CN111420041A - Broad-spectrum combined vaccine of housekeeping enzyme in glycolysis pathway of aquatic pathogenic bacteria and application thereof - Google Patents

Abstract

The invention discloses a broad-spectrum combined vaccine of housekeeping enzymes in glycolysis pathways of aquatic pathogenic bacteria, which takes recombinant protein formed by connecting key epitopes of at least two glycolysis pathway-derived housekeeping enzymes as an antigen component. The invention also discloses a broad-spectrum combined vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteriaApplication in preventing and treating fish infection caused by aquatic pathogenic bacteria. The broad-spectrum combined vaccine of the invention is a polypeptide fragment PGK with immunocompetence₂、PGK₃And PGM₁Combinatorial immunization, administration of PGK₂、PGK₃And ENO₁Combinatorial immunization₁And HK₃Combinatorial immunization, and administration of PGM₁With ENO₁The combined immunity has good immunity, can be used for developing subunit vaccines which are convenient to use, efficient, easy to commercialize and produce in a large scale, are practical and effective, can be used for immune prevention and treatment of multi-pathogen co-infection in aquaculture, and has good application prospect.

Description

Broad-spectrum combined vaccine of housekeeping enzyme in glycolysis pathway of aquatic pathogenic bacteria and application thereof

Technical Field

The invention belongs to the field of bioengineering, and particularly relates to a broad-spectrum combined vaccine of housekeeping enzymes in an aquatic pathogenic bacterium glycolysis pathway and application thereof.

Background

In recent decades, fishery in our country is rapidly developed, the total yield of aquatic products is in the front of the world, and China becomes a world-wide country for production, consumption and import and export of aquatic products. As market demand increases, the degree of intensive farming has increased and has certainly developed, and more people have come to recognize that microbial diseases are not limited to various combinations of one pathogen, such as viruses, bacteria, fungi, parasites, etc., and the presence of one microorganism facilitates infection by other pathogenic microorganisms, thereby collectively causing diseases, and the manner of causing diseases is infection by pathogenic microorganisms. Similarly, multiple pathogen infection modes are ubiquitous in aquaculture, which aggravates the severity of fish diseases and brings great loss to the aquaculture industry in China.

The problems also exist in the aquaculture of China, and if various chemical drugs are abused, the drug residue of aquatic products exceeds the standard, so that the environment is polluted, the food safety of the aquatic products is influenced, and the export of the aquatic products of China is limited. In response to the occurrence of various diseases, chemotherapy represented by antibiotics has been actively used for controlling and preventing diseases. However, the negative effects of environmental pollution, the emergence of a large number of drug-resistant pathogens, drug residues in aquatic products, and the like caused by such disease control measures are becoming serious. Antibiotics-based chemicals have been banned in aquaculture in the european union, the united states and canada. Therefore, the focus of China on aquatic vaccines is higher and higher. The vaccine can enhance the immunity of animals, prevent related diseases, reduce the use of various medicaments, reduce the culture cost, solve the problems of food safety and environmental pollution caused by the residue of various medicaments, and lead the aquaculture industry to move towards the green and sustainable development direction.

Bacteria are the most common pathogenic bacteria in aquaculture, and cause huge loss to aquaculture, such as vibrio anguillarum, vibrio harveyi, edwardsiella tarda, aeromonas hydrophila, pseudomonas fluorescens, fibrobacter columnis, vibrio alginolyticus and the like. Of the strongly pathogenic bacteria, motile aeromonas and edwardsiella are the most prominent. The Edwardsiella tarda (Edwaedsiella tarda) has wide spread area, no obvious seasonality, high infection rate and death rate and various harmful varieties, and most of fish species with higher economic values, such as catfish, carp, tilapia, eel, mullet, turbot and the like, cause large-area death. After Edwardsiella tarda infects turbot, the onset symptoms are manifested as the back skin of the back part of the fish body is black, the abdomen is red and swollen and the kidney is enlarged. Pathological analysis finds that the Edwardsiella tarda is systemic to turbot infection, particularly, kidney lesions are obvious, and macrophages are proliferated and accumulated in multiple organs to generate granulation tumors. In addition, edwardsiella tarda also infects shellfish, reptiles, amphibians, birds, mammals. Notably, edwardsiella tarda is also an important zoonotic pathogen, which is the only member of the edwardsiella genus that infects humans. At present, the pathogen with serious Edwardsiella tarda disease of fish cultured in China is mainly Edwardsiella tarda, and has great threat of transferring the pathogen to human body. At present, no effective prevention and treatment measures for the diseases exist in China.

At present, the control of Edwardsiella mainly depends on the use of antibiotics, mainly chemotherapy. Because antibiotics are continually tolerated, their use in aquaculture is increasingly limited. In addition, pathogenic edwardsiella tarda is often found to be naturally resistant to multiple antibiotic complexes, increasing the difficulty of antibiotic-based treatments. In contrast, from a long-term perspective, vaccines are a safer and more effective approach to disease control. Because the antigenicity of the inactivated vaccine is weak, and the safety of the attenuated vaccine is unstable, therefore, the development of the subunit vaccine which is convenient to use, high-efficiency, easy to commercialize and produce in a large scale and practical and effective is particularly necessary for aquaculture.

Glycolytic housekeeping enzymes are universally present in organisms, participate in basal metabolism, and have high homology among different species. The immunogenicity of these glycolytic housekeeping enzymes is also of increasing concern and is becoming a new target for vaccine design. In view of this, the development of a novel vaccine with better effect is urgently needed, and the Edwardsiella tarda glycolytic housekeeping enzyme protein is preferably used as a preferred antigen protein, so that a foundation is laid for the subsequent design of a multi-pathogen immune control vaccine.

Disclosure of Invention

The inventor researches and discovers that enzyme in glycolysis pathway (EMP pathway) is used as candidate vaccine protein, and preferably antigen protein bi-component and three components are combined for immunization, and an antigen combination for synergistic immunization is screened; and simultaneously, screening optimized antigen protein key epitope peptides, performing tandem expression, purification and immune protection evaluation on the obtained key epitope peptides, and further finding out that different key epitope combination modes generate different immune effects according to experimental results obtained by immunizing zebra fish, thereby providing a basis for the subsequent combined expression of antigen proteins in microalgae. Therefore, the method carries out multi-component combined immune efficacy evaluation, key epitope peptide identification and tandem recombinant expression on the obtained antigen protein so as to obtain the preferred high-efficiency antigen. Therefore, the first purpose of the invention is to provide a broad-spectrum combined vaccine of housekeeping enzymes in the glycolysis pathway of aquatic pathogenic bacteria, which is used for preventing and treating the infection of various aquatic pathogenic bacteria to fishes. The second purpose of the invention is to provide the application of the broad-spectrum combined vaccine of housekeeping enzymes in the glycolysis pathway of the aquatic pathogenic bacteria.

In order to achieve the purpose, the invention provides the following technical scheme:

in a first aspect of the present invention, a broad-spectrum combination vaccine of housekeeping enzymes in glycolytic pathway of aquatic pathogenic bacteria is provided, which comprises a recombinant protein as an antigenic component, wherein the recombinant protein is formed by connecting at least two key epitopes of the housekeeping enzymes from glycolytic pathway.

According to the invention, glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO and HK, and key epitopes of the PGM, the PGK, the ENO and the HK are respectively polypeptide PGM₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

According to the invention, the coding genes of the proteins PGK, PGM, ENO and HK have nucleotide sequences shown as SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8 respectively.

Preferably, the broad-spectrum combination type vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteria takes a recombinant protein formed by connecting key epitopes of PGM and PGK of the housekeeping enzyme from the glycolysis pathway as an antigen component.

According to the invention, the key epitopes of PGM and PGK are PGM respectively₁、PGK₂And PGK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with 195 th and 291 th amino acids corresponding to protein PGK, the amino acid sequences of the proteins PGK and PGM are respectively shown as SEQ ID No. 1 and SEQ ID No. 2, and the corresponding coding genes respectively have the nucleotide sequences shown as SEQ ID No. 5 and SEQ ID No. 6.

According to the invention, the recombinant protein is expressed in E.coli.

According to the invention, the aquatic pathogenic bacteria comprise vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, aeromonas hydrophila, pseudomonas, edwardsiella, aeromonas salmonicida, photobacterium mermairei and yersinia ruckeri.

As a second aspect of the invention, the application of the broad-spectrum combination type vaccine of housekeeping enzymes in the glycolysis pathway of the aquatic pathogenic bacteria in preventing and treating bacterial diseases in aquaculture is provided.

Furthermore, the broad-spectrum combined vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteria is applied to preventing and treating bacterial diseases in aquaculture caused by vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, aeromonas hydrophila, pseudomonas, edwardsiella and the like.

