CA2688292C - A process for preparing methacrylic acid or methacrylic esters - Google Patents

A process for preparing methacrylic acid or methacrylic esters Download PDF

Info

Publication number
CA2688292C
CA2688292C CA2688292A CA2688292A CA2688292C CA 2688292 C CA2688292 C CA 2688292C CA 2688292 A CA2688292 A CA 2688292A CA 2688292 A CA2688292 A CA 2688292A CA 2688292 C CA2688292 C CA 2688292C
Authority
CA
Canada
Prior art keywords
coenzyme
conversion
catalyzes
enzyme
dehydrogenase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA2688292A
Other languages
French (fr)
Other versions
CA2688292A1 (en
Inventor
Achim Marx
Markus Poetter
Stefan Buchholz
Alexander May
Hermann Siegert
Birgit Alber
Georg Fuchs
Lothar Eggeling
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Roehm GmbH
Original Assignee
Evonik Roehm GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=39736879&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2688292(C) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from PCT/EP2007/055394 external-priority patent/WO2007141208A2/en
Application filed by Evonik Roehm GmbH filed Critical Evonik Roehm GmbH
Publication of CA2688292A1 publication Critical patent/CA2688292A1/en
Application granted granted Critical
Publication of CA2688292C publication Critical patent/CA2688292C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C51/00—Preparation of carboxylic acids or their salts, halides or anhydrides
    • C07C51/347—Preparation of carboxylic acids or their salts, halides or anhydrides by reactions not involving formation of carboxyl groups
    • C07C51/377—Preparation of carboxylic acids or their salts, halides or anhydrides by reactions not involving formation of carboxyl groups by splitting-off hydrogen or functional groups; by hydrogenolysis of functional groups
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C57/00—Unsaturated compounds having carboxyl groups bound to acyclic carbon atoms
    • C07C57/02—Unsaturated compounds having carboxyl groups bound to acyclic carbon atoms with only carbon-to-carbon double bonds as unsaturation
    • C07C57/03—Monocarboxylic acids
    • C07C57/04—Acrylic acid; Methacrylic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
    • C07C69/52—Esters of acyclic unsaturated carboxylic acids having the esterified carboxyl group bound to an acyclic carbon atom
    • C07C69/533—Monocarboxylic acid esters having only one carbon-to-carbon double bond
    • C07C69/54—Acrylic acid esters; Methacrylic acid esters
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08F—MACROMOLECULAR COMPOUNDS OBTAINED BY REACTIONS ONLY INVOLVING CARBON-TO-CARBON UNSATURATED BONDS
    • C08F220/00—Copolymers of compounds having one or more unsaturated aliphatic radicals, each having only one carbon-to-carbon double bond, and only one being terminated by only one carboxyl radical or a salt, anhydride ester, amide, imide or nitrile thereof
    • C08F220/02—Monocarboxylic acids having less than ten carbon atoms; Derivatives thereof
    • C08F220/04—Acids; Metal salts or ammonium salts thereof
    • C08F220/06—Acrylic acid; Methacrylic acid; Metal salts or ammonium salts thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/52—Propionic acid; Butyric acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C12P7/625—Polyesters of hydroxy carboxylic acids

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a process for the preparation of methacrylic acid or methacrylic esters, comprising the process steps of IA) preparation of 3-hydroxyisobutyric acid by a process comprising the process step of bringing a cell which has been genetically modified in comparison with its wild type in such a way that it is capable of forming more 3-hydroxyisobutyric acid, or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid in comparison with its wild type, into contact with a nutrient medium comprising, as carbon source, carbohydrates, glycerol, carbon dioxide, methanol, L-valine or L-glutamate under conditions under which 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid are formed from the carbon source, if appropriate, isolation of the 3-hydroxyisobutyric acid from the nutrient medium and also, if appropriate, neutralization of the 3-hydroxyisobutyric acid, IB) dehydration of the 3-hydroxyisobutyric acid with formation of methacrylic acid and also, where appropriate, esterification methacrylic acid.
The invention also relates to a process for the preparation of polymethacrylic acid or polymethacrylic esters.

Description

A process for preparing methacrylic acid or methacrylic esters The present invention relates to a process for the preparation of methacrylic acid or methacrylic esters, and to a process for the preparation of polymethacrylic acid or polymethacrylic esters.
Methacrylic acid is an important intermediate which is employed for the preparation of polymers, in particular in the form of its alkyl esters. An example of a well-known methacrylic acid derivative is the methyl ester of methacrylic acid. The current global annual production of methyl methacrylate amounts to approximately 1.5 million tonnes. The polymethacrylic esters are raw materials in the plastics sector with a multiplicity of uses.
Methacrylic acid is usually produced commercially by means of the heterogeneous gas-phase oxidation of C4-carbon compounds such as butylene, isobutylene, butane, isobutane, t-butyl alcohol or methacrolein by two-step catalysis on solid multi-metal oxide compositions as the catalyst. The resulting product gas mixture, which, besides methacrylic acid, also comprises a large number of secondary products, is subsequently either subjected to a total condensation reaction, generating aqueous methacrylic acid solution, or absorbed in a suitable solvent mixture. This is usually followed by further purification of the resulting liquid phases by means of distillation, crystallization, extraction, or a combination of these measures. Besides the catalytic gas-phase oxidation of C4-carbon compounds, methacrylic acid can also be formed from isobutyric acid by catalytic oxidative dehydrogenation, as is described for example in EP-A-0 356 315. A further possibility for preparing methacrylic acid is what is known as the "ACH process", in which acetone cyanohydrin and sulfuric acid are reacted with the formation of methacrylamide as intermediate, which then reacts further with water to give methacrylic acid. The resulting methacrylic acid is subsequently purified by distillation. This process is described for example in EP-A-1 359 137.
The disadvantage of these conventional processes for the preparation of methacrylic acid is, inter alia, that during both the preparation of the methacrylic acid itself and during the subsequent steps, which involve purification by distillation, the process steps, which cause thermal stress, result, owing to the pronounced susceptibility of methacrylic acid to polymerization, in the formation of dimers or oligomers; this not only entails additional purification efforts, but also yield losses.
It was an object of the present invention to overcome the disadvantages of the prior art.
In particular, it was an object of the present invention to provide a process for the preparation of methacrylic acid which generates methacrylic acid with a minimum of steps which involve thermal stress.
Furthermore, it is intended that this process makes possible the preparation of methacrylic acid from renewable resources, in particular from carbohydrates and/or glycerol.
A contribution to achieving the abovementioned aims is provided by a process for the preparation of methacrylic acid or methacrylic esters, comprising the process steps of IA) preparation of 3-hydroxyisobutyric acid by a process comprising the process step of bringing a cell which has been genetically modified in comparison with its wild type in such a way that it is capable of forming more 3-hydroxyisobutyric acid, or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid in comparison with its wild type, into contact with a nutrient medium comprising, as carbon source, carbohydrates, glycerol, carbon dioxide, methane, methanol, L-valine or L-glutamate under conditions under which 3-hydroxyisobutyric acid or polyhydroxy-alkanoates based on 3-hydroxyisobutyric acid are formed from the carbon source, if appropriate, isolation of the 3-hydroxyisobutyric acid from the nutrient medium and also, if appropriate, neutralization of the 3-hydroxyisobutyric acid. The formation of the 3-hydroxyisobutyric acid or of the polyhydroxyalkanoates based on 3-hydroxyisobutyric acid preferably taking place via methylmalonate semialdehyde or via 3-hydroxyisobutyryl-coenzyme A
as precursor;
IB) dehydration of the 3-hydroxyisobutyric acid with formation of methacrylic acid and also, where appropriate, esterification methacrylic acid.
In the event that the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxy-isobutyric acid takes place via methylmalonate semialdehyde as precursor, it is furthermore preferred that the formation takes place via succinyl-coenzyme A, propionyl-coenzyme A or acryloyl-coenzyme A, especially preferably via succinyl-coenzyme A, as further intermediate. In the event that the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via 3-hydroxyisobutyryl-coenzyme A as precursor, it is furthermore preferred that the formation takes place via isobutyryl-coenzyme A or via 3-hydroxybutyryl-coenzyme A, preferably via 3-hydroxybutyryl-coenzyme A, as further intermediate.
The term "precursor" as used in the present context defines a chemical compound which can be converted enzymatically into 3-hydroxyisobutyric acid in just one _ reaction step, while the term "intermediate" defines a chemical compound which cannot be converted enzymatically into 3-hydroxyisobutyric acid in just one reaction step.
The term "3-hydroxyisobutyric acid" as used in the present context always describes the corresponding C4-carboxylic acid in the form in which it is present as a function of the pH, after having been formed by the microorganisms in question. As a consequence, the term always comprises the pure acid form (3-hydroxyisobutyric acid), the pure base form (3-hydroxyisobutyrate) and mixtures of protonated and deprotonated forms of the acid. Furthermore, the term "3-hydroxyisobutyric acid"
comprises, in principle, both the (R) and the (S) stereoisomer, the (S) stereoisomer being especially preferred.
The wording "that it is capable of forming more 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid in comparison with its wild type" also applies in the event that the wild type of the genetically modified cell is not capable of forming any 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, but at least no detectable amounts of these compounds, and that detectable amounts of these components are only capable of being formed after the genetic modification.
A "wild type" of a cell preferably refers to a cell whose genome is present in a state as generated naturally as the result of evolution. The term is used both for the entire cell and for individual genes. As a consequence, the term "wild type" does not cover in particular those cells, or those genes, whose gene sequences have at least in part been modified by man by means of recombinant methods.
The 3-hydroxyisobutyric acid subsequently gives rise to methacrylic acid by subjecting it to a dehydration reaction under mild conditions. In the case of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, the vesicles present in the cells, which are filled with these polyhydroxyalkanoates, can be isolated and the polymers can subsequently be cleaved to give 3-hydroxyisobutyric acid, which can then be dehydrated to give methacrylic acid.
In this context, it is preferred according to the invention that the genetically modified cell used in the process according to the invention has been genetically modified in such a way that it forms at least twice, especially preferably at least 10 times, more preferably at least 100 times, even more preferably at least 1000 times and most preferably at least 10 000 times more 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid than the wild type of the cell within a defined time interval, preferably within 2 hours, even more preferably within 8 hours and most preferably within 24 hours. The increase in the formation of product can be determined in this context for example by growing the cell used in the process according to the invention and the wild-type cell in each case separately, but under identical conditions (identical cell density, identical nutrient medium, identical culture conditions) for a particular time interval in a suitable nutrient medium and subsequently determining the amount of target product (3-hydroxyisobutyric acid or polyhydroxy-alkanoates based on 3-hydroxyisobutyric acid) in the nutrient medium.
The cells used in the process according to the invention may be prokaryotic or eukaryotic cells. They may take the form of mammalian cells (such as, for example, human cells), of plant cells or of microorganisms such as yeasts, fungi or bacteria, with microorganisms being especially preferred and bacteria and yeasts being most preferred.
Suitable bacteria, yeasts or fungi are in particular those bacteria, yeasts or fungi which have been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Brunswick, Germany, as bacterial, yeast or fungal strains.
Cells which are especially preferably used according to the invention are those of the genera Corynebacterium, Brevibacterium, Bacillus, Acinetobacter, Lactobacillus, Lactococcus, Candida, Pichia, Kl.uveromyces, Saccharomyces, Escherichia, Zymomonas, Yarrowia, Methylobacterium, Ralstonia, Pseudomonas, Burkholderia and Clostridium, with Brevibacterium flavum, Brevibacterium lactofermentum, Escherichia coli, Saccharomyces cerevisiae, Kluveromyces lactis, Candida blankii, Candida rugosa, Corynebacterium glutamicum, Corynebacterium efficiens, Zymonomas mobilis, Yarrowia lipolytica, Methylobacterium extroquens, Ralstonia eutropha, especially Ralstonia eutropha H16, Rhodospirillum rubrum, Rhodobacter sphaeroides, Paracoccus versutus, Pseudomonas aeroginosa, Acinetobacter calcoaceticus and Pichia pastoris being especially preferred.
In accordance with a first variant of the process according to the invention, a cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via methylmalonate semialdehyde as precursor.
In accordance with a first special embodiment of this first variant of the process according to the invention, it is preferred that the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoate based on 3-hydroxyisobutyric acid preferentially takes place via succinyl-coenzyme A as intermediate, where the genetically modified cell used in this embodiment of the process according to the invention preferentially is capable of utilizing carbohydrates, glycerol or glutamate as the carbon source.
Here, it may be advantageous in the context of the first special embodiment of the first variant of the process according to the invention that the genetically modified cell used in this embodiment of the process according to the invention features an increased activity of an enzyme El, which catalyzes the conversion of succinyl-coenzyme A
into methylmalonyl-coenzyme A, in comparison with its wild type (see Figure 1).
The term "increased activity of an enzyme" as used above in connection with the enzyme El and in what follows in the context of the enzymes E2 etc. is preferably to be understood as increased intracellular activity.
What now follows on increasing the enzymatic activity in cells applies both to increasing the activity of the enzyme El and to all enzymes mentioned thereafter, whose activity can, if appropriate, be increased.
In principle, an increase in the enzymatic activity can be achieved by increasing the copy number of the gene sequence(s) which code for the enzyme, by using a strong promoter or by using a gene or allele which codes for a corresponding enzyme with an increased activity, and, if appropriate, combining these measures. Cells which have been genetically modified in accordance with the invention are generated for example by transformation, transductioni conjugation or a combination of these methods with a vector which comprises the desired gene, an allel of this gene or parts thereof, and a vector which makes possible the expression of the gene. The heterologous expression is achieved in particular by integration of the gene, or of the alleles, into the chromosome of the cell or into an extrachromosomally replicating vector.
An overview over the possibilities for increasing the enzymatic activity in cells with pyruvate carboxylase by way of example is found in DE-A-100 31 999.
The expression of the enzymes or genes mentioned hereinabove and in each case hereinbelow can be detected in the gel with the aid of 1- and 2-dimensional protein gel separation and subsequent visual identification of the protein concentration using suitable evaluation software. When the increase in an enzymatic activity is based exclusively on an increase in the expression of the gene in question, the quantification of the increase in the enzymatic activity can be determined in a simple manner by comparing the 1- or 2-dimensional protein separations between the wild type and the genetically modified cell. A conventional method of preparing the protein gels in coryneform bacteria, and of identifying the proteins, is the procedure described by Hermann et al. (Electrophoresis, 22: 1712.23 (2001)). The protein concentration can also be analyzed by Western blot hybridization using an antibody which is specific for the protein to be detected (Sambrook et al., Molecular Cloning: a laboratory manual, 2'd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. USA, 1989) followed by visual evaluation with suitable software for determining the concentration (Lohaus and Meyer (1989) Biospektrum, 5: 32-39; Lottspeich (1999), Angewandte Chemie 111: 2630-2647). The activity of DNA-binding proteins can be measured by means of DNA band shift assays (also referred to as gel retardation) (Wilson et al. (2001) Journal of Bacteriology, 183: 2151-2155). The effect of DNA-binding proteins on the expression of other genes can be detected by various, extensively described methods of the reporter gene assay (Sambrook et al., Molecular Cloning: a laboratory manual, 2'd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
USA, 1989). The intracellular enzymatic activities can be detected by various methods which have been described (Donahue et al. (2000) Journal of Bacteriology 182 (19):
5624-5627; Ray et al. (2000) Journal of Bacteriology 182 (8): 2277-2284; Freedberg et al. (1973) Journal of Bacteriology 115 (3): 816-823). In the event that no specific methods for determining the activity of a particular enzyme are detailed in what follows, the determination of the increase in the enzymatic activity, and also the determination of the reduction in an enzymatic activity, is preferably carried out by means of the methods described in Hermann et al., Electrophoresis, 22: 1712-23 (2001), Lohaus et al., Biospektrum 5 32-39 (1998), Lottspeich, Angewandte Chemie 111: 2630-2647 (1999) and Wilson et al. Journal of Bacteriology, 183:
2151-2155 (2001).
If increasing the enzymatic activity is brought about by mutating the endogenous gene, such mutations can be generated either undirected, using traditional methods such as for example by UV irradiation or by mutagenic chemicals, or directed by means of recombinant methods such as deletion(s), insertion(s) and/or nucleotide substitution(s). These mutations give rise to genetically modified cells. Especially preferred mutants of enzymes are in particular also those enzymes which are no longer capable of being feedback-inhibited, or which are at least less capable of being feedback-inhibited, in comparison with the wild-type enzyme.
If increasing the enzymatic activity is brought about by increasing the expression of an enzyme, then, for example, the copy number of the respective genes are increased, or the promoter and regulatory regions or the ribosomal binding site, which is located upstream of the structural gene, are mutated. Expression cassettes which are incorporated upstream of the structural gene act in the same manner. By means of inducible promoters it is additionally possible to increase the expression at any desired point in time. Furthermore, the enzyme gene may also have assigned to it what are known as enhancer sequences as regulatory sequences; these also bring about an increased gene expression via an improved interaction between RNA polymerase and DNA. Measures for extending the life of the mRNA also improves expression.
Furthermore, preventing the degradation of the enzyme protein also enhances the enzymatic activity. Here, the genes or gene constructs are either present in plasmids in different copy numbers, or else they are integrated and amplified in the chromosome. As an alternative, overexpression of the genes in question may also be achieved by modifying the media composition and the control of the culture.
Instructions for doing so can be found by the skilled worker in Martin et al. (Bio/Technology 5, 137-146 (1987)) in Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio/Technology 6, 428-430 (1988)), in Eikmanns et al. (Gene 102, 93-98 (1991)), in EP-A-0 472 869, in US 4,601,893, in Schwarzer and Pthler ((Bio/Technology 9, 84-87 (1991), in Reinscheid et al.
(Applied and Environmental Microbiology 60, 126-132 (1994)), in LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), in WO-A-96/15246, in Malumbres et al.
(Gene 134, 15-24 (1993), in JP-A-10-229891, in Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)), inter alia, and in known textbooks of genetics and molecular biology. The above-described measures give rise to genetically modified cells, as do the mutations.
Plasmids, for example episomal plasmids, are employed for increasing the expression of the genes in question.
Suitable plasmids are in particular those which are replicated in coryneform bacteria. A large number of known plasmid vectors such as, for example, pZ1 (Menkel et al., Applied and Environmental Microbiology 64: 549-554 (1989)), pEKExl (Eikmanns et al., Gene 107: 69-74 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGAl.
Other plasmid vectors such as, for example, those based on pCG4 (US 4,489,160) or pNG2 {Serwold-Davis et al., FEMS Microbiology Letters 66: 119-124 (1990)} or pAG1 (US 5,158,891), may be employed in the same manner.
Others which are suitable are those plasmid vectors with the aid of which the method of amplifying genes by integration into the chromosome can be applied, as has been described for example by Reinscheid et al. (Applied and Environmental Microbiology 60: 126-132 (1994)) for duplicating or amplifying the hom-thrB operon. In this method, the entire gene is cloned into a plasmid vector which is capable of replication in a host (typically Escherichia coli), but not in Corynebacterium glutamicum.
Suitable vectors are, for example, pSUP301 (Simon et al, Bio/Technology 1: 784-791 (1983)), pK18mob or pK19mob (Schafer et al., Gene 145: 69-73 (1994)), pGEM-T (Promega Corporation, Madison, Wisconsin, USA), pCR2.1-TOPO
(Shuman, Journal of Biological Chemistry 269: 32678-84 (1994)), pCR@Blunt (Invitrogen, Groningen, the Netherlands), pEM1 (Schrumpf et al., Journal of Bacteriology 173: 4510-4516)) or pBGS8 (Spratt et al., Gene 41: 337-342 (1986)). The plasmid vector, which contains the gene to be amplified, is subsequently transferred into the desired Corynebacterium glutamicum strain by means of conjugation or transformation. The conjugation method is described for example in Schafer et al., Applied and Environmental Microbiology 60: 756-759 (1994). Transformation methods are described for example in Thierbach et al., Applied Microbiology and Biotechnology 29: 356-362 (1988), Dunican and Shivnan, Bio/Technology 7: 1067-1070 (1989) and Tauch et al., FEMS
Microbiology Letters 123: 343-347 (1994). Following homologous recombination by means of a cross-over event, the resulting strain comprises at least two copies of the gene in question.
