CA2932626A1 - Means for lung specific delivery - Google Patents

Means for lung specific delivery Download PDF

Info

Publication number
CA2932626A1
CA2932626A1 CA2932626A CA2932626A CA2932626A1 CA 2932626 A1 CA2932626 A1 CA 2932626A1 CA 2932626 A CA2932626 A CA 2932626A CA 2932626 A CA2932626 A CA 2932626A CA 2932626 A1 CA2932626 A1 CA 2932626A1
Authority
CA
Canada
Prior art keywords
composition
lipid
pegylated
cell
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA2932626A
Other languages
French (fr)
Inventor
Oliver Keil
Jorg Kaufmann
Volker Fehring
Ute SCHAEPER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Silence Therapeutics AG
Original Assignee
Silence Therapeutics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Silence Therapeutics AG filed Critical Silence Therapeutics AG
Publication of CA2932626A1 publication Critical patent/CA2932626A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26—Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/007—Pulmonary tract; Aromatherapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Dispersion Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pulmonology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention is related to composition comprising a lipid composition, wherein the lipid composition consists of a cationic lipid of formula (I) wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, Y' is an anion, wherein each of Rl and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl; a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II) wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and p is any integer from 15 to 130; a PEGylated ceramide of formula (III) wherein R5 is linear C7-C15 alkyl, and q is any integer from 15 to 130; and a PEGylated diacylglycerol of formula (IV) wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and r is any integer from 15 to 130.

Description

Means for lung specific delivery The present invention is related to a composition comprising a lipid composition; the composition comprising a lipid composition for use in a method for the treatment of a disease;
use of the composition comprising a lipid composition for the manufacture of a medicament for the treatment and/or prevention of a disease; a pharmaceutical composition comprising composition comprising a lipid composition; use of the composition comprising a lipid composition as a transferring agent; a kit comprising the composition comprising a lipid composition; a method for transferring a biologically active compound or a pharmaceutically active compound into a cell or across a membrane of a cell, wherein the method comprises contacting the cell or the membrane of a cell with the composition comprising a lipid composition; a method for the treatment and/or prevention of a disease, wherein the method comprises administering to a subject in need thereof an effective amount of the composition comprising a lipid composition.
Both molecular biology as well as molecular medicine heavily rely on the introduction of biologically active compounds into cells. Such biologically active compounds typically comprise, among others, DNA, RNA as well as peptides and proteins, respectively. The barrier which has to be overcome is typically a lipid bilayer which has a negatively charged outer surface. In the art, a number of technologies have been developed to penetrate the cellular membrane and to thus introduce the biologically active compounds.
Some methods conceived for laboratory use, however, cannot be used in the medical field and are more particularly not suitable for drug delivery. For example, electroporation and ballistic methods known in the art, would, if at all, only allow a local delivery of biologically active compounds.
Apart from said lipid bilayer cellular membranes also comprise transporter systems.
Accordingly, efforts were undertaken to use this kind of transporter systems in order to transfer the biologically active compounds across the cell membrane. However, due to the
2 specificity or cross-reactivity of such transporter systems, their use is not a generally applicable method.
A more generally applicable approach described in the art for transferring biologically active compounds into cells, is the use of viral vectors. However, viral vectors can be used only for transferring genes efficiently into some cell types; but they cannot be used to introduce chemically synthesised molecules into the cells.
An alternative approach was the use of so called liposomes (Bangham, J. Mol.
Biol. 13, 238-252). Liposomes are vesicles which are generated upon association of amphiphilic lipids in water. Liposomes typically comprise concentrically arranged bilayers of phospholipids.
Depending on the number of layers liposomes can be categorised as small unilamelar vesicles, multilamelar vesicles and large multilamelar vesicles. Liposomes have proven to be effective delivery agents as they allow incorporating hydrophilic compounds into the aqueous intermediate layers, whereas hydrophobic compounds are incorporated into the lipid layers. It is well known in the art that both the composition of the lipid formulation as well as its method of preparation have an effect on the structure and size of the resultant lipid aggregates and thus on the liposomes. Liposomes are also known to incorporate cationic lipids.
Cationic lipids have, apart from being components of liposomes, also attracted considerable attention as they may as such be used for cellular delivery of biopolyrners.
Using cationic lipids any anionic compound can be encapsulated essentially in a quantitative manner due to electrostatic interaction. In addition, it is believed that the cationic lipids interact with the negatively charged cell membranes initiating cellular membrane transport. It has been found that the use of a liposomal formulation containing cationic lipids or the use of cationic lipids as such together with a biologically active compound requires a heuristic approach as each formulation is of limited use because it typically can deliver plasmids into some but not all cell types, usually in the absence of serum.
Charge and/or mass ratios of lipids and the biologically active compounds to be transported by them have turned out to be a crucial factor in the delivery of different types of said
3 biologically active compounds. For example, it has been shown that lipid formulations suitable for plasmid delivery comprising 5,000 to 10,000 bases in size, are generally not effective for the delivery of oligonucleotides such as siRNA molecules, synthetic ribozymes or antisense molecules typically comprising about 10 to about 50 bases. In addition, it has recently been indicated that optimal delivery conditions for antisense oligonucleotides and ribozymes are different, even in the same cell type.
US patent 6,395,713 discloses cationic lipid based compositions whereby the cationic lipid consist of a lipophilic group, a linker and a head group and the use of such compositions for transferring biologically active compounds into a cell.
International patent application WO 2005/105152 discloses another cationic lipid based composition which proved to be particularly effective in the delivery of functional nucleic acid molecule such as siRNA molecules.
Depending on the disease to be treated and the drug to be delivered, there is a need for delivering the drug to specific organs or specific cell types. One such specific organ is lung and one such specific cell type is pulmonary endothelial cell. The targeting of lung and pulmonary endothelial cell is, for example, advantageous in the delivery of a drug for the treatment of a disease such as acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
A problem underlying the present invention is the provision of a means which is capable of delivering an agent, preferably a therapeutically active agent, more preferably a drug, to lung.
A further problem underlying the present invention is the provision of a means which is capable of delivering an agent, preferably a therapeutically active agent, more preferably a drug, to lung tissue. A still further problem underlying the present invention is the provision of a means which is capable of delivering an agent, preferably a therapeutically active agent, more preferably a drug, to a pulmonary endothelial cell.
4 Another problem underlying the present invention is the provision of a means for the treatment of a lung disease, preferably a lung disease which is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
Another problem underlying the present invention is the provision of a delivery vehicle as part of a means for the treatment of a lung disease, preferably a lung disease which is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
Another problem underlying the present invention is the provision of a pharmaceutical composition. Preferable, the pharmaceutical is suitable for the delivery of an agent, preferably a therapeutically active agent, more preferably a drug, to lung. A further problem underlying the present invention is the provision of a pharmaceutical composition suitable for the delivery of an agent, preferably a therapeutically active agent, more preferably a drug, to lung tissue. A still further problem underlying the present invention is the provision of a pharmaceutical composition suitable for the delivery of an agent, preferably a therapeutically active agent, more preferably a drug, to a pulmonary endothelial cell.
Another problem underlying the present invention is the provision of a means which can be used in the manufacture of a medicament, whereby the medicament is suitable for or is for use in the treatment of lung disease, preferably a lung disease which is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
Another problem underlying the present invention is the provision of a method and/or prevention for the treatment of a disease, wherein the method comprises administering to a subject in need thereof an effective amount a composition comprising a therapeutically or pharmaceutically active agent, preferably a drug. A further problem underlying the present invention is the provision of a method for the treatment and/or prevention of a lung disease, wherein the method comprises administering to a subject in need thereof an effective amount a composition comprising a therapeutically or pharmaceutically active agent, preferably a drug. A still further problem underlying the present invention is the provision of a method for the treatment and/or prevention of a disease, preferably a lung disease, whereby the treatment comprises delivering a therapeutically or pharmaceutically active agent to the lung, preferably to a pulmonary endothelial cell.
Another problem underlying the present invention is the provision of a transferring agent.
Preferably the transferring agent is capable of transferring a biologically active agent, a therapeutically active agent and/or or pharmaceutically active agent into a cell or across a membrane of a cell, whereby preferably such cell is a pulmonary endothelial cell.
Another problem underlying the present invention is the provision of a method for transferring a biologically active, a therapeutically active agent and/or a pharmaceutically active agent into a cell or across a membrane of a cell, whereby preferably such cell is a pulmonary endothelial cell.
Another problem underlying the present invention is the provision of a kit.
Preferably, the kit is suitable (a) for use in a method for the treatment and/or prevention of a disease, preferably a lung disease, (b) for use in a method of transferring a biologically active agent, a therapeutically active agent and/or or pharmaceutically active agent into a cell or across a membrane of a cell, whereby preferably such cell is a pulmonary endothelial cell, and/or (c) for use in the manufacture of a medicament, preferably a medicament for the treatment and/or prevention of a disease, more preferably a lung disease and most preferably a lung disease selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary= hypertension and pulmonary artery hypertension.
These and other problems are solved by the subject matter of the attached dependent claims.
Preferred embodiments may be taken from the attached dependent claims. These and other problems are also solved by the following embodiments.

Embodiment 1: A composition comprising a lipid composition, wherein the lipid composition consists of a cationic lipid of formula (I) Ri NH NH

I 2 - n m wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, Y" is an anion, wherein each of R1 and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl;
a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II) I _ (II) wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and p is any integer from 15 to 130;
a PEGylated ceramide of formula (III) = q (III) wherein R5 is linear C7-C15 alkyl, and q is any integer from 15 to 130;
and a PEGylated diacylglycerol of formula (IV) R600-> 1 (IV) wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and r is any integer from 15 to 130.

Embodiment 2: The composition of embodiment 1, wherein R1 and R2 are different from each other.
Embodiment 3: The composition of embodiment 1, wherein R1 and R2 are the same.
Embodiment 4: The composition of any one of embodiments 1 to 3, wherein each of R1 and R2 is individually and independently selected from the group consisting of C12 alkyl, C14 alkyl, C16 alkyl, C18 alkyl, C12 alkenyl, C14 alkenyl, C16 alkenyl and C18 alkenyl.
Embodiment 5: The composition of embodiment 4, wherein each of C12 alkenyl, C14 alkenyl, C16 alkenyl and C18 alkenyl comprises one or two double bonds.
Embodiment 6: The composition of embodiment 5, wherein C18 alkenyl is C18 alkenyl with one double bond between C9 and C10, preferably cis-9-octadecyl].
Embodiment 7: The composition of any one of embodiments 1 to 6, wherein R1 and R2 are different and R1 is palmityl and R2 is oleyl.
Embodiment 8: The composition of any one of embodiments 1 to 6, wherein R1 and R2 are different and wherein R1 is lauryl and R2 is myristyl.
Embodiment 9: The composition of any one of embodiments 1 to 8, wherein the cationic lipid is a compound of formula (Ia) + -1\1NHWNNH2 Y-(Ia) Embodiment 10: The composition of any one of embodiments 1 to 9, wherein Y-is selected from the group comprising halogenids, acetate and trifluoroacetate.

Embodiment 11: The composition of embodiment 10, wherein Y" is CF.
Embodiment 12: The composition of any one of embodiments 1 to 11, wherein the cationic lipid is 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride of formula (lb):

CI- CI
(Ib) Embodiment 13: The composition of any one of embodiments 1 to 11, wherein the cationic lipid is 13-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride of formula (Ic):

CI

CI- CI- (IC) Embodiment 14: The composition of any one of embodiments 1 to 11 wherein the cationic lipid is c-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride of formula (Id):
CI

N N H. N H2 CI ci -(Id) Embodiment 15: The composition of any one of embodiments 1 to 14, wherein the sterol compound is cholesterol.

Embodiment 16:
The composition of any one of embodiments 12 to 14, preferably embodiment 14, wherein the sterol compound is cholesterol.
Embodiment 17:
The compound of any one of embodiments 1 to 14, wherein the sterol compound is stigmasterin.
Embodiment 18:
The composition of any one of embodiments 12 to 14, preferably embodiment 14, wherein the sterol compound is stigmasterin.
Embodiment 19:
The composition of any one of embodiments 1 to 18, preferably any one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEG moiety of the PEGylated lipid has a molecular weight from about 800 to about 5000 Da.
Embodiment 20:
The composition of embodiment 19, wherein the molecular weight of the PEG moiety of the PEGylated lipid is about 800 Da.
Embodiment 21:
The composition of embodiment 19, wherein the molecular weight of the PEG moiety of the PEGylated lipid is about 2000 Da.
Embodiment 22:
The composition of embodiment 19, wherein the molecular weight of the PEG moiety of the PEGylated lipid is about 5000 Da.
Embodiment 23:
The composition of any one of embodiments 1 to 22, preferably any one of embodiments 19 to 22, wherein the PEGylated lipid is a PEGylated phosphoethanolamine of formula (II), wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and p is any integer from 18,19 or 20, or from 44,45 or 46 or from 113, 114 or 115.
Embodiment 24: The composition of embodiment 23, wherein R3 and R4 are the same.

Embodiment 25: The composition of embodiment 23, wherein R3 and R4 are different.
Embodiment 26: The composition of any one of embodiments 23 and 25, wherein each of R3 and R4 is individually and independently selected from the group consisting of C13 alkyl, C15 alkyl and C17 alkyl.
Embodiment 27: The composition of any one of embodiments 1 to 26, preferably one of embodiments 12 to 14, more preferably any one of embodiments 14 and 16, wherein the PEGylated phosphoethanolamine of formula (II) is (Ha) Embodiment 28: The composition of any one of embodiments 1 to 26, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated phosphoethanolamine of formula (II) is =
I _ 113 (Ilb) Embodiment 29: The composition of any one of embodiments 1 to 22, preferably any one of embodiments 19 to 22, wherein the PEGylated lipid is a PEGylated ceramide of formula (III), wherein R5 is linear C7-C15 alkyl, and q is any integer from 18, 19 or 20, or from 44,45 or 46 or from 113, 114 or 115.