According to the invention, the broad-spectrum combined vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteria is used for preventing and treating the fish co-infection of the aquatic pathogenic bacteria such as vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, aeromonas hydrophila, pseudomonas and edwardsiella, and the broad-spectrum combined vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteria has a cross immune protection effect on the aquatic pathogenic bacteria such as vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, aeromonas hydrophila, pseudomonas and edwardsiella.

According to the invention, the Edwardsiella tarda EIB202 is Edwardsiella tarda E.tarda EIB with the following preservation number: CCTCC-M208068.

According to the invention, the vibrio anguillarum is vibrio anguillarum MVM 425.

According to the invention, the Vibrio harveyi is Vibrio harveyi VIB 647.

According to the invention, the aeromonas hydrophila is aeromonas hydrophila L SA 34.

According to the invention, the Vibrio alginolyticus is Vibrio alginolyticus EPGS 020401.

As a third aspect of the present invention, a recombinant protein obtained by linking at least two key epitopes of a housekeeping enzyme derived from the glycolytic pathwayThe derived housekeeping enzymes are PGM, PGK, ENO and HK, and the key epitopes of the PGM, the PGK, the ENO and the HK are PGM respectively₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences corresponding to the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

According to the invention, the coding genes corresponding to the proteins PGK, PGM, ENO and HK have the nucleotide sequences shown as SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8 respectively.

Preferably, the recombinant protein is formed by connecting key epitopes of a glycolytic pathway-derived housekeeping enzyme PGM and PGK, wherein the key epitopes of the PGM and the PGK are PGM respectively₁、PGK₂And PGK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with 195 th and 291 th amino acids corresponding to protein PGK, the amino acid sequences of the proteins PGK and PGM are respectively shown as SEQ ID No. 1 and SEQ ID No. 2, and the corresponding gene coding sequences thereof are respectively shown as nucleotide sequences shown as SEQ ID No. 5 and SEQ ID No. 6.

As a fourth aspect of the present invention, a nucleotide encoding the recombinant protein described above.

As a fifth aspect of the present invention, a recombinant vector comprising an expression vector encoding the nucleotide sequence of the recombinant protein described above.

According to the invention, the expression vector is pET28a (+).

As a sixth aspect of the present invention, a host cell comprising the recombinant vector as described above.

According to the invention, the host cell is E.coli.

Further, the host cell is Escherichia coli B L21 (DE 3).

As six aspects of the invention, the bacteriostatic composition comprises at least one of a recombinant protein formed by connecting key epitopes of at least two glycolytic pathway-derived housekeeping enzymes, an expression vector containing the recombinant protein and a host cell containing the recombinant protein.

According to the invention, the glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO and HK, and the key epitopes of the PGM, the PGK, the ENO and the HK are PGM respectively₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

In a seventh aspect of the present invention, a bacteriostatic agent comprises at least one of a recombinant protein comprising at least two kinds of glycolytic pathway-derived key epitopes linked to each other as a main active ingredient, an expression vector containing the recombinant protein, and a host cell containing the recombinant protein.

According to the invention, the glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO and HK, and the key epitopes of the PGM, the PGK, the ENO and the HK are PGM respectively₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is provided withPolypeptide fragments of amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

According to the invention, the bacteriostatic spectrum of the bacteriostatic agent is as follows: vibrio anguillarum, Vibrio harveyi, Vibrio alginolyticus, Aeromonas hydrophila, Pseudomonas and Edwardsiella.

According to the invention, the Edwardsiella tarda EIB202 is Edwardsiella tarda E.tarda EIB with the following preservation number: CCTCC-M208068.

According to the invention, the vibrio anguillarum is vibrio anguillarum MVM 425.

According to the invention, the Vibrio harveyi is Vibrio harveyi VIB 647.

According to the invention, the aeromonas hydrophila is aeromonas hydrophila L SA 34.

According to the invention, the Vibrio alginolyticus is Vibrio alginolyticus EPGS 020401.

As a seventh aspect of the invention, the application of the broad-spectrum combined vaccine of the housekeeping enzyme in the glycolysis pathway of the aquatic pathogenic bacteria in preparing feed additives, feeds or baits is provided.

According to the invention, the feed is a feed for aquaculture, and the feed additive is a feed additive for aquaculture; the bait is zooplankton such as rotifer, cladocera, copepods, etc.

Preferably, the feed is fish feed; the feed additive is a fish feed additive.

The invention has the beneficial effects that: the invention relates to a polypeptide fragment PGK with immunological activity₂、PGK₃And PGM₁Combinatorial immunization, administration of PGK₂、PGK₃And ENO₁Combinatorial immunization₁And HK₃Combinatorial immunization, and administration of PGM₁With ENO₁The combined immunity has good immunity, can be used for developing subunit vaccines which are convenient to use, efficient, easy to commercialize and produce in a large scale, are practical and effective, can be used for immune prevention and treatment of multi-pathogen co-infection in aquaculture, and has good application prospect.

Drawings

FIG. 1-FIG. 4 are relative immunoprotection analysis of the Edwardsiella tarda glycolysis housekeeping enzyme key epitope after recombinant protein immune zebra fish.

FIG. 5 is the relative immune protection analysis of the recombinant antigen of the invention with various combinations of key epitopes of Edwardsiella tarda after immunizing zebra fish.

FIG. 6 shows the analysis of specific antibody titer in serum of zebrafish immunized with the recombinant antigen containing multiple combinations of key epitopes of Edwardsiella tarda.

FIG. 7 is the cross-reaction titer analysis of antibodies and multi-pathogenic bacteria in serum after immunization of zebra fish with the key segment recombinant antigen of the present invention.

Detailed Description

The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are only for illustrating the present invention and are not to be construed as limiting the scope of the present invention. In addition, the experimental methods used in the following examples are all conventional methods unless otherwise specified. Reference is made to literature 1, "recombinant expression and epitope screening of edwardsiella tarda antigen protein FBA in pichia pastoris", borpan, shanghai, university of eastern china, 2015 (hereinafter referred to as "literature 1"); 2. "analysis of immunogenicity of housekeeping enzymes in the glycolytic pathway of Edwardsiella tarda", Sunjinamin, Shanghai, university of eastern China, 2016 (hereinafter, referred to as "document 2").

Proteins involved in the glycolytic pathway of edwardsiella and other potential vaccine targets, such as the housekeeping enzyme proteins phosphoglycerate kinase (PGK), phosphoglycerate mutase (PGM), Enolase (ENO), Hexokinase (HK), triosephosphate isomerase (TPI), phosphoglucose isomerase (PGI), Phosphofructokinase (PFK), and Pyruvate Kinase (PK) in the glycolytic pathway, are preferably considered as vaccine candidate proteins. Glycolytic housekeeping enzymes are universally present in organisms, participate in basal metabolism, and have high homology among different species. The immunogenicity of these glycolytic housekeeping enzymes is also of increasing concern and is becoming a new target for vaccine design.

The present inventors have conducted epitope screening by partially deleting the amino acid sequence of the encoded protein while maintaining all or part of the functions of the protein, and the epitope and the corresponding antibody have good binding property, and the epitope can stimulate the corresponding immune response of the host. Such proteins include conserved sequences of a portion of amino acids, and in general, altering a single amino acid in a non-essential region of a polypeptide does not alter its biological activity. And the key region of the epitope is preliminarily determined by analyzing the effectiveness of the zebra fish experiment and the reactivity of antiserum, so that a foundation is provided for the subsequent application development.

1. The strains and plasmid sources related to the invention are as follows:

(1) coli B L21 (DE3) from Tiangen Biochemical technology, Inc. (Beijing);

(2) edwardsiella tarda EIB202, deposited under accession number: CCTCC-M208068(Edwards iellatada EIB 202);

(3) pET28a (+) vector: purchased from precious bioengineering (Dalian) Co.

(4) Vibrio anguillarum MVM425 (isolated from Perch fascicularis, Wu, H.Z., Ma, Y., Zhang, H.Z.and Zhang, Y.X. (2004) Complete sequence of viral plasmid from the marine organism Vibrio anguillarum strain MVM425 and location of the nature of reproduction region. J Appl Microbio97, 1021-1028);

(5) aeromonas hydrophila A.hydrophila L SA34 (isolated from freshwater fish, Zhou, L. Y., Wang, X.H., &lTtTtranslation = L "&gTt L &lTt/T &gTt iu, Q, Wang, Q.Y., ZHao, Y.and Zhang, Y.X. (2010) A novel multiple vaccine based secreted antigen-delayed detection and amplification of aquatic bacteria and Aeromonas hydrophila 146. J Biotechnology, 25-30);

(6) vibrio harveyi VIB647 (isolated from a beaver, Zhang, X.H, Meaden, P.G. and dust, B. (2001) duplicate of hemolysin genes in a virluent isolate of Vibrio harveyi. apple Environ Microbiol67, 3161-3167.);

(7) vibrio alginolyticus EPGS020401 (isolated from Epinephelus punctatus, Rui, H.P., &lTtTtransition = L "&gTt L &/T &gTt iu, Q, Wang, Q.Y., Ma, Y., L iu, H.., Shi, C.B.and Zhang, Y.X. (2009) Role of alkaline serineprotease Asp in Vibrio alginate virus and regulation of issx expression library L uxO-L uxR regulation system. J Microbiol Biotechnology 19, 431-438).