The wording "an activity of an enzyme Ex which is increased in comparison with its wild type" used hereinabove and in what follows is preferably always understood as meaning an activity of the respective enzyme Ex which is increased by a factor of at least 2, especially preferably of at least 10, more preferably of at least 100, even more preferably of at least 1000 and most preferably of at least 10 000. Furthermore, the genetically modified cell used in the process according to the invention which features "an activity of an enzyme Ex which is increased in comparison with its wild type", in particular also a cell whose wild type features no, or at least no detectable, activity of this enzyme Ex and which only shows a detectable activity of this enzyme Ex after increasing the enzymatic activity, for example by means of overexpression. In this context, the term "overexpression", or the wording "increase in the expression" used in what follows also comprises the case that a starting cell, for example a wild-type cell, features no, or at least no detectable, expression and detectable expression of the enzyme Ex is only induced by recombinant methods.
Accordingly, the wording "reduced activity of an enzyme Ex" used hereinbelow is understood as meaning an activity which is preferably reduced by a factor of at least 0.5, especially preferably of at least 0.1, more preferably of at least 0.01, even more preferably of at least 0.001 and most preferably of at least 0.0001. The reduction in the activity of a specific enzyme can be obtained for example by directed mutation, by the addition of competitive or non-competitive inhibitors or by other measures for reducing the expression of a specific enzyme which are known to the skilled worker.
In the case of the enzyme El, which catalyzes the conversion of succinyl-coenzyme A into methylmalonyl-coenzyme A, this preferably takes the form of a methylmalonyl-coenzyme A mutase (EC 5.4.99.2). This enzyme is preferably encoded by the gene selected from the group consisting of mut, mutA, mutB, sbm, sbmA, sbmB, sbm5, bhbA, mcmA, mcmAl, mcmA2, mcmB, mcml, mcm2, mcm3, icmA, meaAl and meaA2. The nucleotide sequence of these genes can be found for example in the "Kyoto Encyclopedia of Genes and Genomes" (KEGG database), the databases of the National Center for Biotechnology Information (NCBI) of the National Library of Medicine (Bethesda, MD, USA) or from the nucleotide sequence database of the European Molecular Biologies Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK).
In accordance with an especially preferred embodiment of the first variant of the process according to the invention, the enzyme El takes the form of the methylmalonyl-coenzyme A mutase from Corynebacterium glutamicum ATCC 13032, which is encoded by a gene with the DNA sequence as shown in SEQ ID No 01 and which has the amino acid as shown in SEQ ID No 02.
Furthermore, it is preferred in accordance with a first alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the preparation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, that the genetically modified cell used in accordance with this alternative of the process according to the invention, if appropriate in addition to the increased activity of the enzyme El, features an activity of at least one of the following enzymes E2 to E4 which is increased in comparison with its wild type (see Figure 2):
- of an enzyme E2, which catalyzes the conversion of methylmalonyl-coenzyme A into methyl malonate;
- of an enzyme E3, which catalyzes the conversion of methyl malonate into methylmalonate semialdehyde;
- of an enzyme E4 which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyric acid.
In accordance with the invention cells which are especially used are those in which the activity of the following enzymes or enzyme combinations is increased:
E2, E3, E4, E2E31 E2E4, E3E4, E2E3E4, where E2E3E4 is most preferred. Furthermore, it is possible that an enzyme is also capable of catalyzing at least two of the above-described reaction steps. Thus, for example, it is possible to employ an enzyme which features both the activity of enzyme E2 and that of enzyme E3 (and which therefore catalyzes the conversion of methylmalonyl-coenzyme A directly into methylmalonate semialdehyde) such as, for example, the malonyl coenzyme A reductase from Sulfolobus tokodaii, which is encoded by the DNA
sequence with the SEQ ID No 03 and which has the amino acid sequence as shown in SEQ ID No 04, or else an enzyme which features all three enzymatic activities E2, E3 and E4, such as the malonyl coenzyme A reductase from Chloroflexus aurantiacus (Bugler et al., Journal of Bacteriology 184, pages 2404-2410, 2002).
In this context, it is especially preferred that the enzyme E2 is a methylmalonyl-coenzyme A hydrolase (EC
3.1.2.17), E3 is an aldehyde dehydrogenase (EC 1.2.1.3) or an aldehyde oxidase (EC 1.2.3.1) and E4 is a 3-hydroxyisobutyrate dehydrogenase (EC
1.1.1.31) or a 3-hydroxyacyl-coenzyme A
dehydrogenase (EC 1.1.1.35).
The enzyme E2 is preferably encoded by the aoxl gene. The methylmalonyl-coenzyme A hydrolase from rat liver is described for example in Kovachy et al., "Recognition, isolation, and characterization of rat liver D-methylmalonyl coenzyme A hydrolase", J. Biol. Chem. 258 (1983), pages 11415-11421.
The enzyme E3 is preferably encoded by genes selected from the group consisting of aldh2, aldh3al, aldh3a2, aldhlbl, aldh9al, aldh7al, aldhla4, aldhlal, aldhla2, mgc80785, mgc83352, mgc89020, dmel-CG31075, cg3752, cg9629, alh-9, alh-1, alh-2, f508.35, t7023.15, f1511.19, tT17F15.130, aldl, ald2, ald4, ald5, ald6, ac1044Wp, adr417wp, msc7, tb06.5F5.780, aldH, puuC, putA, aldA, badH, alkH, pcD, rsp1591, rs01031, exaC, acoD, dhaL, pchA, aldB, dhaS, betB, ywdH, ycbD, aldX, aldY, aldAl, aldA2, aldC, pcd, cg10546, cg12668, cg12796, scgl1A.05, sci30A.27c, sce9.27c, sck13.05c, sc5H4.03, thcA, gabD2, alkH, aldH, aldHl, aldY1, aldY2, aldY3, aldY4, aldY5, aldY6, aldY7 and aldhT.
Suitable genes for the enzyme E4 are selected from the group consisting of hibadh, cg15093, cg15093, cg4747, mwL2.23, t13k14.90, f19b15.150, hibA, ygbJ, mmsB, mmsB, garR, tsar, mmsB-1, mmsB-2, yfjR, ykwC, ywjF, hibD, glxR, SCM1.40c, hibD, ehhahd, hadh2, hadhsc, hsdl7B4, 1oc488110, had, mgC81885, hadh2-prov, cg3415, cg7113, ech-1, ech-8, ech-9, ard-1, yfcX, fadB, faoA, fadB2x, hbd-1, hbd-2, hbd-3, hbd-4, hbd-5, hbd-6, hbd-7, hbd-8, hbd-9, hbd-10, fadJ, rs04421, rs02946, rs05766, bbsD, bbsC, fadB1, fadB2, fadB5, hbdA, pimF, fabJ-1, fabJ, scbacl9f3.11, sci35.13, scbac8d1.10c, sc5f2a.15, sc6a5.38, fadC2, fadC4, fadC5, fadC6, had and paaH.
Further suitable 3-hydroxyisobutyrate dehydrogenases are described for example in Bannerjee et al. (1970), J.
Biol. Chem, 245, pages 1828 to 1835, Steele et al.
(1992), J. Biol. Chem., 267, pages 13585 to 13592, Harris et al. (1988), J. Biol. Chem., 263, pages 327 to 331, Harris et al., Biochim. Biophys. Acta, 1645 (1), pages 89 to 95, Hawes et al. (2000), Methods Enzymol., 324, pages 218 to 228, Harris et al., J. Biol. Chem., 275 (49), pages 38780 to 38786, Rougraff et al. (1988), J. Biol.
Chem., 263(1), pages 327 to 331, Robinson et al., J.
Biol. Chem., 225, pages 511 to 521, Hawes et al. (1995), Biochemistry, 34, pages 4231 to 4237, Hasegawa J. (1981), Agric. Biol. Chem., 45, pages 2805 to 2814, Hawes et al.
(1996), FEBS Lett., 389, pages 263 to 267, Hawes et al.
(1996), Enzymology and Molecular Biology of Carbonyl Metabolism, Plenum Press, New York, pages 395 to 402, Adams et al. (1994), Structure, 2, pages 651 to 668, Zhang et et. (1999), Biochemistry, 38, pages 11231 to 11238, Mirny et al., (1999), J. Mbl. Biol., 291, pages 177 to 196 and Lokanath et al. (2005), J hrol Biol.
The nucleotide sequences of the abovementioned genes and of further genes for the enzymes E2 to E4 can also be found in the KEGG database, the NCBI database or the EMBL
database, inter alia.
In accordance with an especially preferred embodiment of this alternative of the process according to the invention, in which a genetically modified cell is used, where succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the preparation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, it is preferred that the malonyl coenzyme A reductase from Sulfolobus tokodaii, which is encoded by the DNA
sequence with the SEQ ID No 03 and which has the amino acid sequence as shown in SEQ ID No 04, is employed for the conversion of methylmalonyl-coenzyme A into methylmalonate semialdehyde. In accordance with another especially preferred embodiment of this variant, the malonyl coenzyme A reductase from Chloroflexus aurantiacus (Hagler et al., Journal of Bacteriology 184, pages 2404-2410, 2002) is employed for the conversion of methylmalonyl-coenzyme A into 3-hydroxyisobutyric acid.
Furthermore, it is preferred in the context of thi first alternative of the first special embodiment of the process according to the invention that the genetically modified cell used in accordance with this embodiment features an activity of an enzyme Es, which features the conversion of methylmalonate semialdehyde into propionyl-coenzyme A, which is reduced in comparison with its wild _ type, this enzyme preferably taking the form of a methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27).
In accordance with a second alternative of the process according to the invention, in which a genetically modified cell is used where succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the preparation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, it is preferred that the cell, if appropriate in addition to the increased activity of the enzyme Elf features an activity of at least one of the following enzymes E4 to E7 which is increased in comparison with its wild type (see Figure 3):
- of an enzyme E6/ which catalyzes the conversion of (R) methylmalonyl-coenzyme A into (S) methylmalonyl-coenzyme A;
- of an enzyme E7/ which catalyzes the conversion of (S) methylmalonyl-coenzyme A into propionyl-coenzyme A;
- of an enzyme E5/ which catalyzes the conversion of propionyl-coenzyme A into methylmalonate semialdehyde;
- of an enzyme E4/ which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyric acid.
Cells which are especially preferably used in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is increased:
ELI, E5/ E6/ E7/ E7/ E4E5/ E4E6/ E4E7/ E5E6/ E5E7/ E6E7 / E4E5E6/
E4E5E7, E4E6E7, E5E6E7 and E4E5E6E7, with E4E5E6E7 being most preferred.

_ _ In this context, it is especially preferred that the enzyme E6 is a methylmalonyl-coenzyme A epimerase (EC 5.1.99.1) E7 is a methylmalonyl-coenzyme A decarboxylase (EC 4.1.1.41), E5 is a methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27), and E4 is a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or a 3-hydroxyacyl-coenzyme A
dehydrogenase (EC 1.1.1.35).
In this context, preferred enzymes E4 are those which have already been mentioned above in the context of the first variant of the first preferred embodiment of the process according to the invention.
The enzyme E6 is preferably encoded by the mcee gene. A
suitable methylmalonyl-coenzyme A decarboxylase (enzyme Efl is described, for example, by Benning et al. in Biochemistry, Vol. 39 (2000), pages 4630-4639.
Suitable genes for the enzyme E5 are preferably selected from the group consisting of aldh6al, cg17896, t22c12.10, ald6, putAl, mmsA, mmsA-1, mmsA-2, mmsA-3, mmsA-4, msdA, iolA and iolAB.
Suitable genes for the enzyme E7 are preferably selected from the group consisting of mmdA, bcc, oadB, oadB2, oadB3, SC1C2.16, SC1G7.10, pccB1, accA2, mmdB, mmdC and ppcB.

_ The nucleotide sequences of the abovementioned genes for the enzymes Es, E6 and E7 may, inter alia, also be found in the KEGG database.
In accordance with a third alternative of the process according to the invention, in which a genetically modified cell is used, where succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the preparation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, it is preferred that the cell, if appropriate in addition to the increased activity of the enzyme El, features an activity of at least one of the following enzymes E4, E5 and E7 which is increased in comparison with its wild type (see Figure 4):
- of an enzyme E7, which catalyzes the conversion of methylmalonyl-coenzyme A into propionyl-coenzyme A;
- of an enzyme E5, which catalyzes the conversion of propionyl-coenzyme A into methylmalonate-semialdehyde;
- of an enzyme E4, which catalyzes the conversion of methylmalonate-semialdehyde into 3-hydroxyisobutyric acid.
This pathway corresponds essentially to the second variant of the first preferred embodiment of the process according to the invention, but, as opposed to the second variant, propionyl-CoA is prepared directly from methylmalonyl-coenzyme A. Preferred enzymes and genes for the enzymes E4, E5 and E7 are those genes or enzymes which have already been mentioned above in connection with the second variant.
Furthermore, it may in accordance with the first special embodiment of the process according to the invention (and also in accordance with all embodiments which are still to be described hereinbelow) also be preferred to use a genetically modified cell which is capable of converting the formed 3-hydroxyisobutyric acid into a polyhydroxy-alkanoate. Such polyhydroxydalkanoates are deposited intracellularly by many microorganisms in the form of highly refractive granula. In this context, it is especially preferred that the genetically modified cell used in the process according to the invention features an activity of at least one of, preferably of the two, the following enzymes E8 and E9 which is increased in comparison with its wild type (see Figure 5):
- of an enzyme EE3, which catalyzes the conversion of 3-hydroxyisobutyric acid into 3-hydroxyisobutyryl-coenzyme A;
- of an enzyme E9, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A to a polyhydroxy-alkanoate based on 3-hydroxyisobutyric acid.
In this context, it is especially preferred that the enzyme E8 is a 3-hydroxyisobutyryl CoA hydrolase (EC 3.1.2.4) and E9 is a polyhydroxyalkanoate synthase.
As has already been explained above, the first preferred embodiment of the process according to the invention generates 3-hydroxyisobutyric acid or the polyhydroxyalkanoates based on 3-hydroxyisobutyric acid from succinyl coenzyme A as intermediate and from methylmalonate semialdehyde as precursor. Here, it may make sense in principle to influence not only one or more of the abovementioned enzyme activities El to E9, but also those enzyme activities which lead to an increased formation of succinyl-coenzyme A in the cell.
In the event that, according to the first special embodiment of the first variant of the process according to the invention, the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoates based on 3-hydroxy-isobutyric acid takes place from carbohydrates or glycerol via succinyl-coenzyme A as intermediate and methylmalonate semialdehyde as precursor, it is, according to a special embodiment of the above-described first, second or third alternative of the process according to the invention, preferred that the genetically modified cell used features an activity of at least one of the, preferably of the two, following enzymes E10 and En which is increased in comparison with its wild type (see Figure 6):
- of an enzyme EH, which catalyzes the conversion of phosphoenolpyruvate into oxaloacetate;
- of an enzyme En, which catalyzes the conversion of pyruvate into oxaloacetate.
In this context, it is especially preferred that the enzyme E10 is a phosphoenolpyruvate carboxylase (EC 4.1.1.31) and En is a pyruvate carboxylase (EC 6.4.1.1).
The enzyme EH is preferably encoded by the genes selected from the group consisting of f12m16.21, f14n22.13, k15m2.8, ppc, clpA, pepC, capP, cg11585, pepC, pck ppc and pccA, where the ppc gene is especially preferred.
Phosphoenolpyruvate carboxylases which are preferred according to the invention are also described in particular in US 4,757,009, US 4,980,285, US 5,573,945, US 6,872,553 and US 6,599,732.
The enzyme EH is preferably encoded by the genes selected from the group consisting of pc, pcx, cg1516, cg1516, pyc-1, pyc-2, aar162Cp, pyr1, accC-2, pycA, pycA2, pca, cg10689, pyc, pycB, accC, oadA, acc and accC1, where the pyc gene is especially preferred. Pyruvate carboxylases which are preferred according to the invention are also described in particular in US 6,455,284, US 6,171,833, US 6,884,606, US 6,403,351, US 6,852,516 and US 6,861,246. A further pyruvate carboxylase which is especially preferred according to the invention is that mutant which is described in "A novel methodology employing Corynebacterium glutamicum genome information to generate a new L-lysine-producing mutant", Ohnishi J
et al., Applied Microbiology and Biotechnology, Vol. 58 (2), pages 217-223 (2002).
The nucleotide sequences of suitable genes of the. enzymes En and En can be found in the KEGG database, the NCBI
database or the EMBL database.
Starting from the oxaloacetate intermediate stage, there are several possibilities for arriving at succinyl-coenzyme A, which can then be converted into 3-hydroxyisobutyric acid via methylmalonyl-coenzyme A by means of the three variants mentioned at the outset.
A first pathway leads via fumarate as intermediate. In this case it is preferred in accordance with a first special embodiment of the above-described first, second or third alternative of the process according to the invention, where a genetically modified cell is used in which methylmalonate-semialdehyde is formed as precursor _ and succinyl-coenzyme A as intermediate, that the cell, if appropriate additionally to an increased activity of the enzyme En or En, features an activity of at least one of the following enzymes E12 to En which is increased in comparison with its wild type (see Figure 7):
- of an enzyme E12, which catalyzes the conversion of oxaloacetate into malate;
- of an enzyme En, which catalyzes the conversion of malate into fumarate;
- of an enzyme EN, which catalyzes the conversion of fumarate into succinate;
- of an enzyme En, which catalyzes the conversion of succinate into succinyl-coenzyme A.
In accordance with the invention, cells which are especially used are those in which the activity of the following enzymes or enzyme combinations is increased:
E12, En, EN, E15, E12E13, E12E14 f E12E15, E13E14 f E13E15, E14E15, E12E13E14 f E12E13E15, E12E14E15, E13E14E15/
E12E13E14E15, with E12E13E14E15 being most preferred.
In this context, it is especially preferred that the enzyme En is a malate dehydrogenase (EC 1.1.1.37) or a malate quinone oxidoreductase (1.1.99.16), En is a fumarate hydratase (EC 4.2.1.2), EN is a succinate dehydrogenase (EC 1.3.99.1 or EC 1.3.5.1) or a succinate quinone oxidoreductase (1.3.5.1), and E15 is a succinate coenzyme A ligase (EC 6.2.1.4 or EC 6.2.1.5).
The enzyme E12 is preferably encoded by genes selected from the group consisting of mdhl, mdh2, morl, cg10748, cg10749, cg5362, mdh-1, f46e10.10, fl9p19.13, f12m16.14, t30120.4, kl5m2.16, flp2.70, fl7i14.150, mn112.18, mik19.17, mdh3, ad1164cp, adr152cp, adr252wp, mdhA, mdhC, mdhB, ybiC, mdh, yiaK, ybiC, allD, citH, yjmC, citH, cg12380, ldh, sqdB, mcio, yojH, mqoA, mqoB, mqol, molo2, mgo3, mclo4 and cg12001, where the mqo gene and the mdh gene are especially preferred.
The enzyme E12 is preferably encoded by genes selected from the group consisting of fh, fhl, sc4094, sc4095, t30b22.19, k3k7.11, acr013/cp, fuml, fum2, fum3, fum4, fumH, fumA, fumB, fumC, fumC1, fumC2, fum, ttdA, ttdB, fumB-alpha, fumB-beta, citG, citB, fumX, fum-1 and fum-2, where the turn gene is especially preferred.
