during a PCR. This is well known to a skilled person, and he/she would know which primers constitute a suitable pair. The amplified sequence may be labelled to facilitate detection, e.g. using fluorescent labels on a probe, or other label

10 means well known to the skilled person.
Figures The invention will now be described in detail with reference to the enclosed Figures, where Figure 1 shows the cumulated mortality of infected fish Figure 2 shows the amino acid sequence encoded by SEQ ID No. 3, the amino acid sequence is corresponding to SEQ ID No 1, Figure 3 shows the genomic sequence of the novel virus (PV) corresponding to SEQ
ID No. 2, Figure 4 shows the genomic sequence of the Codon DNA Segment of the novel virus (PV), corresponding to SEQ ID No. 3, Figure 5 shows the genomic sequence of PV1P corresponding to SEQ ID No. 4, Figure 6 shows the genomic sequence of PV2P corresponding to SEQ ID No. 5, Figure 7 shows the genomic sequence of PV3P corresponding to SEQ ID No. 6, Figure 8 shows the genomic sequence of PV1F corresponding to SEQ ID No. 7, Figure 9 shows the genomic sequence of PV2F corresponding to SEQ ID No. 8, Figure 10 shows the genomic sequence of PV3F corresponding to SEQ ID No. 9, Figure 11 shows the genomic sequence of PV1R corresponding to SEQ ID No. 10, Figure 12 shows the genomic sequence of PV2R corresponding to SEQ ID No. 11, and Figure 13 shows the genomic sequence of PV3R corresponding to SEQ ID No. 12.

11 Examples Reference throughout the description to "an embodiment" signifies that a particular feature, structure or property specified in connection with an embodiment is included in the least in one embodiment. The expressions "in one embodiment", "in a preferred embodiment" or "in an alternative embodiment" different places in the description does not necessarily point to the same embodiment. Further, the different features, structures or properties may be combined in any suitable way in one or more of the embodiments.
Example 1 disease outbreak, virus sequencing and detection Disease outbreak A group of 70 000 Atlantic salmon were stocked in sea water October 1st 2016 at a commercial fish farm. Some mortality was observed during stocking, but the mortality was low in the period from March 2017 through June 2017. From June 2017 the mortality increased steadily. In September 2017, the mortality had reached more than 75% (Figure 1).
The fish showed symptoms of severe anaemia.
RNA sequencing and virus detection On the day of slaughter, 2 September 2017, samples from gill, heart and kidney were collected from 10 fish, from the outbreak above, and sent to PatoGen for analysis by Real-Time qPCR. The samples were analysed for Paramoeba perurans, Branchiomonas, Piscine Reovirus (PRV), Pancreas Disease Virus (PDV), Paranucleospora theridion, Pravicapsula pseudobranchicola, Salmon gill poxvirus (SGPVD), Tenacibaculum maritimum, Yersinia ruckeri, Pasteurella skyensis, Piscirickettsia salmonis, and Infectious Pancreatic Necrosis Virus (IPNV) (Table 1).
Although the gills were particularly affected by many agents, none of the detected agents could explain the observed anaemia and mortality, considering the symptoms and the results of the analysis.