2. The culture medium and culture conditions according to the present invention

(1) L B Medium 1% (w/v) peptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, solid medium added with 2% (w/v) agar, autoclaved at 121 ℃ for 20min, and used for the cultivation of E.coli and Edwardsiella.

(2) DH L culture medium 60g of Choline Suzuku agar culture medium was dissolved in 1L deionized water, and the solution was boiled repeatedly until it was clear, and then cooled to prepare a plate.

(3) The culture conditions are as follows:

escherichia coli was cultured by shaking in L B liquid medium at 37 ℃ or by plate-standing in L B solid medium.

The Edwardsiella tarda is inoculated in L B liquid culture medium and cultured by shaking and shaking at 30 ℃ and 200r/min overnight, the Edwardsiella tarda liquid is coated or streaked on DH L solid culture medium and is inversely placed in a constant temperature incubator at 37 ℃ for overnight culture, and a black-heart colony with semitransparent edges is formed on the DH L solid culture medium.

3. Experimental reagent and noun explanation

(1) Conventional molecular biological reagents and kits are purchased from Tiangen Biotechnology (background) Ltd; wherein the content of the first and second substances,

1) IPTG: isopropyl thiogalactoside

2) Ni-Sepharose: nickel-agarose gel

3) PBS 8.00g of NaCl, 41.42g of Na2HPO41, 0.20g of KCl and 0.27g of KH2PO40.27g of NaCl are weighed and dissolved in 1L ultrapure water.

4) PBST: tween was added in a proportion of 0.05% to the PBS.

5) BSA: bovine serum albumin.

(2) Restriction enzymes BamH I, Xho I were purchased from Bao bioengineering (Dalian) Co., Ltd.

(3) Conventional reagents for protein expression and purification are purchased from Shanghai Biotechnology engineering services, Inc.

(4) Affinity chromatography medium Ni-Sepharose FF was purchased from GE Healthcare.

(5) Goat anti-mouse monoclonal antibodies were purchased from Tiangen.

4. Antigenic protein gene sequence

According to the E.tarda EIB202 whole genome sequence, protein sequences of corresponding Edwardsiella tarda glycolytic pathway related proteins PGK, PGM, ENO, HK and the like are obtained, and are shown as SEQ ID No. 1-SEQ ID No. 4 in the sequence table. The nucleotide sequences of the PGK, PGM, ENO, HK and other genes are shown as SEQ ID No. 5-SEQ ID No. 8 of the sequence table.

5. Antigen protein primer

Specific primers for genes of Edwardsiella tarda glycolytic housekeeping enzyme designed by Primer5 software are shown in Table 1, and the primers were synthesized by Shanghai bioengineering company and purified by PAGE. Specific primers were designed according to the principle of primer design, and as shown in tables 2 and 3, the primers were synthesized by Shanghai bioengineering company and purified as PAGE products.

TABLE 1 primer sequences for glycolysis-related protein gene cloning

Primer name	Primer sequence (5 '-3')	Restriction sites	SEQ ID
				PGM-F	CGCGGATCCATGAGACAGGTATATCTTAT	BamH I	No:9
PGM-R	CCGCTCGAGCTAACGTAACACTTCATCC	Xho I	No:10
				PGK-F	CGCGGATCCTTACTGCTTGGCGCGCTCTTC	BamH I	No:11
PGK-R	CCGCTCGAGATGTCTGTAATTAAGATGAC	Xho I	No:12
				ENO-F	CGCGGATCCTTAATGCTGGCCTTTCACTTCTT	BamH I	No:13
ENO-R	CCGCTCGAGATGTCCAAAATCGTTAAAGTC	Xho I	No:14
				HK-F	CGCGGATCCATGAGCCGTTTTGCGTTG	BamH I	No:15
HK-R	CCGCTCGAGTTAAAGACGAGTGCCCAG	Xho I	No:16

TABLE 2 cloning of primer sequences for key segments of glycolytic housekeeping enzymes

Primer name	Primer sequence (5 '-3')	Restriction sites	SEQ ID
				PGM1-F	CGCGGATCCATGAGACAGGTATATC	BamH I	No:17
PGM1-R	CCGCTCGAGGCTGGCGATCACGTG	Xho I	No:18
				PGK2-F	CGCGGATCCGGCGTTGACGTTGCC	BamH I	No:19
PGK2-R	GGTCAGCTTGGTGGAGACTTTGGAGCCGCC	/	No:20
				PGK3-F	GGCGGCTCCAAAGTCTCCACCAAGCTGACC	/	No:21
PGK3-R	CCGCTCGAGGGCAGAGGCATCGCC	Xho I	No:22
				ENO1-F	CGCGGATCCATGTCCAAAATCGTT	BamH I	No:23
ENO1-R	CCGCTCGAGAGCACCGAACTTGGA	Xho I	No:24
				HK3-F	CGCGGATCCGTGGATTTCGCGACC	BamH I	No:25
HK3-R	CCGCTCGAGCATCACACAGAACAG	Xho I	No:26

TABLE 3 primer sequences for amplifying the corresponding nucleotides of each polypeptide in the housekeeping enzyme

6. Experimental animal and immunological reagent

(1) Zebra fish, purchased from Shanghai farm, having a body length of 4cm and a body weight of about 0.4 g. The fish breeding system is placed in an aquarium for acclimation and domestication for 2 weeks before the experiment, and then is moved to a fish breeding system for acclimation for 2 weeks. The fish breeding system changes the water body in a flowing mode every day, and the breeding temperature is about 22 ℃. Feeding for 2 times a day and removing fecal residue in time.

(2) The anesthetic tricaine methosulponate (MS-222) for fish was purchased from Sigma.

(3) Adjuvant MONTANIDE for fish^TMISA763A, purchased from SEPPIC, france.

Example 1 preliminary screening of key epitopes of the glycolytic pathway housekeeping enzymes PGK, PGM, ENO, HK

1. Preparation of recombinant antigenic proteins

The screening of key epitopes of the housekeeping enzyme protein PGK in the EMP pathway is taken as an example. Extraction of the vector Plasmid pET28a (+) was performed according to the instructions of the TIANPrep Mini Plasmid Kit. Restriction enzymes BamH I and Xho I are selected for double enzyme digestion, and the linearized vector after enzyme digestion is recovered by an agarose gel recovery kit.

The extraction of the Edwardsiella tarda EIB202 genome was performed according to the instructions of the genome extraction Kit (TIANAmp Bacteria DNA Kit). The Edwardsiella tarda EIB202 genome is taken as a template, and specific primers are designed, wherein the sequences of the primers are shown as SEQ ID No. 11 and SEQ ID No. 12. Carrying out PCR amplification on a coding sequence of the protein PGK to obtain a gene fragment, carrying out double enzyme digestion by restriction enzymes BamH I and Xho I to obtain a target gene, and constructing a recombinant plasmid as a positive control group together with a linearized vector through DNA ligase. Wherein, the nucleotide sequence of the coding PGK is shown as SEQ ID No. 5; the amino acid sequence corresponding to the protein PGK is shown as SEQ ID No. 1.

Protein PGK was divided into 4 polypeptide fragments: PGK₁(1-97aa)、PGK₂(98-194aa)、PGK₃(195-291aa)、PGK₄(292-) 387 aa). The gene corresponding to the protein PGK is used as a template, and a specific primer is designed according to the primer design principle, the primer sequence is shown as SEQ ID No. 27-SEQ ID No. 34, and each segment of gene fragment corresponding to the polypeptide is amplified. Deleting one gene segment each time, sequentially splicing the other segments by an Overlap method to obtain new target gene segments, wherein the protein variants coded by the sequences are respectively as follows: delta PGK₁(98-387aa)、ΔPGK₂(1-97aa，195-387aa)、ΔPGK₃(1-194aa，292-387aa)、ΔPGK₄(1-291aa), carrying out double digestion by restriction enzymes BamH I and Xho I, connecting a target gene with a sticky end and a linearized plasmid vector under the action of DNA ligase to form a recombinant plasmid containing the target gene, wherein the recombinant plasmid can be used for transfloning escherichia coli DH5 α host bacteria, determining the clone on a plate to be positive through sequencing verification, extracting the recombinant plasmid in the positive host bacteria, transforming the recombinant plasmid into escherichia coli B L21 (DH3) host bacteria, and verifying the recombinant plasmid to be positive again, namely the recombinant escherichia coli B L21/pET-28 a-delta PGK of Edwardsiella tarda PGK protein₁、BL21/pET-28a-ΔPGK₂、BL21/pET-28a-ΔPGK₃、BL21/pET-28a-ΔPGK₄。

Wherein, the PCR amplification conditions are as follows: 5 minutes at 95 ℃; at 95 ℃ for 30 seconds; 30 seconds at 60 ℃; converting the time at 72 ℃ according to 1 kb/min for 34 cycles; 72 ℃ for 5 minutes; keeping the temperature at 12 ℃.