The enzyme E14 is preferably encoded by genes selected from the group consisting of sdhl, sdh2, sdh3, sdh4, sdh5, sdh6, osml, osm2, sdhA, sdhB, sdhC, sdhD, frdA, frdB, frdC, frdD, ifcA-1, ifcA-2, sdhB-1, sdhB-2, frdC2, cg10370, cg10371, cg10372, scm10.10c, scm10.11c, scm10.12c, sc5g8.25c, sc5g8.26c, scbac-31e11.02c, scbac31e11.02c, sc4b10.10c, sdhA2, sdhB2, sdhAl, sdhB1, qcrB2, sdhA3, sdhB3, frdB1 and frdB2, where the genes sdhA, sdhB and sdhC are especially preferred.
The enzyme En is preferably encoded by genes selected from the group consisting of suclgl, suclg2, loc434885, cg10622, dmel-CG6255, flla3.3, f8115.30, mkd15.11, lscl, lsc2, ae1211wp, afr134cp, scsA, scsB, sucC and sucD.
Again, the nucleotide sequences of suitable genes of the enzymes En to En, can also be found in the KEGG
database, the NCBI database or the EMBL database.

_ In the event that the activity of one or more of the enzymes E12 to E15 is increased, it may also prove advantageous that the cell features an activity of one of the following enzymes E16 to E23 which is reduced in comparison with its wild type:
- of an enzyme E16, which catalyzes the conversion of oxaloacetate into citrate;
- of an enzyme E17, which catalyzes the conversion of malate into oxaloacetate;
- of an enzyme E18, which catalyzes the conversion of succinyl-coenzyme A into succinate, - of an enzyme E19, which catalyzes the conversion of oxaloacetate into phosphoenolpyruvate, - of an enzyme E20, which catalyzes the conversion of oxaloacetate into pyruvate, - of an enzyme E21, which catalyzes the conversion of oxaloacetate into aspartate, - of an enzyme E22, which catalyzes the conversion of malate into pyruvate, - of an enzyme E23, which catalyzes the conversion of pyruvate into acetate.
Cells which are especially preferred in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is reduced: E18, E17, E18, E19, E20, En, and E16E17E18E19E20E21E22E23=
In this context, it is especially preferred that the enzyme E16 is a citrate synthase (EC 2.3.3.1 or EC 2.3.3.8), E17 is a malate oxidase (EC 1.1.3.3), E18 is a succinyl CoA hydrolase (EC 3.1.2.3), E19 is a phosphoenolpyruvate carboxykinase (EC 4.1.1.49 or 4.1.1.32), E20 is an oxaloacetate decarboxylase (EC 4.1.1.3), E21 is an aspartate transaminase (EC 2.6.1.1), E22 is a malate dehydrogenase (EC 1.1.1.38, EC 1.1.1.39 or EC 1.1.1.40), E23 is a pyruvate dehydrogenase (EC 1.2.1.51).
The enzyme E16 is preferably encoded by genes selected from the group consisting of glt, cs, csl, cg3861, cts-1, f7f19.21, f4i1.16, t20n10.90, t20n10.100, t209.80, citl, cit2, cit3, aar004cp, agr002wp, cshA, gltA, citZ, cit, prpC, cisY, cis, mmgD, citA, gltAl, gltA2, gltA3, cg10829, prpC1, scd10.20, citAl, citA2, citA3, acly, cg8322, f5e6.2, k7jJ8.14 and citE, where gltA is most preferred.
The enzyme E19 is preferably encoded by genes selected from the group consisting of pckA, pckl, pck2, cg10924, cg17725, cg17725, pckG, ppcK, cg12863, pck and 2sck36.02.
The enzyme E20 is preferably encoded by genes selected from the group consisting of oadA, oadB, oadC, oadG, oag3, eda, dcoA, oadAl, oadA2, pycB and mmdB.
The enzyme E21 is preferably encoded by genes selected from the group consisting of myn8.7, gltl, adr290wp, gltB, gltD, gltl, glsl, gltA, glt, glxD, gltD1, gltD2, gdh2, ag1040Cp, gdhAl, gdhA, gdhA2, gluD, gluD1, gluD2, rocG, ypcA, gudB, tlli18.2, t2i1.150, mrg7.13, f19c24.7, gdh, gdhl, gdh2, gdh3, gotl, got2, cg4233, cg8430, f23n19.17, fl3j11.16, t26c19.9, f7f1.18, F1ON7.200, t1611.170, f15n18.110, t20d1.70, aatl, aat2, ab1038wp, afr211cp, agxl, bna4, aatA, aatB, ybdL, aspC, yfbQ, aat, avtAl, avtA2, tyrB, avtA, avtB, argD1, argD2, aspB1, aspB2, aspB3, aspB, aspC1, aspC2, aspC3, aspC4, RS05143, aspAT, ywfG, yhdR, argD, mtnV, alaT, hisC, avtAl, avtA2, avtA3, cg10240, cg11103, cg12599, cg12844, 2sck36.07c, sc9e12.21, sc2h4.04c, tyrB, gtp, gtpl, gtp2, cg1640, f20d23.34, f26f24.16, f24j13.15, tl0d10.20 and agr085wp, where aspC, aatA, gdh, gudB, gdhA, gltB and gltD are especially preferred.
The enzyme E21 is preferably by genes selected from the group consisting of myn8.7, gltl, adr290wp, gltB, gltD, gltl, glsl, gltA, glt, glxD, gltD1, gltD2, gdh2, ag10400p, gdhAl, gdhA, gdhA2, gluD, gluD1, gluD2, rocG, ypcA, The enzyme E22 is preferably encoded by genes selected from the group consisting of me, mel, me2, me3, mae, mael, mae2, sfcA, sfcAl, maeA, maeB, tme, yqkJ, ywkA, yqkJ, malS, ytsJ, mleA, mleS, mez, sce59.10c, 2sc7g11.23, malS1, malS2, dme, maeB1, maeB2, mdh, mdhl, mdh2, dmel_cg10120, dmel cg10120, dmel-cg5889, f19k16.27, f6f22.7, t22p22.60, f18a17.1, modl, tme, mao, cg13007, malS and malE.
The enzyme E23 is preferably encoded by genes selected from the group consisting of me, mel, me2, me3, mae, mael, mae2, sfcA, sfcAl, maeA, maeB, tme, yqkJ, ywkA, yqkJ, malS, ytsJ, mleA, mleS, mez, sce59.10c, 2sc7g11.23, malS1, malS2, dme, maeB1, maeB2, mdh, mdhl, mdh2, dmel_cg10120, dmel_cg10120, dmel-cg5889, f19k16.27, f6f22.7, t22p22.60, f18a17.1, modl, tme, mao, cg13007, malS and malE.
Furthermore, it is preferred in accordance with the invention that, in the event where the increased provision of succinyl-coenzyme A in the cell takes place by means of the above-described pathway (oxaloacetate -*
malate -* fumarate -* succinyl-coenzyme A), the provision of reduction equivalents in the cell is also increased in a targeted manner.
One possibility of increasing the reduction equivalents consists in increasing the oxidative pentose phosphate pathway. In this context, it is especially preferred that the activity of glucose 6-phosphate dehydrogenase (EC
1.1.1.49) and/or of 6-phosphogluconate dehydrogenase (EC
1.1.1.44), which is preferably encoded by the gnd gene, is increased while, if appropriate, simultaneously inhibiting glycolysis, for example by lowering the activity of glucose 6-phosphate isomerase, as described in WO-A-01/07626. In addition to, or instead of, the directed promotion of the pentose phosphate pathway, it may furthermore be preferred to provide reduction equivalents by supplying, to the cells, ethanol as the carbon source and by promoting, in the cells, the conversion of the ethanol into acetaldehyde by means of alcohol dehydrogenases (EC 1.1.1.1, EC 1.1.1.2, EC 1.1.1.71 or EC 1.1.99.8) and the further conversion of the acetaldehyde into acetyl coenzyme A by means of acetaldehyde dehydrogenases (EC 1.2.1.10). Again, suitable genes for alcohol dehydrogenases and acetaldehyde dehydrogenases, can be found in gene databases which are known to the skilled worker, such as, for example, the KEGG database, the NCBI database or the EMBL database.
A second pathway from oxaloacetate to succinyl-coenzyme A
leads via citrate as intermediate. In this case, it is preferred in accordance with a second special embodiment of the above-described first, second or third alternative of the process according to the invention to use a genetically modified cell, if appropriate in addition to an increased activity of the enzyme E10 or En, features an activity of at least one of the following enzymes En to En and EN to En which is increased in comparison with its wild type (see Figure 8):
- of an enzyme E16, which catalyzes the conversion of oxaloacetate into citrate;
- of an enzyme E24, which catalyzes the conversion of citrate into isocitrate;
- of an enzyme En, which catalyzes the conversion of isocitrate into glyoxalate and succinate;
- of an enzyme E26, which catalyzes the conversion of glyoxalate into malate;
- of an enzyme En, which catalyzes the conversion of malate into fumarate;
- of an enzyme EIA, which catalyzes the conversion of fumarate into succinate;
- of an enzyme En, which catalyzes the conversion of succinate into succinyl-coenzyme A.
In this context, cells which are especially preferred in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is increased: E13, E14, Ent E16, E24, E25, E26, E13E14, E13E15/
E13E16, E13E24, E13E25, E13E26r E14E15, E14E16, E14-E24, E14E25, E14E26, E15E16, E15E24, E15E25, E15E26 and EEFFEEE
_13_14_15_16_24_25_26, where E13E14E15E16E24E25E26 is most preferred.

_ In this context, it is especially preferred that the enzyme En is a fumarate hydratase (EC 4.2.1.2), EN is a succinate dehydrogenase (EC 1.3.99.1 or EC 1.3.5.1) or a succinate quinone oxidoreductase (1.3.5.1), En is a succinate coenzyme A ligase (EC 6.2.1.4 or EC 6.2.1.5), E16 is a citrate synthase (EC 2.3.3.1 or EC 2.3.3.8), E24 is an aconitate hydratase (EC 4.2.1.3), En is an isocitrate lyase (EC 4.1.3.1) and E26 is a malate synthase (EC 2.3.3.9).
Preferred genes for the enzymes En to E16 are those which have already been described above in connection with the first pathway from oxaloacetate to succinyl-coenzyme A.
The enzyme E24 is preferably encoded by genes selected from the group consisting of aco1, aco2, ratireb, dmel-CG4706, dmel-CG4900, dmel-cg6342, cg9244, t3p4.5, f10m23.310, f4b14.100, ad1032Wp, afr629wp, acnA, acnB, acnC, acnD, rpfA, acnAl, acnA2, acnM, citB, leuC, cg11540, sacA, can and aco, where acnA and acnB are especially preferred.
The enzyme En is preferably encoded by genes selected from the group consisting of msd21.4, icll, ic12, ad1066cp, ag1057wp, aceA, id, aceAa, aceAb, cg10097 and cg12331, where aceA is especially preferred. In accordance with a particular embodiment, genes which are preferred are those which code for an isocitrate lyase which is deregulated at the gene level or protein level.
The enzyme E26 is preferably encoded by genes selected from the group consisting of med24.5, mlsS1, acr268cp, masA, glcB, aceB, mls, glcB-1, glcB-2, cg12329, masZ, aceB1, aceB2 and mas, where the aceB gene is especially preferred.
Again, the nucleotide sequences of suitable genes of the enzymes E24 to E26 can be found in the KEGG database, the NCBI database or the EMBL database.
When the provision of oxaloacetate from phosphoenol-pyruvate or from pyruvate is promoted by increasing the activity of the enzyme En or En, the succinate which is formed, besides glyoxalate, upon cleavage of the isocitrate by the isocitrate lyase may also be utilized for the formation of succinyl-coenzyme A. Furthermore, it may be advantageous in this second pathway from the oxaloacetate to the succinate to reduce the activity of an enzyme E27, which catalyzes the conversion of isocitrate into 2-oxoglutarate and which preferably takes the form of an isocitrate dehydrogenase (EC 1.1.1.41 or EC 1.1.1.42). Preferably, the isocitrate dehydrogenase takes the form of an enzyme which is encoded by a gene selected from the group consisting of idh1, idh2, cg7176, cg7176, cg7176, f20d21.16, f12p19.10, tl5n1.80, idpl, idp2, idp3, aa1022Wp, aer061Cp, idhC, idhM, icdA, icd, idh, icdl, icd2, leuB, citC, citC, cg10664, leuB2, idh3A, idg3B, idh3G, cg12233, dmel-CG5028, dmel-CG6439, f6p23.14, f23e12.180, f8d20.160, f12e4.20, ad1223wp and afr137cp, where icdA and citC are especially preferred.
A third pathway from the oxaloacetate to the succinyl-coenzyme A leads via 2-oxoglutarate as intermediate. In this case, it is preferred in accordance with a third special embodiment of the above-described first, second or third alternative of the process according to the invention to use a genetically modified cell featuring an activity of at least one of the following enzymes E16, EH, E27 and EH which is increased in comparison with its wild type, if appropriate in addition to an increased activity of the enzyme En or En (see Figure 9):
- of an enzyme En, which catalyzes the conversion of oxaloacetate into citrate;
- of an enzyme E24, which catalyzes the conversion of citrate into isocitrate;
- of an enzyme E27, which catalyzes the conversion of isocitrate into 2-oxoglutarate;
- of an enzyme EH, which catalyzes the conversion of 2-oxoglutarate into succinyl-coenzyme A.
In this context, cells which are especially preferred in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is increased: E18, E24, E27, E28, E16E24, E18E27 E16E28 E24E27 E24E28 r E27E281 E16E24E27 E16E24E28 E24E27E28 and E16E24E27E28, where E18E24E27E28 is most preferred.
In this context, it is especially preferred that the enzyme E18 is a citrate synthase (EC 2.3.3.1 or EC 2.3.3.8), E24 is an aconitate hydratase (EC 4.2.1.3), E27 is an isocitrate dehydrogenase (EC 1.1.1.41 or EC 1.1.1.42) and E28 is a 2-oxoglutarate synthase (EC 1.2.7.3).
Preferred genes for the enzymes E16, E24 and E27 are those which have already been described above in connection with the first and second pathway from the oxaloacetate to the succinyl-coenzyme A.
The enzyme E213 is preferably encoded by genes selected from the group consisting of korA, korB, kor D, korAl, korA2, korB1, korB2, oorA, oorB, oorC, oorD, oforA, oforB, porA, porB, porAl, porA2, porA3, porA4, porG, porG1, porG2, porB1, porB2, porB3, SCD20.12c, SCD20.13c, SCAH10.34c, SCAH10.35c, korG, orA, orB, korG1 and korG2.
Furthermore, En may also take the form of a dehydrogenase complex consisting of a plurality of subunits which have different enzymatic activities. In particular, it may take the form of a dehydrogenase complex comprising an oxoglutarate dehydrogenase (EC 1.2.4.2), a dihydrolipoyl dehydrogenase (EC 1.8.1.4) and a dihydrolipoyllysine-residue succinyl transferase (EC 2.3.1.61). In this context, the oxoglutarate dehydrogenase (EC 1.2.4.2) is preferably encoded by genes selected from the group consisting of ogdh, ghdhl, 1oc239017, mgc68800, mgc80496, cg11661, t22e16.70, mpA24.10, kgdl, aer374cp, sucA, odhA, kgdA and cg11129, where sucA and odhA are especially preferred. The dihydrolipoyl dehydrogenase (EC 1.8.1.4) is preferably encoded by genes selected from the group consisting of dld, dld-prov, dldh, cg7430, t2j15.6, k14a17.6, at3g17240, mgd8.71pdl, afr512wp, dldl, lpd, tb03.26j7.650, tb04.3m17.450, tb927.8.7380, tb08.10k10.200, lpdA, lpdG, lpdV, lpd3, acoD, lpdAl, lpdA2, lpdA3, odhL, pdhD, pdhD1, pdhD2, pdhD3, pdhD42, lpdAchl, lpdAch2, lpdAc, acoL, bfmbC, bkdD, cg10366, cg10688, scm1.17c, pdhL, sck13.11, lpdB2 and dldl, where lpd is especially preferred. In this context, the dihydrolipoyllysine-residue succinyl transferase (EC
2.3.1.61) is preferably encoded by genes selected from the group consisting of dlst, dlst-prov, mgc89125, dmel CG5214, f10m23.250, k13p22.8, kgd2ag1200wp, kgd2, _ odhB, sucB, aceF, kgdB, sucB1, sucB2, pdhC, dlaT, kgd, sc5F7.20 and sc4B10.24c, where sucB and odhB are especially preferred.
The nucleotide sequences of suitable genes of the enzyme En or of the abovementioned subunits of the enzyme E28, can, again, be found in the KEGG database, the NCBI
datase or the EMBL database.
The above-described pathways from the oxaloacetate to the succinyl-coenzyme A depart from phosphoenolpyruvate or from pyruvate as substrate precursors. In this context, it may furthermore be preferred to genetically modify the cells in such a way that they are capable of providing especially large amounts of pyruvate or phosphoenolpyruvate starting from carbohydrates and/or from glycerol.
In the event that the cells are capable of utilizing glycerol as nutrient source, it is preferred that the genetically modified cell used in the process according to the invention displays an activity of at least one, preferably all, of the following enzymes En to E.42 which is increased in comparison with its wild type:
- of an enzyme En, which facilitates the diffusion of glycerol into the cell, - of an enzyme Em, which catalyzes the conversion of glycerol into glycerol 3-phosphate, - of an enzyme E31, which catalyzes the conversion of glycerol 3-phosphate into dihydroxyacetone phosphate, - of an enzyme E32, which catalyzes the transfer of sulfur to the sulfur acceptor thioredoxin 1, - of an enzyme E33, which catalyzes the hydrolysis of phospholipids with formation of alcohols and glycerol, - of an enzyme E34, which catalyzes the transport of glycerol 3-phosphate into the cell in exchange for phosphate;
- of an enzyme E35, which catalyzes the conversion of dihydroxyacetone phosphate into glyceraldehyde 3-phosphate, - of an enzyme E36, which catalyzes the conversion of glyceraldehyde 3-phosphate into 1,3-biphospho-glycerate, - of an enzyme E37, which catalyzes the conversion of 1,3-biphosphoglycerate into 3-phosphoglycerate, - of an enzyme EH, which catalyzes the conversion of 3-phosphoglycerate into 2-phosphoglycerate, - of an enzyme E39, which catalyzes the conversion of 2-phosphoglycerate into phosphoenolpyruvate, - of an enzyme E40, which catalyzes the conversion of phosphoenolpyruvate into pyruvate, - of an enzyme E41, which catalyzes the conversion of glycerol into dihydroxyacetone, - of an enzyme E42, which catalyzes the conversion of dihydroxyacetone into dihydroxyacetone phosphate.
In this context, cells which are especially preferred in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is reduced: E29, E30, En, E32, E33, E34 E35, E36, E37 E38 E39, E40 E41, E42, E29E301 E29E31 E29E32 E29E331 E29E34 E29E35 E29E36 E29E37 r E29E38 E29E39 E29E40 r E29E41 E29E42 E30E31 E30E32 r E30E33 E30E34 E30E35 E30E36 r E30E37 E30E38 r E30E39 E30E40 E30E41 E30E42 E31E32 E31E33 E31E34 r E31E35 E31E36 E31E37 E31E38 E31E39 E31E40 E31E41 E31E42 E32E33 r E32E34 E32E35 E32E36 E32E37 E32E38 I E32E391 E32E40 I E32E41 E32E42 r E33E34 E33E35 =
E33E36 E33E37 E33E38 E33E39 r E33E40 E34E41 E33E42 r E34E35 E34E36 E34E47 E34E38 E34E39 E34E40 E34E41 E34E42 E35E36 r E35E37 r E35E38 E35E39 r E35E40 E35E411 E35E42 E36E37 r E36E38 E36E39 E36E40 E36E41 E39E42 E40E41 E40E42 r E41E42 and E29E30E31E32E33E34E35E36E37E38E39-E40a41E42.