12 Table 1. Agents analysed by qPCR and the Average Ct values Agents Gills Heart Kidney Paramoeba perurans 19,0 np np Branchiomonas 19,1 np np Picine Reovirus (PRV) np 29,11 np Pancrease disaese virus (PDV) np neg np Paranucleospora the ridion 18,8 np np Parvicapsula pseudobranchicola 35,4* np np Salmon gill poxvirus disease (SGPVD) 25,8*** np np Tenacibaculum maritimum 31,3** 34,1** 38*
Yersinia ruckeri np neg* neg Pasteurella -RK np np np Pasteurella skyensis s2 nd np nd Piscirickettsia salmonis nd np neg IPNV nd np neg np=not performed; nd=no data Number of samples analysed (N)=10 except for * where N=1, **N=2, ***N=7 Tissue preparation, RNA isolation and analysis RNA was extracted from samples of kidney, heart and gills using RNAeasy Universal kit (Qiagen) on an automated system at the PatoGen AS accredited commercial laboratory. The RNA quality and concentration of the samples were assessed with the Agilent 2100 Bioanalyzer (Agilent Technologies) and the Qubit 3.0 Fluorometer (Thermo Fischer scientific) using the RNA 6000 Pico Kit (Agilent) and the QubitTM
RNA HS Assay kit (Thermo Fischer Scientific).
Library preparation and RNA sequencing with Ion Torrent S5 3,2 pg of RNA from one gill sample was used as starting input for the RNA
sequencing library preparation. The RNA from the sample was treated with RiboMinus TM Eukaryote Kit v2 (Thermo Fischer Scientific) to remove ribosomal RNA. The rRNA-depleted RNA was fragmented and library was constructed using the Ion Total-RNA Seq Kit v2 (Thermo Fischer Scientific). The library was bar-coded and further quantified with qRT-PCR.
Using the Ion Chef and the Ion 520 TM and Ion 530 TM kit Chef (Thermo Fischer Scientific), the library was clonally amplified on Ion Sphere Particles, loaded into one 530 Chip and sequenced on the Ion Torrent S5 (Thermo Fischer Scientific).

13 Description of bioinformatics analysis Approximately five million reads were generated for the RNA sequencing experiment. BAM-files were converted to FASTQ files using SAMTOOLS fastq command, and we applied our in-house pathogen detection pipeline using the reads.
Our approach utilizes publicly available research tools, as described in the following.
First, reads were first trimmed 25bp in both the 5' and 3' end, and short reads (<10 bps) were removed using VSEARCH (https://github.com/torognes/vsearch). Reads mapping to the salmon genome were then removed using Kraken (Wood and Salzberg, 2014), before sequence construction with SPADES using the remaining reads were performed (Bankevich et al., 2012). The resulting scaffold sequences were then tested for complementarity with known sequences using blastn and blast( algorithms against the nucleotide (nt) and Swiss-Prot databases, respectively.
The obtained sequence matched partly to members of the Picornaviridae family (Posavirus and Fisavirus).
The final genome is 8,713 bps, and divided into the following sections;
Bases 1-602; 5'UTR
Bases 603-8,585; CDS (2661 aa) Bases 8,586-8,713; 3'UTR
Real Time PCR
To validate if the tentative virus, in the following referred to as PV, could be disease causing we designed a RT-PCR-assay in the presumptive polymerase region of the sequence using forward and reverse primers (PV1-F and PV1-R table 4 and 5), and a minor groove binding (MGB) probe (PV1-P) labelled with 6-FAM (table 3). The primers were designed using the software Primer Express 3Ø1 (Thermo Fischer Scientific). Secondary structures and the possibility of primer dimers were tested using the online software I DT OligoAnalyzer 3.1, and the specificity of the primers and the probe were checked using NCBI's Blastn. The primers and the probe were