Inoculating the expression strain with successful sequencing and growing to a certain extentThe method comprises the steps of adding IPTG (isopropyl-beta-thiogalactoside) for induced expression, collecting bacterial liquid, centrifuging, then breaking the wall by using an ultrasonic method, collecting supernatant and precipitate, detecting protein induced expression by protein electrophoresis, wherein recombinant plasmids are provided with 6 × His labels, Western blot can be adopted to further verify that the protein is successfully expressed, two ends of 4 recombinant proteins are respectively provided with one His label and can be specifically combined with nickel, therefore, a nickel column can be used for specifically purifying target protein, and delta PGK (delta PGK) protein variants are obtained by elution, wherein the delta PGK protein variants are respectively delta PGK₁(98-387aa)、ΔPGK₂(1-97aa，195-387aa)、ΔPGK₃(1-194aa，292-387aa)、ΔPGK₄(1-291 aa). The variant Δ PGK protein was then packed into a molecular weight cut-off dialysis bag and dialyzed against PBS solution and stored at-70 ℃.

The OD was measured by using a nucleic acid quantifying apparatus NanoDrop ND-1000 spectrophotometer to determine the concentration of the recombinant protein, and the protein was diluted to a predetermined concentration with PBS buffer.

2. Immunization injection of zebra fish

Mixing a plurality of groups of delta PGK protein variants obtained by purification with an adjuvant ISA763A according to a ratio of 7:3, wherein a mixed solution of the delta PGK protein variants and the adjuvant is an experimental group, a mixed solution of PGK full-length protein and the adjuvant is a positive control group, a mixed solution of PBS and the adjuvant is a negative control group, fully oscillating and uniformly mixing to enable the final protein concentration to be 0.3 mu g/mu L and the final dose to be 1.5 mu g/tail, randomly dividing the bred zebra fish into ten groups, injecting 30 tails in each group, carrying out tail muscle injection immunization, carrying out normal breeding after the immunization is finished, observing the activity and death conditions of the fish, and the immunization time is 4 weeks.

Before injection, the zebra fish is soaked in 100ng/m L MS-222 for anesthesia, and after the experiment period is finished, the rest zebra fish is euthanized, namely soaked in 200ng/m L MS-222 for more than 10 min.

3. Toxin counteracting injection for zebra fish

Collecting Edwardsiella tarda EIB202 cells, washing with sterilized PBS three times, measuring density of resuspended cells with spectrophotometer, and quantifying OD ₆₀₀1, diluting the bacterial liquid with PBS to required gradient concentration, performing tail intramuscular injection immunization on each test zebra fish according to the dosage of 5 mu L/tail, observing and recordingMorbidity and mortality of zebra fish in each group.

4. Recombinant protein immunoprotection assay (RPS)

4.1 after 4 weeks of zebra fish immune breeding, selecting proper dosage to carry out toxicity attack experiment on the immunized zebra fish according to the half lethal dose L D50 value of the wild strain, observing and recording the morbidity and mortality of each group of zebra fish, and calculating the Relative protection Rate (RPS) according to the formula:

RPS ═ (1-immune group mortality/control group mortality) × 100%

The survival rate of zebrafish within two weeks after challenge is shown in figure 1.

The results in FIG. 1 show that: (1) the accumulated survival rate of zebra fish immunized by the full-length protein expressed by the PGK is higher and reaches 78% within two weeks after EIB202 challenge. (2) Protein variants Δ PGK₂And Δ PGK₃The final survival rate of the corresponding experimental groups was lower than that of the PBS control group. Lack of key polypeptide segment PGK₂And PGK₃The survival rate of the zebra fish after challenge is reduced by 41 percent and 50 percent. (3) Protein variants Δ PGK₁And Δ PGK₄The final survival rate of the corresponding experimental groups was higher than that of the PBS control group.

And (4) conclusion: the key region of the protein PGK with immunoprotection is the polypeptide PGK₂And PGK₃And (3) fragment.

4.2 the diseased fish is dissected to find that spleen of the fish body is swollen, blood loss is pink, and liver is subjected to diffuse bleeding, the diseased fish tissue is properly treated and diluted to be shown in a DH L plate, the plate is placed upside down in a constant-temperature incubator at 37 ℃ for overnight culture, and a large number of black-heart colonies exist on the plate, which indicates that the pathogenic reason of the zebra fish is really the infection of Edwardsiella tarda.

Example 2 Primary screening of PGM, ENO, HK Key epitopes

The specific experimental steps and the method refer to example 1 and reference 1, the genome of Edwardsiella tarda EIB202 is taken as a template, specific primers are designed, the primers are respectively shown as SEQ ID No. 9 and SEQ ID No. 10, SEQ ID No. 13 and SEQ ID No. 14, and SEQ ID No. 15 and SEQ ID No. 16, related gene fragments of glycolytic pathway housekeeping enzymes PGM, ENO and HK proteins are obtained by amplification, and the coding sequences of the PGM, ENO and HK proteins are respectively shown as SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8; the corresponding amino acid sequences are respectively shown as SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4. The target gene obtained by double enzyme digestion of restriction enzymes BamH I and Xho I is used for constructing a recombinant plasmid as a negative control group by DNA ligase and a linearized vector.

The housekeeping enzymes PGM, ENO and HK in Edwardsiella tarda are divided into four sections: PGM₁(1-54aa)、PGM₂(55-108aa)、PGM₃(109-162aa)、PGM₄(163-215aa)；ENO₁(1-108aa)、ENO₂(109-215aa)、ENO₃(217-324aa)、ENO₄(325-433aa)；HK₁(1-80aa)、HK₂(81-160aa)、HK₃(161-240aa)、HK₄(241-321 aa). The gene corresponding to each protein is taken as a template, a specific primer is designed according to the primer design principle, the sequence of the primer is shown as SEQ ID No. 35-SEQ ID No. 58, and each segment of gene fragment corresponding to the polypeptide is amplified. Deleting one gene segment each time, sequentially splicing the other segments by an Overlap method to obtain new target gene segments, wherein the protein variants coded by the sequences are respectively as follows: Δ PGM₁(55-215aa)、ΔPGM₂(1-54aa，109-215aa)、ΔPGM₃(1-108aa，163-215aa)、ΔPGM₄(1-162aa)；ΔENO₁(109-433aa)、ΔENO₂(1-108aa，217-433aa)、ΔENO₃(1-215aa，325-433aa)、ΔENO₄(1-324aa)；ΔHK₁(81-321aa)、ΔHK₂(1-80aa，161-321aa)、ΔHK₃(1-160aa，241-321aa)、ΔHK₄(1-240aa), performing double enzyme digestion on each target gene by BamHI and XhoI, respectively constructing recombinant plasmids with a linearized plasmid pET28a (+), and respectively constructing recombinant escherichia coli B L21/pET-28 a-delta PGM by verifying that the positive recombinant plasmids are used for constructing recombinant escherichia coli₁、BL21/pET-28a-ΔPGM₂、BL21/pET-28a-ΔPGM₃、BL21/pET-28a-ΔPGM₄；BL21/pET-28a-ΔENO₁、BL21/pET-28a-ΔENO₂、BL21/pET-28a-ΔENO₃、BL21/pET-28a-ΔENO₄；BL21/pET-28a-ΔHK₁、BL21/pET-28a-ΔHK₂、BL21/pET-28a-ΔHK₃、BL21/pET-28a-ΔHK₄. After the recombinant protein is obtained by induced expression and purification, a zebra fish injection experiment is carried out, and then the immunoprotection (RPS) of the recombinant protein is determined after an Edwardsiella tarda virus challenge experiment is carried out. As shown in FIGS. 2-4, protein variants Δ PGM₁The survival rate of the immunized zebra fish is reduced by 37 percent; protein variants delta ENO₁The survival rate of the immunized zebra fish is reduced by 28 percent; protein variants Δ HK₃The survival rate of the immunized zebra fish is reduced by 14 percent.