In this context, it is especially preferred that the enzyme E29 is an aquaglyceroporin (glycerol facilitator) which is preferably encoded by the glpF gene, EH is a glycerol kinase (EC 2.7.1.30) which is preferably encoded by the glpK gene, En is a glycerol 3-phosphate dehydrogenase (EC
1.1.99.5), preferably an FAD-dependent glycerol 3-phosphate dehydrogenase, where the glycerol 3-phosphate dehydrogenase is preferably encoded by the glpA gene, the glpB gene, the glpC gene or the glpD gene, especially preferably by the glpD gene, E32 is a sulfur transferase which is encoded by the glpE
gene, E33 is a glycerol phosphodiesterase (EC 3.1.4.46) which is preferably encoded by the glpQ gene, E34 is a glycerol 3-phosphate permease which is preferably encoded by the glpT gene, E35 is a triose phosphate isomerase (EC 5.3.1.1), _ E36 is a glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.12), E37 is a phosphoglycerate kinase (EC 2.7.2.3), EH is a phosphoglycerate mutase (EC 5.4.2.1), E39 is an enolase (EC 4.2.1.11), ELI() is a pyruvate kinase (EC 2.7.1.40), Ein is a glycerol dehydrogenase (EC 1.1.1.6) which is preferably encoded by the gldA gene, and 15 E42 is a dihydroxyacetone kinase (EC 2.7.1.29) which is preferably encoded by the dhaK gene.
The gene sequences of the abovementioned enzymes can, again, be found in the gene databases which are known to the skilled worker, in particular the KEGG database, the NCBI database or the EMBL database.
Furthermore, the gap gene, which codes for glyceraldehyde 3-phosphate dehydrogenase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), the tpi gene, which codes for triose phosphate isomerase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), and the pgk gene, which codes for 3-phosphoglycerate kinase (Eikmanns (1992), Journal of Bacteriology 174: 6076-6086), are also known from other sources.
Using the known genes of the enzymes En to E42, it is possible to prepare genetically modified cells in which at least one, preferably at least two, more preferably at least three and most preferably all activities of the enzymes En to E42 has been increased by means of the techniques (mutation of the enzyme or increase in the expression of the enzyme) described at the outset in _ _ connection with the enzyme E. These cells are capable of being cultured in the presence of glycerol as the only carbon source (or else together with carbohydrates as further carbon source).
In addition to increasing one or more of the enzymatic activities En to Euf it may, in the event that the cell is capable of utilizing glycerol as carbon source, also be advantageous when the following genes are expressed, preferably heterologously expressed, in the cells used in the process according to the invention:
- the glpG gene or the 3925 gene, - the glpX gene, - the dhaR gene, the ycgU gene or the b1201 gene, - the fsa gene, the mipB gene, the ybiZ gene or the 30825 gene, - the talC gene, the fsaB gene, the yijG gene or the b3946 gene.
Again, the nucleotide sequences of these genes can be found in the KEGG database, the NCBI database or the EMBL
database.
In the event that the cells are capable of utilizing carbohydrates as nutrient source, it is preferred that the cell used in the process according to the invention features an activity of at least one, preferably of all, of the following enzymes E43 to E45 and E36 to E40 which is increased in comparison with its wild type:
- of an enzyme E43, which catalyzes the conversion of a-D-glucose 6-phosphate into P-D-fructose 6-phosphate, - of an enzyme E44, which catalyzes the conversion of P-D-fructose 6-phosphate into P-D-fructose 1,6-biphosphate, - of an enzyme E45, which catalyzes the conversion of P-D-fructose 1,6-biphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate, - of an enzyme E36, which catalyzes the conversion of glyceraldehyde 3-phosphate into 1,3-biphospho-glycerate, - of an enzyme E37, which catalyzes the conversion of 1,3-biphosphoglycerate into 3-phosphoglycerate, - of an enzyme EH, which catalyzes the conversion of 3-phosphoglycerate into 2-phosphoglycerate, - of an enzyme E39, which catalyzes the conversion of 2-phosphoglycerate into phosphoenolpyruvate, and - of an enzyme Ezio, which catalyzes the conversion of phosphoenolpyruvate into pyruvate.
In this context genetically modified cells which are especially preferred in accordance with the invention are those in which the activity of the following enzymes or enzyme combinations is increased:
E36, E37 E38 E39 E40 E43 E44 E45 E36E37 E36E38 r E36E39 I E36E40 E36E43 E36E44 E36E45 E37E38; E37E39 E37E40 E37E43 r E37E44 E37E45 E38E39; E38E40 E38E43 E38E44 ; E38E45 E39E40 E39E43 E39E44 r E39E45 r E40E43 r E40E44 r E40E45 E43E44 r E43E45 r E44E45 andEEEE EEEE
-36-37-38-39-40-43-44-45 =
In this context, it is especially preferred that the enzyme E0 is a glucose 6-phosphate isomerase (EC 5.3.1.9).
&IL] is a 6-phosphofructo kinase (EC 2.7.1.11), E45 is a fructose bisphosphate aldolase (EC 4.1.2.13), E36 is a glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.12), En is a phosphoglycerate kinase (EC 2.7.2.3), E38 is a phosphoglycerate mutase (EC 5.4.2.1), E39 is an enolase (EC 4.2.1.11) and E0 is a pyruvate kinase (EC 2.7.1.40).
Again, the nucleotide sequences of these genes can be found be found in the KEGG database, the NCBI database or the EMBL database.
In the event that the cell is capable of utilizing carbohydrates as carbon source, it is furthermore preferred to increase not only the activity of the abovementioned enzymes E.13 to E45 and E36 to E40, but also the uptake of glucose into the cells, for example by increasing the activity of enzymes of the phosphotransferase system, in particular those enzymes which are encoded by ptsI, ptsH and ptsM genes, or by enhancing glucokinase (EC 2.7.1.2), which is preferably encoded by the glk gene. In this context, reference is made in particular to US 6,680,187, US 6,818,432, US
6,913,910 and US 6,884,614, whose disclosure content with regard to the possibilities for overexpressing the ptsI, ptsH, ptsM and glk genes. In the event that carbohydrates act as carbon source, it may also be advantageous to promote the pentose phosphate pathway in a targeted manner, for example by increasing the activity of glucose 6-phosphate dehydrogenase (EC 1.1.1.49) and of 6-phosphogluconate dehydrogenase (EC 1.1.1.44), which is preferably encoded by the gnd gene, while, if appropriate, simultaneously inhibiting glycolysis, for example by weakening the activity of glucose 6-phosphate isomerase, as is described in WO-A-01/07626.
In the event that, according to the special embodiment of the process according to the invention where a genetically modified cell is used, in which methylmalonate semialdehyde is formed as precursor and succinyl-coenzyme A as intermediate, the cells form 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid via oxaloacetate and pyruvate as intermediates, it may furthermore be preferred to reduce the activity of at least one, preferably of all, of the following enzymatic activities in the cell:
- of an enzyme which catalyzes the conversion of oxaloacetate into phosphoenolpyruvate, such as, for example, phosphoenylpyruvate carboxykinase (EC
4.1.1.49) (see also DE-A-199 50 409), - of an enzyme which catalyzes the conversion of pyruvate into acetate such as, for example, pyruvate oxidase (EC 1.2.2.2) (see also DE-A-199 51 975), - of an enzyme which catalyzes the conversion of a-D-glucose 6-phosphate into P-D-fructose 6-phosphate (see also US 09/396,478), - of an enzyme which catalyzes the conversion of pyruvate into lactate such as, for example, 1-lactate dehydrogenase (EC 1.1.1.27) or lactate-malate transhydrogenase (EC 1.1.99.7), _ - of an enzyme which catalyzes the conversion of pyruvate into acetyl-coenzyme A such as, for example, pyruvate dehydrogenase (EC 1.2.1.51), - of an enzyme which catalyzes the conversion of pyruvate into acetyl phosphate such as, for example, pyruvate oxidase (EC 1.2.3.3), - of an enzyme which catalyzes the conversion of pyruvate into acetate, such as, for example, pyruvate dehydrogenase (EC 1.2.2.2), - of an enzyme which catalyzes the conversion of pyruvate into phosphoenolpyruvate such as, for example, phosphoenolpyruvate synthase (EC 2.7.9.2) or pyruvate, phosphate dikinase (EC 2.7.9.1), - of an enzyme which catalyzes the conversion of pyruvate into alanine such as, for example, alanine transaminase (2.6.1.2) or alanine-oxo-acid transaminase (EC 2.6.1.12), and/or - of an enzyme which converts pyruvate into acetolactate such as, for example, acetohydroxy acid synthase (EC 2.2.1.6).
Cells which are especially preferred in accordance with the invention and which are capable of forming 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxybutyric acid from carbohydrates as carbon source via succinyl-coenzyme A as intermediate and in which one or more of the abovementioned enzymatic activities, in particular one of the enzymatic activities El to E45, more preferably the enzymatic activities El, E1E2E3E4, E1E4E5E6E7 or and E1E4E5E7, can be increased are those microorganisms which have been described by Bennett et al., Metab. Eng. (2005), 7 (3), pages 229 to 239, Bennett et al., Biotechnol. Bioeng. (2005), 90 (6), pages 775 to 779, Bennett et al., Biotechnol. Prog. (2005), 21 (2), pages 358 to 365, Bennett et al. (2005), Appl.
Microbiol. Biotechnol., 67 (4), pages 515 to 523, Vemuri et al. (2002), Applied and Environmental Microbiology 68 (4), pages 1715 to 1727 and in US 6,455,284.
If, according to the first special embodiment of the process according to the invention, the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoates based on 3-hydroxyisobutyric acid starting from L-glutamate as carbon source takes place via succinyl-coenzyme A as intermediate, it is, in accordance with a further special embodiment of the process according to the invention, where a genetically modified cell is used, in which methylmalonat semialdehyde is formed as precursor and succinyl-coenzyme A as intermediate, furthermore preferred in accordance with the invention that the cell used features an activity of at least one of the, preferably of the two, following enzymes En and E46 which is increased in comparison with its wild type (see Figure 10):
- of an enzyme E46, which catalyzes the conversion of L-glutamate into 2-oxoglutarate;
- of an enzyme B28, which catalyzes the conversion of 2-oxoglutarate into succinyl-coenzyme A.
In this context, it is especially preferred that the enzyme E46 is a glutamate synthase (EC 1.4.1.13 or EC
1.4.1.14), a glutamate dehydrogenase (EC 1.4.1.2, EC
1.4.1.3 or EC 1.4.1.4) or an aspartate transaminase (EC 2.6.1.1 or EC 2.6.1.2) and E28 is a 2-oxoglutarate synthase (EC 1.2.7.3).
Preferred as enzyme En are those which have already been mentioned at the outset as preferred enzymes En.
The enzyme E46 is preferably encoded by the genes selected from the group consisting of: myn8., gltl, adr290wp, gltB, gltD, yeiT, aegA, ygfT, gltD-1, gltD-2, glt1, glt2, glsl, gltA, glt, glxD, gltA, yerD, cg10184, cg10185, sc3c9.12, gdhl, gdh2, ag140cp, gdhA, gdhA1, gdhA2, gluD, rocG, ypcA, gudB, gluD, gdhA, gdhA2, gdh, gdhA-1, gdhA2-2, gdhA-3, gluD1, gluD2, gludl-prov, gludla, t11118.2, t2I1.150, mrg7.13, gotl, got2, caspat, got2-prov, xr406-prov, 406-prov, cg4233, cg4233, cg8430, cg8430, f23n19.17, fl3j11.16, t26c19.9, f7f1.18, f10n7.200, t1611.170, f15n18.110, t20d1.70, aat, aatl, aat2, ab1038wp, afr211cp, agxl, bnA4, aatA, aatB, ybdL, aspC, yfbQ, ydcR, avtA2, aspC-1, aspC-2, aspC-3, aspC-4, aspB, aspB-1, aspB-2, aspB-3, aspB-4, argD1, argD2, aatAc, ywfG, mtnV, alaT, avtAl, avtA2, avtA3, cg10240, cg11103, cg12599, cg12844, dapC, 2sck36.07c, sc9e12.21, sc2h4.04c, aspB1, aspB2, aspB3, tyrB, gpt, gptl, gpt2, mgc82097, cg1640, c32f10.8, f20d23.34, f26f24.16, f24j13.15, t10d10.20 and agrwp.
Again, the nucleotide sequences of these genes can be found be found in the KEGG database, the NCBI database or the EMBL database.
In accordance with a second special embodiment of the process according to the invention, where a genetically modified cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via methylmalonate semialdehyde as precursor, it is preferred that the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoate based on 3-hydroxyisobutyric acid takes place via propionyl-coenzyme A as intermediate, where the cell used is capable of preferentially utilizing carbohydrates, glycerol, methane or methanol as carbon source. In this context, a variety of pathways exist for arriving at 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, departing from propionyl-coenzyme A.
In accordance with a first alternative of this second special embodiment of the process according to the invention, the formation of intermediate propionyl-coenzyme A takes place via acetyl-coenzyme A as further intermediate. In this context, it is especially preferred that the genetically modified cell used features an activity of at least one of the following enzymes E.4, E5 and E47 to E52 which is increased in comparison with its wild type (see Figures 11 and 12):
- of an enzyme E47, which catalyzes the conversion of acetyl-coenzyme A into malonyl-coenzyme A;
- of an enzyme E48, which catalyzes the conversion of malonyl-coenzyme A into malonate semialdehyde;
- of an enzyme E49, which catalyzes the conversion of malonate semialdehyde into 3-hydroxypropionate;
- of an enzyme E50, which catalyzes the conversion of 3-hydroxypropionate into 3-hydroxypropionyl-coenzyme A;
- of an enzyme E51, which catalyzes the conversion of 3-hydroxypropionyl-coenzyme A into acryloyl-coenzyme A;
- of an enzyme E52, which catalyzes the conversion of acryloyl-coenzyme A into propionyl-coenzyme A;
- of an enzyme E5, which catalyzes the conversion of propionyl-coenzyme A into methylmalonate semialdehyde;
- of an enzyme ELI, which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxy-isobutyrate.
Genetically modified cells are especially preferably used in accordance with the invention, in which the activity of the following enzymes or enzyme combinations is increased: E47, E48, E49, E50, E51, E52, Eil, E5 and E47E48E49E50E51E52E4E5=
Furthermore, it is particularly preferred in this context that the enzyme E4 is a 3-hydroxyisobutyrate dehydrogenase (EC
1.1.1.31) or a 3-hydroxyacyl-coenzyme A
dehydrogenase (EC 1.1.1.35), E5 is a methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27), E47 is a malonyl-coenzyme A decarboxylase (EC 4.1.1.9), a malonate-coenzyme A transferase (EC 2.8.3.3), a methylmalonyl-coenzyme A carboxytransferase (EC
2.1.3.1) or an acetyl-coenzyme A carboxylase (EC
6.4.1.2), E48 is a malonate-semialdehyde dehydrogenase (EC
1.2.1.18), E49 is a 3-hydroxypropionate dehydrogenase (EC
1.1.1.59), E50 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC
3.1.2.4), E51 is an enoyl-coenzyme A hydratase (EC 4.2.1.17) and E52 is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3).
Preferred genes for the enzymes E4 and E5 are those which have already been described above in connection with the first special embodiment of the cell according to the invention.
The enzyme E47 is preferably encoded by genes selected from the group consisting of mlycd, t19b17.4, tb08.2904.110, matA, acac, acaca, acacb, f5j5.21, f15c21.2, t8p21.5, accl, aar071wp, accA, accB, accC, accD, accC1, accC2, mmdA, fabG, accD1, accD2, accD3, cg10831, accBC, dtsR1, accDA, scc24.16c and cg11327, where accA, accC and accD are most preferred.
The enzyme E48 is preferably encoded by the iolD gene.
The enzyme E51 is preferably encoded by genes selected from the group consisting of echsi, ehhadh, hadha, eths1-prov, cg4389, cg4389, cg6543, cg6984, cg8778, ech-1, ech-2, ech-3, ech-4, ech-5, ech-6, ech-7, FCAALL.314, fcaa11.21, fox2, ecil, eci2, paaF, paaG, yfcX, fadB, faoA, rpfF, phaA, phaB, echAl, echA2, echA3, echA4, echA5, echA6, echA7, echA8, echA9, echA9, echA10, echA11, echAl2, echA13, echA14, echA15, echA16, echA17, echA18, echA19, echA20, echA21, fad-1, fad-2, fad-3, dcaE, hcaA, fadJ, rsp0671, rsp0035, rsp0648, rsp0647, rs03234, rs03271, rs04421, rs04419, rs02820, rs02946, paaGl, paaG2, paaG3, ech, pksH, ydbS, eccH1, eccH2, pimF, fabJ1, fabJ2, caiD2, ysiB, yngF, yusL, fucA, cg10919, scf41.23, scd10.16, sck13.22, scp8.07c, stbacl6h6.14, sc5f2a.15, sc6a5.38, hbd-1, hbd-2, hdb-3, hdb-4, hdb-5, hdb-6, hdb-7, hdb-8, hdb-9, hdb-10, fad-1, fad-2, fad-3, fad-4, fad-5, paaF-1, paaF-2, paaF-3, paaF-4, paaF-5, paaF-6, paaF-7 and crt.
The enzyme E52 is preferably encoded by genes selected from the group consisting of acadl, acadm, acad10, acadll, acadm-prov, acadl-prov, mgc81873, cg12262, cg4703, cg4860, f3e22.5, af1213wp, acdC, fadE13, acd-1, acd-2, acd-3, acd-4, acd-5, acd-6, acd-7, acd-8, acd-9, acd-10, acd-11, acd-12, acd, fadEl, fadE2, fadE3, fadE4, fadE5, fadE6, fadE7, fadE13, fadE14, fadE15, fadE16, fadE17, fadE18, fadE19, fadE20, fadE21, fadE22, fadE23, fadE26, fadE27, fadE30, fadE31, fadE33, fadE35, fadE38, fadE45, fadE, caiA, aidB, RSp0036, RS03588, mmgC, acdA-3, bcd, acdA, acdHl, acdH2, acdH3, aidB, acdI and acdH.
The nucleotide sequences of suitable genes for the enzymes Eu to E52, in particular also of the enzymes E49 and E50, can be found in the KEGG database, the NCBI
database or the EMBL database.
According to a second alternative of this second special embodiment of the process according to the invention, the formation of the intermediate propionyl-coenzyme A also takes place via acetyl-coenzyme A as further intermediate, where, according to this alternative, the propionyl-coenzyme A is not converted directly into the methylmalonate semialdehyde, but via methylmalonyl-coenzyme A. In this context, it is especially preferred that the genetically modified cell used features an activity of at least one of the following enzymes E2 to ELI, E6, E7 and Eu to E52 which is increased in comparison with its wild type (see Figures 13 and 14):
- of an enzyme Eu, which catalyzes the conversion of acetyl-coenzyme A into malonyl-coenzyme A;
- of an enzyme E48, which catalyzes the conversion of malonyl-coenzyme A into malonate semialdehyde;
- of an enzyme E49, which catalyzes the conversion of malonate semialdehyde into 3-hydroxypropionate;
- of an enzyme EH, which catalyzes the conversion of 3-hydroxypropionate into 3-hydroxypropionyl-coenzyme A;

_ - of an enzyme E51, which catalyzes the conversion of 3-hydroxypropionyl-coenzyme A into acryloyl-coenzyme A;
- of an enzyme E52, which catalyzes the conversion of acryloyl-coenzyme A into propionyl-coenzyme A;
- of an enzyme E.7, which catalyzes the conversion of propionyl-coenzyme A into (S)-methylmalonyl-coenzyme A;
- of an enzyme E6, which catalyzes the conversion of (S)-methylmalonyl-coenzyme A into (R)-methylmalonyl-coenzyme A;
- of an enzyme E2, which catalyzes the conversion of (R)-methylmalonyl-coenzyme A into methyl malonate;
- of an enzyme ED which catalyzes the conversion of methyl malonate into methylmalonate semialdehyde;
- of an enzyme E0 which catalyzes the conversion of methylmelonate-semialdehyde into 3-hydroxy-isobutyrate.