14 found not to form secondary structures or primer dimers, nor to hybridize to any other known sequence. The primers and the probe were manufactured by Thermo Fischer Scientific.
The RT-PCR assay was performed using TaqMan Fast Virus 1-Step Master Mix.
Amplifications were done on a QuantStudio 5 Real Time PCR systemThermo Fischer Scientific) with the following conditions: 5 min at 50 C, 20 sec at followed by 45 cycles of 95 C/3 sec and 60 C/30 seconds.
Results of the qPCR
To validate if the tentative virus could be disease causing, 11 fish with clinical symptoms, and 16 fish with no symptoms were tested with the PV1- qPCR assay (Table 2). Extracted total RNA from gill, kidney or heart samples were used in the test.
Table 2 Reference number Fish no. Tissue Sample Name Control PV1 Clinical symptoms PG0330860 4 Gill FR15922906 20,3 21,0 Yes PG0330860 4 Heart FR15922907 14,7 29,8 Yes PG0330860 4 Kidney FR1592290702 22,3 Yes PG0330860 5 Gill FR15922908 14,0 18,0 Yes PG0330860 5 Heart FR15922909 15,9 28,5 Yes PG0330860 5 Kidney FR1592290902 22,3 Yes PG0330860 6 Gill FR15922910 16,1 16,2 Yes PG0330860 6 Heart FR15922911 17,3 32,9 Yes PG0330860 6 Kidney FR1592291102 20,8 32,1 Yes PG0330860 3 Gill FR15922918 15,1 19,7 Yes PG0330860 3 Heart FR15922919 14,7 33,1 Yes PG0330860 3 Kidney FR1592291902 21,9 Yes PG0330860 14 Heart FR15922920 13,3 36,8 Yes PG0330860 14 Gill FR15922921 15,2 24,4 Yes PG0330860 14 Kidney FR1592292002 17,1 35,8 Yes PG0330860 15 Gill FR15922922 15,0 26,9 Yes PG0330860 15 Heart FR15922925 18,3 35,9 Yes PG0330860 15 Kidney FR1592292502 21,0 Yes PG0330860 2 Heart FR15922926 15,5 35,2 Yes PG0330860 2 Gill FR15922927 18,8 20,5 Yes PG0330860 2 Kidney FR1592292602 22,9 Yes Table 2 PG0330860 13 Heart FR15922928 17,0 Yes PG0330860 13 Gill FR15922930 16,2 22,4 Yes PG0330860 13 Kidney FR1592292802 22,8 Yes PG0330860 12 Heart FR15922929 20,6 Yes PG0330860 12 Gill FR15922931 16,3 27,7 Yes PG0330860 12 Kidney FR1592292902 22,7 Yes PG0330860 11 Heart FR15922932 18,6 32,2 Yes PG0330860 11 Gill FR15922933 21,9 29,8 Yes PG0330860 11 Kidney FR1592293202 23,1 36,7 Yes PG0330860 1 Heart FR15922934 15,0 20,9 Yes PG0330861 1 Kidney FR1592293402 21,2 32,2 Yes PG0380090 Gill FR15922876 16,8 No PG0380090 Gill FR15922877 16,9 No PG0380090 Gill FR15922878 16,6 No PG0380090 Gill FR15922879 16,3 No PG0380090 Gill FR15922880 17,1 No PG0380090 Gill FR15922881 15,9 No PG0380090 Gill FR15922882 13,8 35,4 No PG0380090 Gill FR15922883 14,5 37,0 No PG0380090 Gill FR15922884 13,6 No PG0380090 Gill FR15922885 14,9 No PG0380090 Gill FR15922886 16,2 No PG0380090 Gill FR15922887 15,8 No PG0380090 Gill FR15922888 15,3 No PG0380090 Gill FR15922889 14,7 No PG0380090 Gill FR15922890 16,9 No PG0380090 Gill FR15922891 17,2 No ------ means negative result of detection.
The PV1 Real Time assay detected relatively high amounts of the gene sequence the PV assay targeted. There are multiple factors that may have affected the fish, 5 however the overall trends is clear positive, and samples from the gills of all fish having clinical symptoms, were positive with Ct values ranging from 16,2 to 29,8.
The gill tissue from fish with no symptoms of disease were in general negative to PV1 by Real Time assay, except for two fish that had Ct values of 35,4 and 37 which show that there are very small amount of virus detected in these fish. This confirms 10 that the virus detected causes the observed symptoms of anaemia.