Embodiment 30: The composition of embodiment 29, wherein R5 is linear C7 alkyl.
Embodiment 31: The composition of embodiment 30, wherein R5 is linear C15 alkyl.
Embodiment 32: The composition of any one of embodiments 1 to 22 and 29 to 31, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated ceramide of formula (III) is o (Ma) Embodiment 33: The composition of any one of embodiments 1 to 22 and 29 to 31, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated ceramide of formula (III) is NH

(Mb) Embodiment 34: The composition of any one of embodiments 1 to 22, preferably any one of embodiments 19 to 22, wherein the PEGylated lipid is a PEGylated diacylglycerol of formula (IV) 0 (IV), wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and r is any integer from 18, 19 or 20, or from 44,45 or 46 or from 113, 114 or 115.
Embodiment 35: The composition of embodiment 34, wherein R6 and R7 are the same.
Embodiment 36: The composition of embodiment 34, wherein R6 and R7 are different.
Embodiment 37: The composition of any one of embodiments 34 to 36, wherein each of R6 and R7 is individually and independently selected from the group consisting of linear C17 alkyl, linear C15 alkyl and linear C13 alkyl.
Embodiment 38: The composition of any one of embodiments 1 to 22 and 34 to 37, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is (IVa).
Embodiment 39: The composition of any one of embodiments 1 to 22 and 34 to 36, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is (IVb).
Embodiment 40: The composition of any one of embodiments 1 to 22 and 34 to 36, preferably one of embodiments 12 to 14, more preferably any one of embodiments 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is =

(IVc).
Embodiment 41: The composition of any one of embodiments 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of 13-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ NNI-rWNHNH2 CI- CI
13-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride + _ NNI-rWNHN H2 CI C
and c-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride CI

CI_ wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated phosphoethanolamine of formula (II), wherein the PEGylated phosphoethanolamine is selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N4methoxy(polyethylene glycol)-2000]
(ammonium salt) 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000]
(ammonium salt) NHO

Embodiment 42: The composition of any one of embodiments 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ CI CI _ 3-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride + _ CI CI
and E-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride CI

CI CI_ wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated ceramide of formula (III), wherein the PEGylated ceramide is selected from the group consisting of N-octanoyl-sphingosine-1- {succinyl[methoxy(polyethylene glycol)2000]}

o and N-palmitoyl-sphingosine-1- {succinyl[methoxy(polyethylene glycol)2000] }

Embodiment 43: The composition of any one of embodiments 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ 13-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride _ NH3 NHCl Cl and c-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride Cl Cl Ci -wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated diacylglycerol of formula (IV), wherein the PEGylated diacylglycerol is selected from the group consisting of 1,2-Distearoyl-sn-glycerol [methoxy(polyethylene glycol)2000]

00c01 1,2-Dipalmitoyl-sn-glycerol [methoxy(polyethylene glycol)2000]

0 ]`

Embodiment 44: The composition of any one of embodiments 1 to 43, preferably of any one of embodiments 41 to 43, wherein the cationic lipid is f3-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ CI- CI
the sterol compound is cholesterol, and the PEGylated lipid is PEGylated phosphoethanolamine of formula (II) is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt) Embodiment 45: The composition of any of embodiments 1 to 44, preferably any of embodiments 41 to 44 and more preferably embodiment 44, wherein, in the lipid composition, the content of the cationic lipid composition is from about 65 mole % to about 75 mole %, the content of the sterol compound is from about 24 mole % to about 34 mole % and the content of the PEGylated lipid is from about 0.5 mole % to about 1.5 mole %, wherein the sum of the content of the cationic lipid, of the sterol compound and of the PEGylated lipid for the lipid composition is 100 mole %.
Embodiment 46:
The composition of embodiment 45, wherein, in the lipid composition, the content of the cationic lipid is about 70 mole %, the content of the sterol compound is about 29 mole % and the content of the PEGylated lipid is about 1 mole %.
Embodiment 47:
A composition of any of the preceding embodiments, wherein the lipid composition is as follows:
70 mole % ofP-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ 29 mole % of cholesterol, and 1 mole % of 1,2-distearoyl-sn-glycero-3 -pho sphoethanolamine-N- [methoxy(polyethylene glycol)-2000]
(ammonium salt) Embodiment 48: The composition of any one of embodiments 1 to 47, wherein the composition comprises a carrier, preferably the carrier is a pharmaceutically acceptable carrier.
Embodiment 49: The composition of embodiment 48, wherein the carrier is selected from the group comprising water, an aqueous solution, preferably an isotonic aqueous solution, a salt solution, preferably an isotonic salt solution, a buffer, preferably an isotonic buffer, and a water miscible solvent.
Embodiment 50: The composition of embodiment 49, wherein the carrier is a water miscible solvent and wherein the water miscible solvent is selected from the group consisting of ethanol and tertiary butanol Embodiment 51: The composition of any one of embodiments 48 to 50, wherein the carrier is an aqueous sucrose solution, preferably a 270 mM aqueous sucrose solution.
Embodiment 52: The composition according to any one of the preceding embodiments, wherein the lipid composition is as follows:
70 mole % of [3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ NNHjWNH NH2 29 mole % of cholesterol, and 1 mole % of PEGylated phosphoethanolamine of formula (II) is;

1,2-di stearoyl-sn-glycero-3 -pho sphoethanolamine-N- [methoxy(polyethylene glycol)-2000]
(ammonium salt) and wherein the composition comprises a 270 mM aqueous sucrose solution.
Embodiment 53:
The composition according to any one of embodiments 48 to 52, wherein the lipid composition forms particles in the carrier.
Embodiment 54:
The composition of embodiment 53, wherein the particles have a Z-average size according to DLS measurement of about 30 nm to about 150 nm.
Embodiment 55:
The composition of embodiment 54, wherein the particles have a Z-average size according to DLS measurement of about 50 nm to about 100 nm.
Embodiment 56:
The composition of any one of embodiments 53 to 55, wherein the Z-average size according to DLS measurement of the particles is about 60 - 80 nm as determined by dynamic light scattering.
Embodiment 57:
The composition of any one of embodiments 1 to 56, preferably any one of embodiments 48 to 56, wherein the composition, determined at a temperature of 20 C and in a 270 mM sucrose solution, has a zeta potential of about + 25 to about + 80 mV, preferably of about + 30 mV to about + 60 mV, more preferably of about +46 mV.
Embodiment 58:
The composition of any one of embodiments 1 to 57, preferably any one of embodiments 41 to 57 and more preferably any one of embodiments 47 and 52, wherein the composition further comprises a chemical compound, wherein the chemical compound is a biologically active agent or a pharmaceutically active agent.
Embodiment 59: The composition of any one of embodiments 1 to 57, preferably any one of embodiments 41 to 57 and more preferably any one of embodiments 47 and 52, wherein the composition further comprises a chemical compound, wherein the chemical compound is capable of being delivered by the lipid composition into and/or to a cell.
Embodiment 60: The composition of embodiment 59, wherein the cell is a cell of a mammal, preferably the mammal is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse.
Embodiment 61: The composition of any one of embodiments 59 to 60, wherein the cell is a pulmonary endothelial cell, preferably the cell is a human pulmonary endothelial cell.
Embodiment 62: The composition of any one of embodiments 58 to 61, wherein the chemical compound is selected from the group comprising an oligonucleotide, a polynucleotide, a nucleic acid, a peptide, a polypeptide, a protein and a small molecule.
Embodiment 63: The composition of embodiment 62, wherein the chemical compound is a nucleic acid and wherein the nucleic acid is selected from the group comprising RNA, DNA, PNA and LNA.
Embodiment 64: The composition of embodiment 62, wherein the nucleic acid is a functional nucleic acid, preferably the functional nucleic acid is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer a spiegelmer and mRNA.
Embodiment 65: The composition of embodiment 62, wherein the polynucleotide is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA
interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer, a spiegelmer and mRNA.
Embodiment 66: The composition of embodiment 62, wherein the oligonucleotide is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA
interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer and a spiegelmer.
Embodiment 67: The composition of any one of embodiments 62 and 66, wherein the oligonucleotide forms a complex with the lipid composition.
Embodiment 68: The composition of any one of embodiments 1 to 67, preferably of any one of embodiments 41 to 47 and 53 to 56, wherein the composition comprises an siRNA
molecule.
Embodiment 69: The composition of embodiment 68, wherein the siRNA molecule is targeting ANG2.
Embodiment 70: The composition of embodiment 70, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.
Embodiment 71: The composition of embodiment 70, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.
Embodiment 72: The composition of embodiment 62, wherein the chemical compound is a protein and wherein the protein is selected from the group comprising an antibody, a cytokine and an anticaline.
Embodiment 73: The composition of any one of the preceding embodiments, wherein the lipid composition is as follows:
70 mole % of 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride -N NHWNI-rNH2 29 mole % of cholesterol, and 1 mole % of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-knethoxy(polyethylene glycol)-2000]
(ammonium salt) wherein the composition comprises, preferably as a or the carrier, a 270 mM
aqueous sucrose solution.; and wherein the composition comprises a chemical compound, wherein the chemical compound is selected from the group comprising an siRNA, microRNA, siNA and a RNA
interference mediating compound, preferably the chemical compound is (a) a or the biologically or pharmaceutically active agent and/or (b) is capable of being delivered by the lipid composition into and/or to a cell, more preferably to a mammalian pulmonary endothelial cell.
Embodiment 74: The composition according to any one of embodiments 1 to 73, preferably any one of embodiments 58 to 73 and more preferably embodiment 73, wherein the chemical compound is a functional nucleic acid and wherein the ratio between the charged lipid nitrogen atoms to the nucleic acid backbone phosphates (N/P ratio) is about from 3 to 12, preferably about from 5 to 10 and more preferably about from 8 to 9 and most preferably about 8.4 Embodiment 75: The composition of any one of embodiments 73 and 74, wherein the composition comprises an siRNA molecule.
Embodiment 76: The composition of embodiment 75, wherein the siRNA molecule is targeting ANG2.
Embodiment 77: The composition of embodiment 76, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.
Embodiment 78: The composition of embodiment 77, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.
Embodiment 79: The composition of any one of embodiments 73 to 78, preferably of embodiment 78, wherein the composition comprises 0.28 mg/ml of siRNA and 2.4 mg/ml total lipids.
Embodiment 80: The composition of any one of the preceding embodiments, wherein the lipid composition is as follows:
70 mole % of 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride _ NNHThNH NH2 CI CI
29 mole % of cholesterol, and 1 mole % of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt) o wherein the composition comprises, preferably as a or the carrier, a 270 mM
aqueous sucrose solution;

=
wherein the composition comprises a chemical compound, wherein the chemical compound is selected from the group comprising an siRNA, microRNA and siNA, preferably the chemical compound is (a) a or the biologically or pharmaceutically active agent and/or (b) is capable of being delivered by the lipid composition into and/or to a cell, more preferably to a mammalian pulmonary endothelial cell; and wherein the ratio between the charged lipid nitrogen atoms to the nucleic acid backbone phosphates (N/P ratio) is about 8 to 9, preferably about 8.4.
Embodiment 81: The composition of embodiment 80, wherein the composition comprises an siRNA molecule.
Embodiment 82: The composition of embodiment 81, wherein the siRNA molecule is targeting ANG2.
Embodiment 83: The composition of embodiment 82, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
S'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.
Embodiment 84: The composition of embodiment 83, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
'AgUuGgAaGgAcCaCaUgC (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-0-methyl.

Embodiment 85: The composition of any one of embodiments 80 to 84, preferably of embodiment 84, wherein the composition comprises 0.28 mg/ml of siRNA and 2.4 mg/ml total lipids.
Embodiment 86: The composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85, for use in a method for the treatment and/or prevention of a disease of a subject.
Embodiment 87: The composition of embodiment 86, wherein the method comprises administering to a subject in need thereof an effective amount of the composition, preferably a therapeutically effective amount of the composition.
Embodiment 88: The composition of any one of embodiments 86 to 87, wherein the composition delivers the chemical compound into a cell of the subject.
Embodiment 89: The composition of embodiment 88, wherein the cell is a pulmonary endothelial cell.
Embodiment 90: The composition of embodiment 89, wherein the chemical compound provides for a therapeutic effect in the pulmonary endothelial cell, preferably the chemical compound targets and more preferably inhibits a target molecule within the cell, whereupon the therapeutic effect is achieved.
Embodiment 91: The composition of embodiment 90, wherein the target molecule is involved in the pathological mechanism underlying the disease.
Embodiment 92: The composition of any one of embodiments 86 to 91, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.

Embodiment 93: The composition of any one of embodiments 86 to 92, wherein the subject is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse.
Embodiment 94: The composition of any one of embodiments 86 to 93, wherein the composition is administered to the subject by means of intravenous administration or by means of inhalation.
Embodiment 95: Use of the composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85, for the manufacture of a medicament for the treatment and/or prevention of a disease.
Embodiment 96: Use of embodiment 95, wherein the disease is a disease where a target molecule involved in the pathological mechanism underlying the disease is present in a pulmonary endothelial cell and the inhibition of the target molecule provides a therapeutic effect.
Embodiment 97: Use of any one of embodiments 95 to 96, wherein the chemical compound of the composition targets and more preferably inhibits the target molecule within the cell, whereupon the therapeutic effect is achieved.
Embodiment 98: Use of any one of embodiments 95 to 97, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
Embodiment 99: Use of any one of embodiments 95 to 98, wherein the medicament is for intravenous administration.

Embodiment 100: A pharmaceutical composition comprising a composition of any one of embodiments 1 to 85, preferably a composition of any one of embodiments 58 to 85 and more preferably of embodiments 73 to 85, and a pharmaceutically acceptable carrier.
Embodiment 101: The pharmaceutical composition of embodiment 100, wherein the chemical composition of the composition of any one of embodiments 1 to 85, preferably a composition of any one of embodiments 58 to 850 and more preferably of embodiments 73 and 85, is a or the pharmaceutically active agent.
Embodiment 102: The pharmaceutical composition of any one of embodiments 100 to 101, wherein the carrier of the composition of any one of embodiments 1 to 85, preferably a composition of any one of embodiments 57 to 85 and more preferably of embodiments 73 to 85, is a or the pharmaceutically acceptable carrier.
Embodiment 103: The pharmaceutical composition of any one of embodiments 100 to 102, wherein the pharmaceutical composition is for use in the treatment and/or prevention of a disease, whereby the disease is defined as in any of embodiments 95 to 99.
Embodiment 104: Use of the composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85, as a transferring agent.
Embodiment 105: Use of embodiment 104, wherein the transferring agent transfers a biologically active or pharmaceutically active compound into a cell, preferably a mammalian cell and more preferably a human cell.
Embodiment 106: Use of embodiment 105, wherein the cell is a pulmonary endothelial cell, preferably a human pulmonary endothelial cell.

Embodiment 107: Use of any of embodiments 104 to 106, wherein the chemical compound of the chemical composition is the biologically active agent or the pharmaceutically active agent.
Embodiment 108: A kit comprising a composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85, and instructions of use.
Embodiment 109: A method for transferring a biologically active compound or a pharmaceutically active compound into a cell or across a membrane of a cell, wherein the method comprises the step of contacting the cell or the membrane of a cell with a composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85, and the biologically active compound or = pharmaceutically active compound.
Embodiment 110: The method of embodiment 109, wherein the method comprises the step of detecting the biologically active compound or the pharmaceutically active compound in the cell and/or beyond the membrane of a cell.
Embodiment 111: The method of any one of embodiments 109 to 110, wherein the biologically active compound or the pharmaceutically active compound is the chemical = compound of the composition of any one of embodiments 58 to 85.
Embodiment 112: A method for the treatment and/or prevention of a disease, wherein the method comprises administering to a subject in need thereof an effective amount of a composition of any one of embodiments 1 to 85, preferably of any one of embodiments 58 to 85 and more preferably of any one of embodiments 73 to 85.
Embodiment 113: The method of embodiment 112, wherein the composition delivers the chemical compound into a cell of the subject.

Embodiment 114: The method of embodiment 113, wherein the cell is a pulmonary endothelial cell.
Embodiment 115: The method of embodiment 114, wherein the chemical compound provides for a therapeutic effect in the pulmonary endothelial cell, preferably the chemical compound targets and more preferably inhibits a target molecule within the cell, whereupon the therapeutic effect is achieved.
Embodiment 116: The method of embodiment 115, wherein the target molecule is involved in the pathological mechanism underlying the disease.
Embodiment 117: The method of any one of embodiments 112 to 116, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
Embodiment 118: The method of any one of embodiments 112 to 117, wherein the subject is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse, preferably the subject is man.
Embodiment 119: A method for the manufacture of a medicament, wherein the method comprises formulating a composition according to any one of embodiments 1 to 85 with a pharmaceutically active agent.
Embodiment 120: The method of embodiment 119, wherein the medicament is for the treatment and/or prevention of a disease as described in any of the preceding embodiments.
Embodiment 121: The method of any one of embodiments 119 to 120, wherein the pharmaceutically active agent is a compound suitable for the treatment of a lung disease.