Genetically modified cells are especially preferably used according to the invention, in which the activity of the following enzymes or enzyme combinations is increased:
E2/ E3/ ELI/ E6/ E7/ E47/ E48/ E49/ EH/ E51/ E52 and Preferred enzymes and genes of these enzymes are those genes and enzymes which have already been mentioned above in connection with the enzymes E2 to E0 E6/ E7 and E47 to E.
According to a third alternative of this first alternative of the second special embodiment of the _ process according to the invention, the formation of the intermediate propionyl-coenzyme A also takes place via acetyl-coenzyme A as further intermediate, where, according to this alternative, the propionyl-coenzyme A
is, again, not converted directly into methylmalonate-semialdehyde, but via (R)-methylmalonyl-coenzyme A (and not via (S)-methylmalonyl-coenzyme A). In this context, it is especially preferred that the genetically modified cell used features an activity of at least one of the following enzymes E2 to E4, E7 and E4-7 to E52 which is increased in comparison with its wild type (see Figures and 16):
- of an enzyme E47, which catalyzes the conversion of 15 acetyl-coenzyme A into malonyl-coenzyme A;
- of an enzyme E48, which catalyzes the conversion of malonyl-coenzyme A into malonate semialdehyde;
- of an enzyme E49, which catalyzes the conversion of malonate semialdehyde into 3-hydroxypropionate;
- of an enzyme E50, which catalyzes the conversion of 3-hydroxypropionate into 3-hydroxypropionyl-coenzyme A;
- of an enzyme E51, which catalyzes the conversion of 3-hydroxypropionyl-coenzyme A into acryloyl-coenzyme A;
- of an enzyme E52, which catalyzes the conversion of acryloyl-coenzyme A into propionyl-coenzyme A;
- of an enzyme E7, which catalyzes the conversion of propionyl-coenzyme A into methylmalonyl-coenzyme A;
- of an enzyme E2, which catalyzes the conversion of methylmalonyl-coenzyme A into methylmalonate;
- of an enzyme E3, which catalyzes the conversion of methyl malonate into methylmalonate-semialdehyde;
- of an enzyme E4, which catalyzes the conversion of methylmalonate-semialdehyde into 3-hydroxy-isobutyrate.
Genetically modified cells are especially preferably used according to the invention, in which the activity of the following enzymes or enzyme combinations is increased:
E2, E3, E4, E7, E47, E48r E49, E50, E51, E52 and E2E3E4E7E47E48E49E50E51E52=
Preferred enzymes and genes of these enzymes are, again, those genes and enzymes which have already been mentioned above in connection with the enzymes E2 to ELI, E7 and E47 to E52.
According to a fourth alternative of the second special embodiment of the process according to the invention, the formation of the intermediate propionyl-coenzyme A also takes place via acetyl-coenzyme A as further intermediate, where, according to this alternative, acetoacetyl-coenzyme A is formed as intermediate. In this context, it may be preferred that the genetically modified cell used features an activity of at least one of the following enzymes Eg and E53 to E61 which is increased in comparison with its wild type:
- of an enzyme E53, which catalyzes the conversion of two acetyl-coenzyme A units into acetoacetyl-coenzyme A;
- of an enzyme E54, which catalyzes the conversion of acetoacetyl-coenzyme A into 3-hydroxybutanoyl-coenzyme A;
- of an enzyme Ess, which catalyzes the conversion of 3-hydroxybutanoyl-coenzyme A into crotonyl-coenzyme A;
- of an enzyme E56, which catalyzes the conversion of crotonyl-coenzyme A into butyryl-coenzyme A;
- of an enzyme E57, which catalyzes the conversion of butyryl-coenzyme A into ethylmalonyl-coenzyme A;
- of an enzyme E58, which catalyzes the conversion of ethylmalonyl-coenzyme A into methylsuccinyl-coenzyme A;
- of an enzyme E59, which catalyzes the conversion of methylsuccinyl-coenzyme A isobutyryl-coenzyme A;
- of an enzyme E60, which catalyzes the conversion of isobutyryl-coenzyme A into methacrylyl-coenzyme A;
- of an enzyme E61, which catalyzes the conversion of methacrylyl-coenzyme A into 3-hydroxyisobutyryl-coenzyme A;
- of an enzyme E8, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A into 3-hydroxy-isobutyrate.
In this context, genetically modified cells which are especially preferred according to the invention are those in which the activity of the following enzymes or enzyme combinations is increased: E8, E53, E54, E55, E56, E57, E58, E58, E60, E61 and E8E53E54E55E56E57E58E59E60E61.
This metabolic pathway and the enzymes which play a role in this metabolic pathway are described, for example, in Korotkova et al., Journal of Bacteriology (2002), pages 1750 to 1758.
According to a fifth alternative of the second special embodiment of the process according to the invention, the formation of the intermediate propionyl-coenzyme A takes place via, again, acetyl-coenzyme A as further intermediate, where, according to this alternative, acetoacetyl-coenzyme A is formed as further intermediate but where, in this case, ethylmalonyl-coenzyme A is formed directly from crotonyl-coenzyme A. In this context, it may be preferred that the cell features an activity of at least one of the following enzymes E8, E53 to E55, E58 and E62 to E65 which is increased in comparison with its wild type (see Figure 17):
- of an enzyme E53, which catalyzes the conversion of two acetyl-coenzyme A units into acetoacetyl-coenzyme A;
- of an enzyme E54, which catalyzes the conversion of acetoacetyl-coenzyme A into 3-hydroxybutyryl-coenzyme A;
- of an enzyme E55, which catalyzes the conversion of 3-hydroxybutyryl-coenzyme A into crotonyl-coenzyme A;
- of an enzyme E62, which catalyzes the conversion of crotonyl-coenzyme A into ethylmalonyl-coenzyme A
- of an enzyme E58, which catalyzes the conversion of ethylmalonyl-coenzyme A into methylsuccinyl-coenzyme A;
- of an enzyme E63, which catalyzes the conversion of methylsuccinyl-coenzyme A into mesaconyl-coenzyme A;
- of an enzyme E64, which catalyzes the conversion of mesaconyl-coenzyme A into P-methylmalyl-coenzyme A;
_ of an enzyme E85, which catalyzes the conversion of P-methylmalyl-coenzyme A into glyoxylate and propionyl-coenzyme A.
Then, from propionyl-coenzyme A 3-hydroxyisobutyric acid can be formed in the above-described manner (increasing the activity of one or more of the enzymes E7, E2, E3 and E4, increasing the activity of one or more of the enzymes E7, E8, E2, E3 and E4, or increasing the activity of one of the, or of both, enzymes E4 and E5)=
In this context, it is especially preferred that the enzyme E53 is a P-ketothiolase (EC 2.3.1.9), E54 is an acetoacetyl-coenzyme A reductase (an EC
1.1.1.36), E55 is an enoyl-coenzyme A hydratase (EC 4.2.1.17), E82 is a crotonyl-coenzyme A decarboxylase, E58 is an ethylmalonyl-coenzyme A mutase (EC 5.4.99.2), E83 is a methylsuccinyl-coenzyme A dehydrogenase, E84 is a mesaconyl-coenzyme A hydratase, and E85 is a P-methylmalyl/L-malyl-coenzyme A lyase.
The enzyme E53 is preferably encoded by genes selected from the group consisting of acatl, acat2, 1oc484063, 1Loc489421, mgc69098, mgc81403, mgc81256, mgc83664, kat-1, erg10, ygeF, atoB, fadAx, phbA-1, phbA-2, atoB-2, pcaF, pcaF-2, phb-A, bktB, phaA, tioL, thlA, fadA, paaJ, phbAf, pimB, mmgA, yhfS, thl, vraB, thl, mvaC, thiL, paaJ, fadA3, fadA4, fadA5, fadA6, cg112392, catF, sc8f4.03, thiLl, thiL2, acaB1, acaB2, acaB3 or acaB4, where acatl, acat2, atoB and phbA and the corresponding gene from Rhodobacter sphaeroides are especially preferred.
The enzyme E54 is preferably encoded by genes selected from the group consisting of phbB, fabG, phbN1, phbB2 or cg112444, where phbB is especially preferred and the corresponding gene from Rhodobacter sphaeroides is especially preferred.
The enzyme E55 is preferably encoded by genes selected from the group consisting of echS1, ehhadh, hadha, echsl-prov, cg4389, cg4389, cg6543, cg6984, cg8778, ech-1, ech-2, ech-3, ech-4, ech-5, ech-6, ech-7, FCAALL.314, fcaa11.21, fox2, eci1, eci2, paaF, paaG, yfcX, fadB, faoA, rpfF, phaA, phaB, echAl, echA2, echA3, echA4, echA5, echA6, echA7, echA8, echA9, echA9, echA10, echAll, echAl2, echA13, echA14, echA15, echA16, echA17, echA18, echA19, echA20, echA21, fad-1, fad-2, fad-3, dcaE, hcaA, fadJ, rsp0671, rsp0035, rsp0648, rsp0647, rs03234, rs03271, rs04421, rs04419, rs02820, rs02946, paaG1, paaG2, paaG3, ech, pksH, ydbS, eccH1, eccH2, pimF, fabJ1, fabJ2, caiD2, ysiB, yngF, yusL, fucA, cg10919, scf41.23, scd10.16, sck13.22, scp8.07c, stbacl6h6.14, sc5f2a.15, sc6a5.38, hbd-1, hbd-2, hdb-3, hib-4, hdb-5, hdb-6, hdb-7, hdb-8, hdb-9, hdb-10, fad-1, fad-2, fad-3, fad-4, fad-5, paaF-1, paaF-2, paaF-3, paaF-4, paaF-5, paaF-6, paaF-7 and crt here the corresponding gene from Rhodobacter sphaeroides is especially preferred.
Suitable genes for the enzyme E58 are selected from the group consisting of mut, mutA, mutB, sbm, sbmA, sbmB, sbm5, bhbA, mcmA, mcmAl, mcmA2, mcmB, mcml, mcm2, mcm3, icmA, meaAl and meaA2, where, again, the corresponding gene from Rhodobacter sphaeroides is especially preferred.
The enzyme which is preferably employed as enzyme E62 is an enzyme from Rhodobacter sphaeroides which is encoded by the DNA sequence with the SEQ ID No 05 and which has the amino acid sequence as shown in SEQ ID No 06.
Preferred genes for the enzymes E63, Em and E65 are, in particular, the genes for these enzymes from Rhodobacter sphaeroides.
Further examples of nucleotide sequences of the abovementioned genes can also be found in the KEGG
database, the NCBI database or the EMBL database, inter alia.
As has already been explained above, the first alternative of the second preferred embodiment of the process according to the invention generates 3-hydroxyisobutyric acid or the polyhydroxyalkanoates based on 3-hydroxyisobutyric acid via propionyl-coenzyme A and acetyl-coenzyme A as intermediates. In this context, it may be meaningful, in principle, to influence not only one or more of the abovementioned enzymatic activities E2 to E8 and E.47 to E65, but also those enzymatic activities which bring about an increase in the formation of acetyl-coenzyme A in the cell.
In the event that 3-hydroxyisobutyric acid is formed from carbohydrates or glycerol as carbon source, it may be preferred that the cell features an increased activity in an enzyme E66, which catalyzes the conversion of pyruvate into acetyl-coenzyme A. This enzyme E66 preferably takes the form of a pyruvate dehydrogenase (EC 1.2.1.51).
In the event that 3-hydroxyisobutyric acid is formed from Cl-carbon sources such as, for example, methane or methanol, it may be preferred that the cell features an activity of at least one of the enzymes E67 to E71 which is increased in comparison with its wild type:
- of an enzyme E67, which catalyzes the conversion of methane into methanol;
- of an enzyme EH, which catalyzes the conversion of methanol into formaldehyde;
- of an enzyme E69, which catalyzes the conversion of formaldehyde into 5,10-methylenetetrahydrofolate;
- of an enzyme E70, which catalyzes the conversion of 5,10-methylenetetrahydrofolate into 5-methyltetra-hydrofolate;
- of an enzyme Eil, which catalyzes the conversion of 5-methyltetrahydrofolate into acetyl-coenzyme A.
In this context, it is especially preferred that the enzyme E67 is a methane monooxygenase (EC 1.14.13.25), EH is a methanol dehydrogenase (EC 1.1.1.244), E69 is a methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27), E70 is a methylenetetrahydrofolate reductase (EC
1.5.1.20), E71 is a carbon monoxide dehydrogenase (EC 1.2.99.2).
The nucleotide sequences of suitable genes for the enzymes E63 to E67 can be found in the KEGG database, the NCBI database or the EMBL database.
According to a third special embodiment of the process according to the invention, where a genetically modified cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via methylmalonate-semialdehyde as precursor, it is preferred that the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoate based on 3-hydroxyisobutyric acid takes place via acryloyl-coenzyme A as intermediate, where the cell used is capable of preferentially utilizing carbohydrates, glycerol or glutamate as carbon source.
In connection with the third special embodiment of the process according to the invention, it is especially preferred when the genetically modified cell used features an activity of at least one of the following enzymes E2 to ELI, E62, E72 and E.73 which is increased in comparison with its wild type (see Figure 18):
- of an enzyme E72, which catalyzes the conversion of beta-alanine to beta-alanyl-coenzyme A, - of an enzyme E.73, which catalyzes the conversion of beta-alanyl-coenzyme A into acrylyl-coenzyme A, - of an enzyme E62, which catalyzes the conversion of acrylyl-coenzyme A into methylmalonyl-coenzyme A (or the conversion of crotonyl-coenzyme A into ethylmalonyl-coenzyme A), - of an enzyme E2, which catalyzes the conversion of methylmalonyl-coenzyme A into methyl malonate;
- of an enzyme E3, which catalyzes the conversion of methyl malonate into methylmalonate-semialdehyde;
- of an enzyme E0 which catalyzes the conversion of methylmalonate-semialdehyde into 3-hydroxyisobutyric acid.
In this context, cells which are especially preferred according to the invention are those in which the activity of the following enzymes or enzyme combinations is increased: E62E2, E62E3, E62E4, E62E2E3 and E72E73E62E2E3E4-In connection with the fourth special embodiment, too, of the process according to the invention it may be advantageous to use a genetically modified cell in which an enzyme which is capable of catalyzing at least two of the above-described reaction steps is overexpressed. Here too, it is possible for example to employ an enzyme which features both the activity of the enzyme E2 and the activity of the enzyme E3, such as, for example, the malonyl-coenzyme A reductase from Sulfolobus tokodaii, which is encoded by the DNA sequence with the SEQ ID No 03 and which features the amino acid sequence as shown in SEQ ID No 04. Furthermore, it is, in principle, also possible in the context of the fourth special embodiment of the cell according to the invention to employ a cell which is already capable of forming especially large amounts of acrylyl-coenzyme A.
In this context, it is especially preferred that the enzyme E72 is a coenzyme A transferase (EC 2.8.3.1) or a coenzyme A synthetase, preferably a coenzyme A
trans ferase, E73 is a beta-alanyl-coenzyme A ammonia-lyase (EC 4.3.1.6), Eu is a crotonyl-coenzyme A decarboxylase E2 is a methylmalonyl-coenzyme A hydrolase (EC
3.1.2.17), E2 is an aldehyde dehydrogenase (EC 1.2.1.3) or an aldehyde oxidase (EC 1.2.3.1) and E4 is a 3-hydroxyisobutyrate dehydrogenase (EC
1.1.1.31) or a 3-hydroxyacyl-coenzyme A
dehydrogenase (EC 1.1.1.35).
Preferred enzymes E.72 with a CoA transferase activity are those from Megasphaera elsdenii, Clostridium propionicum, Clostridium kluyveri and also from Escherichia coli.
Examples which may be mentioned at this point of a DNA
sequence coding for a CoA transferase is the sequence from Megasphaera elsdenii referred to as SEQ ID No: 24 in WO-A-03/062173. Enzymes which are furthermore preferred are those variants of the CoA transferase which are described in WO-A-03/062173.
Suitable enzymes E73 with a beta-alanyl-coenzyme A
ammonia-lyase activity are, for example, those from Clostridium propionicum. DNA sequences which code for such an enzyme can be obtained for example from Clostridium propionicum as described in Example 10 in WO-A-03/062173. The DNA sequence which codes for the beta-alanyl-coenzyme A ammonia-lyase from Clostridium propionicum is specified in WO-A-03/062173 as SEQ ID No:
22.
An enzyme E62 which is preferably employed is, again, the crotonyl-coenzyme A decarboxylase from Rhodobacter sphaeroides, which is encoded by the DNA sequence with the SEQ ID No 05 and which features the amino acid sequence as shown in SEQ ID No 06. This enzyme is not only capable of converting crotonyl-coenzyme A into ethylmalonyl-coenzyme A, but also of converting acrylyl-coenzyme A into methylmalonyl-coenzyme A.
Suitable genes for the enzymes E2 to E4 have already been mentioned in connection with the first variant of the process according to the invention, where it is also preferred in connection with the second variant, the above-described gene from Sulfolobus tokodaii is especially preferred as gene for the enzyme E3.
According to an especially preferred variant of the third special embodiment of the process according to the invention, a genetically modified cell is used which features at least one activity of the enzyme E2 and E62 or of the enzymes E2, E3 and E62 which is increased in comparison with its wild type, where the enzyme E2 or the enzymes E2 and E3 is encoded by a DNA sequence as shown in SEQ ID No 03 and the enzyme E62 is encoded by a DNA
sequence as shown in SEQ ID No 05. In this context, it is preferred when the increased activity of these two enzymes is achieved by overexpressing, in the cell, the polypeptides with SEQ ID No 04 and SEQ ID No 06 or else that amino acid sequences with at least 50%, preferably at least 55%, more preferably at least 60%, more preferably at least 65% and most preferably at least 70%
identity with the amino acid sequence as shown in SEQ ID
No 04 and SEQ ID No 06, respectively. In this context, these two DNA sequences may be integrated into the genome of the cell or else be present on a vector inside the cell.
In connection with the above-described third special embodiment of the process according to the invention, it may furthermore be advantageous when the genetically modified cell used features not only an increase in the activity of the enzyme E62 and/or of the activity of the enzyme E2 or of the enzymes E2 and E3, but at least one, preferably both, of the following properties:
- an activity of an enzyme Ell, which catalyzes the conversion of pyruvate into oxaloacetate or of an enzyme E74, which catalyzes the conversion of phosphoenolpyruvate into oxaloacetate, but preferably of an enzyme Ell, which catalyzes the conversion of pyruvate into oxaloacet&te, which is increased in comparison with its wild type and - an increased activity of an enzyme Em, which catalyzes the conversion of aspartate into beta-alanine.
The enzyme En preferably takes the form of a carboxylase, especially preferably of a pyruvate carboxylase (EC
number 6.4.1.1), which catalyzes the conversion of - pyruvate into oxaloacetate. A pyruvate carboxylase which is especially preferred in this context is the mutant which is described in "A novel methodology employing Corynebacterium glutamicum genome information to generate a new L-lysine-producing mutant." Ohnishi J et al., Applied Microbiology and Biotechnology, Vol. 58 (2), pages 217-223 (2002). In this mutation, the amino acid proline at position 458 has been substituted by serine.
The enzyme Em preferably takes the form of a decarboxylase, especially preferably of a glutamate decarboxylate or of an aspartate decarboxylase, with a 1-aspartate 1-decarboxylase (EC number 4.1.1.11) which is encoded by the panD gene being most preferred. Aspartate decarboxylase catalyzes the conversion of aspartate into beta-alanine. Genes for aspartate decarboxylase (panD
genes) from, inter alia, Escherichia coil (FEMS
Microbiology Letters, 143, pages 247-252 (1996)), "Photorhabdus luminescens subsp. Laumondii, Mycobacterium bovis subsp. Bovis") and from a large number of other microorganisms have already been cloned and sequenced.