And (4) conclusion: the key area of immunoprotection of protein PGM is that of PGM₁Polypeptide fragments; the key region of the protein ENO with immunoprotection is in ENO₁Polypeptide fragments; the key region of protein HK with immunoprotection is in HK₃Polypeptide fragments.

Example 3 Multi-combination tandem expression of key epitopes of housekeeping enzymes

1. Preparation of key epitope multi-combination recombinant antigen protein

Extraction of the vector Plasmid pET28a (+) was performed according to the instructions of the TIANPrep Mini Plasmid Kit. Restriction enzymes BamH I and Xho I are selected for double enzyme digestion, and an agarose gel DNA recovery kit is used for recovery. One or more of the primary key epitope peptides of one or more housekeeping enzymes PGM, PGK, ENO, HK and the like in the Edwardsiella glycolysis pathway are selected for tandem expression, and the peptide sequences are respectively designed as SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19 and SEQ ID No: 20. the specific primers shown in SEQ ID No. 21 and SEQ ID No. 22, SEQ ID No. 23 and SEQ ID No. 24, SEQ ID No. 25 and SEQ ID No. 26 obtain a target gene band. Preferred embodiments employ tandem expression of the key epitope peptides of two of the housekeeping enzymes. Wherein the key epitope of PGM is polypeptide fragment PGM₁The key epitope of the PGK is a polypeptide fragment PGK₂And polypeptide fragment PGK₃Fusion expressed Polypeptide (PGK)_2-3) The key epitope of ENO is polypeptide fragment ENO₁The key epitope of HK is polypeptide fragment HK₃Constructing recombinant plasmid which can be used for cloning host bacterium of Escherichia coli B L21 (DE3), inducing protein expression, and obtaining proteinAnd (3) detecting protein induced expression by electrophoresis, wherein the recombinant plasmid is provided with a 6 × His tag, and can be further verified to be successfully expressed by Western blot.

2. Injection administration immune protection experiment using zebra fish as experimental animal

The purified recombinant protein is mixed with an adjuvant ISA763A according to the proportion of 7:3 until the protein concentration reaches 0.3 mug/mug L, the final dose is 1.5 mug/tail, fish tail muscle injection immunization is adopted, PBS and the adjuvant ISA763A are used as negative control groups, PGM, PGK, ENO and HK full-length protein and the adjuvant ISA763 76 763A are mixed as positive control groups, then normal feeding is carried out, the activity and the death of the fish are observed, the immunization time is one month, after the zebra fish are immunized and cultured for 4 weeks, the appropriate dose is selected to carry out toxicity attack experiment on the immunized zebra fish according to the half lethal dose of the wild strain L D50 value, the morbidity and the death of each group of zebra fish are observed and recorded, and RPS is calculated.

The relative protection Rates (RPS) of recombinant proteins in the glycolytic pathway against zebrafish are shown in FIG. 5.

Figure 5 results show that: the relative protection rate of the PGM and the key section of the PGK after combined immunization reaches 67.7 percent,

the relative protection rate of PGM and the key section of ENO after combined immunization reaches 46.7 percent.

The relative protection rate after combined immunization of PGM and key segments of HK reaches 44.3%.

After combined immunization of PGK and the key segment of ENO, the relative protection rate reaches 51.7 percent.

The relative protection rate of the PGK and the key segment of the HK after combined immunization reaches 39.7 percent.

The minimum combination of key segments for ENO and HK was also 27.3%.

And (4) conclusion: the key section combined immunity has better immunity.

3. Serum antibody level assay

The serum sampling time point is 4 weeks after immunization, 25 zebra fish and anesthetized zebra fish are taken at random from the immunization group and the control group respectively, the tail fin of each fish is cut off by using surgical scissors, the capillary tube is placed on a bleeding point, when the blood enters the capillary tube about 3 mu L, the blood in the capillary tube is transferred to a small thin-wall tube, the thin-wall tube is placed at 4 ℃, the centrifugation is carried out for 5min at 750g after 16h, the upper serum is taken for 10 mu L, and the blood is transferred to the temperature of minus 20 ℃ for standby.

Diluting the purified recombinant protein to 20ng/m L with a coating buffer solution, adding a 96-well E L ISA plate, 100 mu L/well, 3 replicates for each sample, standing overnight at 4 ℃, diluting the bacterial liquid to 1 × CFU/m L with PBS, adding a 96-well E L ISA plate, 100 mu L/well, 3 replicates for each sample, standing overnight at 4 ℃, pouring off the coating solution the next day, adding 200 mu L PBST washing solution to each well, washing the plate 3 times with a blocking solution (PBST + 2% (w/v) BSA), adding 200 mu L with a blocking solution (PBST + 2% (w/v) BSA), incubating for 2h at 22 ℃, removing the blocking solution, washing the plate 3 times with a washing solution 300 mu L, draining, adding fish immune serum, diluting the plate to be tested with PBST at 1:40, diluting the plate for 100 mu L/well with 100 mu L, incubating for 2h with a blank control, incubating for 3h at 22 ℃, incubating with a washing plate 300 mu 365, washing the plate for 3 min, adding a mouse immune serum, adding a monoclonal antibody to the plate, incubating for 5min, adding a monoclonal antibody for detecting the mouse immune reaction, adding a monoclonal antibody for detecting the mouse antibody, washing the mouse antibody for detecting the mouse antibody, washing the mouse antibody, and detecting the antibody, wherein the antibody, the.

Serum antibody level titer analysis is shown in figure 6.

The results show that: the serum of the zebra fish immunized by the recombinant vaccine of the key segment can generate specific immune effect. PGK_2-3With PGM₁The combination of (a) increased serum antibody levels by 75% over the whole protein combination, PGM₁With ENO₁、PGM₁And HK₃、PGK_2-3With ENO₁The combination is also improved by 15.6 percent, 18.9 percent and 14.0 percent respectively compared with the serum antibody level of the whole protein combination; but ENO₁And HK₃The combined immunity was not good, but was reduced by 54.5% compared to their full-length protein at serum antibody level.

And (4) conclusion: PGK_2-3With PGM₁The combined immunity of the (A) has better immune effect. Set of key segments for different housekeeping enzymesThe combination of key segments produces different effects in part at the serum antibody level, and in part combinations such as ENO, there is a synergistic effect in comparison to the combination of full-length proteins₁And HK₃Antagonism is also present in the combination.

4. Cross immune effect

Since enzymes in the glycolytic pathway are highly conserved in amino acid sequence among marine pathogens, cross-reactivity of serum of zebrafish immunized with recombinant proteins was examined by indirect E L ISA method against other four major marine pathogens, Vibrio anguillarum (V.anguillarum MVM425), Aeromonas hydrophila (A.hydrophylla L SA34), Vibrio harveyi (V.harveyi VIB647), Vibrio alginolyticus (V.algornyliticus EPGS020401) as PGK_2-3With PGM₁Are preferred embodiments. The detection of antibody cross reaction was performed by coating with different pathogenic bacteria and diluting the serum 100-fold as a primary antibody. Specific Experimental methods and procedures with reference to example 3 and reference 2, serum antibody level titer analysis is shown in FIG. 7, and it can be seen that PGK is immunized against these pathogenic bacteria_2-3With PGM₁The antibody level in the combined zebra fish serum was significantly higher than that in the control PBS. Indicating that antibodies specific for these proteins in serum are able to recognize surface antigens of these pathogenic bacteria, indicating PGK_2-3With PGM₁The combination can be used as a broad-spectrum antigen and has cross protection effect on various pathogenic bacteria.

In conclusion, the invention constructs and screens the preferred vaccine aiming at the preferred antigen, is used for immune prevention and treatment of multi-pathogen co-infection in aquaculture, and provides technical support for realizing high yield and high quality of aquatic animals and constructing ecological and healthy sustainable aquaculture environment. Furthermore, the vaccine of the present invention can be prepared in the form of a kit or kit by a method known in the art, so as to be conveniently used by those skilled in the art; optionally including instructions for use therein.

The foregoing is merely a preferred embodiment of this invention and it will be appreciated by those skilled in the art that numerous modifications and adaptations can be made without departing from the principles of the invention. Such modifications and refinements are also to be considered within the scope of the present invention.