Additional qPCR assays We have designed 3 quantitative Real Time TaqMan assays targeting various regions of the genome, as described above for PV1.
Table 3 Probes targeting the sequence.
Name Probe SEQ ID No PV1 TAGACGTCAAGAAGCAAG SEQ ID No 4 PV2 AGCCGCAGCATCGT SEQ ID No 5 pv3 AGGTCCTGAATCCA SEQ ID No 6 Table 4 Primers forward targeting the sequence.
Name Primer Forward SEQ ID No PV1 GGGCCAGAGAGCCATAGCA SEQ ID No 7 PV2 AGCCGCAGCATCGT SEQ ID No 8 PV3 TCTCAGCCGTTTTG SEQ ID No 9 Table 5 Primers revers targeting the sequence.
Name Primer Reverse SEQ ID No PV1 CCGCGTTGGTATGAGACTGA SEQ ID No 10 PV2 CAATATGGGCCTTACAA SEQ ID Noll PV3 CCAGCGACGGTCTA SEQ ID No 12 Example 2 Expression and use of recombinant proteins SEQ ID No. 2 was amplified by PCR and cloned into a pET system using standard system. E. coil host cells were transformed, and recombinant protein expressed.
Additionally, SEQ ID No. 2 was amplified by PCR and cloned in to a eukaryotic vector. An eukaryotic host cell was transformed, and a recombinant protein expressed. Recombinant protein was purified using standard techniques.
Recombinant proteins described herein, were formulated in a suitable vaccine that could be added excipients for example but not limited liposomes, water in oil emulsions. The vaccine will be used to produce an immune response in Salmonoids.

Any variants of SEQ ID No 2 that has a conservative amino acid substitution may be used, and are included in this description. Additionally, any open reading frames expressing protein from the novel virus or any variant of a novel virus having about 70% sequence identity to the open reading frame described herein may be used to produce a formulation and immune response.
Example 3 Vaccine efficacy in salmon The efficacy of the vaccine based on recombinant protein from example 2 were injected to salmon in doses on 0,025 to 0,1 ml/fish. After an immunization period of 5-10 weeks, vaccine efficacy was measured in an intraperitoneal challenge of vaccinated and non-vaccinated control fish. The fish were challenged with the novel virus either directly from homogenate or from virus propagated in cell lines.
Tissue samples at from 2 to 8 weeks post challenge were analysed by histology and PCR screening. Mortality was observed after vaccination, but Relative Percentage Survival was more than 50% which confirms protection.
Example 4 DNA vaccine and its efficacy .. SEQ ID No. 2 or SEQ ID No. 3 and parts, fragments and variants thereof will be cloned into a vaccine vector suitable to be used as a DNA vaccine. The resulting vector will be injected intramuscularly to salmon. After a suitable immunization period the vaccinated and none vaccinated fish will be challenged and evaluated as described in example 3.
Example 5 Virus stability The virus was passed through cell lines 10 times, and the virus did not change.

Example 6 Virulence of the virus Juvenile Atlantic salmon were challenged to a suspension of the virus, in freshwater, under standard conditions. High mortality was observed. 4-10 weeks post challenge survived fish were sampled for histology and PCR, and showed clear symptoms of infection.
Example 7 Immunization of rabbits Peptides were synthetized from the amino acid sequences of assumed antigenic region from the fusion-associated small transmembrane protein (FAST) protein (SEQ
ID No. 1) encoded by SEQ IN No. 2 and used for immunization of a rabbit to obtain FAST-specific antiserum.
.. Rabbits were immunized (3 boosters) with the synthetic peptide. The immune response was measured by immune histochemistry and by PCR.

Claims

1. A virulent virus isolated from Atlantic salmon, wherein the genome comprises a ribonucleic acid sequence having at least 70 % identity to SEQ ID NO 2 or 3 and variants thereof.

2. A virus according to claim 1, wherein the genome is at least 80 %, preferably 85%, preferably 90%, more preferably 95% or even more preferably 99% identical to SEQ
ID NO 2.

3. A virus according to claims 1 or 2, wherein the genome encodes an amino acid sequence according to SEQ ID NO 1, or variants thereof having at least 70 %
identity to SEQ ID NO 1.

4. An isolated nucleic acid sequence originating from a virus in Atlantic salmon having a sequence selected from the group consisting of SEQ ID No 2 and 3, sequences being complementary to SEQ ID NO 2 and 3, and variants thereof being at least 70 % identical thereof.