DE-A-198 55 313 describes in particular the nucleotide sequence of the panD gene from Corynebacterium glutamicum. In principle, it is possible to use panD
genes of any feasible origin, no matt-,r whether from bacteria, yeasts or fungi. Furthermore, it is possible to employ all alleles of the panD gene, in particular also those which are the result of the degeneracy of the genetic code or of function-neutral sense mutations. An aspartate decarboxylase which is especially preferred according to the invention, besides the aspartate decarboxylase from Corynebacterium glutamicum, is the Escherichia coil mutant DV9 (Vallari and Rock, Journal of Bacteriology, 164, pages 136-142 (1985)). The preparation of recombinant cells in which both the activity of the pyruvate carboxylase and the activity of the aspartate decarboxylase is increased in described in DE-A-10 2005 048 818.
According to a second variant of the process according to the invention, the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via 3-hydroxyisobutyryl-coenzyme A as precursor.
In the event that, in the process according to the invention, a cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via 3-hydroxyisobutyryl-coenzyme A as precursor, as specified in the second variant, it is preferred according to a first special embodiment that the formation of 3-hydroxyisobutyric acid or of the polyhydroxyalkanoate based on 3-hydroxyisobutyric acid takes place via isobutyryl-coenzyme A as intermediate, where the cell is capable of preferentially utilizing carbohydrates, glycerol or L-valine as carbon source.
In the event that carbohydrates or glycerol act as the carbon source, it is preferred, according to a first alternative of this first special embodiment of the second variant of the process according to the invention to use a genetically modified cell which features an activity of at least one of the following enzymes E.76 to E79, EH, E61 and E8 which is increased in comparison with its wild type (see Figure 19):
- of an enzyme Em, which catalyzes the conversion of pyruvate into 2-acetolactate;
- of an enzyme ET?, which catalyzes the conversion of 2-acetolactate into 2,3-dihydroxyisovalerate;
- of an enzyme Emi, which catalyzes the conversion of 2,3-dihydroxyisovalerate into 2-oxoisovalerate;
- of an enzyme E-79, which catalyzes the conversion of 2-oxoisovalerate into isobutyryl-coenzyme A;
- of an enzyme EH, which catalyzes the conversion of isobutyryl-coenzyme A into methacrylyl-coenzyme A;
- of an enzyme E61, which catalyzes the conversion of methacrylyl-coenzyme A into 3-hydroxyisobutyryl-coenzyme A;
- of an enzyme E8, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A into 3-hydroxy-isobutyrate.
Genetically modified cells are especially preferably used in accordance with the invention, in which the activity of the following enzymes or enzyme combinations is increased: E8, E60, E61, E76, E77, E78, E79 and E8E60E61E76E77E78E79.
In this context, it is especially preferred that the enzyme E9 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC
3.1.2.4), E76 is an acetolactate synthase (EC 2.2.1.6), E77 is a dihydroxyisovalerate dehydrogenase (EC
1.1.1.86), E79 is a 2,3-dihydroxyisovalerate dehydratase (EC
4.2.1.9), E79 is a 2-oxoisovalerate dehydrogenase (EC 1.2.1.25 or EC 1.2.4.4), E60 is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3), a butyryl-coenzyme A dehydrogenase (EC 1.3.99.2) or a 2-methylacyl-coenzyme A dehydrogenase (EC
1.3.99.12), and E61 is an enoyl-coenzyme A hydratase (EC 4.2.1.17).
Preferred enzymes ED E60 and E61 are those which have already been described above.
The enzyme E76 is preferably encoded by genes selected from the group consisting of ilvbl, t8p19.70, ilvl, ilv2, ilv6, aa1021wp, ae1305cp, ilvI, ilvH, ilvN, ilvB, ilvM, ilvG, ilvN, budB, ilvN-1, ilvN-2, atrC, ilvX, iolD, budB, alsS, ilvK, ilvB1, ilvB2, ilvB3, ilvN1, ilvN2, cg11271, cg11272, iolD and scc57A.40c.
The enzyme E77 is preferably encoded by genes selected from the group consisting of fl4p22.200, ilv5, ac1198Wp, ilvC, ilvY, ilvC-1, ilvC-2, ilvC-3 and cg11273, where the ilvC gene is most preferred.
The enzyme Em is preferably encoded by genes selected from the group consisting of f14o13.18, ilv3, ac1117wp, ilvD, cg11268, ilvD1 and ilvD2, where ilvD is most preferred.
In the event that L-valine acts as carbon source, it is preferred according to a second modification of the first special embodiment of the second alternative of the process according to the invention, where a genetically modified cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via 3-hydroxyisobutyryl-coenzyme A as precursor and isobutyryl-coenzyme A as intermediate, that this used cell features an activity of at least one of the following enzymes E79, En, E60, E61 and E8 which is increased in comparison with its wild type (see Figure 20):
- of an enzyme EH, which catalyzes the conversion of L-valine into 2-oxoisovalerate;
- of an enzyme E79, which catalyzes the conversion of 2-oxoisovalerate into isobutyryl-coenzyme A;
- of an enzyme EH, which catalyzes the conversion of isobutyryl-coenzyme A into methacrylyl-coenzyme A;
- of an enzyme E61, which catalyzes the conversion of methacrylyl-coenzyme A into 3-hydroxyisobutyryl-coenzyme A;
- of an enzyme E8, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A into 3-hydroxyiso-butyrate.
Genetically modified cells are especially preferably used in accordance with the invention, in which the activity _ of the following enzymes or enzyme combinations is increased: E8, EH, E61, E79, EH and E8E60E61E79E80.
In this context, it is especially preferred that the enzyme E8 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC 3.1.2.4), EH is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3), a butyryl-coenzyme A dehydrogenase (EC 1.3.99.2) or a 2-methylacyl-coenzyme A dehydrogenase (EC 1.3.99.12), E61 is an enoyl-coenzyme A hydratase (EC 4.2.1.17), E79 is a 2-oxoisovalerate dehydrogenase (EC 1.2.1.25 or EC 1.2.4.4), and EH is an amino acid transferase (EC 2.6.1.42).
Preferred enzymes E8, EH, E61 and E79 are those which have already been described above.
The enzyme EH is preferably encoded by genes selected from the group consisting of bcat1, bcat2, t27I1.8, t27i1.9, f2j10.5, f2j10.4, tl2h1.16, mmb12.20, t9c5.3, mpa24.13, batl, bat2, ad1384wp, eca39, bcaA, ilvE, ilvEl, ilvE2, ilvE3, ywaA, ybgE, bcaT and cg12204, where ilvE is especially preferred.
The nucleotide sequences of suitable genes the enzyme EH
can, again, be found in the KEGG database, the NCBI
database or the EMBL database.
In connection with this second alternative of the first special embodiment of the second variant of the process according to the invention, it may furthermore be advantageous to use a genetically modified cell in which the activity of an enzyme E4 which catalyzes the conversion of methylmalonate-semialdehyde into 3-hydroxyisobutyric acid is reduced, where this enzyme E4 preferably takes the form of a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or of a 3-hydroxyacyl-coenzyme A dehydrogenase (EC 1.1.1.35).
According to the second modification of the first special embodiment of the second variant of the process according to the invention, where a genetically modified cell is used, in which the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via 3-hydroxyisobutyryl-coenzyme A as precursor and isobutyryl-coenzyme A as intermediate and starting from L-valine as carbon source, it may furthermore be preferred to employ those cells which are already capable of forming large amounts of L-valine. In this context, suitable cells are in particular those which have been described by Blombach et al. in Applied Environmental Microbiology, Vol. 73 (7) (2007), pages 2079-2084.
According to a special embodiment of the process according to the invention, it is furthermore preferred that the genetically modified cell used features an expression of the gib() gene which is increased in comparison with its wild type. Furthermore, it may under certain circumstances be preferred that the genetically modified cell used features an activity of the citrate transport protein which is encoded by the dctA gene or the citP gene, which activity is reduced in comparison with its wild type.
The genetically modified cell used in the process according to the invention may preferably be obtained by a process comprising the method step of increasing the activity of at least one of the above-described enzymes, preferably of one or more of the enzymes - El to E4, - El, E4, E5, E6 and E71 - El, E4, E5 and E7, - E4, E5 and E47 to E52, - E2 to E4 E6 E7 and E47 to E52, - E2 to E4 E7 and E47 to E52 - E8 and E53 to E61, E53 to E55, E58 and E62 to E64, - E2 to E3 E62 E72 and E73, E60, E61 and E76 to E79 or - E8, E60, E61, E79 and E80 in the cell, where increasing the enzymatic activity is preferably carried out by the methods described at the outset.
In the process step IA) of the process according to the invention, the genetically modified cells can be into contact with the nutrient medium, and thus cultured, either continuously or batchwise in the batch method or in the fed-batch method or in the repeated-fed-batch method in order to produce 3-hydroxyisobutyrate or polyhydroxyalkanoates based on 3-hydroxyisobutyrate. A
semicontinuous method as described in GB-A-1009370 is also feasible. An overview over known culture methods are described in the textbook by Chmiel ("Bioprozesstechnik 1. EinfUhrung in die Bioverfahrenstechnik" [Bioprocess technology 1. introduction to bioprocess technology]
(Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas ("Bioreaktoren und periphere Einrichtungen", [Bioreactors and peripheral equipment]
Vieweg Verlag, Braunschweig/Wiesbaden, 1994).
The culture medium to be used must suitably meet the requirements of the strains in question. Descriptions of culture media for various microorganisms can be found in the textbook "Manual of Methods for General Bacteriology"
of the American Society for Bacteriology (Washington D.C., USA, 1981).
Carbon sources which may be used are carbohydrates such as, for example, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as, for example, soy oil, sunflower oil, peanut oil and coconut fat, fatty acids such as, for example, palmitic acid, stearic acid and linolic acid, alcohols such as, for example, glycerol and methanol, hydrocarbons such as methane, amino acids such as L-glutamate or L-valine, or organic acids such as, for example, acetic acid. These substances may be used singularly or as a mixture. It is especially preferred to employ carbohydrates, in particular monosaccharides, oligosaccharides or polysaccharides, as described in US 6 01 494 and US 6 136 576, or C5-sugars, or glycerol.
Nitrogen sources which can be used are organic nitrogen-comprising compounds such as peptones, yeast extract, meat extract, malt extract, cornsteep liquor, soya mill and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources can be used singularly or as a mixture.
Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-comprising salts can be used as sources of phosphorus. The culture medium must furthermore comprise salts of metals such as, for example, magnesium sulfate or iron sulfate, which are required for growth. Finally, essential growth factors such as amino acids and vitamins may be employed in addition to the abovementioned substances. Moreover, suitable precursors may be added to the culture medium. The abovementioned input materials may be added to the culture in the form of a single batch or else fed in a suitable manner during culturing.
The pH for the culture can be controlled by employing, in an appropriate manner, basic compounds such as sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia, or acidic compounds such as phosphoric acid or sulfuric acid. Foaming can be controlled by employing antifoams such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids, it is possible to add to the medium suitable substances which have a selective effect, such as, for example, antibiotics. Aerobic conditions are maintained by introducing, into the culture, oxygen or oxygen-containing gas mixtures such as, for example, ambient air. The culture temperature is normally 20 C to 45 C and preferably 25 C to 40 C. It may be preferred to employ, as cells, those cells which are described in US 6 803 218, in particular when using cells which are capable of converting glycerol as the substrate. In this case, the cells can be cultured at temperatures in the range of from 40 to 100 C.
The isolation of 3-hydroxyisobutyric acid from the nutrient solution is preferably carried out continuously, it being furthermore preferred in this context also to produce 3-hydroxyisobutyric acid by fermentation in a continuous manner, so that the entire process from the production of 3-hydroxyisobutyric acid up to its isolation from the fermentation liquor can be carried out continuously. For the continuous isolation of the production of 3-hydroxyisobutyric acid from the fermentation liquor, the former is continuously passed over a device for removing the microorganisms employed during fermentation, preferably through a filter with an exclusion level in the range of from 20 to 200 kDa, where a solid/liquid separation takes place. It is also feasible to employ a centrifuge, a suitable sedimentation device or a combination of these devices, it being especially preferred to first separate at least part of the microorganisms by sedimentation and subsequently to feed the fermentation liquor, which has been freed from part of the microorganisms, to ultrafiltration or to a centrifugation device.
After the microorganisms have been removed, the fermentation product, which is enriched with regard to its 3-hydroxyisobutyric acid fraction, is fed to a separation system, preferably a multistep separation system. This separation system provides a plurality of separation steps which are connected in series, from which steps in each case return lines lead away and back to the fermentation tank. Furthermore, exit pipes lead out of the respective separation steps. The individual separation steps may operate by the electrodialysis, the reverse osmosis, the ultrafiltration or the nanofiltration principle. As a rule, these are membrane separation devices in the individual separation steps.
The selection of the individual separation steps is a function of the nature and the extent of the fermentation by-products and substrate residues.
Besides the 3-hydroxyisobutyric acid being separated off by means of electrodialysis, reverse osmosis, ultrafiltration or nanofiltration, in the course of which an aqueous 3-hydroxyisobutyric acid solution is obtained as the end product, the 3-hydroxyisobutyric acid can also be separated off by extractive methods from the fermentation solution which has been freed from microorganisms, in which case, finally, the pure 3-hydroxyisobutyric acid can be obtained. To separate the 3-hydroxyisobutryic acid by extraction, it is possible to add, to the fermentation solution, for example ammonium compounds or amines in order to form an ammonium salt of 3-hydroxyisobutyric acid. This ammonium salt can then be separated from the fermentation solution by adding an organic extractant and subsequently heating the resulting mixture, whereby the ammonium salt is concentrated in the organic phase. Then, the 3-hydroxyisobutyric acid can be isolated from this phase for example by further extraction steps, giving the pure 3-hydroxyisobutyric acid. More details regarding the separation method can be found in WO-A-02/090312 regarding the separation of hydroxycarboxylic acids from fermentation solutions.
Depending on the way in which the 3-hydroxyisobutyric acid is separated from the fermentation solution, either an aqueous solution of 3-hydroxyisobutyric acid comprising 2 to 90% by weight, preferably 7.5 to 50% by weight and especially preferably 10 to 25% by weight of 3-hydroxyisobutyric acid, or else pure 3-hydroxyisobutyric acid is obtained.
Furthermore, the 3-hydroxyisobutyric acid prepared in step IA) of the process according to the invention can also be neutralized, either before, during or after the purification, for which purpose bases such as, for example, calcium hydroxide or sodium hydroxide can be employed.
In process step IB) of the process according to the invention, the 3-hydroxyisobutyric acid is dehydrated with formation of methacrylic acid, for which purpose it is possible either to employ the pure 3-hydroxyisobutyric acid isolated from the fermentation solution or else the aqueous solution of 3-hydroxyisobutryic acid, which has been isolated when working up the fermentation solution, it also being possible to concentrate the aqueous solution of 3-hydroxyisobutyric acid, if appropriate, before the dehydration step, for example by means of distillation, if appropriate in the presence of a suitable entrainer.
The dehydration reaction can, in principle, be carried out in liquid phase or in the gas phase. Furthermore, it is preferred in accordance with the invention that the dehydration reaction is carried out in the presence of a catalyst, with the nature of the catalyst employed depending on whether a gas-phase or a liquid-phase reaction is carried out.
Suitable dehydration catalysts are both acidic catalysts and alkaline catalysts. Acidic catalysts are preferred, in particular because they show less tendency to form oligomers. The dehydration catalyst may be employed both as a homogeneous and as a heterogeneous catalyst. If the dehydration catalyst is present in the form of a heterogeneous catalyst, it is preferred that the dehydration catalyst is in contact with a support x.
Suitable supports x are all solids believed by the skilled worker to be suitable. In the present context, it is preferred that the solids have suitable pore volumes which are suitable for good binding and absorption of the dehydration catalyst. Furthermore, total pore volumes as specified by DIN 66133 in a range of from 0.01 to 3 ml/g are preferred, and total pore volumes in the range of from 0.1 to 1.5 ml/g are especially preferred. Moreover, it is preferred that the solids which are suitable as support x have a surface area in the range of from 0.001 to 1000 m2/g, preferably in the range of from 0.005 to 450 m2/g and furthermore preferred in the range of from 0.01 to 300 m2/g as determined by BET test as specified in DIN 66131. A support which may be employed for the dehydration catalyst can firstly be bulk material with a mean particle diameter in the range of from 0.1 to 40 mm, preferably in the range of from 1 to 10 mm, and furthermore preferably in the range from 1.5 to 5 mm. The wall of the dehydration reactor may furthermore act as support. Furthermore, the support may be acidic or alkaline per se, or else an acidic or alkaline dehydration catalyst may be applied to an inert support.
Application techniques which may be mentioned in particular are immersion or impregnation or else incorporation into a support matrix.
Suitable supports x, which may also feature dehydration catalyst properties, are, in particular, natural or synthetic silicates such as, in particular, mordenite, montmorillonite, acidic zeolites; supports which are coated with monobasic, dibasic or polybasic inorganic acids, in particular phosphoric acid, or with acidic salts of inorganic acids, such as substances of the oxide or silicate type, for example A1203, Ti02; oxides and mixed oxides such as, for example, y-A1203 and ZnO-A1203 mixed oxides of the heteropolyacids.
In accordance with an embodiment according to the invention, the support x consists at least in part of a compound of the oxide type. Such compounds of the oxide type should feature at least one of the elements selected from among Si, Ti, Zr, Al, P or a combination of at least two of these. Such supports may also act as dehydration catalyst themselves, owing to their acidic or alkaline properties. A preferred class of compounds, both as support by way of x and by way of dehydration catalyst comprise silicon/aluminum/phosphorus oxides. Preferred alkaline substances which act both as dehydration catalyst and also as support x comprise alkali, alkaline earth, lanthanum, lanthoids or a combination of at least two of these in the form of their oxides. Such acidic or alkaline dehydration catalysts are commercially available both from Degussa AG and from Sudchemie AG. A further class are ion exchangers. Again, these may be present both in alkaline and in acidic form.
Suitable homogeneous dehydration catalysts are, in particular, inorganic acids, preferably phosphorus-containing acids and furthermore preferably phosphoric acid. These inorganic acids can be immobilized on the support x by immersion or impregnation.
The use of heterogeneous catalysts has proved particularly advantageous in particular in the case of gas phase dehydration. In the case of liquid-phase dehydration, however, both homogeneous and heterogeneous dehydration catalysts are employed.
Furthermore, it is preferred that the method according to the invention involves the use of a dehydration catalyst with an Ho value in the range of from +1 to -10, preferably in the range of from +2 to -8.2 and furthermore preferably, in the case of liquid-phase dehydration, in the range of from +2 to -3 and in gas-phase dehydration in the range of from -3 to -8.2. The Ho value corresponds to the acid function as defined by Hammert and can be determined by what is known as amine titration and the use of indicators, or by the absorption of a gaseous base (see "Studies in Surface Science and Catalytics", vol. 51, 1989: "New solid Acids and Bases, their catalytic Properties", K. Tannabe et al).
According to a special embodiment of the method according to the invention, the acidic solid catalyst employed is a porous support structure which has been brought into contact with an inorganic acid, preferably with phosphoric acid or with superacids such as, for example, sulfated or phosphated zirconium oxide and which is based preferably on at least 90% by weight, furthermore preferably at least 95% by weight and most preferably at least 99% by weight of a silicon oxide, preferably an Si02. The bringing into contact of the porous support structure with the inorganic acid is preferably carried out by impregnating the support structure with the acid, with the latter preferably being brought into contact with the former in an amount in a range of from 10 to 70%
by weight, especially preferably in the range of from 20 to 60% by weight and more preferably in a range of from 30 to 50% by weight, based on the weight of the support structure, followed by drying. After drying, the support structure is heated in order to fix the inorganic acid, preferably at a temperature in a range of from 300 to 600 C, more preferably in a range of from 400 to 500 C.