Sequence listing

<110> university of east China's college of science

<120> broad-spectrum combined vaccine of housekeeping enzyme in glycolysis pathway of aquatic pathogenic bacteria and application thereof

<141>2020-03-09

<160>58

<170>SIPOSequenceListing 1.0

<210>1

<211>387

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ser Val Ile Lys Met Thr Asp Leu Asp Leu Ala Gly Lys Arg Val

1 5 10 15

Leu Ile Arg Ala Asp Leu Asn Val Pro Val Lys Asp Gly Lys Val Thr

20 25 30

Ser Asp Ala Arg Ile Arg Ala Ser Leu Pro Thr Ile Glu Leu Ala Leu

35 40 45

Lys Gln Gly Ala Arg Val Met Val Thr Ser His Leu Gly Arg Pro Thr

50 55 60

Glu Gly Glu Tyr Asn Asp Ala Phe Ser Leu Leu Pro Val Val Asn Tyr

65 70 75 80

Leu Lys Asp His Leu Lys Ser Pro Val Arg Leu Ala Lys Asp Tyr Leu

85 90 95

Asp Gly Val Asp Val Ala Gln Gly Glu Leu Val Val Leu Glu Asn Val

100 105 110

Arg Phe Asn Lys Gly Glu Lys Lys Asp Asp Glu Thr Leu Ser Lys Lys

115 120 125

Tyr Ala Ala Leu Cys Asp Val Phe Val Met Asp Ala Phe Gly Thr Ala

130 135 140

His Arg Ala Gln Ala Ser Thr His Gly Val Gly Lys Phe Ala Pro Ile

145 150 155 160

Ala Cys Ala Gly Pro Leu Leu Ser Gly Glu Leu Glu Ala Leu Gly Lys

165 170 175

Ala Leu Ser Asn Pro Ala Arg Pro Met Val Ala Ile Val Gly Gly Ser

180 185 190

Lys Val Ser Thr Lys Leu Thr Val Leu Asp Ser Leu Ser Lys Ile Ala

195 200 205

Asp Gln Leu Ile Val Gly Gly Gly Ile Ala Asn Thr Phe Ile Ala Ala

210 215 220

Glu Gly His Asn Val Gly Lys Ser Leu Tyr Glu Ala Asp Leu Ile Pro

225 230 235 240

Glu Ala Lys Lys Leu Leu Gly Thr Cys Asp Ile Pro Val Pro Thr Asp

245 250 255

Val Arg Val Ala Thr Glu Phe Ser Glu Thr Ala Pro Ala Thr Met Lys

260 265 270

Ser Val Ser Asp Ile Lys Asp Asp Glu Gln Val Leu Asp Leu Gly Asp

275 280 285

Ala Ser Ala Glu Gln Leu Ala Ala Ile Leu Lys Asn Ala Lys Thr Ile

290 295 300

Leu Trp Asn Gly Pro Val Gly Val Phe Glu Phe Pro Asn Phe Cys Lys

305 310 315 320

Gly Thr Glu Ile Val Ala Asn Ala Ile Ala Asn Ser Asp Ala Phe Ser

325 330 335

Ile Ala Gly Gly Gly Asp Thr Leu Ala Ala Ile Asp Leu Phe Gly Ile

340 345 350

Ala Asp Lys Ile Ser Tyr Ile Ser Thr Gly Gly Gly Ala Phe Leu Glu

355 360 365

Phe Val Glu Gly Lys Lys Leu Pro Ala Val Val Met Leu Glu Glu Arg

370 375 380

Ala Lys Gln

385

<210>2

<211>215

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Arg Gln Val Tyr Leu Ile Arg His Gly Glu Thr Glu Trp Asn Val

1 5 10 15

Gln Arg Arg Ile Gln Gly Gln Ser Asn Ser Pro Leu Thr Val Met Gly

20 25 30

Glu Gln Gln Ala Arg Gln Val Gly Ala Arg Leu Gly Gln Met Gly Ile

35 40 45

Thr His Val Ile Ala Ser Asp Leu Gly Arg Thr Gln Gln Thr Gly Glu

50 55 60

Ile Ile Ala Ala Ala Cys Arg Cys Pro Leu Thr Leu Asp Ala Arg Leu

65 70 75 80

Arg Glu Leu Ser Met Gly Val Leu Glu Ser Arg Leu Leu Ala Ser Leu

85 90 95

Ser Pro Gln Glu Glu Gln Trp Arg Leu Ser Met Leu Asp Gly Ser Pro

100 105 110

Gln Gly Cys Ile Pro Gln Gly Glu Thr Met Ala Gln Leu Ala Glu Arg

115 120 125

Met Gln Gln Ala Leu Asn Asp Cys Leu Ala Leu Pro Gln Gly Ser Arg

130 135 140

Pro Val Leu Val Ser His Gly Ile Ala Leu Gly Cys Leu Leu Ser Thr

145 150 155 160

Val Leu Gly Leu Pro Pro Tyr Ala Glu Arg Arg Leu Arg Leu Arg Asn

165 170 175

Cys Ser Leu Ser Arg Val Asp Tyr Gln Gln Ser Ala Trp Leu Ala Ser

180 185 190

Gly Trp Val Val Glu Thr Ala Gly Asp Val Gln His Leu Ala Gln Pro

195 200 205

Ser Met Asp Glu ValLeu Arg

210 215

<210>3

<211>433

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Met Ser Lys Ile Val Lys Val Ile Gly Arg Glu Ile Ile Asp Ser Arg

1 5 10 15

Gly Asn Pro Thr Val Glu Ala Glu Val His Leu Glu Gly Gly Phe Val

20 25 30

Gly Met Ala Ala Ala Pro Ser Gly Ala Ser Thr Gly Ser Arg Glu Ala

35 40 45

Leu Glu Leu Arg Asp Gly Asp Lys Ser Arg Phe Leu Gly Lys Gly Val

50 55 60

Leu Lys Ala Val Ala Ala Val Asn Gly Pro Ile Ala Glu Ala Ile Ile

65 70 75 80

Gly Lys Asp Ala Lys Asp Gln Ala Asn Ile Asp Gln Ile Met Ile Glu

85 90 95

Leu Asp Gly Thr Glu Asn Lys Ser Lys Phe Gly Ala Asn Ala Ile Leu

100 105 110

Ala Val Ser Leu Ala Asn Ala Lys Ala Ala Ala Ala Ala Lys Gly Leu

115 120 125

Pro Leu Tyr Ala His Ile Ala Glu Leu Asn Gly Thr Pro Gly Lys Tyr

130 135 140

Ser Met Pro Leu Pro Met Met Asn Ile Ile Asn Gly Gly Glu His Ala

145 150 155 160

Asp Asn Asn Val Asp Ile Gln Glu Phe Met Ile Gln Pro Val Gly Ala

165 170 175

Lys Thr Leu Lys Glu Ala Val Arg Ile Gly Ser Glu Val Phe His Asn

180 185 190

Leu Ala Lys Val Leu Lys Ser Lys Gly Met Asn Thr Ala Val Gly Asp

195 200 205

Glu Gly Gly Tyr Ala Pro Asn Leu Glu Ser Asn Ala Ala Ala Leu Ala

210 215 220

Ala Ile Lys Glu Ala Val Glu Lys Ala Gly Tyr Val Leu Gly Lys Asp

225 230 235 240

Val Thr Leu Ala Met Asp Cys Ala Ala Ser Glu Phe Tyr Asn Lys Glu

245 250 255

Thr Gly Met Tyr Glu Leu Lys Gly Glu Gly Lys Ser Phe Thr Ser Asn

260 265 270

Glu Phe Thr His Tyr Leu Glu Gly Leu Thr Lys Glu Tyr Pro Ile Val

275 280 285

Ser Ile Glu Asp Gly Leu Asp Glu Ser Asp Trp Asp Gly Phe Ala Tyr

290 295 300

Gln Thr Lys Val Met Gly Asp Lys Leu Gln Leu Val Gly Asp Asp Leu

305 310 315 320

Phe Val Thr Asn Thr Lys Ile Leu Lys Glu Gly Ile Glu Lys Gly Ile

325 330 335

Ala Asn Ser Ile Leu Ile Lys Phe Asn Gln Ile Gly Ser Leu Thr Glu

340 345 350

Thr Leu Ala Ala Ile Lys Met Ala Lys Asp Ala Gly Tyr Thr Ala Val

355 360 365

Ile Ser His Arg Ser Gly Glu Thr Glu Asp Ala Thr Ile Ala Asp Leu

370 375 380

Ala Val Gly Thr Ala Ala Gly Gln Ile Lys Thr Gly Ser Met Ser Arg

385 390 395 400

Ser Asp Arg Val Ala Lys Tyr Asn Gln Leu Ile Arg Ile Glu Glu Ala

405 410 415

Leu Gly Ala Ala Ala Pro Phe Asn Gly Leu Lys Glu Val Lys Gly Gln

420 425 430

His

<210>4

<211>321

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Met Ser Arg Phe Ala Leu Val Gly Asp Val Gly Gly Thr Asn Ala Arg