Embodiment 122: The composition according to any one of embodiments 1 to 68, wherein the siRNA is targeting a target as indicated in Table 1. In a preferred embodiment the target is PKN3, whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 3 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 4, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified;
is CD31, whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 11 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 12, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified;
is Tie2 whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 9 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 10, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified;
is KDR/VEGFR2, whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 13 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 14, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified;
is CDH5NE-Cadherin, whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 15 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 16, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified; or is BMPR2, whereby more preferably the siRNA comprises a nucleic acid strand having a nucleotide sequence of SEQ ID NO: 17 and/or nucleic acid strand having a nucleotide sequence of SEQ ID NO: 18, whereby the nucleotides of the nucleic acid strands are modified as indicated in Table 1, or are not or differently modified;
It is within the present invention that in each and any embodiment of each and any aspect of the invention where the cationic lipid is 13-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide, said 3-arginy1-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide is preferably 13-L-arginy1-2,3-L-diamino propionic acid-N-palmityl-N-oleyl-amide.
It is within the present invention that in each and any embodiment of each and any aspect of the invention where the cationic lipid is 13-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide, said 3-arginy1-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide is preferably 3-L-arginy1-2,3-L-diamino propionic acid-N-lauryl-N-myristyl-amide.
It is within the present invention that in each and any embodiment of each and any aspect of the invention where the cationic lipid is E-arginyl-lysine-N-lauryl-N-myristyl-amide, said E-arginyl-lysine-N-lauryl-N-myristyl-amide is preferably E-L-arginyl-L-lysine-N-lauryl-N-myristyl-amide.
The present inventors have surprisingly found that a composition comprising a lipid composition, wherein the lipid composition consists of a cationic lipid of formula (I) NH NH

I 2 m 'R NH3 NH3 NH2 (I) wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, wherein Y- is an anion, and wherein each of R1 and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl;
a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II) R3\ 0 _ (II) wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and wherein p is any integer from 15 to 130;
a PEGylated ceramide of formula (III) (DC)OT
-(III) wherein R5 is linear C7-C15 alkyl, and wherein q is any integer from 15 to 130;

and a PEGylated diacylglycerol of formula (IV) (IV) wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and wherein r is any integer from 15 to 130, is suitable to accumulate in and address lung and lung tissue of a host organism, such as a mammal, and thus to deliver an agent associated with such lipid composition such as a nucleic acid to such organ and tissue, and more specifically to pulmonary endothelial cells of such host organism. Preferably such nucleic acid is an oligonucleotide or a polynucleotide such as an siRNA, but is not limited thereto.
This finding is insofar surprising as it contrasts typical systemic behavior of cationic lipid nano-complexes, which generally show prevalent gene knockdown in liver tissue with only transient accumulation of siRNA in the lung (Polach, KJ et al. (2012), Mol Ther 20: 91-100;
Schroeder, A et al. (2010), J Intern Med 267: 9-21; Tao, W et al. (2010), Mol Ther 18: 1657-1666). Without wishing to be bound by any theory, the present inventors assume that the PEG
moiety of the PEGylated lipid is present on the surface of the lipoplexes nanoparticles formed by the lipid composition forming a hydrophilic protective layer around the nanoparticles able to repel the adsorption of opsonin proteins via steric repulsion forces thus avoiding binding and rapid degradation of the lipoplexes by blood serum opsonins such as immunoglobulins and fibronectins which otherwise would result in systemic toxicity observed upon intravenous administration of cationic delivery systems. Furthermore, the cationic lipid was shown to allow for an active loading of negatively charged RNA into lipoplexes due to electrostatic interactions and entropic effects, respectively. It condenses oligonucleotides, protects them from degradation and facilitates uptake by cells and endosomal release. The sterol compound of the lipid composition of the invention is assumed to maintain lipoplex stability without losing fusogenicity, and thus affects lamellarity, plasma pharmacokinetics and biodistribution of lipoplexes.
In light of the experimental evidence provided herein it is evident that the composition comprising a lipid composition of the invention is suitable for the treatment of lung diseases and disease which can be treated by targeting a pharmaceutically active agent and/or a therapeutically active agent to the lung, to lung issue and/or pulmonary endothelial cells. Such diseases include lung cancer as well as lung metastases (see, e.g. Steeg, PS
(2006), Nat Med 12: 895-904) whereby target molecules in case of lung cancer are CD31, Ras, myc, Hif-1 a, VEGF-R2, -R1, R-3, PKN3, miR221, miR145. The observed low and one-time dosing observed with the composition comprising a lipid composition of the invention in particular also makes it a vehicle for the delivery of agents useful in the treatment of acute infections requiring hospital admission with intravenous drug administration, such as acute respiratory distress syndrome (ARDS) /acute lung injury (ALT), a life-threatening syndrome characterized by inflammation and increased vascular permeability leading to edema and sepsis (van der Heijden, M et al. (2009), Expert Opin Ther Targets 13: 39-53; David, S et al.
(2012), Crit Care Med 40: 3034-3041; and Hotchkiss, RS et al. (2003), N Engl J Med 348: 138-150. A
particular target molecule which can be targeted by a pharmaceutically active agent or a therapeutically active agent in connection with ARDS / ALI, respectively, is ANG2. ANG2 which is also referred to as "angiopoietin-2" is an endothelial derived Tie2 antagonist and directly contributes to sepsis morbidity and mortality as a vascular destabilizing factor (Fiedler, U., and H.G. Augustin. 2006, Trends Immunol. 27:552-8). Selective target gene inhibition by the lipid composition employing synthetic nucleic acids such as siRNAs, antisense molecules, antagomirs (described, for example, in Piva et al. 2013, INTERNATIONAL JOURNAL OF ONCOLOGY 43: 985-994, Ganguli et al., 2011, Bioinformation 7(1): 41-43 (2011), and Costa et al.2013, Pharmaceuticals, 6, 1195-1220) and/or micro RNA mimics (described, for example, in Henry et al., 2011, Pharmaceutical research 12, 3030-3042; and Ling, H., et al. (2013), Nat Rev Drug Discov 12(11): 847-865) is therefore a strategy for the treatment and/or prevention of lung diseases, including acute life threatening lung diseases.
A further aspect of the present invention is a lipid composition, wherein the lipid composition consists of a cationic lipid of formula (I) ¨ ¨
R, Y- Y-wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, wherein Y- is an anion, and wherein each of R1 and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl;
a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II) I I
R 0'0-P-0 I _ wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and wherein p is any integer from 15 to 130;
a PEGylated ceramide of formula (III) 5 =
RHO

wherein R5 is linear C7-C15 alkyl, and wherein q is any integer from 15 to 130;
and a PEGylated diacylglycerol of formula (IV) wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and wherein r is any integer from 15 to 130.

A further aspect of the invention resides in the use of the cationic lipid of formula (I) rµ1\1NHNH
I 2 n m wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, wherein Y- is an anion, and wherein each of R1 and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl, in the manufacture of a lipid composition of the invention, a medicament of the invention or a delivery vehicle of the invention.
A further aspect of the present invention is the use of a sterol compound selected from the group consisting of cholesterol and stigmasterol, in the manufacture of a lipid composition of the invention, a medicament of the invention or a delivery vehicle of the invention.
A still further aspect of the present invention is the use of a PEGylated phosphoethanolamine of formula (II) I _ wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and wherein p is any integer from 15 to 130;

a PEGylated ceramide of formula (III) -R,NH 0 wherein R5 is linear C7-C15 alkyl, and wherein q is any integer from 15 to 130;
and a PEGylated diacylglycerol of formula (IV) _ wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and wherein r is any integer from 15 to 130 in the manufacture of a lipid composition of the invention, a medicament of the invention or a delivery vehicle of the invention.
If not indicated to the contrary, a composition of the invention is a composition comprising a lipid composition of the invention. It is within the present invention that any embodiment of the lipid composition of the invention is also an embodiment of the lipid composition of the invention.

As preferably used herein, a delivery agent or a delivery vehicle is a composition comprising the lipid composition of the invention. As also preferably used herein, a delivery agent or a delivery vehicle is a composition of the invention. A delivery agent or a delivery vehicle as preferably used herein is an agent or a vehicle such as a composition which is suitable to deliver a compound to a structure; preferably such structure is an organ, tissue or cell; more preferably such structure is an organ, tissue or cell. In a preferred embodiment such compound is a therapeutically active agent, a biologically active agent or a pharmaceutically active agent.
As preferably used herein, a therapeutically active agent is a compound which is suitable to elicit in a host organism a therapeutic or therapeutically beneficial effect.
As preferably used herein, a biologically active agent is a compound which is suitable to elicit in a host organism a biological effect.
As preferably used herein, a pharmaceutically active agent is a compound which is suitable to elicit in a host organism a pharmaceutical or pharmaceutically beneficial effect.
It will be acknowledged that if not indicated to the contrary, any embodiment of a therapeutically active agent is also an embodiment of a biologically active agent and of a pharmaceutically active agent, and vice versa.
In connection with the instant invention, therapy also encompasses prevention.
In accordance therewith, a therapeutically active agent is, in an embodiment also an agent which is active in prevention of a disease. In an alternative embodiment, a therapeutically active agent is not active in the prevention of a disease.
As preferably used herein alkyl is an alkane substituent missing one hydrogen, whereby an alkane consist only of hydrogen and carbon atoms, all bonds are single bonds, and the carbon atoms are not joined in cyclic structures but instead form an open chain; the general chemical formula of alkanes is CnH2n+2.

As preferably used herein alkenyl is an alkene substituent missing one hydrogen, whereby an alkene is an unsaturated chemical compound containing at least one carbon¨carbon double bond.
As preferably used herein, PEG is polyethylene glycol.
As used herein, n is any integer between 1 and 4, which means that n may be 1, 2, 3 and 4. As used herein, m is any integer between 1 and 3, which means that m may be 1, 2 and 3.
The cationic lipid of the composition of the invention and a method for its preparation is, for example, disclosed in international patent application WO 2005/105152.
It is to be understood that the cationic lipid of the composition of the invention is a cationic lipids. More preferably, any of the NH or NH2 groups present in said lipid are present in a protonated form. Typically, any positive charge of said lipid is compensated by the presence of an anion. Such anion can be a monovalent or polyvalent anion. Preferred anions are halides, acetate and trifluoroacetate. Halides as used herein are preferably chlorides, fluorides, iodides and bromides. Most preferred are chlorides. Upon association of the cationic lipid and the therapeutically or pharmaceutically or biologically active compound to be transferred into a cell, the halide anion is replaced by the said active compound which preferably exhibits one or several negative charges, although it has to be acknowledged that the overall charge of the biologically active compound is not necessarily negative. The same considerations are equally applicable to the other compounds of the composition of the invention. In case such compound is an anionic compound or bears one or several negative charges such negative charges may be compensated by the presence of a cation. Such cation can be a monovalent or polyvalent anion. Preferred cations are ammonium, sodium or potassium.
It is to be acknowledged that any compound according to formula (I) comprises at least two asymmetric C atoms. It is within the present invention that any possible diastereomer of such compound is disclosed herein, i. e. in particular the R-R; S-S; R-S and S-R
diastereomer.

The sterol compound of the composition of the invention can be either synthetic or be obtained from natural sources such as sheep wool or plants.
The PEGylated lipid of the composition of the invention is available from commercial sources such as NOF Corporation, Japan; Avanti Polar Lipids, US; or Cordon Pharma, Switzerland.
Methods for determining the Z-average size of the lipid composition of the invention and the composition of the invention are known to the person skilled in the art and include Dynamic Light Scattering, DLS, as described in the example part or may be taken, for example, from the Zetasizer Nano Series User Manuel, Malvern Instruments Ltd., UK.
Methods for determining the zeta potential of the lipid composition of the invention and the composition of the invention are known to the person skilled in the art and include Electrophoretic Light Scattering which is described in the example part or may be taken, for example, from the Zetasizer Nano Series User Manuel, Malvern Instruments Ltd., UK.
The composition of the invention and particularly the lipid composition of the invention may comprise, in an embodiment, a carrier. Such carrier is preferably a liquid carrier. Preferred liquid carriers are aqueous carriers and non-aqueous carriers. Preferred aqueous carriers are water, an aqueous salt solution, an aqueous buffer system, more preferably the buffer system and/or the aqueous salt solution have a physiological buffer strength and physiological salt concentration(s). Preferred non-aqueous carriers are solvents, preferably organic solvents such as ethanol, tert.-butanol. Without wishing to be bound by any theory, any water miscible organic solvent can, in principle, be used. It is to be acknowledged that the composition, more particularly the lipid composition can thus be present as or form liposomes;
when contacted with overall negatively charged compounds, preferably compounds to be delivered by the lipid composition of the invention and/or the composition of the invention, the lipid composition of the invention and the composition of the invention form lipoplexes, i.e. a complex that is formed by the electrostatic interaction and the entropic effect based on the release of counter ions and water when a polyanion such as a nucleic acid molecule interact with a cationic lipid or a lipid system that contains beside other lipid components at least one cationic lipid component.
In a further embodiment, the lipid composition of the invention and/or the composition of the invention is present as a lyophilized composition. The thus lyophilized composition allows effective long-term storage of the composition at room temperature.
It is within the present invention that the lipid composition of the invention and/or the composition of the invention comprise a chemical compound, whereby said chemical compound is a biologically active agent, a therapeutically active agent and/or a pharmaceutically active agent. This kind of agent will also be referred as "the active agent"
herein.
Preferably, any such active agent is a negatively charged molecule. The term negatively charged molecule means to include molecules that have at least one or more than one negatively charged group that can ion-pair with the positively charged group of the cationic lipid according to the present invention, although the present inventor does not wish to be bound by any theory. In principle, the positive charge at the linker moiety could also have some effect on the overall structure of either the lipid as such or any complex formed between the cationic lipid and the negatively charged molecule, i.e. the biologically active compound.
Apart from that, the additional positive charge introduced into the lipid according to the present invention compared to the cationic lipids disclosed in US patent
6,395,713, should contribute to an increased toxicity of this lipid as taught by Xu Y, Szoka FC
Jr.; Biochemistry;
1996 May 07, 35 (18): 5616-23. In contrast to what the one skilled in the art would have expected from this document of the prior art the compounds according to the present invention are particularly suitable for the various purposes disclosed herein and are in particular devoid of any increased toxicity.
A peptide as preferably used herein is any polymer consisting of at least two amino acids which are covalently linked to each other, preferably through a peptide bond.
More preferably, a peptide consists of two to ten amino acids. A particularly preferred embodiment of the peptide is an oligopeptide which even more preferably comprises from about 10 to about 100 amino acids. Proteins as preferably used herein are polymers consisting of a plurality of amino acids which are covalently linked to each other. Preferably such proteins comprise about at least 100 amino acids or amino acid residues.
A preferred protein which may be used in connection with the cationic lipid and the composition according to the present invention, is any antibody, preferably any monoclonal antibody.
Particularly preferred biologically active compounds, i.e. pharmaceutically active compounds and such further constituent as used in connection with the composition according to the present invention are nucleic acids. Such nucleic acids can be either DNA, RNA, PNA or any mixture thereof. More preferably, the nucleic acid is a functional nucleic acid. A functional nucleic acid as preferably used herein is a nucleic acid which is not a nucleic acid coding for a peptide and protein, respectively. Preferred functional nucleic acids are siRNA, siNA, RNAi, antisense-nucleic acids, ribozymes, aptamers and spiegelmers which are all known in the art.
siRNA are small interfering RNA as, for example, described in international patent application PCT/EP03/08666. These molecules typically consist of a double-stranded RNA
structure which comprises between 15 to 25, preferably 18 to 23 nucleotide pairs which are base-pairing to each other, i.e. are essentially complementary to each other, typically mediated by Watson-Crick base-pairing. One strand of this double-stranded RNA molecule is essentially complementary to a target nucleic acid, preferably a mRNA, whereas the second strand of said double-stranded RNA molecule is essentially identical to a stretch of said target nucleic acid. The siRNA molecule may be flanked on each side and each stretch, respectively, by a number of additional oligonucleotides which, however, do not necessarily have to base-pair to each other.
RNAi has essentially the same design as siRNA, however, the molecules are significantly longer compared to siRNA. RNAi molecules typically comprise 50 or more nucleotides and base pairs, respectively.