According to a special embodiment of the method according to the invention, the dehydration reaction is carried out in the gas phase. Here, it is possible to employ conventional apparatuses as are known to the skilled worker in the field of gas phase reaction, for example tubular reactors. It is especially preferred to employ shell-and-tube heat exchangers and reactors which comprise thermoplates as heat exchangers.
According to an embodiment of the gas-phase dehydration reaction, pure 3-hydroxyisobutyric acid is introduced into a reactor comprising one of the abovementioned fixed-bed catalysts. According to another embodiment, the 3-hydroxyisobutyric acid is introduced into the reactor in the form of an aqueous solution comprising 2 to 80% by weight, especially preferably 5 to 50% by weight and more preferably 10 to 25% by weight of 3-hydroxyisobutyric acid, in each case based on the total weight of the aqueous solution. The pressure and temperature conditions inside the reactor are chosen such that the 3-hydroxyisobutyric acid, or the aqueous solution, is present in gaseous form when entering the reactor. The dehydration in the gas phase is preferably carried out in the temperature range of between 200 and 400 C, especially preferably between 250 and 350 C. The pressure inside the reactor during the gas-phase dehydration reaction is preferably in a range of from 0.1 to 50 bar, especially preferably in a range of from 0.2 to 10 bar and most preferably in a range of from 0.5 to 5 bar.
The amount of 3-hydroxyisobutyric acid introduced into the reactor in the gas-phase dehydration reaction is preferably in a range of from 10 to 100% by volume, especially preferably in a range of from 20 to 100% by volume and most preferably in a range of from 30 to 100%
by volume.
According to another special embodiment of the method according to the invention, the dehydration reaction is performed in the liquid phase. The liquid-phase dehydration reaction can also be carried out in all apparatuses which are known to the skilled worker and in which a fluid can be heated to a desired reaction temperature, during which process a pressure can be applied to the apparatus which is sufficient for maintaining the reaction components in the liquid state under the desired temperature conditions.
According to a special embodiment of the method according to the invention, the liquid-phase dehydration method comprises a first method step, in which pure 3-hydroxyisobutyric acid or an aqueous solution comprising 5 to 100% by weight, especially preferably 20 to 100% by weight and most preferably 50 to 100% by weight of 3-hydroxyisobutyric acid, based on the total weight of the aqueous solution, is introduced into a reactor. The pressure and temperature conditions inside the reactor are chosen such that the 3-hydroxyisobutyric acid, or the aqueous solution, is present in liquid form when entering the reactor. According to a special embodiment of the method according to the invention in which the dehydration reaction is carried out in the liquid phase, the 3-hydroxyisobutyric acid, or the aqueous solution, is passed in such a way over a fixed catalyst bed inside the dehydration reactor that the liquid phase trickles over the surface of the catalyst particles. Such a procedure may be carried out for example in a trickle-bed reactor.
The dehydration in the liquid phase is preferably carried out in a temperature range of between 200 and 350 C, especially preferably between 250 and 300 C. The pressure inside the reactor in the case of liquid-phase dehydration is preferably in a range of from 1 to 50 bar, especially preferably in a range of from 2 to 25 bar and most preferably in a range of from 3 to 10 bar.
The catalysis of the dehydration reaction may be homogeneous or heterogeneous, both in the case of gas-phase dehydration and in the case of liquid-phase dehydration.
In the case of homogeneous catalysis, the catalyst, which in this case preferably takes the form of an inorganic acid such as, for example, phosphoric acid or sulfuric acid, is first brought into contact with the pure 3-hydroxyisobutyric acid or with the aqueous solution comprising the 3-hydroxyisobutyric acid. Thereafter, the resulting composition is introduced into the reactor and converted into methacrylic acid under the desired pressure and temperature conditions. It is also feasible to introduce the inorganic acid independently of the 3-hydroxyisobutyric acid or the aqueous solution into the reactor. In this case, the reactor features at least two feed lines, one for the 3-hydroxyisobutyric acid, or the aqueous solution comprising 3-hydroxyisobutyric acid, and one for the catalyst. If the dehydration reaction is carried out in liquid phase in a trickle-bed reactor, it is preferred to introduce the catalyst together with the 3-hydroxyisobutyric acid, or the aqueous solution comprising the 3-hydroxyisobutyric acid, at the top of the reactor.
In the case of heterogeneous catalysis, the catalyst is in the form of a solid substrate located in the reaction space, for example in the form of a fixed bed, in the form of catalyst-coated plates, preferably thermoplates, which are arranged inside the reactor, or else in the form of catalyst-coated reactor walls. Reactors which are possible are described for example in DE-A-198 48 208, DE-A-100 19 381 and EP-A-I 234 612. In the case of heterogeneous catalysis, preferred catalysts are support structures which have been brought into contact with inorganic acids, preferably impregnated porous support structures. The 3-hydroxyisobutyric acid, or the aqueous solution comprising the 3-hydroxyisobutyric acid, is then brought into contact with the surface of the solid catalyst material in the form of a vapor, or in liquid form.
According to an especially preferred embodiment of the method according to the invention, the dehydration of the 3-hydroxyisobutyric acid is carried out in liquid phase at a pressure in the range of from 200 to 500 mbar, at a temperature in a range of from 200 to 230 C and in the presence of alkali metal ions as the catalyst.
The reaction mixture which is obtained after the dehydration reaction is either an aqueous methacrylic acid solution which does not contain any catalyst components (such a solution is obtained in the case of heterogeneously catalyzed dehydration) or else an aqueous methacrylic acid solution which comprises catalysts (such a solution is obtained in the case of homogeneously catalyzed dehydration). Furthermore, the aqueous methacrylic acid solution may be in liquid form (if the _ dehydration reaction has been effected in the liquid phase) or in gaseous form (if the dehydration reaction has been carried out in the gas phase).
If appropriate, the resulting methacrylic acid solution can, according to a special embodiment of the method according to the invention, be esterified without further processing. In such a case, the methacrylic acid solution is brought into contact with suitable alcohols such as, for example, methanol, ethanol, 1-propanol, 2-propanol or 1-butanol and suitable esterification catalysts known to the skilled worker such as, for example, concentrated acids, with heating, and the methacrylic acid is so converted into the corresponding esters. However, it may be advantageous additionally to purify the methacrylic acid before esterification, it being possible to employ, in principle, any purification method which is known to the skilled worker and which is conventionally employed for the purification of contaminated (meth)acrylic acid obtained by catalytic gas-phase oxidation of propylene.
If the dehydration reaction has been carried out in the gas phase, it is preferred that the methacrylic acid is first condensed, generating an aqueous methacrylic acid solution. Here, any condensation method known to the skilled worker may be employed in principle, for example a fractional condensation as described in WO-A-2004/035514, WO-A-03/014172 or EP-A-EP 1 163 201 or by total condensation as described in EP-A-0 695 736. It is also feasible to add additional solvents, in particular water, during the condensation process in order to absorb the methacrylic acid as completely as possible.
The aqueous methacrylic acid solution obtained after condensation, or else the aqueous methacrylic acid solution obtained in the event of liquid-phase dehydration, can then be freed from water and other contaminants in further purification steps. Here, it is possible first to remove the water by azeotrope distillation in the presence of an entrainer as described, for example, in DE-A-198 53 064. It is also feasible to employ high-boiling organic solvents for absorbing the methacrylic acid, as is disclosed for example in EP-A-0 974 574. In addition to these distillation methods, membranes for dewatering may also be employed, as proposed for example in DE-A-44 01 405.
Employing crystallization methods for purifying the aqueous methacrylic acid solution, which has been generated in the case of liquid-phase dehydration or which has been obtained by condensation, is furthermore feasible.
The methacrylic acid obtained after dehydration can be purified even further in further method steps. Thus, high-boiling contaminants which are still present can be removed by further distillation steps. However, it is especially preferred to further purify the methacrylic acid obtained by dehydration using crystallization methods as described for example in DE-A-101 49 353.
The resulting purified methacrylic acid can then be esterified, if appropriate.
A contribution to solving the problems mentioned at the outset is furthermore provided by a method of preparing methacrylic acid or methacrylic esters, comprising the method steps IIA) preparation of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid by the method described above, IB) cleavage of the polyhydroxyalkanoates based on 3-hydroxyisobutyric acid with formation of 3-hydroxyisobutyric acid and, if appropriate, neutralization of the 3-hydroxyisobutyric acid and/or isolation of the 3-hydroxyisobutyric acid, IIC) dehydration of the 3-hydroxyisobutyric acid with formation of methacrylic acid and, if appropriate, esterification of the methacrylate or methacrylic acid.
A contribution to solving the problems mentioned at the outset is also provided by a method of preparing polymethacrylic acid or polymethacrylic esters, comprising the method steps IIIA) preparation of methacrylic acid by the method described above, IIIB) free-radical polymerization of the methacrylic acid, it being possible, if appropriate, to esterify at least in part the carboxyl groups of the methacrylic acid before or after the free-radical polymerization reaction.
The present invention will now be illustrated in greater detail with reference to nonlimiting figures and examples.
Figure 1 shows the conversion of succinyl-coenzyme A into methylmalonyl-coenzyme A with catalysis by the enzyme El.
Figure 2 shows the conversion of methylmalonyl-coenzyme A
into 3-hydroxyisobutyric acid with catalysis by the enzymes E2 to E4 in accordance with the first alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 3 shows the conversion of (R)-methylmalonyl-coenzyme A into 3-hydroxyisobutyric acid with catalysis by the enzymes E.4, E6 and E7 in accordance with the second alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 4 shows the conversion of methylmalonyl-coenzyme A
into 3-hydroxyisobutyric acid with catalysis by the enzymes E4, E5 and E7 in accordance with the third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 5 shows the conversion of 3-hydroxyisobutyric acid into a polyhydroxyalkanoate with catalysis by the enzymes E5 and E9.
Figure 6 shows the conversion of phosphoenolpyruvate or pyruvate into oxalacetate with catalysis by the enzymes En or Ell according to a special embodiment of the first, second or third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 7 shows the conversion of oxalacetate into succinyl-coenzyme A with catalysis by the enzymes E12 to En according to a first special embodiment of the first, second or third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 8 shows the conversion of oxalacetate into succinyl-coenzyme A with catalysis by the enzymes E13 to En and E24 to E26 according to a second special embodiment of the first, second or third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 9 shows the conversion of oxalacetate into succinyl-coenzyme A with catalysis by the enzymes E16, E24, En and E28 according to a third special embodiment of the first, second or third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 10 shows the conversion of L-glutamate into succinyl-coenzyme A with catalysis by the enzymes E46 and EH in accordance with a further special embodiment of the first, second or third alternative of the process according to the invention, where a genetically modified cell is used, in which succinyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figures 11 and 12 show the conversion of acetyl-coenzyme A into 3-hydroxyisobutyric acid with catalysis by the enzymes ELI, E5 and Eu to Eu in accordance with a first alternative of the second special embodiment of the process according to the invention, where a genetically modified cell is used, in which propionyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figures 13 and 14 show the conversion of propionyl-coenzyme A into 3-hydroxyisobutyric acid with catalysis by the enzymes E2 to E4/ E6/ E7 and E47 to E52 in accordance with a second alternative of the second special embodiment of the process according to the invention, where a genetically modified cell is used, in which propionyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figures 15 and 16 show the conversion of propionyl-coenzyme A into 3-hydroxyisobutyric acid with catalysis by the enzymes E2 to ELI, E7 and Eu to Eu in accordance with a third alternative of the second special embodiment of the process according to the invention, where a genetically modified cell is used, in which propionyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 17 shows the conversion of two units of acetyl-coenzyme A into glyoxylate and propionyl-coenzyme A with catalysis by the enzymes E53 to E55, E58 and Eu to E65 in accordance with a fifth alternative of the second special embodiment of the process according to the invention, where a genetically modified cell is used, in which propionyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 18 shows the conversion of P-alanine into 3-hydroxyisobutyric acid with catalysis by the enzymes E2 to ELI, E62, E.72 and E73 according to a third special embodiment of the process according to the invention, where a genetically modified cell is used, in which acrylyl-coenzyme A is formed as intermediate and methylmalonate semialdehyde as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 19 shows the conversion of pyruvate into 3-hydroxyisobuytric acid with catalysis by the enzymes E76 to E79, EH, 61 and E8 according to a first alternative of the first special embodiment of the second variant of the process according to the invention, where a genetically modified cell is used, in which isobutyryl-coenzyme A is formed as intermediate and 3-hydroxyisobutyryl-coenzyme A
as precursor in the production of 3-hydroxyisobutyric acid Or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 20 shows the conversion of L-valine into 3-hydroxyisobutyric acid with catalysis by the enzymes E8, EH, E61, E.79 and EH according to a second alternative of the first special embodiment of the second variant of the process according to the invention, where a genetically modified cell is used, in which isobutyryl-coenzyme A is formed as intermediate and 3-hydroxyisobutyryl-coenzyme A as precursor in the production of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid.
Figure 21 shows the plasmid pEKEx2MCM of Example 3.
Figure 22 shows the vector pGA4_3HIBDH of Example 3.
Figure 23 shows the vector pGA5 MMCoAR 3HIBDH of Example 3.
Figure 24 shows the vector pECXT99A of Example 3.
Figure 25 shows the vector pECXT99A MMCoAR_3HIBDH of Example 3.
Figure 26 shows detection by means of ion chromatography of production of 3-hydroxyisobutyric acid by the recombinant cells in Example 3.
Figure 27 shows the peak indicated in Figure 26 being identified by means of ion chromatography as that of 3-hydroxyisobutyric acid.
Examples Example 1 The present invention is now illustrated in Example 1 with reference to a recombinant cell which is capable of producing 3-hydroxyisobutyric acid via 3-hydroxyiso-butyryl-coenzyme A as precursor and isobutyryl-coenzyme A
as intermediate, starting from L-valine as carbon source.
In accordance with the invention, this cell may be used for the production of methacrylic acid. To this end, the enzymes EC 2.6.1.42 and EC 1.2.4.4 (in each case from Pseudomonas aeruginosa) and a cluster comprising the three enzymes EC 1.3.99.12, EC 4.2.1.17 and EC 3.1.2.4 (from Acinetobacter calcoaceticus) were overexpressed in E. coli BL21 (DE3).

_ _ Here, the enzyme EC 1.2.4.4 is encoded by a gene with the DNA sequence as shown in SEQ ID No 07 and 08 (a and p subunit), while the enzyme EC 2.6.1.42 is encoded by a gene with the DNA sequence as shown in SEQ ID No 09. The enzyme EC 1.3.99.12 is encoded by a gene with the DNA
sequence with the SEQ ID No 10, the enzyme EC 4.2.1.17 by a gene with the DNA sequence as shown in SEQ ID No 11, and the enzyme EC 3.1.2.4 by a gene with the DNA sequence as shown in SEQ ID No 12.
1. Organisms, plasmids and oligonucleotides The following bacterial strains, vectors, genomic DNA and oligonucleotides were used for preparing this recombinant cell:
Table 1: Bacterial strains used Strain Reference (manufacturer) E. coil DH5 NEB
E. coil BL21 (DE3) Invitrogen Table 2: Vectors used Vector Reference (manufacturer) pCDFDuet-1 Novagen pET101/D-TOPO Invitrogen pCR2.1-TOPO Invitrogen Table 3: Genomic DNA used Strain Pseudomonas aeruginosa PA01 Acinetobacter calcoaceticus ADP1 Table 4: Oligonucleotides used Name Sequence Aca_VClus_f 5' -ATGCAATTTAATGAAGAACAGCTATTAATTC-3' (SEQ ID No. 13) Aca_VClus_r 5'-CAGTCTGAAATGACTAACCTAATTGGC-3' ev (SEQ ID No. 14) Pae_26142_f 5' -ACGGAATTCTGAAGGAGCTGGCAACTATG-3' (SEQ ID No. 15) Pae_26142_r 5' -TTGTCGACTTACTTGACCAGGGTACGCC-3 ' ev (SEQ ID No. 16) 5'-ACAGATCTGGAGGCCTGTCATGAGTGATTAC-3' Pae_1244_fw (SEQ ID No. 17) Pae_1244_re 5' -ATGGGTACCCATTCA.GACCTCCATC-3 ' (SEQ ID No. 18) 2. Amplification of the PCR fragments 1.2.4.4 (2313 kb) and 2.6.1.42 (958 bp) First, the fragments of 1.2.4.4 and 2.6.1.42 were amplified by means of PCR starting from the total DNA from Pseudomonas aeroginosa, using the primers as shown in SEQ ID No 15 to SEQ ID No 18, which are detailed in Table 4.
3. Digestion of the vector pCDF-Duet-1 and of the PCR
fragment 2.6.1.42 (958 bp) The vector pCDFDuet-1 (featuring a streptomycin-/spectinomycin resistance) is cleaved by means of EcoRI/SalI, as is the PCR fragment 2.6.1.42, and the restrictions thus obtained are ligated overnight with T4 ligase. This gives rise to the vector pCDFDuet::2.6.1.42.
4. Cloning of the PCR fragments into the vector pCR2.1-TOPO
The preparation of a cloning vector comprising the fragment 2.6.1.42 or the fragment 1.2.4.4, using the vector pCR2.1-TOPO, was performed as specified in the manufacturer's instructions. E. coil DH5a cells were transformed with the resulting cloning vectors pCR2.1-TOPO::1.2.4.4 and pCR2.1-TOPO::2.6.1.42.
Since the pCR2.1-TOPO vectors feature a kanamycin resistance and an ampicillin resistance, the transformants were plated onto 2 AXI and KXI plates (20 and 40 1). The plasmids of the resulting clones were isolated and digested:
pCR2.1-TOPO::1.2.4.4 BgIII KiDnI
fragment size 2313 bp pCR2.1-TOPO::2.6.1.42 EcoRI + Sail fragment size 958 bp Each of the fragments was eluted from the gel and purified with the QIAquick kit from Qiagen (following instructions).
5. Preparation of the vector pCDFDuet:2.6.1.42-1.2.4.4 The vector pCDFDuet::2.6.1.42 and the vector pCR2.1-TOPO::1.2.4.4 are digested with BgIII/KionI.
This is followed by the ligation of pCDFDuet::2.6.1.42 (BgIII/KpnI) with pCR2.1-TOPO::1.2.4.4, giving rise to the vector pCDFDuet::2.6.1.42-1.2.4.4. Again, E. coil DH5a cells were transformed by means of this cloning vector. The plasmids were isolated. The plasmid pCDFDuet::2.6.1.42-1.2.4.4 features the DNA sequence as shown in SEQ ID No 19.
6. Cloning the valine cluster from Acinetobacter calcoaceticus (V-ClusAca) Strain ATCC 33304 Acinetobacter calcoaceticus was cultured for the isolation of total DNA (HH agar or medium). Total DNA was isolated by means of the DNEasy kit from Qiagen (L1 and L2) and by a method comprising the method steps i) centrifugation of 1 ml of culture, ii) addition of 200 1 of 1420 to the pellet, iii) heating for 10 min at 95 C, iv) centrifugation (10 min, 13 000 rpm), and v) removing the supernatant for a PCR.
To amplify the valine cluster from A. calcoaceticus, a PCR was carried out using the primers as shown in SEQ ID No 13 and SEQ ID No 14, which have been detailed in Table 4 (following the manufacturer's instructions using the polymerases Pfu and Tag, respectively).
The PCR products were purified and, following the instructions, ligated to the plasmid pET101/D-TOPO
and transferred into E. coli DH5a. This gives rise to the plasmid pET101/D-TOPO::V-ClusterAca. Plasmid pET101/D-TOPO::V-ClusterAca features the DNA sequence as shown in SEQ ID No 20.
7. Preparation of a recombinant cell which is capable of forming 3-hydroxyisobutyric acid from L-valine E. coil BL21 (DE3) was transformed with the plasmids pET101/D-TOPO::V-ClusterAca and pCDF-Duet::2.6.1.42-1.2.4.4 (plated onto LB spec./amp medium). The resulting cells were capable of converting, in a nutrient medium comprising L-valine, the L-valine into 3-hydroxyisobutyric acid. In contrast, the wild type of the cells (E. coil BL21 (DE3)) was not capable of forming detectable amounts of 3-hydroxyisobutyric acid in such a nutrient medium.