1 5 10 15

Leu Ala Leu Cys Cys Leu Asp Thr Gly Cys Leu Gln Ala Val Gln Ser

20 25 30

Tyr Pro Gly Gln Gln Phe Asp Ser Leu Glu Ser Val Ile Arg Thr Tyr

35 40 45

Leu Gln Ala Gln Ala Val Ser Val Thr Ser Ala Cys Ile Ala Ile Ala

50 55 60

Cys Pro Ile Thr Gly Asp Arg Val Ala Met Thr Asn His Ser Trp Ala

65 70 75 80

Phe Ser Ile Ser Ala Met Gln Arg Ser Leu Gly Leu Ala His Leu Ser

85 90 95

Val Ile Asn Asp Phe Thr Ala Val Ser Met Ala Val Pro Val Leu Pro

100 105 110

Ala Glu Ser Leu Leu Gln Leu Gly Gly Gln Thr Ala Gln Pro Asp Arg

115 120 125

Pro Ile Ala Ile Tyr Gly Ala Gly Thr Gly Leu Gly Val Ala His Leu

130 135 140

Ile Arg Ala Gly Asp Arg Trp Ile Ser Leu Pro Gly Glu Gly Gly His

145 150 155 160

Val Asp Phe Ala Thr Gly Ser Asp Glu Glu Asp Ala Leu Leu Thr Ala

165 170 175

Leu Arg Ala Asp Leu Gly Arg Val Ser Ala Glu Arg Val Leu Ser Gly

180 185 190

Pro Gly Leu Val Asn Leu Tyr Arg Ala Val Ala Arg Val Ala Gly Arg

195 200 205

Thr Pro Gln Ser Leu Thr Pro Gln Glu Val Ser Glu Arg Ala Leu Ala

210 215 220

Asp Arg Cys Pro Asp Cys Arg Arg Ala Leu Ser Leu Phe Cys Val Met

225 230 235 240

Met Gly Arg Phe Gly Gly Asn Leu Ala Leu Asn Met Gly Thr Phe Gly

245 250 255

Gly Val Tyr Ile Ala Gly Gly Ile Val Pro Arg Phe Leu Ala Phe Phe

260 265 270

Arg Asp Ser Gly Phe Arg Gln Ala Phe Glu Asp Lys Gly Arg Phe Lys

275 280 285

Ala Tyr Leu Ala Pro Ile Pro Val Phe Leu Ile Val His Asp Asn Pro

290 295 300

Gly Leu Leu Gly Ala Gly Ala Tyr Leu Arg Gln Gln Leu Gly Thr Arg

305 310 315 320

Leu

<210>5

<211>1164

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atgtctgtaa ttaagatgac cgatttggat ctggcgggta aacgcgttct gatccgtgcg 60