A further class of functional nucleic acids which are active based on the same mode of action as siRNA and RNAi is siNA. siNA is, e. g., described in international patent application PCT/EP03/074654. More particularly, siNA corresponds to siRNA, whereby the siNA
molecule does not comprise any ribonucleotides.
Antisense nucleic acids, as preferably used herein, are oligonucleotides which hybridise based on base complementarity with a target RNA, preferably mRNA, thereby activating RNaseH.
RNaseH is activated by both phosphodiester and phosphothioate-coupled DNA.
Phosphodiester-coupled DNA, however, is rapidly degraded by cellular nucleases with exception of phosphothioate-coupled DNA. Antisense polynucleotides are thus effective only as DNA-RNA hybrid complexes. Preferred lengths of antisense nucleic acids range from 16 to 23 nucleotides. Examples for this kind of antisense oligonucleotides are described, among others, in US patent 5,849,902 and US patent 5,989,912.
A further group of functional nucleic acids are ribozymes which are catalytically active nucleic acids preferably consisting of RNA which basically comprise two moieties. The first moiety shows a catalytic activity, whereas the second moiety is responsible for the specific interaction with the target nucleic acid. Upon interaction between the target nucleic acid and the said moiety of the ribozyme, typically by hybridisation and Watson-Crick base-pairing of essentially complementary stretches of bases on the two hybridising strands, the catalytically active moiety may become active which means that it cleaves, either intramolecularly or intermolecularly, the target nucleic acid in case the catalytic activity of the ribozyme is a phosphodiesterase activity. Ribozymes, the use and design principles are known to the ones skilled in the art and, for example, described in Doherty and Doudna (Annu.
Ref. Biophys.
Biomolstruct. 2000; 30: 457-75).
A still further group of functional nucleic acids are microRNAs. microRNA is a small non-coding RNA molecule. The completely processed mature miRNAs typically have a length of about 22 nucleotides. A mircoRNA functions in transcriptional and post-transcriptional regulation of gene expression. Encoded by eukaryotic nuclear DNA, miRNAs function via base-pairing with complementary sequences within mRNA molecules, usually resulting in gene silencing via translational repression or target degradation., and/or micro RNA mimics (see, for example, Anand, S. (2013), Vasc Cell 5(1): 2; Kasinski, A. L. and F.
J. Slack (2011), Nat Rev Cancer 11(12): 849-864; Liu, D., et al. (2011), Int J Dev Biol 55(4-5): 419-429;
Staszel, T., et al. (2011), Pol Arch Med Wewn 121(10): 361-366; Urbich, C., et al. (2008), Cardiovasc Res 79(4): 581-588; Costa, P. M. and M. C. Pedroso de Lima (2013), Pharmaceuticals (Basel) 6(10): 1195-1220; and Henry, J. C., et al. (2011), Pharm Res 28(12):
3030-3042).
Another group of functional nucleic acids are antagomirs which are, for example described in Costa, P. M. and M. C. Pedroso de Lima (2013), Pharmaceuticals (Basel) 6(10):
1195-1220;
Piva, R., et al. (2013), Int J Oncol 43(4): 985-994; Ganguli, S., et al.
(2011), Bioinformation
7(1): 41-43; and Ling, H., et al. (2013), Nat Rev Drug Discov 12(11): 847-865.
A still further group of functional nucleic acids are aptamers. Aptamers are D-nucleic acids which are either single-stranded or double-stranded and which specifically interact with a target molecule. The manufacture or selection of aptamers is, e.g., described in European patent EP 0 533 838. In contrast to RNAi, siRNA, siNA, antisense-nucleotides and ribozymes, aptamers do not degrade any target mRNA but interact specifically with the secondary and tertiary structure of a target compound such as a protein. Upon interaction with the target, the target typically shows a change in its biological activity. The length of aptamers typically ranges from as little as 15 to as much as 80 nucleotides, and preferably ranges from about 20 to about 50 nucleotides.
Another group of functional nucleic acids are spiegelmers as, for example, described in international patent application WO 98/08856. Spiegelmers are molecules similar to aptamers.
However, spiegelmers consist either completely or mostly of L-nucleotides rather than D-nucleotides in contrast to aptamers. Otherwise, particularly with regard to possible lengths of spiegelmers, the same applies to spiegelmers as outlined in connection with aptamers.

A further aspect of the present invention is related to a pharmaceutical composition comprising the lipid composition of the invention or the composition of the invention. The pharmaceutical composition of the invention comprises a pharmaceutically active compound and optionally a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carrier may, preferably, be selected from the group of carrier as defined herein in connection with the composition according to the present invention. It will be understood by those skilled in the art that any composition as described herein may, in principle, be also used as a pharmaceutical composition provided that its ingredients and any combination thereof is pharmaceutically acceptable. A pharmaceutical composition comprises a pharmaceutically active compound. Such pharmaceutically active compound can be the same as the further compound or the active agent of the composition according to the present invention which is preferably any biologically active compound, more preferably any biologically active compound as disclosed herein. The further constituent, pharmaceutically active compound and/or biologically active compound are preferably selected from the group comprising peptides, proteins, oligonucleotides, polynucleotides and nucleic acids.
The composition, particularly the pharmaceutical composition according to the present invention can be used for various forms of administration, whereby local administration and systemic administration are particularly preferred. Even more preferred is a route of administration which is selected from the group comprising intramuscular, percutaneous, subcutaneous, intravenous and pulmonary administration. As preferably used herein, local administration means that the respective composition is administered in close spatial relationship to the cell, tissue and organ, respectively, to which the composition and the biologically active compound, respectively, is to be administered. As used herein, systemic administration means an administration which is different from a local administration and more preferably is the administration into a body fluid such as blood and liquor, respectively, whereby the body liquid transports the composition to the cell, tissue and organ, respectively, to which the composition and the biologically active compound, respectively, is to be delivered.

As preferably used herein a host organism or a subject is a mammal, preferably the mammal is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse; more preferably the host organism or the subject is man.
Any medicament which can be manufactured using the composition according to the present invention, respectively, is for the treatment and prevention of a subject.
Preferably such subject is a mammal and even more preferably such mammal is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse. In a further aspect the composition according to the present invention and/or the lipid composition of the invention can be used as a transferring agent, more preferably as a transfection agent.
As preferably used herein a transferring agent is any agent which is suitable to transfer a compound, more preferably a biologically active compound such as a pharmaceutically active compound across a membrane, preferably a cell membrane and more preferably transfer such compound into a cell as previously described herein. Preferably, the cells are pulmonary endothelial cells, more preferably endothelial cells of a host organism as defined herein.
In a still further aspect the present invention is related to a method for transferring, more particularly transfecting, a cell with a biologically active compound. In a first step, whereby the sequence of steps is not necessarily limited, the cell and the membrane and cell, respectively, is provided. In a second step, a compound according to the present invention is provided as well as a biologically active compound such as a pharmaceutically active compound. This reaction can be contacted with the cell and the membrane, respectively, and due to the biophysical characteristics of the compound and the composition according to the present invention, the biologically active compound will be transferred from one side of the membrane to the other one, or in case the membrane forms a cell, from outside the cell to within the cell. It is within the present invention that prior to contacting the cell and the membrane, respectively, the biologically active compound and composition of the invention and/or the lipid composition of the invention are contacted, whereupon preferably a complex is formed and such complex is contacted with the cell and the membrane, respectively.

In a further aspect of the present invention the method for transferring a biologically active compound and a pharmaceutically active compound, respectively, comprises the steps of providing the cell and the membrane, respectively, providing a composition according to the present invention and/or a lipid composition of the invention and contacting both the composition and the cell and the membrane, respectively. It is within the present invention that the composition may be formed prior or during the contacting with the cell and the membrane, respectively.
In an embodiment of any method for transferring a biologically active compound as disclosed herein, the method may comprise further steps, preferably the step of detecting whether the biologically active compound has been transferred. Such detection reaction strongly depends on the kind of biologically active compounds transferred according to the method and will be readily obvious for the ones skilled in the art. It is within the present invention that such method is performed on any cell, tissue, organ and organism as described herein.
In a further aspect the present invention is related to a method for the manufacture of a medicament. The method comprises formulating a therapeutically active agent or a pharmaceutically active agent together with a composition of the invention and/or a lipid composition of the invention. Details on how such formulating is practiced are known to a person skilled in the art, and may also be taken from the example part of the instant description.
The instant invention is further illustrated by the following Figs. and Examples from which further features, embodiments and advantages of the invention may be taken, whereby Fig. 1 is a diagram showing siRNA distribution in vivo 1 hour after systemic application using different lipoplex formulations; siRNA concentrations are indicated in percent initial dose per gram of tissue [%ID/g];

Fig. 2a is showing the chemical compounds forming DACC, their chemical structure and their molar ratio, expressed in percent, as well as the basic design of the siRNA
molecules of the lipoplexes formed by DACC) and said siRNA moelcules; the siRNA molecules are blunt-ended and the circles on both strands indicate a 2-0-methyl modified nucleotide;
Fig. 2b is a diagram showing the particle size distribution of DACC/siRNA
lipoplexes as Z-average size;
Fig. 2c is a diagram showing zeta potential of DACC/siRNA lipoplexes;
Fig. 2d is an electron microphotograph of DACC/siRNA lipoplexes;
Fig. 3a is a diagram showing siRNA concentrations expressed as % ID/g tissue in various organs 1, 6 and 24 hours upon administration of DACC/siRNA lipoplexes;
Fig. 3b is a series of confocal microscopic images of formaline fixed paraffin embedded lung tissue sections illustrating cellular distribution of Cy3-labeled siRNA in the lungs 1 hour after systemic i.v. administration of DACC/siRNACy3; the upper left image shows siRNA-Cy3 staining in white, the upper right image and the lower images show close up views of siRNACy3 staining in red and nuclear staining in green; scale bars are indicated;
Fig. 3c is a series of confocal microscopic images of formaline fixed paraffin embedded sections of the heart, liver, spleen and kidney illustrating cellular distribution of Cy3 -labeled siRNA in said organs 1 hour after systemic i.v. administration of DACC/siRNACy3; the upper panel is depicted in white at low magnification, and the lower panel is in red in close up views; scale bars are indicated;
Fig. 4a shows the result of a Western blot analysis of a mouse endothelial cell line, MS-1, after transfection with DACC/siRNATie-2 lipoplexes for the inhibition of Tie-2;

Figs. 4b to 4e are diagrams showing the inhibition of Tie-2 mRNA relative to the inhibition of PTEN mRNA in cells of the lung (Fig. 4b), heart (Fig. 4c), liver (Fig. 4d) and kidney (Fig. 4e) of mice upon treatment with DACC/5iRNAT1e-2 lipoplexes as determined by quantitative reverse transcriptase¨PCR analysis;
Fig. 5a is a diagram showing the inhibition of Tie-2 mRNA relative to the inhibition of Actin mRNA in lung cells of mice treated by bolus injection with DACC/siRNATie-2 lipoplexes, with DACC/siRNAcD31 lipoplexes and 270 mM sucrose solution, whereby the amount of lipoplexes administered was 3.0 mg/kg, 1.5 mg/kg and 0.75 mg/kg, respectively;
Fig. 5b is a diagram showing the inhibition of Tie-2 mRNA relative to the inhibition of Actin mRNA in lung cells of mice treated by infusion of DACC/siRNATie-2 lipoplexes and 5%
glucose solution, whereby the amount of lipoplexes administered was 0.3 mg/kg, 1.0 mg/kg, 3.0 mg/kg. 6.0 mg/kg and 12 mg/kg, respectively;
Fig. 6a is a diagram showing the inhibition of Tie-2 mRNA relative to the inhibition of Actin mRNA in lung cells of mice treated with DACC/siRNATie-2 lipoplexes, control lipoplexes or sucrose 3 days p.t., 7 days p.t., 14 days p.t. and 21 days p.t.;
Fig. 6b shows the result of a Western blot analysis of lung tissue of mice that was collected 3 days and 21 days.after administration of a single dose of DACC/5iRNATie-2 lipoplexes or sucrose solution, with PTEN being used as a loading control;
Fig. 7a to 7d are diagrams showing the inhibition of various target genes (Fig. 7a: VEGFR2;
Fig. 7b: VE-Cadherin; Fig. 7c: BMPR2; and Fig. 7d: CD31) relative to the inhibition of PTEN
mRNA in pulmonary endothelium of mice treated with DACC/siRNAvEGFR2 lipoplexes (Fig.
7a), DACC/siRNAVE-Cadherin lipoplexes (Fig. 7b), DACC/siRNABmPR2 lipoplexes (Fig. 7c) and DACC/siRNAcD31 lipoplexes (Fig. 7d), whereby in each case 270 mM sucrose and a DACC/siRNA""I was administered in a control group of animals;

Fig. 8a is a representation of an experimental set-up for a lung metastasis mouse model and a treatment scheme using DACC/siRNAcD31;
Fig. 8b is a diagram illustrating relative body weight until day 15 during the treatment scheme shown in Fig. 8a;
Fig. 8c is a Kaplan-Meier diagram indicating the survival of mice by defined end point criteria for a period of 70 days after cell challenge treated with DACC/siRNAc 31 , DACC/siRNALuciferase or 270 mM sucrose as control in an experimental lung metastasis mouse model as depicted in the scheme in Fig. 8a;
Fig. 8d is a diagram showing the inhibition of CD31 mRNA relative to the inhibition of CD34 mRNA in lung tissue of mice treated with DACC/siRNAcD31 lipoplexes, control lipoplexes or sucrose;
Fig. 9a is a representation of an experimental set-up for induction of an inflammatory response by LPS treatment and a treatment scheme using DACC/siRNAANGPT2.
Fig. 9b is a diagram showing the inhibition of ANGPT2 mRNA relative to the expression of actin mRNA in lungs of mice 6 hours after challenge with either LPS (0.5 mg/kg) or saline (0.9 % NaC1). Mice were treated with DACC/siRNAANGPT2 lipoplexes with a dose of 2.8 mg/kg, 2.0 mg/kg and "10 mg/kg; 270 mM sucrose was used as a vehicle control;
Fig. 10a is a representation of an experimental set-up for a S. pneumoniae infected lung mouse model and a treatment scheme using DACC/siRNAANGPT2 ;
Fig. 10b is a Kaplan-Meier diagram indicating the survival of mice for a period of 10 days after challenge with S. pneumonia treated either with DACC/siRNAANGPT2 and ampicillin, DACC/siRNALuciferase and ampicillin, sucrose and ampicillin or sucrose and vehicle (saline) as depicted in the scheme in Fig. 10a;

Fig.11 is a summary outlining the experimental set-up for determining reduction of EDN1 expression in mice using different siRNA molecules targeting either EDN1 or soluble VEGF
receptor 1 (sFlt1) and different delivery systems; and Fig. 12 is a bar diagram showing EDN1 mRNA expression in total lysates of lung tissue from mice treated according to the experimental set-up illustrated in Fig. 5; EDN1 mRNA
expression is normalized relative to PTEN mRNA.
Example 1: Materials and Methods The materials and methods described in the following were used throughout the examples, if not indicated to the contrary.
Short interfering RNAs The siRNA molecules (AtuRNAi) used in the experiments subject to Examples 2 to 9 are listed in Table 1. The siRNA molecules (AtuRNAi) used in said Examples 2 to 9 are blunt, 19-mer double-stranded RNA oligonucleotides stabilized by alternating 2'-0-methyl modifications on both strands, and the siRNA molecules used in the experiments subject to Examples 10 to 11 are listed in Table 2. The siRNA molecules used in said Examples 10 to 11 are blunt, 19-mer double-stranded RNA oligonucleotides stabilized by alternating 2'-0-methyl modifications on both strands with the control siRNA molecules targeting Luciferase are 23-mer double-stranded RNA oligonucleotides stabilized by alternating 2'-0-methyl modifications on both strands. Such modification has been previously described Santel A et al. (Santel, A et al. (2006). Gene Ther 13: 1222-1234) and Czauderna, F. et al. (Czauderna, F.
et al. (2003), Nucleic Acids Res 31: 2705-2716), and were synthesized by BioSpring (Frankfurt a.M., Germany). 2'-0-methyl modification of a nucleotide is indicated throughout this specification and the claims by the thus modified nucleotide being represented by a corresponding capital letter, whereas a non-modified nucleotide is represented by a corresponding lower case letter.