5. An isolated nucleic acid sequence according to claim 1, characterized in that the sequence is at least 80 %, preferably 90%, more preferably 95 % identical with any of the sequences SEQ ID No 2 or 3, or any sequences being complementary to SEQ

ID No 2 or 3.

6. A primer and/or probe having a sequence selected from the group consisting of SEQ ID NO 4-12, sequences being complementary to SEQ ID NO 4-12, and variants being at least 90 % identical with any of the sequences SEQ ID NO 4-12 and sequences being complementary to variants of SEQ ID NO 4-12.

7. A method for detection of a virus in a biological sample, characterized by comprising the following steps:
a) preparing a sample comprising nucleic acid sequences isolated from the biological sample for a reverse transcription reaction, b) subjecting the mixture of a) to a polymerase chain reaction with a pair of primers according to claim 6, and c) determining whether the binding of the primers to nucleotide sequences in the sample and amplification of the sequence between them have occurred indicating 5 the presence of the virus in the sample tested.

8. A method for detection of a virus in a biological sample, characterized by comprising the following steps:
a) preparing a sample comprising nucleic acid sequences isolated from the biological 10 sample for a reverse transcription reaction, b) sequencing the mixture of a), and c) comparing the resulting sequence with the sequence selected of the group consisting of SEQ ID No 2 and 3 and sequences being complementary to SEQ ID
NO 2 and 3, wherein 70 % identity verifies the presence of the virus in the biological 15 sample tested.

9. A method according to claim 8, wherein the sequencing is performed by a method selected from the group consisting in IIlumina (Solexa) sequencing, Roche 454 sequencing, lon Torrent and SOLiD sequencing.

10. A method according to 8, wherein the sequence is at least 80 %, preferably 90%, more preferably 95 % identical with any of the sequences SEQ ID No 2 and 3 or sequences being complementary to SEQ ID No 2 and 3.

11. Use of a nucleotide sequence comprising at the least 10 contiguous nucleotides of any of the sequences SEQ ID No 2-12, or 10 contiguous nucleotides being complementary of any of the sequences SEQ ID No 2-12, for establishing the existence of virus in a biological sample.

12. Use according to claim 11, wherein the nucleic acid sequence has a sequence selected from the group of SEQ ID No 2 and 3, or a sequence being complementary to the any of the sequences SEQ ID No 2 and 3.

13. A vector comprising a nucleic acid sequence according to any one of claims 4-5.

14. A host cell comprising a vector according to claim 13.

15. A DNA-vaccine comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO 2 and 3, and variants thereof being at least 70 %
identical with any of the sequences of SEQ ID NO 2 and 3.

16. A recombinant protein encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO 2 and 3, and variants thereof being at least 70 %
identical with any of the sequences of SEQ ID NO 2 and 3.

17. A recombinant protein having an amino acid sequence according to SEQ ID No 1.

18. A recombinant vaccine comprising at least one recombinant protein according to claim 16 or 17.

19. An antibody specifically recognizing and specifically binding to a recombinant protein according to claim 16 or 17.

20. Diagnostic kit comprising at least one primer sequence according to claim 6, a recombinant protein according to any one of claims 16-17, and/or an antibody according to claim 19.

21. An immunogenic composition comprising at least one of the following - an attenuated or inactivated virus as defined in claims 1-3, - a recombinant protein according to claims 16-17, - a nucleic acid sequence having at least 70% sequence identity with SEQ ID
No 2 or 3.

22. Use of the immunogenic composition according to claim 21, in the manufacture of a vaccine, functional feed or additive for functional feed, for the treatment or prophylaxis of infection in an animal.

23. Use of the virus according to any one of claims 1-3, a nucleic acid according to any one of claims 4-8, a recombinant protein according to any one of claims 16-17, antibody according to claim 19 or an immunogenic composition according to claim 21, in a challenge model.