gacctgaacg ttccggttaa agacggtaaa gtgacttccg atgcgcgtat ccgcgcgtcg 120

ctgccgacca ttgagctggc gctgaagcag ggtgcgcgcg tgatggtaac ctcccatctg 180

ggtcgtccga ccgaaggcga gtacaacgat gcgttctctc tgctgccggt ggtgaattac 240

ctcaaagatc atctgaagtc gccggtgcgt ctggccaaag attacctgga cggcgttgac 300

gttgcccagg gcgagctggt ggtgctggaa aacgtccgct tcaacaaggg cgagaagaaa 360

gacgacgaaa ccctgtctaa gaaatacgct gccctgtgcg acgtgttcgt tatggatgcg 420

ttcggcaccg cgcaccgcgc ccaggcctct acccacggcg tgggcaagtt tgcgccgatc 480

gcctgtgccg gtccgctgct gtccggcgag ctggaagccc tgggcaaagc cctgagcaac 540

ccggcgcgtc cgatggtcgc catcgtcggc ggctccaaag tctccaccaa gctgaccgtt 600

ctggactccc tgtccaagat cgctgaccag ctgatcgtgg gcggcggtat cgcgaatacc 660

ttcatcgcgg cggaaggcca caacgtgggt aaatccctgt atgaagccga cctgatcccg 720

gaagccaaga agctgctggg cacctgcgat atcccggtac cgaccgacgt gcgcgtagcc 780

accgagttct ctgagacggc gccggcgacc atgaagtccg tcagcgacat caaagacgac 840

gagcaggttc tggatctggg cgatgcctct gccgagcagc tggccgctat cctgaaaaac 900

gccaagacca tcctgtggaa cggtccggtc ggcgtcttcg agttcccgaa cttctgtaaa 960

gggaccgaga tcgtggccaa tgccatcgcc aacagcgacg ccttctccat cgccggcggc 1020

ggcgatacgc tggcggccat cgatctgttc ggcatcgccg acaagatctc ctacatctcc 1080

accggcggcg gcgccttcct ggagtttgta gaaggcaaga aactgccggc tgtggtgatg 1140

ctcgaagagc gcgccaagca gtaa 1164

<210>6

<211>648

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

atgagacagg tatatcttat tcgtcacggc gaaacggagt ggaacgtaca gcggcgtatt 60

cagggacagt cgaacagccc gctgaccgtg atgggcgaac agcaggcgcg gcaggtcggc 120

gcgcgcttag ggcagatggg cattacccac gtgatcgcca gcgatctggg gcgcactcag 180

cagacggggg agatcatcgc cgcggcctgt cgctgtccgc tgacgctgga tgcccgtctg 240

cgcgagctga gcatgggggt gctggagtcg cgtctgttgg cctcgctgtc gccgcaggag 300

gagcagtggc gcctgagcat gctggatggt tcgccgcagg gctgtattcc gcagggggag 360

accatggcgc agctggctga gcgcatgcag caggcgctga acgattgcct ggcgctaccg 420

caggggagcc gtccggtgct ggtgagccat ggcattgccc tgggctgcct gctctccacg 480

gtgctgggac tgccgccgta cgctgagcgc cgcctgcgcc tgcgcaactg ctcgctgtcg 540

cgggtggact atcagcagag cgcatggctg gcgagcggat gggtggtcga aacggcgggg600

gatgtacagc atctggccca gccgtcgatg gatgaagtgt tacgttag 648

<210>7

<211>1302

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

atgtccaaaa tcgttaaagt catcggtcgc gaaatcatcg actcccgcgg taacccgact 60

gtagaagccg aagttcatct ggaaggcggt ttcgtcggta tggctgctgc gccgtcaggt 120

gcttctaccg gctcccgcga agcgctggag ctgcgcgacg gtgacaagtc acgtttcctg 180

ggtaaaggcg ttctgaaagc ggttgccgcc gttaacggcc cgatcgctga agccatcatc 240

ggcaaagacg ccaaagatca ggcaaatatc gaccagatca tgatcgagct ggacggcact 300

gaaaacaaat ccaagttcgg tgctaacgcc attctggcgg tttccctggc taacgctaaa 360

gcagccgctg ccgctaaagg cctgccgctg tatgctcaca tcgccgagct gaacggtact 420

ccgggcaaat actccatgcc gctgccgatg atgaacatca tcaacggcgg tgagcacgcc 480

gacaacaacg tcgacatcca ggagttcatg atccagccgg ttggcgctaa gaccctgaaa 540

gaagcggtac gcatcggttc tgaagtgttc cataacctgg ctaaagtgct gaagtctaaa 600

ggcatgaaca ccgccgtggg cgacgaaggc ggctacgcgc cgaacctgga gtccaacgcg 660

gctgcgctgg ctgctatcaa agaagccgtt gagaaagccg gttacgtgct gggtaaagac 720

gttaccctgg ccatggactg cgccgcctct gagttctaca acaaagaaac cggtatgtat 780

gaactgaaag gcgaaggcaa atccttcacc tccaacgagt tcacccacta cctggaaggc 840

ctgaccaaag agtatccgat cgtctctatc gaagacggtc tggacgagtc tgactgggat 900

ggcttcgctt atcagaccaa agtgatgggc gacaagctgc agctggtggg cgacgacctg 960

ttcgtgacca acaccaagat cctgaaagaa ggcatcgaga aaggcatcgc taactccatc 1020

ctgatcaagt tcaaccagat cggttctctg accgaaaccc tggccgctat caagatggcg 1080

aaagacgctg gctacaccgc cgtgatctct caccgttcag gcgagaccga agacgcgacc 1140

atcgccgatc tggcggtagg tactgcggct ggccagatca agaccggttc catgagccgt 1200

tctgatcgcg ttgctaagta caaccagctg atccgtatcg aagaagcgct gggcgcggct 1260

gcaccgttca acggtctgaa agaagtgaaa ggccagcatt aa 1302

<210>8

<211>966

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

atgagccgtt ttgcgttggt tggcgatgtg ggcgggacca atgcccgcct ggcgctgtgc 60

tgtctcgaca ccgggtgtct ccaggcggtg cagagctacc cgggacagca gttcgatagc 120

ctggagtcgg tcatccggac ttacctgcag gcgcaggcgg tatcggtgac gtcggcctgt 180

atcgcgatcg cctgcccgat caccggcgat cgcgtggcga tgaccaatca cagctgggcg 240

ttttccatca gcgcgatgca gcgttcgctg gggttggcgc acctgtcggt gatcaacgac 300

tttaccgcgg tctccatggc ggtgccggtg ctccccgcgg agagtctgct gcagctgggc 360

ggccagacgg cgcagcccga tcggcctatc gccatctacg gcgccggtac cgggctgggc 420

gtcgcgcacc tgatccgggc cggagatcgc tggatcagcc tgccgggtga ggggggacat 480

gtggatttcg cgaccggtag cgatgaagag gacgcgctgc tgacggcgct gcgcgccgac 540

ctggggcggg tctccgccga gcgggtgctc tccggccccg gtctcgtcaa tttgtatcgc 600

gccgtcgccc gggttgcggg gcggacgccg cagtccctga cgccgcagga ggtcagcgag 660

cgggcgctgg ccgatcgctg tccggactgt cgacgggcgc tgtcgctgtt ctgtgtgatg 720

atggggcgct ttggtggcaa tctggcgctg aatatgggca cctttggcgg ggtgtatatc 780

gccggcggga tcgtgccgcg ttttctggcg tttttccgcg actccggctt tcgtcaggcg 840

ttcgaggaca aggggcgctt taaggcgtat ctcgcgccga tcccggtctt tctgatcgtg 900

cacgacaatc ccggtctgct tggcgccggc gcctatctgc gtcagcagct gggcactcgt 960

ctttaa 966

<210>9

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cgcggatcca tgagacaggt atatcttat 29

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccgctcgagc taacgtaaca cttcatcc 28

<210>11

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cgcggatcct tactgcttgg cgcgctcttc 30

<210>12

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ccgctcgaga tgtctgtaat taagatgac 29

<210>13

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cgcggatcct taatgctggc ctttcacttc tt 32

<210>14

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ccgctcgaga tgtccaaaat cgttaaagtc 30

<210>15

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cgcggatcca tgagccgttt tgcgttg 27

<210>16

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ccgctcgagt taaagacgag tgcccag 27

<210>17

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

cgcggatcca tgagacaggt atatc 25

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

ccgctcgagg ctggcgatca cgtg 24

<210>19

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

cgcggatccg gcgttgacgt tgcc 24

<210>20

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

ggtcagcttg gtggagactt tggagccgcc 30

<210>21

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ggcggctcca aagtctccac caagctgacc 30

<210>22

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

ccgctcgagg gcagaggcat cgcc 24

<210>23

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

cgcggatcca tgtccaaaat cgtt 24

<210>24

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

ccgctcgaga gcaccgaact tgga 24

<210>25

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

cgcggatccg tggatttcgc gacc 24

<210>26

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

ccgctcgagc atcacacaga acag 24

<210>27

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

atgtctgtaa ttaagatgac cg 22

<210>28

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

gtccaggtaa tctttggcc 19

<210>29

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

ggcgttgacg ttgccc 16

<210>30

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

gactttggag ccgccg 16

<210>31

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

tccaccaagc tgaccgttc 19

<210>32

<211>14

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

ggcagaggca tcgc 14

<210>33

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

gagcagctgg ccgctatc 18

<210>34

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

ttactgcttg gcgcgctc 18

<210>35

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

atgagacagg tatatcttat tcgtcacggc 30

<210>36

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

gctggcgatc acgtggg 17

<210>37

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

gatctggggc gcactcag 18

<210>38

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

cagcatgctc aggcgcc 17

<210>39

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

gatggttcgc cgcaggg 17

<210>40

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

cagcaccgtg gagagcag 18

<210>41

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

ggactgccgc cgtacgct 18

<210>42

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

ctaacgtaac acttcatcca tc 22

<210>43

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

atgtccaaaa tcgttaaagt catc 24

<210>44

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

agcaccgaac ttggatttg 19

<210>45

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

aacgccattc tggcgg 16

<210>46

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

caggttcggc gcgtag 16

<210>47

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

gagtccaacg cggctg 16

<210>48

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

gttggtcacg aacaggtcg 19

<210>49

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

accaagatcc tgaaagaagg catc 24

<210>50

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

ttaatgctgg cctttcactt ctttc 25

<210>51

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

atgagccgtt ttgcgttgg 19

<210>52

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

cgcccagctg tgattggtc 19

<210>53

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

ttttccatca gcgcgatgca g 21

<210>54

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

atgtcccccc tcacccg 17

<210>55

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

gtggatttcg cgaccggtag c 21

<210>56

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

catcacacag aacagcgaca gcg 23

<210>57

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

atggggcgct ttggtgg 17

<210>58

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>58

ttaaagacga gtgcccagct gc 22

Claims (12)

1. A broad-spectrum combined vaccine of housekeeping enzymes in glycolysis pathway of aquatic pathogenic bacteria is characterized in that the vaccine is a recombinant protein formed by connecting key epitopes of at least two housekeeping enzymes from glycolysis pathway.

2. The vaccine of claim 1, wherein the glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO, HK, and the PG is a broad-spectrum combination of the housekeeping enzymes in the glycolytic pathway of aquatic pathogensThe key epitopes of M, PGK, ENO and HK are PGM respectively₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

3. The broad-spectrum combination vaccine of housekeeping enzymes in glycolytic pathway of aquatic pathogens according to claim 1, characterized in that it is a recombinant protein formed by connecting key epitopes of PGM and PGK of the housekeeping enzymes derived from glycolytic pathway as an antigen component;

the key epitopes of PGM and PGK are PGM respectively₁、PGK₂And PGK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with 195 th and 291 th amino acids corresponding to protein PGK, the amino acid sequences of the proteins PGK and PGM are respectively shown as SEQ ID No. 1 and SEQ ID No. 2, and the corresponding coding gene sequences are respectively shown as SEQ ID No. 5 and SEQ ID No. 6.

4. The combination broad-spectrum vaccine of housekeeping enzymes in the glycolytic pathway of aquatic pathogens according to any one of claims 1 to 3, wherein the aquatic pathogens comprise Vibrio anguillarum, Vibrio harveyi, Vibrio alginolyticus, Aeromonas hydrophila, Pseudomonas, Edwardsiella, Aeromonas salmonicida, Photobacterium mermairei, Yersinia ruckeri.

5. Use of a broad spectrum combination vaccine of housekeeping enzymes in the glycolytic pathway of aquatic pathogens according to any one of claims 1 to 3 for the control of bacterial diseases in aquaculture.

6. A recombinant protein characterized by being obtained by linking together the key epitopes of at least two glycolytic pathway-derived housekeeping enzymes PGM, PGK, ENO and HK, wherein the key epitopes of PGM, PGK, ENO and HK are PGM₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

7. A recombinant vector comprising an expression vector having a nucleotide sequence encoding the recombinant protein of claim 5.

8. A host cell comprising the recombinant vector of claim 7.

9. A bacteriostatic composition is characterized by comprising at least one of a recombinant protein formed by connecting key epitopes of at least two glycolytic pathway-derived housekeeping enzymes, an expression vector containing the recombinant protein and a host cell containing the recombinant protein; wherein the content of the first and second substances,

the glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO, HK, the PGM, ENO, HK,The key epitopes of PGK, ENO and HK are PGM respectively₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

10. A bacteriostatic agent is characterized in that the main active component of the bacteriostatic agent is at least one of recombinant protein formed by connecting key epitopes of at least two glycolytic pathway-derived housekeeping enzymes, an expression vector containing the recombinant protein and a host cell containing the recombinant protein; wherein the content of the first and second substances,

the glycolytic pathway-derived housekeeping enzymes are PGM, PGK, ENO and HK, and the key epitopes of the PGM, the PGK, the ENO and the HK are respectively PGM₁、PGK₂And PGK₃、ENO₁And HK₃The PGM₁Is a polypeptide fragment having amino acids 1 to 54 corresponding to protein PGM, said PGK₂Is a polypeptide fragment with amino acids 98-194 of the protein PGK₃Is a polypeptide fragment with amino acid 195-291 corresponding to protein PGK, the ENO₁Is a polypeptide fragment with the 1 st to 108 th amino acids corresponding to the ENO protein, and the HK₃Is a polypeptide fragment with the amino acid positions 161-240 corresponding to the protein HK, and the amino acid sequences of the proteins PGK, PGM, ENO and HK are respectively shown as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

11. The bacteriostatic agent according to claim 10, wherein the bacteriostatic spectrum of the bacteriostatic agent is as follows: vibrio anguillarum, Vibrio harveyi, Vibrio alginolyticus, Aeromonas hydrophila, Pseudomonas and Edwardsiella.

12. Use of a broad spectrum combination vaccine of housekeeping enzymes in the glycolytic pathway of aquatic pathogens according to any one of claims 1 to 3 for the preparation of a feed additive, feed or bait.

Images