Table 1:
siRNA target passenger strand (s) guide strand (as) PKN3 5 'aGaCuUgAgGaCuUcCuGgAcAa 3' 5 'UuGuCcAgGaAgUcCuCaAgUcU 3' (SEQ ID NO: 4) (SEQ ID NO: 3) siRNA-Cy3 5 'AuCuUgCuGaAaUuCuGaUaCuG-'cAgUaUcAgAaUuUcAgCaAgAu 3' CY3 (SEQ ID NO: 6) (SEQ ID NO: 5) Luciferase 5 'UcGaAgUaUuCcGcGuAcGuGaU
5 'aUcAcGuAcGcGgAaUaCuUcGa 3'3' (SEQ ID NO: 8) (SEQ ID NO: 7) Tie2 5 'cCaUcAuUuGcCcAgAuAu 3' 5 'AuAuCuGgGcAaAuGaUgG 3' (SEQ DI NO: 10) (SEQ ID NO: 9) CD31 5 'cAgAuAcUcUaGaAcGgAa 3' 5 'UuCcGuUcUaGaGuAuCuG 3' (SEQ ID NO: 12) (SEQ ID NO: 11) KDR/VEGFR2 5 'cGgGgCaAgAgAaAuGaAuUuGu 3' 5 'AcAaAuUcAuUuCuCuUgCcCcG 3' (SEQ ID NO: 14) (SEQ ID NO: 13) CDH5NE- 5 'uUgAaGcAaCuGuGaAuUc 3' 5 'GaAuUcAcAgUuGcUuCaA 3' Cadherin (SEQ ID NO: 16) (SEQ ID NO: 15) 5 'uUgCcAaGaUgAaUaCaAucaAu 3' 5 'AuUgAuUgUaUuCaUcUuGgCaA 3' (SEQ ID NO: 18) (SEQ ID NO: 17) Table 2:
siRNA target passenger strand (s) guide strans (as) (Internal reference) (internal reference) (internal reference) ANGPT2 5 'gCaUgUgGuCcUuCcAaCu 3'5 'AgUuGgAaGgAcCaCaUgC 3 (SEQ ID NO: 2) (SEQ ID NO: 1) (ANGPT2-hmrc-7B) (ANGPT2-hmrc-7A) Preparation and characterization of siRNA lipoplexes Atuplex is a lipid composition containing a) 50 mol% 13-(L-arginy1)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide tri-hydrochloride);
b) 49 mol% 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE); and c) 1 mol% N-(Carbonyl-methoxypolyethyleneglycol-2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt.
DACC9 is a lipid composition containing a) 70 mol% 13-(Larginy1)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide tri-hydrochloride of the following formula:
NH2' cr NH3. NH3+
cr cr b) 29 mol% cholesterol; and c) 1 mol% mPEG-2000-DSPE of the following formula:

_ Na.

, whereby the charge ratio [lipids/phosphate oligo] is 8.4.
DACC10 is a lipid composition containing a) 70 mol% 13-(L-arginy1)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide tri-hydrochloride of the following formula:
0 NI-12+
Or NH3 NH, cr cr b) 29 mol% cholesterol; and c) 1 mol% mPEG-2000-Ceramide-C8 of the following formula:

, whereby the charge ratio [lipids/phosphate Ego] is 8.4.
Cationic liposomes, also referred to as DACC9, comprised of cationic lipid AtuFECTO1 (13-L-arginy1-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride;
Silence Therapeutics AG, Berlin, Germany), cholesterol (Sigma Aldrich) and mPEG2000-DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanol amine-N [methoxy (polyethylene glycol)-2000]);
Avanti Polar Lipids Inc., Alabaster, AL, USA) at a molar ratio of 70:29:1 were prepared by lipid film rehydration (Santel, A et al. (2006). Gene Ther 13: 1222-1234)) with 270 mM
sterile sucrose solution. Cationic liposomes comprised of the above DACC10 lipid composition were prepared in an analogous manner. The resulting liposomal stock solutions had total lipid concentrations of 5 mg/ml or up to 9 mg/ml (e.g. for infusion studies), respectively. The formation of siRNA lipoplexes occurred by mixing equal volumes of liposomal dispersion and siRNA solution in 270 mM sucrose. For this purpose, the concentration of both were adjusted in a way, that the final lipoplex formulation was characterized by a final lipid / siRNA ratio [m/m] of ca. 6.8, which corresponded to a charge ratio between nucleic acid backbone phosphates to charged lipid nitrogen atoms (N/P ratio) of approximately 8.4. Particle sizes (Z-average size, intensity distribution) and zeta potentials of liposomes and lipoplexes were determined by Dynamic Light Scattering using a Zetasizer Nano-ZS (Malvern Instruments, Worcestershire, UK). Here, corresponding dispersant properties were adjusted to 270 mM sucrose. Negative stain transmission electron microscopy (nsTEM) was done by Vironova AB (Stockholm, Sweden).
If reference is made to DACC, this means that such reference refers to both DACC9 and DACC10.
siRNA distribution and RNAi in vivo Eight week old C57B1/6j (Harlan) males and females were used for in vivo studies. All animal experiments in this study were performed according to approved protocols and in compliance with the guidelines of the Landesamt fur Arbeits-, Gesundheitsschutz und technische Sicherheit Berlin, Germany (No. G0264/99). Isotonic siRNA lipoplex formulations were administered intravenously through bolus tail vein injection at the indicated doses. For siRNA-Cy3 biodistribution studies, mice received a single dose of DACC9siRNA-Cy3 (2.8 mg siRNA/kg body weight). 1 hour post-injection mice were sacrificed by cervical dislocation and tissues were processed for paraffin embedding as previously described (Santel, A et al.
(2006). Gene Ther 13: 1222-1234)). Sections of 4 pm were cut and deparaffinized with Roticlear (Roth, A538.5), rehydrated through graded ethanol washes and counterstained with Sytox Green dye (Molecular probes). Fluorescence uptake was analyzed with a Zeiss LSM510 Meta confocal microscope. Images were recorded and processed by Zeiss LSM5 software. For quantitative analysis of siRNA distribution in different organs, mice received a single dose of lipoplexes formulated with PKN3 siRNA. Concentrations of PKN3 siRNA in different tissues were determined by a modified capture probe sandwich hybridization assay (Aleku, M, et al.
(2008). Cancer Res 68: 9788-9798). For target mRNA knock down analyses, tissues were dissected immediately after sacrifice of the mice and instantly snap-frozen in liquid nitrogen.
Approximately 20 mg of tissue was homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany) using tungsten carbide beads (Qiagen). Total RNA was isolated from the lysate with the Invisorb Spin Tissue RNA Mini Kit (Invitek, Berlin, Germany).
Depending on the tissue, 25-100 ng total RNA was used for quantitative TaqMan RT-PCR with the amplicon sets (listed in Table 3) obtained from BioTez GmBH, Berlin, Germany):
The TaqMan RT-PCR reactions were carried out with an ABI PRISM 7700 Sequence Detector (Software: Sequence Detection System v1.6.3 (ABI)) or StepOnePlusTM Real Time PCR
Sytem (ABI) using a standard protocol for RT-PCR as described previously (Santel, A et al.
(2006). Gene Ther 13: 1222-1234)) with primers and probes at a concentration of 300 and 100 nM respectively. TaqMan data were calculated by using the Comparative CT
method. Target protein expression was assessed by Western blotting of whole tissue lysates as described previously (Santel, A et al. (2006). Gene Ther 13: 1222-1234)). Snap frozen tissues were homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany), and proteins were extracted in Riper-lysis buffer. Equal amounts of protein were loaded for immunobot analysis using the following antibodies: rabbit anti-PTEN (Ab-2, Neomarkers, Fremont, CA, USA) and mouse anti-Tie2 (clone Ab33, Upstate 05-584).
Table 3: Primer sets for Taqman analysis Target Upper Primer Lower primer Probe Genes Tie-2 ATGAGACAGTGCT AGCATCCTGTTTAAG AGCCTTATGAGAGACCATCA
GGAGGGAGA GACACCAA TTTGCCCAG
(SEQ ID NO: 19) (SEQ ID NO: 20) (SEQ ID NO: 21) CACAGAGAC (SEQ CCGTTC TCATGGAAA
ID NO: 22) (SEQ ID NO: 23) (SEQ ID NO: 24) AGAGCCACA (SEQ GATCAAGG GTCCCACC
ID NO: 25) (SEQ ID NO: 26) (SEQ ID NO: 27) TCTGTGA TTATAATG TTACCACGAGG
(SEQ ID NO: 28) (SEQ ID NO: 29) (SEQ ID NO: 30) VE- GAACGAGGACAG CTCCCGATTAAACTG TCATAAACAACCATGACAAC
Cadherin CAACTTCACC CCCATAC ACCGCCAA
(SEQ ID NO: 31) (SEQ ID NO: 32) (SEQ ID NO: 33) PTEN CACCGCCAAATTT AAGGGTTTGATAAGT TGCACAGTATCCTTTTGAAG
AACTGCAGA (SEQ TCTAGCTGT ACCATAACCCA
ID NO: 34) (SEQ ID NO: 35) (SEQ ID NO: 36) Actin GTTTGAGACCTTC GACCAGAGGCATAC CCATGTACGTAGCCATCCA
AACACCCCA (SEQ AGGGACA GGCTGTG
ID NO: 37) (SEQ ID NO: 38) (SEQ ID NO: 39) GGTGCTAGT GCCTAACC AGTCTGA
(SEQ ID NO: 40) (SEQ ID NO: 41) (SEQ ID NO: 42) CAATGACAA (SEQ GACCAC GCTGGTGGT
ID NO: 43) (SEQ ID NO: 44) (SEQ ID NO: 45) Infusion studies For infusion studies jugular vein catheterized mice (Harlan) received a single 1 hour infusion of DACC9/lipoplexes of the highest dose (12 mg siRNA/kg body weight; 40 ml/kg body weight). For dose titrations, DACC9 lipoplex stock solution was diluted in 5%
Glucose solution to keep the administration volume constant.
Transfection of mouse endothelial cell line, MS1.
The mouse endothelial cell line MS1(ATCC CRL-2279) was obtained from the American type cell culture collection (ATCC) and cultivated according to the supplier's recommendations. Cells were seeded in 6 well plates and transfected with DACC9/siRNATie-2 as described previously (Santel, A et al. (2006). Gene Ther 13: 1222-1234)).
Briefly, about 12 hours after cell seeding different amounts of DACC9/siRNA formulations diluted in 10%
serum-containing medium were added to the cells to achieve transfection concentrations in a range of 10 to 160 nM siRNA. Three days after transfection cells were lysed.
Proteins were separated by SDS-PAGE and subjected to immunoblotting as previously described (Santel, A
etal. (2006). Gene Ther 13: 1222-1234)).
Experimental lung metastasis mouse model Lewis lung carcinoma (LLC) cells were cultured in RPMI medium supplemented with 10 %
FCS and 4 mM glutamine. Cells were dissociated with trypsin and subsequently washed in cell culture medium and in PBS. 250 000 cells in 200 1.11 PBS were injected into the tail vein of 8 week old male BDF1 mice (Harlan). Mice were treated 11 times with isotonic sucrose or with DACC9 lipoplexes on alternating days beginning 5 days before tumor cell challenge.

Mice were monitored daily for bodyweight development and signs of suffering.
When reaching defined endpoint criteria (score >= 4) animals were sacrificed by cervical dislocation.
Endpoint criteria were signs of suffering (cachexia, weakening, difficulty moving or eating, compound toxicity (hunching convulsions), 15% reduction of body weight for 3 consecutive days or 213% body weight loss for 1 day and a score of >= 4.) Streptococcus pneumonia infected lung model The study was conducted by Eurofin/Panlabs (Ricerca, study B09784, adapted from model 608100): Male specific pathogen free ICR mice weighing 20 to 22g were treated with DACC9 lipoplex (2.8 mg siRNA/kg body weight) or sucrose as vehicle control by tail vein injection. 24 hours later, all mice were infected intratracheally with Streptococcus pneumoniae (ATCC 6301) with LD 90-100 dose (0.02m1, 7-9 x 106 CFU) to induce acute pneumonia. 2 hours after infection a single suboptimal dose of Ampicillin (3 mg/kg) was given by intravenous route. Survival of mice is monitored up to 10 days after infection.
Without treatment with ampicillin, mice died within 3 days after infection with S. pneumonia.
Only a moderate increase in survival was observed by single dose of ampicillin.
DACC9/Angpt2 siRNA pretreatment in addition to Ampicillin treatment enhances survival of mice significantly. Survival of >50% of animals indicates significant activity of test substance.
Statistical analysis Data are expressed as means SEM.
Example 2: Lung specificity of DACC
Different lipoplex formulations were evaluated in vivo in order to investigate their respective capacity to deliver siRNA cargo to select organs. All lipoplexes used to examine siRNA
biodistribution pattern were formulated with the cationic lipid AtuFECTO1 and siRNA"
but contained different co-lipids and/or PEG-lipids at different ratios.
Lipoplexes were administered intravenously via tail-vein injection, and siRNA concentrations were determined in liver, kidney, lung, heart and spleen tissue samples 1 hour after systemic application using a siRNA specific quantitative ELISA-based capture-probe assay. The results are shown in Fig.
1.
The composition of the various lipoplexes is summarized in Table 4.
Table 4: Composition of various lipoplexes Lipoplex cationic lipid co-lipid co-lipid PEG-lipid molar ratio [%]
16/18:1DapAr lipoplex_01 g 100 16/18:1DapAr lipoplex_02 g DPhyPE mPEG2000-DSPE 50:49:01 16/18:1DapAr lipoplex_03 g Cholesterol mPEG2000-DSPE 50:49:01 lipoplex_04 12/14DapArg Cholesterol mPEG2000-DSPE 70:29:01 16/18:1DapAr DACC9 g Cholesterol mPEG2000-DSPE 70:29:01 16/18:1DapAr lipoplex_05 g CHEMS mPEG2000-DSPE 70:29:01 16/18:1DapAr lipoplex_06 g DOPC mPEG2000-DSPE 25:74:1 16/18:1DapAr lipoplex_07 g DOPC mPEG2000-DSPE 50:49:01 16/18:1DapAr lipoplex_08 g DOPC mPEG2000-DSPE 75:24:01 16/18:1DapAr lipoplex_09 g Cholesterol CHEMS mPEG2000-DMPE 19:30:59:2 16/18:1DapAr lipoplex_10 g Cholesterol CHEMS mPEG2000-DMPE 45:33:20:2 Concentrations of siRNA delivered to the respective tissues varied depending on the lipoplex system used, whereas the DACC9 lipoplex system displayed the most efficient siRNA
delivery to the lungs (Fig. 1, black bar). Furthermore, an inverse correlation between lipoplex formulation stability and functional organ uptake, i.e. the formulations most stable even with respect to their tendency to aggregate were also found to be least entrapped in the vascular beds of the pulmonary endothelium, but rather to accumulate directly in the liver and spleen for subsequent degradation. However, delivery of siRNA to the target tissue and cellular uptake were not the sole factors responsible for activity as demonstrated previously by Heyes et al. (Heyes, J, Palmer, L, Bremner, K, and MacLachlan, I (2005). J Control Release 107:
276-287) for a different cationic lipid based system, suggesting that instead of endocytosis being rate-limiting, it is rather those events occurring once the siRNA has been internalized by the cell which have the greatest effect on the efficiency of gene-silencing, such as endosomal release and RISC loading.
Example 3: Lipid composition and physico-chemical characterization of the DACC/siRNA lipoplexes DACC9 lipoplexes, sometimes also referred to as DACC9 lipoplexes herein, are composed of the positively charged lipid system AtuFECTO1 (13-L-arginy1-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride), cholesterol and mPEG2000-DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanol amine-N [methoxy (polyethylene glycol)-2000]) in a molar ratio of 70:29:1 together with a blunt ended siRNA duplexes chemically stabilized by alternating 2 '-0-methyl modifications on both strands (Santel, A, et al. (2006), Gene Ther 13: 1222-1234; Aleku, M, et al. (2008), Cancer Res 68: 9788-9798) in 270 mM sucrose solution. The chemical compounds of DACC9, their chemical structure and their molar ratio, expressed in percent, as well as the basic design of the siRNA molecules of the lipoplexes are indicated in Fig. 2a. In connection with the siRNA molecules it is to be noted that they are blunt-ended and that the circles indicate a 2-0-methyl modified nucleotide.
The resulting DACC9 lipoplex particles were characterized regarding size and zeta potential.
The Z-average size amounted to ¨70 nm as determined by dynamic light scattering in a 270 mM sucrose solution with the result being shown in Fig. 2b, and the zeta potential measured in 270 mM sucrose was between 40 and 50 mV as may be taken from Fig. 2c.
Electron microscopy of DACC9 lipoplex particles revealed predominantly lamellar structures in mostly spherical arrangements as shown in Fig. 2d. The addition of sucrose enables formulation stability during freezing, drying and rehydration steps, thereby ensuring effective long-term storage as a lyophilized product (data not shown). Simiar results were obtained for DACC10 lipoplexes composed of the DACC10 lipid composition a blunt ended siRNA

duplexes chemically stabilized by alternating 2 '-0-methyl modifications on both strands (Santel, A, et al. (2006), Gene Ther 13: 1222-1234; Aleku, M, et al. (2008), Cancer Res 68:
9788-9798) in 270 mM sucrose solution.
Example 4: Primary delivery of siRNAs to lung endothelium by DACC
To characterize the tissue distribution and kinetics of siRNA delivery by systemic application of DACC9 lipoplexes in more detail, mice were treated with a single dose of DACC9 (2.8 mg siRNA/kg body weight) and a number of tissue samples from different organs were collected 1, 6 and 24 hours after administration of the DACC9 lipoplex formulation to determine respective siRNA concentrations. The results are shown in Fig. 3a.
As may be taken from Fig. 3a, highest siRNA concentrations [about 40% ID/g tissue] were found in lung tissue at the 1-hour time point, followed by spleen, liver and to lesser extent kidney and heart. siRNA concentrations in all tissues investigated diminished over time, siRNA levels below 1% of initial dose were measured in blood, brain, prostate or skeletal muscle.
In order to examine siRNA distribution within predominantly targeted tissue, mice were treated with DACC9 lipoplexes formulated with cyanine dye (Cy3) labeled siRNA.
Cy3-labeled siRNAs in the tissues were then visualized by confocal microscopy of formalin-fixed paraffin embedded tissue sections. siRNA distribution patterns in lung, liver, kidney and heart were reminiscent of vascular staining patterns as may be taken from Figs. 3b-c.
From all organs investigated, lungs were most intensely stained by siRNA-Cy3 where siRNA
staining is evenly distributed in the lung vasculature.

Upon close up-view, siRNA derived staining in the lungs was finely dotted and centered around cell nuclei, this observation being indicative for intracellular uptake of siRNAs (Fig.
3b). In the heart, distinct Cy3 staining was found lining the capillaries, while muscle fibers were free of siRNA-Cy3 signal (Fig. 3c). The sinusoidal endothelial cell layer in the liver showed weak siRNA-Cy3 staining pattern (Fig. 3c), while individual cells within the liver sinusoids were strongly Cy3 stained. The oval shaped nucleus (Fig. 3c, see arrow) marks Kupffer cells responsible for the removal of foreign particulate substances, hence, lipoplexes found here could also have been taken up by phagocytosis (Whitehead, KA et al.
(2009), Nat Rev Drug Discov 8: 129-138). Hepatocytes, discernible by their large, regular and round nucleus, were free of siRNA-Cy3 staining. siRNA-Cy3 staining in the spleen was pronounced in the marginal zones of the white pulp, while the center of the white pulp remained CY3-staining free (Fig. 3c). Since monocytes and macrophages known to be responsible for lipoplex clearance from the blood are sequestered into this zone, lipoplex clearance by respective macrophages could explain the enhanced siRNA-Cy3 staining pattern observed in this area. Distinct Cy3 signals were also detected in peritubular capillaries of the kidney (Fig.
3c, arrow). Staining of tubular cells was diffuse, with a tendency for Cy3-siRNA
accumulation towards the lumen of the tubuli, indicative for secretion of free siRNA by the kidney. Altogether, the quantitative and qualitative analysis of siRNA
distribution by the DACC9 delivery system revealed siRNA uptake to occur mainly in the lungs, but distinct siRNA-Cy3 derived signals were also detected in the microvasculature of heart, liver and kidney as well as in phagocytic cells of liver and spleen.
Example 5: Inhibition of target gene expression by DACC9 in lung vasculature To test whether siRNA delivered by DACC9 is functionally active and can be used for inhibition of target gene expression in vascular beds, DACC formulations with siRNAs specific for the target gene Tie-2 were prepared. Tie-2 expression is highly specific for endothelial cells and it is a common marker for this cell type in many organs (van der Heijden, M et al., Expert Opin Ther Targets 13: 39-53). RNAi activity of DACC/siRNATie-2 was first tested in vitro. Human umbilical vein endothelial cells (HUVECs) were transfected with DACC9/siRNATie-2, and Tie-2 protein expression was assessed in cell lysates by immuno-blotting after 72 hours. The results are shown in Fig. 4a.
Tie-2 expression was significantly reduced by DACC9i5iRNATie-2 at a dose of 160 and 80 nM
siRNA, and to a lesser extent 40 nM siRNA, (Fig. 4a), which confirmed that DACC9 can functionally deliver siRNA into cells and mediate RNAi. It should be noted that these concentrations are not reflective of the siRNAs IC50s, since DACC9 is not optimized for cell culture transfection experiments, and lower concentrations can be used in the latter.
To investigate whether DACC9 is capable of gene silencing in the vascular endothelium in vivo, mice were given three doses of DACC9 lipoplexes on consecutive days by tail vein injection (3x2.8 mg/kg). Lung, heart, liver, and kidney tissues were collected 24 hours after the last treatment. Total mRNA was prepared from whole tissue lysates, and target mRNA
levels were assessed by quantitative RT-PCR. The results are shown in Figs. 4b-e. Tie-2 mRNA levels were reduced by over 80 % in the lung tissue of mice treated systemically with DACC9/siRNATie-2 as compared to control treatments with either DACC9/siRNAc0ntr0l or with sucrose solution (Fig. 4b). No significant Tie-2 knock-down was observed in liver, kidney, and heart tissue even after repeated dosing of DACC9/5iRNAT1e-2 formulation (Figs. 4c-e), indicating that the lungs are the primary organ functionally targeted by DACC9/siRNATie-2.
Example 6: DACC/siRNA dose responsiveness of target gene expression To further investigate the dose requirements for target gene inhibition by DACC9 lipoplexes in mice, single doses of 3.0, 1.5 and 0.75 mg siRNA/kg body weight of DACC9/siRNATie-2 or DACC9siRNAcD311 were administered by intravenous tail-vein bolus injection.
Lung tissue was collected 24 hours post injection for RNA analysis. The results for inhibition of Tie-2 target gene expression are shown in Fig. 5a.
Surprisingly, already a single dose of DACC9/siRNATie-2 (3.0 mg siRNA/kg) injected by bolus treatment sufficed to reduce Tie-2 mRNA levels similar to those obtained after repeated dosing as described for Fig. 4b (3x2.8 mg siRNA/kg) (compare, Figs. 5a and 4b). 1.5 mg siRNA/kg was also effective in reducing Tie-2 expression, but to a lesser extent, and 0.75 mg siRNA/kg did not affect Tie-2 levels significantly. Since all DACC9 applications described so far were performed by bolus injection, but application via infusion is the preferred mode of lipoplex delivery in humans, different doses of DACC9/siRNATie-2 were administered into the jugular vein of mice by 1 hour infusions. Such administration by mode of infusion (the infusion is administered over a period of time of about 1 h), is a prerequisite in clinical settings. The results are shown in Fig. 5b.
Target gene silencing after DACC9/siRNATie-2 infusion was comparable to that by bolus injection at 3 mg siRNA/kg body weight. Tie-2 mRNA levels in lung tissue were reduced by approximately 80 %. Since this mode of application enabled the use of larger volumes of DACC9 lipoplexes as compared to bolus injection, doses administered were increased to 6 mg siRNA/kg and/or 12 mg siRNA/kg, respectively. This increase in lipoplex concentration was shown to reduce Tie-2 expression levels even further to over 95% (Fig. 5b).
Nonetheless, all animals tolerated infusion treatment of DACC9/siRNAT1e-2 even at highest dosage (12mg/kg) (Fig. 5b).
Based on the above data an EC50 in the mouse of about 1.5 mg siRNA/kg for inhibition of Tie-2 expression in the lungs using a single dose, but higher doses of 3 mg/kg (bolus) and up to 6 mg/kg (infusion) were also tolerated. However, higher single doses of siRNA lipoplexes had unfavorable effects on body weight development, showing a drop of over 10 % at the 12 mg siRNA/kg dose levels (compared to negligible weight loss at a dose of 3 and 1 mg siRNA/kg (data not shown). From a clinical standpoint, the observed low and one-time dosing is favorable for subsequent toxicity profiling.

Example 7: Duration of target inhibition and verification of RNAi-mediated knock-down mediated by DACC
To assess duration of target gene inhibition by DACC9 lipoplexes, mice were treated with a single dose (2.8 mg/kg) of DACC9/siRNAT1e-2 or DACC9/siRNAANGPT2 and cohorts were sacrificed 3, 7, 14 and 21 days post treatment (p.t.). Tie-2 target mRNA
levels in the respective lung tissue were quantified by quantitative RT-PCR. The results are shown in Fig.
6a.
Most prominent reduction of Tie-2 expression in the DACC9/siRNATie-2 treatment group was observed three days p.t. with lipoplexes (over 80 % Tie-2 reduction compared to DACC9 control groups). Nonetheless, Tie-2 mRNA levels were still reduced by over 50 % (Fig. 6a) after 21 days, as compared to control groups treated either with sucrose or with control DACC9 lipoplex. Remarkably, a single dose of DACC9 lipoplex (2.8 mg siRNA/kg) was shown to reduce mRNA levels of the target gene Tie-2 by 60-90 % (Fig. 6a), with this silencing effect persisting for up to three weeks.
To confirm that the reduction in Tie-2 mRNA leads to a corresponding reduction of Tie-2 protein, lung tissue homogenates were prepared frorh mice 3 and 21 days after treatment with DACC9 lipoplex or with sucrose as vehicle control, respectively. Tie-2 protein was detected by Western blotting as shown in Fig. 6b. Most prominent reduction of Tie-2 protein levels were seen three days after treatment, corresponding to the respective decrease of Tie-2 mRNA
levels, and were shown to gradually subside over time. However a profound reduction of Tie-2 protein expression was still observed 21 days after treatment. Furthermore, Tie-2 mRNA
levels remain reduced by over 70 % after 21 days.

Example 8: Inhibition of additional target genes in the pulmonary endothelium by DACC/siRNA
In order to confirm that the DACC9 delivery system is also capable of inhibiting other genes expressed in the pulmonary endothelium apart from Tie-2, DACC9 lipoplexes were prepared with specific siRNAs for other gene targets whose expression is highly restricted to endothelial cells: the VEGFR2 receptor, VE-cadherin, BMPR2 and the CD31 gene with the sequences of the respective siRNAs being as indicated in Example 1. Treating mice with a single injection (2.8 mg siRNA/kg) of DACC9/siRNAvEGFR2, DACC9/siRNAVE-Cadherin, DACC9/siRNABMPR-2, or DACC9/siRNAc 31 reduced mRNA levels of respective target genes by 60-90 % as shown in Fig. 7. The observed reduction of mRNA levels thus demonstrates that DACC9 lipoplexes are capable of functionally delivering siRNA to the vascular endothelium, thereby enabling target-specific gene silencing in this tissue type.
Furthermore, merely a single application of DACC9 lipoplexes was sufficient for down-regulating the expression of the respective target genes in lung vasculature.
Example 9: DACC/siRNAc 31 treatment increases survival in experimental lung metastasis mouse model CD31/Pecam1 is a cell surface protein required for homotypic as well as heterotypic cell interactions. It is involved in multiple processes of tumorigenesis, like angiogenesis, vascular permeability and metastases (Cao, G et al. (2009), Am J Pathol 175: 903-915;
DeLisser, H et al. (2010), Proc Natl Acad Sci USA 107: 18616-18621). It was also demonstrated in previous studies that targeting CD31 by RNA interference leads to reduction of tumor growth in subcutaneous xenograft tumor models and in orthotopic prostate cancer model (Santel, A, et al. (2006), Gene Ther 13: 1360-1370).
In the instant study it was investigated whether DACC9/siRNAcD31 could be employed therapeutically in the treatment of lung cancer. To this end, it was tested whether treatment with DACC9/siRNA0D31 had a therapeutic benefit in an experimental lung metastasis mouse model (Santel, A et al. (2010), Clin Cancer Res 16: 5469-5480.). In this model, Lewis lung carcinoma cells (LL) are applied intravenously to syngeneic BDF1 mice, thus leading to colonization of tumor cells in the lungs and subsequent outgrowths of pulmonary metastases.
ciferase DACC9/siRNAcD31, control lipoplexes DACC9/siRNAlu , and sucrose as vehicle control were prepared and injected into mice five days prior to LL tumor cell i.v injection.
Treatment by bolus injection (2.8 mg/kg) was repeated on alternating days until day 15 (Fig.
8a).
Body weight was monitored continuously. Decrease in body weight due to DACC9 lipoplex application during the treatment period was not observed as may be taken from Fig. 8b.
Survival of animals was monitored by defined endpoint criteria for up to 70 days after tumor cell challenge. The results are shown in Fig. 8c. Survival of animals which received DACC9/siRNAcD31 was significantly enhanced as compared to control treatment group that cifeas received sucrose (p < 0.006, log-rank test) or DACC9/5iRNAlu re < 0.001). Animals treated with isotonic sucrose solution or luciferase control lipoplexes showed poor survival: in the sucrose control group, none of the animals survived past 30 days, and only two animals of luci the DACC9/siRNA rase controlgroup survived up to day 70. In comparison, 7 of 8 animals receiving DACC9/siRNAcD31 survived up to day 70. CD31 expression was evaluated after completion of the treatment phase on day 16 after tumor cell challenge in separate cohorts (Fig. 8a). Compared to animals treated with DACC9/siRNAluciferase or sucrose as vehicle control, CD31 expression in lungs of animals treated with DACC9/siRNAcD31 was reduced by approximately 80 % (Fig. 8d) confirming that CD31 expression could be targeted by DACC9 lipoplexes in a therapeutic setting.
Example 10: Prevention of induction of ANG2 by LPS in mice by DACC/siRNAANG2 C57BL6 mice were treated intravenously with the indicated doses of DACC9 lipoplex or with sucrose solution. 48 hours later, mice were challenged with LPS (0.5 mg/kg, i.v.) or saline (0.9% NaC1). Lung tissues were collected 6 hours after the LPS treatment and processed for RNA isolation (see Fig. 9a). ANGPT2 mRNA levels in lung tissue samples were determined by qRT-PCR. Actin mRNA levels were used as normalizer. Other aspects of the experiment related to materials and methods used, were carried out in accordance with Example 1.
The results are shown in Fig. 9b. As may be taken from Fig. 9b, the sucrose treatment groups LPS induced elevation of ANGPT2 mRNA levels in lung tissue. DACC9/ANGPT2 siRNA

treatment reduced ANGPT2 induction in a dose dependent manner.
Example 11: DACC/siRNA treatment increases survival in S. pneumoniae infected lung model (mouse) Male specific pathogen free ICR mice weighing 20 to 22g were treated with DACC9 lipoplex (2.8 mg siRNA/kg body weight) or sucrose as vehicle control for the lipoplex by tail vein injection. 24 hours later, all mice were infected intratracheally with Streptococcus pneumoniae (ATCC 6301) with LD 90-100 dose (0.02m1, 7-9 x 106 CFU) to induce acute pneumonia. 2 hours after infection a single suboptimal dose of Ampicillin, "AMP", (3 mg/kg) or 0.9% NaC1 was given by intravenous route. Survival of mice is monitored up to 10 days after infection (see Fig. 10a). Other aspects of the experiment related to materials and methods used, were carried out in accordance with Example 1. The results are shown in Fig.
10b.
As may be taken from Fig. 10b, without treatment with Ampicillin, mice died within 3 days after infection with S. pneumonia. Only a moderate increase in survival was observed by single dose of Ampicillin. DACC9/Angpt2 siRNA (DACC9/siRNAAngpt2) pretreatment in addition to Ampicillin treatment enhances survival of mice significantly.
Survival of >50% of animals indicates significant activity of test substance.

Example 12: Reduction of EDN-1 expression in mice The purpose of this animal study was to evaluate different delivery systems for targeting the endothelin 1 coding gene EDN1. The experimental set-up and treatment scheme for the mice is outlined in Fig. 11.
Mice were treated with a single dose of an EDN1-targeting siRNA referred to as EDN1-hmr2 (consisting of two separate strands which are 100% complementary to each other, whereby each strand consists of 19 nucletoides) formulated with DACC9, DACC10 or with three doses of EDN1-hmr2 siRNA formulated with Atuplex by bolus application. Control lipoplexes contained siRNA targeting the gene coding for soluble VEGF receptor 1 (sFlt1) which is referred to as sFLT1-hm4. Target gene expression was analyzed in lung tissues 48 hours post treatment.
The results are shown in Figs. 12. From said Fig. 12 it is evident that for the purpose of delivery siRNA to lung tissue siRNA formulated with either DACC9 or DACC10 is more potent than siRNA formulated with Atuplex.
All of the references recite herein are herewith incorporated by reference.
The features of the present invention disclosed in the specification, the claims and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.

Claims (121)

Claims
1. A
composition comprising a lipid composition, wherein the lipid composition consists of a cationic lipid of formula (I) wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1, 2 and 3, Y- is an anion, wherein each of R1 and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl;
a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II) wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and p is any integer from 15 to 130;
a PEGylated ceramide of formula (III) wherein R5 is linear C7-C15 alkyl, and q is any integer from 15 to 130;
and a PEGylated diacylglycerol of formula (IV) wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and r is any integer from 15 to 130.
2. The composition of claim 1, wherein R1 and R2 are different from each other.
3. The composition of claim 1, wherein R1 and R2 are the same.
4. The composition of any one of claims 1 to 3, wherein each of R1 and R2 is individually and independently selected from the group consisting of C12 alkyl, C14 alkyl, C16 alkyl, C18 alkyl, C12 alkenyl, C14 alkenyl, C16 alkenyl and C18 alkenyl.
5. The composition of claim 4, wherein each of C12 alkenyl, C14 alkenyl, C16 alkenyl and C18 alkenyl comprises one or two double bonds.
6. The composition of claim 5, wherein C18 alkenyl is C18 alkenyl with one double bond between C9 and C10, preferably cis-9-octadecyl].
7. The composition of any one of claims 1 to 6, wherein R1 and R2 are different and R1 is palmityl and R2 is oleyl.
8. The composition of any one of claims 1 to 6, wherein R1 and R2 are different and wherein R1 is lauryl and R2 is myristyl.
9. The composition of any one of claims 1 to 8, wherein the cationic lipid is a compound of formula (Ia) (Ia)
10. The composition of any one of claims 1 to 9, wherein Y- is selected from the group comprising halogenids, acetate and trifluoroacetate.
11. The composition of claim 10, wherein Y- is Cl-.
12. The composition of any one of claims 1 to 11, wherein the cationic lipid is .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride of formula (Ib):
13. The composition of any one of claims 1 to 11, wherein the cationic lipid is 3-arginyl-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride of formula (Ic):
14. The composition of any one of claims 1 to 11 wherein the cationic lipid is .epsilon.-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride of formula (Id):
15. The composition of any one of claims 1 to 14, wherein the sterol compound is cholesterol.
16. The composition of any one of claims 12 to 14, preferably claim 14, wherein the sterol compound is cholesterol.
17. The compound of any one of claims 1 to 14, wherein the sterol compound is stigmasterin.
18. The composition of any one of claims 12 to 14, preferably claim 14, wherein the sterol compound is stigmasterin.
19. The composition of any one of claims 1 to 18, preferably any one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEG moiety of the PEGylated lipid has a molecular weight from about 800 to about 5000 Da.
20. The composition of claim 19, wherein the molecular weight of the PEG
moiety of the PEGylated lipid is about 800 Da.
21. The composition of claim 19, wherein the molecular weight of the PEG
moiety of the PEGylated lipid is about 2000 Da.
22. The composition of claim 19, wherein the molecular weight of the PEG
moiety of the PEGylated lipid is about 5000 Da.
23. The composition of any one of claims 1 to 22, preferably any one of claims 19 to 22, wherein the PEGylated lipid is a PEGylated phosphoethanolamine of formula (II), wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and p is any integer from 18, 19 or 20, or from 44, 45 or 46 or from 113, 114 or 115.
24. The composition of claim 23, wherein R3 and R4 are the same.
25. The composition of claim 23, wherein R3 and R4 are different.
26. The composition of any one of claims 23 and 25, wherein each of R3 and R4 is individually and independently selected from the group consisting of C13 alkyl, C15 alkyl and C17 alkyl.
27. The composition of any one of claims 1 to 26, preferably one of claims 12 to 14, more preferably any one of claims 14 and 16, wherein the PEGylated phosphoethanolamine of formula (II) is
28. The composition of any one of claims 1 to 26, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated phosphoethanolamine of formula (II) is
29. The composition of any one of claims 1 to 22, preferably any one of claims 19 to 22, wherein the PEGylated lipid is a PEGylated ceramide of formula (III), wherein R5 is linear C7-C15 alkyl, and q is any integer from 18, 19 or 20, or from 44, 45 or 46 or from 113, 114 or 115.
30. The composition of claim 29, wherein R5 is linear C7 alkyl.
31. The composition of claim 30, wherein R5 is linear C15 alkyl.
32. The composition of any one of claims 1 to 22 and 29 to 31, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated ceramide of formula (III) is
33. The composition of any one of claims 1 to 22 and 29 to 31, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated ceramide of formula (III) is
34. The composition of any one of claims 1 to 22, preferably any one of claims 19 to 22, wherein the PEGylated lipid is a PEGylated diacylglycerol of formula (IV), wherein each of R6 and R7 is individually and independently linear C11-C17 alkyl, and r is any integer from 18, 19 or 20, or from 44, 45 or 46 or from 113, 114 or 115.
35. The composition of claim 34, wherein R6 and R7 are the same.
36. The composition of claim 34, wherein R6 and R7 are different.
37. The composition of any one of claims 34 to 36, wherein each of R6 and R7 is individually and independently selected from the group consisting of linear C17 alkyl, linear C15 alkyl and linear C13 alkyl.
38. The composition of any one of claims 1 to 22 and 34 to 37, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is
39. The composition of any one of claims 1 to 22 and 34 to 36, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is
40. The composition of any one of claims 1 to 22 and 34 to 36, preferably one of claims 12 to 14, more preferably any one of claims 16 and 18, wherein the PEGylated diacylglycerol of formula (IV) is
41. The composition of any one of claims 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride .beta.-arginyl-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride and .epsilon.-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated phosphoethanolamine of formula (II), wherein the PEGylated phosphoethanolamine is selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt) 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000]
(ammonium salt)
42. The composition of any one of claims 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride .beta.-arginyl-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride and .epsilon.-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated ceramide of formula (III), wherein the PEGylated ceramide is selected from the group consisting of N-octanoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)2000]}
and N-palmitoyl-sphingosine-1- {succinyl[methoxy(polyethylene glycol)2000]}
43. The composition of any one of claims 1 to 40, wherein the cationic lipid of formula (I) is selected from the group consisting of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride .beta.-arginyl-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride and .epsilon.-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterin; and wherein the PEGylated lipid is a PEGylated diacylglycerol of formula (IV), wherein the PEGylated diacylglycerol is selected from the group consisting of 1,2-Distearoyl-sn-glycerol [methoxy(polyethylene glycol)2000]
1,2-Dipalmitoyl-sn-glycerol [methoxy(polyethylene glycol)2000]
44. The composition of any one of claims 1 to 43, preferably of any one of claims 41 to 43, wherein the cationic lipid is .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride the sterol compound is cholesterol, and the PEGylated lipid is PEGylated phosphoethanolamine of formula (II) is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt)
45. The composition of any of clams 1 to 44, preferably any of claims 41 to 44 and more preferably claim 44, wherein, in the lipid composition, the content of the cationic lipid composition is from about 65 mole % to about 75 mole %, the content of the sterol compound is from about 24 mole % to about 34 mole % and the content of the PEGylated lipid is from about 0.5 mole % to about 1.5 mole %, wherein the sum of the content of the cationic lipid, of the sterol compound and of the PEGylated lipid for the lipid composition is 100 mole %.
46. The composition of claim 45, wherein, in the lipid composition, the content of the cationic lipid is about 70 mole %, the content of the sterol compound is about 29 mole % and the content of the PEGylated lipid is about 1 mole %.
47. A composition of any of the preceding claims, wherein the lipid composition is as follows:
70 mole % of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride 29 mole % of cholesterol, and 1 mole % of 1,2-di stearoyl-sn-glycero-3 -phosphoethanol amine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt)
48. The composition of any one of claims 1 to 47, wherein the composition comprises a carrier, preferably the carrier is a pharmaceutically acceptable carrier.
49. The composition of claim 48, wherein the carrier is selected from the group comprising water, an aqueous solution, preferably an isotonic aqueous solution, a salt solution, preferably an isotonic salt solution, a buffer, preferably an isotonic buffer, and a water miscible solvent.
50. The composition of claim 49, wherein the carrier is a water miscible solvent and wherein the water miscible solvent is selected from the group consisting of ethanol and tertiary butanol
51. The composition of any one of claims 48 to 50, wherein the carrier is an aqueous sucrose solution, preferably a 270 mM aqueous sucrose solution.
52. The composition according to any one of the preceding claims, wherein the lipid composition is as follows:
70 mole % of 13-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride 29 mole % of cholesterol, and 1 mole % of PEGylated phosphoethanolamine of formula (II), wherein the PEGylated phosphoethanolamine of formula (II) is 1,2-di stearoyl-sn-glycero-3 -phosphoethanolamine-N4methoxy(polyethylene glycol)-2000]
(ammonium salt) and wherein the composition comprises a 270 mM aqueous sucrose solution.
53. The composition according to any one of claims 48 to 52, wherein the lipid composition forms particles in the carrier.
54. The composition of claim 53, wherein the particles have a Z-average size according to DLS measurement of about 30 nm to about 150 nm.
55. The composition of claim 54, wherein the particles have a Z-average size according to DLS measurement of about 50 nm to about 100 nm.
56. The composition of any one of claims 53 to 55, wherein the Z-average size according to DLS measurement of the particles is about 60 - 80 nm as determined by dynamic light scattering.
57. The composition of any one of claims 1 to 56, preferably any one of claims 48 to 56, wherein the composition, determined at a temperature of 20 °C and in a 270 mM sucrose solution, has a zeta potential of about + 25 to about + 80 mV, preferably of about + 30 mV to about + 60 mV, more preferably of about + 46 mV.
58. The composition of any one of claims 1 to 57, preferably any one of claims 41 to 57 and more preferably any one of claims 47 and 52, wherein the composition further comprises a chemical compound, wherein the chemical compound is a biologically active agent or a pharmaceutically active agent.
59. The composition of any one of claims 1 to 57, preferably any one of claims 41 to 57 and more preferably any one of claims 47 and 52, wherein the composition further comprises a chemical compound, wherein the chemical compound is capable of being delivered by the lipid composition into and/or to a cell.
60. The composition of claim 59, wherein the cell is a cell of a mammal, preferably the mammal is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse.
61. The composition of any one of claims 59 to 60, wherein the cell is a pulmonary endothelial cell, preferably the cell is a human pulmonary endothelial cell.
62. The composition of any one of claims 58 to 61, wherein the chemical compound is selected from the group comprising an oligonucleotide, a polynucleotide, a nucleic acid, a peptide, a polypeptide, a protein and a small molecule.
63. The composition of claim 62, wherein the chemical compound is a nucleic acid and wherein the nucleic acid is selected from the group comprising RNA, DNA, PNA
and LNA.
64. The composition of claim 62, wherein the nucleic acid is a functional nucleic acid, preferably the functional nucleic acid is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer a spiegelmer and mRNA.
65. The composition of claim 62, wherein the polynucleotide is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer, a spiegelmer and mRNA.
66. The composition of claim 62, wherein the oligonucleotide is selected from the group comprising an siRNA, a microRNA, an siNA, a RNA interference mediating nucleic acid, an antisense nucleic acid, a ribozyme, an aptamer and a spiegelmer.
67. The composition of any one of claims 62 and 66, wherein the oligonucleotide forms a complex with the lipid composition.
68. The composition of any one of claims 1 to 67, preferably of any one of claims 41 to 47 and 53 to 56, wherein the composition comprises an siRNA molecule.
69. The composition of claim 68, wherein the siRNA molecule is targeting ANG2.
70. The composition of claim 70, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
71. The composition of claim 70, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
72. The composition of claim 62, wherein the chemical compound is a protein and wherein the protein is selected from the group comprising an antibody, a cytokine and an anticaline.
73. The composition of any one of the preceding claims, wherein the lipid composition is as follows:
70 mole % of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride 29 mole % of cholesterol, and 1 mole % of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [methoxy(polyethylene glycol)-2000]
(ammonium salt) wherein the composition comprises, preferably as a or the carrier, a 270 mM
aqueous sucrose solution.; and wherein the composition comprises a chemical compound, wherein the chemical compound is selected from the group comprising an siRNA, microRNA, siNA and a RNA
interference mediating compound, preferably the chemical compound is (a) a or the biologically or pharmaceutically active agent and/or (b) is capable of being delivered by the lipid composition into and/or to a cell, more preferably to a mammalian pulmonary endothelial cell.
74. The composition according to any one of claims 1 to 73, preferably any one of claims 58 to 73 and more preferably clam 73, wherein the chemical compound is a functional nucleic acid and wherein the ratio between the charged lipid nitrogen atoms to the nucleic acid backbone phosphates (N/P ratio) is about from 3 to 12, preferably about from 5 to 10 and more preferably about from 8 to 9 and most preferably about 8.4
75. The composition of any one of claims 73 and 74, wherein the composition comprises an siRNA molecule.
76. The composition of claim 75, wherein the siRNA molecule is targeting ANG2.
77. The composition of claim 76, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
78. The composition of claim 77, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
5 'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5 'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
79. The composition of any one of claims 73 to 78, preferably of claim 78, wherein the composition comprises 0.28 mg/ml of siRNA and 2.4 mg/ml total lipids.
80. The composition of any one of the preceding claims, wherein the lipid composition is as follows:
70 mole % of .beta.-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride 29 mole % of cholesterol, and 1 mole % of 1,2-di stearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]
(ammonium salt) wherein the composition comprises, preferably as a or the carrier, a 270 mM
aqueous sucrose solution;
wherein the composition comprises a chemical compound, wherein the chemical compound is selected from the group comprising an siRNA, microRNA and siNA, preferably the chemical compound is (a) a or the biologically or pharmaceutically active agent and/or (b) is capable of being delivered by the lipid composition into and/or to a cell, more preferably to a mammalian pulmonary endothelial cell; and wherein the ratio between the charged lipid nitrogen atoms to the nucleic acid backbone phosphates (N/P ratio) is about 8 to 9, preferably about 8.4.
81. The composition of claim 80, wherein the composition comprises an siRNA
molecule.
82. The composition of claim 81, wherein the siRNA molecule is targeting ANG2.
83. The composition of claim 82, wherein the ANG2 targeting siRNA molecule comprises one or both of the following two sequences:
5'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
84. The composition of claim 83, wherein the ANG 2 targeting siRNA molecule comprises the following two sequences:
'AgUuGgAaGgAcCaCaUgC 3' (SEQ ID NO: 1) and 5 'gCaUgUgGuCcUuCcAaCu 3' (SEQ ID NO: 2), preferably the nucleotides indicated as capital letter are 2'-O-methyl.
85. The composition of any one of claims 80 to 84, preferably of claim 84, wherein the composition comprises 0.28 mg/ml of siRNA and 2.4 mg/ml total lipids.
86. The composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85, for use in a method for the treatment and/or prevention of a disease of a subject.
87. The composition of claim 86, wherein the method comprises administering to a subject in need thereof an effective amount of the composition, preferably a therapeutically effective amount of the composition.
88. The composition of any one of claims 86 to 87, wherein the composition delivers the chemical compound into a cell of the subject.
89. The composition of claim 88, wherein the cell is a pulmonary endothelial cell.
90. The composition of claim 89, wherein the chemical compound provides for a therapeutic effect in the pulmonary endothelial cell, preferably the chemical compound targets and more preferably inhibits a target molecule within the cell, whereupon the therapeutic effect is achieved.
91. The composition of claim 90, wherein the target molecule is involved in the pathological mechanism underlying the disease.
92. The composition of any one of claims 86 to 91, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
93. The composition of any one of claims 86 to 92, wherein the subject is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse.
94. The composition of any one of claims 86 to 93, wherein the composition is administered to the subject by means of intravenous administration or by means of inhalation.
95. Use of the composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85, for the manufacture of a medicament for the treatment and/or prevention of a disease.
96. Use of claim 95, wherein the disease is a disease where a target molecule involved in the pathological mechanism underlying the disease is present in a pulmonary endothelial cell and the inhibition of the target molecule provides a therapeutic effect.
97. Use of any one of claims 95 to 96, wherein the chemical compound of the composition targets and more preferably inhibits the target molecule within the cell, whereupon the therapeutic effect is achieved.
98. Use of any one of claims 95 to 97, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
99. Use of any one of claims 95 to 98, wherein the medicament is for intravenous administration.
100. A pharmaceutical composition comprising a composition of any one of claims 1 to 85, preferably a composition of any one of claims 58 to 85 and more preferably of claims 73 to 85, and a pharmaceutically acceptable carrier.
101. The pharmaceutical composition of claim 100, wherein the chemical composition of the composition of any one of claims 1 to 85, preferably a composition of any one of claims 58 to 850 and more preferably of claims 73 and 85, is a or the pharmaceutically active agent.
102. The pharmaceutical composition of any one of claims 100 to 101, wherein the carrier of the composition of any one of claims 1 to 85, preferably a composition of any one of claims 57 to 85 and more preferably of claims 73 to 85, is a or the pharmaceutically acceptable carrier.
103. The pharmaceutical composition of any one of claims 100 to 102, wherein the pharmaceutical composition is for use in the treatment and/or prevention of a disease, whereby the disease is defined as in any of claims 95 to 99.
104. Use of the composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85, as a transferring agent.
105. Use of claim 104, wherein the transferring agent transfers a biologically active or pharmaceutically active compound into a cell, preferably a mammalian cell and more preferably a human cell.
106. Use of claim 105, wherein the cell is a pulmonary endothelial cell, preferably a human pulmonary endothelial cell.
107. Use of any of claims 104 to 106, wherein the chemical compound of the chemical composition is the biologically active agent or the pharmaceutically active agent.
108. A kit comprising a composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85, and instructions of use.
109. A method for transferring a biologically active compound or a pharmaceutically active compound into a cell or across a membrane of a cell, wherein the method comprises the step of contacting the cell or the membrane of a cell with a composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85, and the biologically active compound or pharmaceutically active compound.
110. The method of claim 109, wherein the method comprises the step of detecting the biologically active compound or the pharmaceutically active compound in the cell and/or beyond the membrane of a cell.
111. The method of any one of claims 109 to 110, wherein the biologically active compound or the pharmaceutically active compound is the chemical compound of the composition of any one of claims 58 to 85.
112. A method for the treatment and/or prevention of a disease, wherein the method comprises administering to a subject in need thereof an effective amount of a composition of any one of claims 1 to 85, preferably of any one of claims 58 to 85 and more preferably of any one of claims 73 to 85
113. The method of claim 112, wherein the composition delivers the chemical compound into a cell of the subject.
114. The method of claim 113, wherein the cell is a pulmonary endothelial cell.
115. The method of claim 114, wherein the chemical compound provides for a therapeutic effect in the pulmonary endothelial cell, preferably the chemical compound targets and more preferably inhibits a target molecule within the cell, whereupon the therapeutic effect is achieved.
116. The method of claim 115, wherein the target molecule is involved in the pathological mechanism underlying the disease.
117. The method of any one of claims 112 to 116, wherein the disease is selected from the group comprising acute lung injury, acute respiratory distress syndrome, lung cancer, pulmonary metastasis, pulmonary hypertension and pulmonary artery hypertension.
118. The method of any one of claims 112 to 117, wherein the subject is selected from the group comprising man, mouse, rat, rabbit, hamster, guinea pig, monkey, dog, cat, pig, sheep, goat, cow and horse, preferably the subject is man.
119. A method for the manufacture of a medicament, wherein the method comprises formulating a composition according to any one of claims 1 to 85 with a pharmaceutically active agent.
120. The method of claims 119, wherein the medicament is for the treatment and/or prevention of a disease as described in any of the preceding claims.
121. The method of any one of claims 119 to 120, wherein the pharmaceutically active agent is a compound suitable for the treatment of a lung disease.
CA2932626A 2013-12-05 2014-12-05 Means for lung specific delivery Abandoned CA2932626A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP13005672.4 2013-12-05
EP13005672 2013-12-05
PCT/EP2014/003274 WO2015082080A1 (en) 2013-12-05 2014-12-05 Means for lung specific delivery

Publications (1)

Publication Number Publication Date
CA2932626A1 true CA2932626A1 (en) 2015-06-11

Family

ID=49758972

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2932626A Abandoned CA2932626A1 (en) 2013-12-05 2014-12-05 Means for lung specific delivery

Country Status (8)

Country Link
US (2) US20160303047A1 (en)
EP (1) EP3076950A1 (en)
JP (1) JP2016540769A (en)
KR (1) KR20160095003A (en)
CN (1) CN105873568B (en)
AU (1) AU2014359716A1 (en)
CA (1) CA2932626A1 (en)
WO (1) WO2015082080A1 (en)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016083624A1 (en) * 2014-11-28 2016-06-02 Silence Therapeutics Gmbh Means for inhibiting the expression of edn1
CN110114461A (en) 2016-08-17 2019-08-09 博德研究所 Novel C RISPR enzyme and system
US20200283743A1 (en) 2016-08-17 2020-09-10 The Broad Institute, Inc. Novel crispr enzymes and systems
CA3043768A1 (en) 2016-11-29 2018-06-07 PureTech Health LLC Exosomes for delivery of therapeutic agents
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
WO2019046809A1 (en) * 2017-08-31 2019-03-07 Modernatx, Inc. Methods of making lipid nanoparticles
CA3073848A1 (en) 2017-09-21 2019-03-28 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
EP3710039A4 (en) 2017-11-13 2021-08-04 The Broad Institute, Inc. Methods and compositions for treating cancer by targeting the clec2d-klrb1 pathway
US10968257B2 (en) 2018-04-03 2021-04-06 The Broad Institute, Inc. Target recognition motifs and uses thereof
EP3833761A1 (en) 2018-08-07 2021-06-16 The Broad Institute, Inc. Novel cas12b enzymes and systems
EP3852728B1 (en) 2018-09-20 2024-09-18 ModernaTX, Inc. Preparation of lipid nanoparticles and methods of administration thereof
WO2020191102A1 (en) 2019-03-18 2020-09-24 The Broad Institute, Inc. Type vii crispr proteins and systems
EP3865122A1 (en) * 2020-02-11 2021-08-18 Pantherna Therapeutics GmbH Lipid composition and use thereof for delivery of a therapeutically active agent to endothelium
CN115154439B (en) * 2022-09-08 2022-12-09 南京澄实生物科技有限公司 mRNA lipid nanoparticle delivery system and preparation method and application thereof

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE318832T1 (en) 1990-06-11 2006-03-15 Gilead Sciences Inc METHOD FOR USING NUCLEIC ACID LIGANDS
DE59708838D1 (en) 1996-08-30 2003-01-09 Jens Peter Fuerste MIRROR SELECTION AND MIRROR EVOLUTION OF NUCLEIC ACIDS
US5989912A (en) 1996-11-21 1999-11-23 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US5849902A (en) 1996-09-26 1998-12-15 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US6395713B1 (en) 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
CN1294891A (en) * 1999-11-05 2001-05-16 洛阳百合轻工业有限公司 Once-used degradable health Mongolian oak leaf tableware
EP1432724A4 (en) 2002-02-20 2006-02-01 Sirna Therapeutics Inc Rna interference mediated inhibition of map kinase genes
CN1968714B (en) * 2004-05-05 2013-10-16 赛伦斯治疗公司 Lipids, lipid complexes and use thereof
EP1830888B1 (en) * 2004-12-27 2015-08-05 Silence Therapeutics GmbH Lipid complexes coated with peg and their use
CA2649630C (en) * 2006-04-20 2016-04-05 Silence Therapeutics Ag Lipoplex formulations for specific delivery to vascular endothelium
WO2009067243A2 (en) * 2007-11-20 2009-05-28 Isis Pharmaceuticals Inc. Modulation of cd40 expression
US8829179B2 (en) * 2009-02-18 2014-09-09 Silence Therapeutics Gmbh Means for inhibiting the expression of ANG2

Also Published As

Publication number Publication date
CN105873568A (en) 2016-08-17
KR20160095003A (en) 2016-08-10
CN105873568B (en) 2019-10-08
WO2015082080A1 (en) 2015-06-11
EP3076950A1 (en) 2016-10-12
JP2016540769A (en) 2016-12-28
US20160303047A1 (en) 2016-10-20
AU2014359716A1 (en) 2016-06-09
US20190038557A1 (en) 2019-02-07

Similar Documents

Publication Publication Date Title
US20190038557A1 (en) Means for lung specific delivery
JP6442551B2 (en) Method for producing lipid nanoparticles for drug delivery
US8598333B2 (en) SiRNA silencing of genes expressed in cancer
US7838658B2 (en) siRNA silencing of filovirus gene expression
CA2565633C (en) Lipids, lipid complexes and use thereof
JP2022544652A (en) Improved Lipid Nanoparticles for Delivery of Nucleic Acids
US20190015330A1 (en) Liposomes comprising a calcium phosphate-containing precipitate
EP2459724B1 (en) Cell-targeting nanoparticles comprising polynucleotide agents and uses thereof
TW201623614A (en) Compositions and methods for silencing hepatitis B virus gene expression
JP2008537752A5 (en)
JP2008537752A (en) RNAi therapeutic compositions and methods for treating cancer and other neovascular diseases
Grijalvo et al. Oligonucleotide delivery: a patent review (2010–2013)
WO2017135397A1 (en) Antisense oligonucleotide for suppressing expression of complement b factor
KR20220124170A (en) Exosome-based therapy for liver fibrosis and other fibrosis-related diseases
Yin et al. Asymmetric siRNA targeting the bcl‑2 gene inhibits the proliferation of cancer cells in vitro and in vivo
Miller Delivering the promise of small ncRNA therapeutics
WO2010021389A1 (en) Nucleic acid capable of inhibiting expression of bcl-2 protein
KR20240072931A (en) Lipid nanoparticle comprising histidine and preparation method thereof
Grant-Serroukh Lipid nanoparticles for mRNA-mediated cancer therapy
Balgobind The silencing of HER2/neu gene expression in a breast cancer cell model using cationic lipid based delivery systems.
Philippou et al. DEVELOPING APTAMERS FOR THE DELIVERY OF THERAPEUTIC RNA
Lu et al. Intracellular siRNA Delivery by Multifunctional Nanoparticles
WO2017010500A1 (en) Antisense oligonucleotide inhibiting β2gpi expression

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20160628

FZDE Dead

Effective date: 20171205