Example 2 In this example, a DNA encoding a gene is isolated and the gene is overexpressed in E. coli. The DNA encodes an enzyme which has both the activity of the enzyme E2 and that of the enzyme E3.
1. Culturing and harvesting Sulfolobus tokodaii Sulfolobus tokodaii was grown in a small culture volume (40-200 ml) at 75 C and a pH of 3.0, with shaking (150 rpm). The growth was monitored photometrically via measuring the optical density at 578 nm (0D578 nm). A modified Sulfolobus medium was used (modified as described by Brock et al., Archives of Microbiology 84, pages 54-68, 1972;
Suzuki et al., Extremophiles, 6, pages 39-44, 2002).
The energy and carbohydrate source used were yeast extract, casamino acids and glucose. The medium consisted of the following components: basal medium, glucose stock solution, iron stock solution and trace element stock solution. At an OD578,m of 0.3-0.5 (exponential phase), the cells were harvested. The centrifugation was carried out in a Sorvall centrifuge (SS34 rotor) for 15 min at 9000 rpm. The cell pellet was employed directly for the DNA
extraction.
Basal medium. KH2PO4 (0.28 g/l), (NH4) 2SO4 (1.3 g/l), MgSO4 x 7 H20 (0.25 g/l), CaCl2 x 6 H20 (0.07 g/l), yeast extract (1 g/l) and casamino acids (1 g/l). Before autoclaving, the pH was brought to 3.0 using H2SO4.
Glucose stock solution (100x). Glucose (100 g/l).
The solution was filter-sterilized.
Iron stock solution (1000x). FeC13 x 6 H20 (20 g/l). The solution was filter-sterilized.
Trace element stock solution (1000x). MnC12 x 4 H20 (1.8 g/1), Na2B407 x 10 H20 (4.5 g/1), ZnB04 x 7 H20 (220 mg/1), CuC12 x 2 H20 (50 mg/1), Na2Mo04 x 2 H20 (30 mg/1), VOSO4 x 5 H20 (30 mg/1), CoC12 x 6 H20 (8.4 mg/1). The individual components were dissolved in succession in distilled H20, the pH was brought to 3.0 using HC1, and the solution was filter-sterilized.
2. Isolation of genomic DNA from S. tokodaii Genomic DNA was isolated by the method of Murray and Thompson (Nucleic Acid Research, 8, pages 4321-4325, 1980). To this end, 10-50 mg (fresh weight) of freshly harvested cells are weighed into a 1.5 ml Eppendorf reaction vessel and resuspended in 570 ml of TE buffer (10 mM Tris/HC1 (pH 8.0), 1 mM NaEDTA).
1 of a 10% (w/v) SDS solution (sodium dodecyl sulfate solution) and 3 1 of Proteinase K (20 25 g/ 1) were added and the mixture was incubated for 1 h at 52 C. Thereafter, 100 1 of 5 M NaC1 solution and 80 1 of pre-warmed 10% (w/v) cetyltrimethylammonium bromide (CTAB) solution (10%
(w/v) CTAB in 0.7 M NaC1) were added. After 30 incubation for 10 min at 65 C, the complexes of CTAB, cell wall fragments and proteins were extracted with 780 1 of chloroform/iso-amyl alcohol (24:1 (v/v)) and spun down for 15 min at 14 000 rpm.
The aqueous top phase was transferred into a fresh Eppendorf reaction vessel and the extraction was repeated. After the aqueous phase was free from pigments, it was covered with a layer of 400 1 of 100% isopropanol. By carefully mixing the two phases, the chromosomal DNA precipitated at the interface. Then, it was possible to fish out the DNA
with a drawn-out Pasteur pipette and washed in 200 1 of 70% ethanol. After recentrifugation (5 min, 14 000 rpm), the supernatant was pipetted off and the DNA was dried for 2 h at room temperature and finally dissolved in 100 1 of TE buffer.
3. Amplification of the malonyl-coenzyme A reductase gene The polymer chain reaction (PCR) (Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51, pages 263-273, 1986) was employed to amplify the malonyl-CoA reductase gene in a targeted fashion, from the genomic Sulfolobus tokodaii DNA obtained in Example 2. It was carried out in a thermocycler (Biometra, Gottingen).
A preparative PCR in which Pfu polymerase (Pfunds, Genaxxon) was used, was employed. The Pfu polymerase contains a 3'-5' exonuclease ("proofreading") function.
The following primers were used:
5'-ATTATCCCATGGGGAGAACATTAAAAGC-3' ("forward primer"; NcoI cleavage site is underlined;
SEQ ID No 21) and 5'-CGGGATCCTTACTTTTCAATATATCC-3' ("reverse primer"; BamHI cleavage site is underlined;
SEQ ID No 22) The reaction mixture detailed in Table 1 hereinbelow was employed for the PCR reactions. The PCR was carried out as a hot start PCR, i.e. the reaction mixture was incubated for 2 min at 95 C before adding the Pfu polymerase. This was followed by 30 cycles of in each case 1 minute at 95 C, 1 minute at 45 C and 5 minutes at 72 C, followed by a last step of 30 seconds at 45 C, 15 minutes at 72 C and, finally, a pause at 6 C.
Table 1 Standard reaction mixtures (50 1) for proofreading PCR with Pfu polymerase Composition 1/50 1 batch x Pfu PCR 5 reaction buffer dNTP mix (2 mM per 5 nucleotide) Forward primer (2 M) 12.5 Reverse primer (2 M) 12.5 Chromosomal DNA 1 (10-50 ng) Pfu polymerase 2 (2.5 U/ 1) dd-H20 12 A gene fragment with a length of 1.1 kb was obtained.
4. Cloning the malonyl-coenzyme A reductase gene To clone the malonyl-coenzyme A reductase gene from Sulfolobus tokodaii, the gene amplified in Example 3 was cloned unspecifically with the vector pCR T7/CT-Topo (Invitrogen, Karlsruhe), using the "pCR T7 Topo TA Expression Kit" (Invitrogen, Karlsruhe). This was done following the manufacturer's instructions.
To isolate the plasmid DNA, the plasmid DNA was prepared using the "QIAprep Spin Plasmid Miniprep Kit" from Qiagen (Hilden) following the manufacturer's instructions, starting from 5 ml _ overnight cultures of transformed E. coli TOP1OF' cells.
5. Generation of an expression vector To generate an expression vector comprising the malonyl-coenzyme A reductase gene, the isolated cloning vector obtained in Example 4 is subjected to restriction digestion with the restriction enzymes NcoI and BamHI. To this end, 25-27 1 of plasmid DNA
(expression vector pTrc99A and pCR T7/CT-Topo vector, respectively, with the incorporated malonyl-coenzyme A reductase gene) are mixed thoroughly with 5 1 of a reaction buffer (10x) and 2-3 1 of restriction enzyme (10 U/ 1; Fermentas, St. Leon-Rot). The reaction mixture was made up to 50 1 with distilled H20 and incubated for 5 h at the temperature specified by the manufacturer. An ethanol precipitation was carried out before further use. To this end, the DNA was mixed with 3 volumes of 100% ethanol and 0.1 volumes of 3 M sodium acetate buffer (pH 5.3) and incubated for 2 h or overnight at -80 C. After a centrifugation step (20 min, 14 000 rpm, 4 C, Eppendorf table-top centrifuge), the supernatant is removed carefully, and the DNA was washed with 3 volumes of 70% (v/v) ethanol. After 10 min incubation at room temperature, the mixture was recentrifuged (10 min, 14 000 rpm, 4 C, Eppendorf table-top centrifuge) and the supernatant was discarded. The DNA was then dried for 1 hour at room temperature and subsequently taken up in the desired volume of H20 or TE buffer (10 mM Tris/HC1 (pH 8.0), 1 mM NaEDTA).
Then, alkaline phosphatase is used for removing the 5'-phosphate groups of the linearized double-stranded vector. In this manner, the cloning efficiency is increased since religation of the vector is prevented. Calf intestinal alkaline phosphatase was used for dephosphorylating the digested vector.
The dephosphorylation was carried out in the same buffer as the restriction digestion. 50 1 of restriction mixture were mixed with 1.5 1 of CIAP
(Calf Intestine Alkaline Phosphatase (1U/ 1;
Fermentas, St. Leon-Rot) and the mixture was incubated for 30 min at 37 C. Before further use of the cleaved and dephosphorylated vector, an ethanol precipitation was carried out as described above.
T4 DNA ligase was used the ligation of the insert DNA with the expression vector, plasmid DNA and insert DNA being employed in a molar ratio of from 1:3-1:6.
Stock solutions:
Ligation buffer (10x): 0.5 M Tris/HC1, pH 7.6 100 mM MgC12 0.5 mg/ml BSA
filter-sterilized, storage at room temperature 5 mM ATP (adenosine triphosphate) Always make up freshly in sterile distilled H20 50 mM DTE (dithioerythritol) Always make up freshly in ligation buffer The ligation mixtures had a volume of 50 1. Plasmid DNA (2-10 1), insert DNA (2-20 1), 5 1 of ligation buffer with DTE (50 mM) and the corresponding amount of sterile distilled 1420 were pipetted together, vortexed, spun down briefly and _ _ subsequently incubated for 5 min at 45 C. The mixture was cooled on ice. 5 1 of 5 mM ATP and 1.5 1 of T4 DNA ligase (1 U/ 1; Fermentas; St.
Leon-Rot) were added, and everything was mixed.
Ligation was performed overnight at 16 C.
The ligation mixture was employed directly for transforming chemically competent cells.
6. Transformation of E. Coli cells with the expression vector A 5 ml overnight culture was grown starting from a single colony of E. coli Rosetta 2 cells. On the next morning, 50 ml of LB medium (Sambrook et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) were inoculated with 0.5-1.0 ml of this culture. After incubation for 1.5-2 h (37 C, shaking (180 rpm)), an OD578nrn of 0.6 was reached. The cells were cooled on ice for 10 min and subsequently spun down for 5 min at 5000 rpm and 4 C (GSA rotor, Sorvall centrifuge). The supernatant was discarded and the cell pellet was resuspended in 2.7 ml of cold 0.1 M CaC12 solution. After addition of 2.3 ml of sterile 50% (v/v) glycerol, the cell suspension was divided into portions (in each case 300 1) in 1.5-ml Eppendorf reaction vessels. The competent cells were immediately frozen in liquid nitrogen and subsequently stored at -80 C.
To transform the cells, an aliquot of the chemically competent cells (300 1) was defrosted on ice and treated with 25 1 of a ligation mixture. Everything was mixed carefully and incubated for 30 min on ice.
After a heat shock (42 C, 1 min) the mixture was reincubated on ice for 5 min. Thereafter, 800 1 of LB medium (Sambrook et al., 1989) were added, and _ the cells were shaken for 1 h at 37 C (Thermomixer, Eppendorf 5436). The mixture was concentrated and finally streaked onto LB medium. To this end, the mixture was spun down for 1 min at 10 000 rpm, 750 m of the supernatant were discarded, and the cell pellet was resuspended. 50 1, 100 1 and 200 1 of this concentrated mixture were streaked onto LB
plates (Sambrook et al., 1989) supplemented with 100 g/ml ampicillin and incubated overnight in the incubator at 37 C. The plates were washed with 1 ml LB medium. This cell suspension was used for subsequently inoculating 150 ml LB medium (supplemented with 100 g/ml ampicillin) in 500 ml Erlenmeyer flasks with baffles. The cultures grew at 37 C and 180 rpm. Overexpression was performed by inducing the promoter in pTrc99A by adding 0.5 M
IPTG (isopropyl-P-D-thiogalactopyranoside) at an OD578,, of 0.6. The induced cultures were incubated for 3 h under the abovementioned conditions and subsequently harvested at an D578nm = 2.7.
7. Detection of the enzymatic activity The E. co/i strain obtained in Example 6 was disrupted by means of a cell mill. The disrupted cells were heated for 15 min at 85 C. During this heat precipitation, nonheat resistant enzymes coagulate and are precipitated. Since the target protein is heat resistant, it is retained in the supernatant. To measure the malonyl-coenzyme A
reductase activity, the supernatant was diluted 1:50 in TM buffer (50 mM Tris/C1, 1 mM MgC12, pH 8.1). 30 1 of the diluted or undiluted (for detecting the methylmalonyl-coenzyme A reductase activity) supernatant were pipetted to 500 1 of HIPS buffer (100 mM HEPES/Na0H, 5 mM mgC12, 1 mM
dithioerythritol, containing 0.5 mM NADPH).

_ In a first batch, the reaction was started by adding malonyl-coenzyme A, the final concentration being 0.5 mM. The drop in the NADPH absorption at 365 nm was determined. The enzyme activity determined was 15.5 Rmol/min/mg protein (15.5 U/mg).
In a second batch, the reaction was started by adding methylmalonyl-coenzyme A (from Fluka, Article No.: 67767), the final concentration being 2.0 mM.
The drop in the NADPH absorption at 365 nm was determined. The enzyme activity determined was 0.24 Rmol/min/mg protein (0.24 U/mg).
It can be seen from these results that the polypeptide which codes for the DNA sequence with the SEQ ID No 03 catalyzes both the conversion of malonyl-CoA and of methylmalonyl-coenzyme A.
1 mol of NADPH was oxidized per mole of malonyl-CoA
or methylmalonyl-Coa employed. From this it can be concluded that the enzymatic reaction leads to the corresponding semialdehyde.
Example 3 The present invention is furthermore illustrated in Example 3 on the basis of the production of methacrylic acid by a recombinant cell capable of producing 3-hydroxyisobutyric acid via methylmalonate semialdehyde as precursor, starting from glucose as carbon source. To this end, the enzymes methylmalonyl-coenzym A mutase (E1) and 3-hydroxyisobutyrate dehydrogenase (E4), inter alia, were overexpressed in C. glutamicum ATCC13032.
1. Cloning of the genes NCg11470, NCg11471 and NCg11472 (arginine/ornithine transport system ATPase, methylmalonyl-coenzyme A mutase and methylmalonyl-coenzym A mutase, N-terminal domain/subunit) in pEKEx2, construction of pEKEx2MCM cgl DNA manipulation using standard methods as described in Sambrook, J. et al. (1989), "Molecular Cloning: a laboratory manual", 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. DNA
amplifications were carried out using SAWADY Pwo-DNA
polymerase (Pecilab Biotechnologie, Erlangen, Germany) or Platinum Pfx-DNA polymerase (Invitrogen, Karlsruhe, Germany). Unless stated otherwise, the polymerases were used according to the manufacturer's information. Oligonucleotides for PCR
amplifications and introduction of restriction cleavage sites were obtained from MWG-Biotech (Ebersberg, Germany). Engineered strains were identified by colony PCR using Taq Polymerase READYMIX (Sigma, Taufkirchen, Germany), and plasmid preparations. DNA fragments were purified and isolated using the MinElute Gel Extraction Kit (Quiagen, Hilden, Germany) according to the manufacturer's information. Plasmid DNA was isolated by means of the Qiaprep spin Miniprep Kit (Quiagen, Hilden, Germany). All of the plasmids constructed were verified by restriction analysis and subsequent sequencing.
pEKEx2MCM_cg1 was constructed using the pEKEx2 vector (Kleinertz et al., 1991 Gene 102:93), which allows cloned genes to be transcribed under the control of the isopropyl p-D-thiogalactopyranoside (IPTG)-inducible tac promoter and the lac repressor system (lacIq). The 5.2 kb large DNA fragment coding for the genes NCg11470, NCg11471 and NCg11472 was amplified by means of the following oligonucleotides and Corynebacterium glutamicum ATCC13032 DNA as template:
pcg1859-57_vorwarts (SEQ ID No. 23):
5'-cgqtcgacaaggagatatagataTGACTGATCTCACAAAGACTGC-3 and pcg1857-59_ruckwarts (SEQ ID No. 24):
5'-cTTAGGCTTTGTCGAACGCCTCC-3'.
(Sequences complementary to the genomic sequence are indicated in capital letters).
In addition, restriction cleavage sites (underlined) and a ribosome binding site (aaggag), 8 nucleotides upstream of the start codon, were introduced into the amplicons. In the process, the original start codon, TTG, was replaced with ATG). The PCR amplicon was phosphorylated using polynucleotide kinase (Roche, Basle, Switzerland) and cloned with blunt ends into the Smal cleavage site of the pUC19 vector (Yanisch-Perron et al., 1985, Gene 33:103-19). The identity and correctness of the 5.2 kb insert were confirmed by sequencing. The 5.2 kb fragment was then isolated by way of a Sall fragment from the pUC19 derivative and ligated to the Sall cleavage site of the pEKEx2 vector. Plasmids having the correct orientation were selected on the basis of restriction digest, with one of these being referred to as pEKEx2MCM cgl. The plasmid obtained is shown in Figure 21.
2. Cloning of Thermus thermophilus 3-hydroxyisobutyrate dehydrogenase in pEKEx2, construction of pEC-XT99A
MMCoAR 3HIBDH
The gene of Thermus thermophilus (TTHA0237) 3-hydroxyisobutyrate dehydrogenase (3HIBDH) was synthesized, taking into account the codon usage of C. glutamicum. The codon usage-optimized gene (SEQ
ID No. 25) was synthesized into the vector pGA4 (pGA4_3HIBDH, Figure 22). The pGA4_3HIBDH vector was digested by the endonucleases KpnI and Ec1136II and, as a result of this, the 3HIBDH gene was ligated into the vector pGA5 MMCoAR, a vector which already contains a sequence derived from Sulfolobus tokodaii methylmalonyl-coenzyme A mutase under the functional expression control of the T7 promoter and which had been linearized by the restriction enzymes BamHI
(with subsequent filling-in reaction) and KpnI. The resulting vector, pGA5_MMCoAR_3HIBDH is depicted in Figure 23.
The insert containing methylmalonyl-coenzyme A
reductase and 3HIBDH was cloned into the target vector pECXT99A (accession number: AY219684, Figure 24) which had been linearized by digestion with the restriction endonucleases BamHI (with subsequent filling-in reaction) and KpnI from the pGA52MC0AR-3HIBDH vector by digestion with KpnI and Ec/136II
(resulting vector: pECXT99A MMCoAR 3HIBDH, Figure 25).
3.
Preparation of C. glutamicum cells transformed with pEKEx3MCM cgl and pEC-XT99A 3HIBDH varIIMMCoAR
Competent cells of C. glutamicum ATCC13032 were prepared as described in Tauch et al. (Curr Microbiol. 2002,45:362-367). DNA of pEKEx2MCM_cg1 and pEC-XT99A_3HIBDH varIIMMCoAR was introduced by means of electroporation, and transformants were selected on brain heart agar from Merck (Darmstadt, Germany) which had been supplemented with 50 mg/1 kanamycin and 5 mg/1 tetracycline (Liebl et al. FEMS Microbiol Lett., 1989, 53:299-303). Plasmid DNA was isolated from transformants and characterized by means of restriction digest. In this manner C. glutamicum pEKEx2MCM_cg1/pEC-XT99A 3HIBDH varIIMMCoAR was obtained.
_ _ 4. Cultivation and production of 3-hydroxyisobutyric acid A single colony of C. glutamicum pEKEx2MCM_cg1/pEC-XT99A 3HIBDH varIIMMCoAR was used for inoculation in _ _ 25 ml of complete medium (brain heart medium) containing 15 pg/1 kanamycin and 5 pg/l tetracycline, and cultured at 30 C and 200 rpm overnight. The wild type was grown without antibiotics as a control.
The cultures were removed by centrifugation (10 min, 4 C, 5292 x g) and washed with saline (0.9% NaC1).
The cells were resuspended in 25 ml (in 250 ml flasks) of GCXII medium containing antibiotics (15 pg/1 kanamycin and 5 pg/1 tetracycline). The plasmid-carrying strain was induced with 0.5 mM
(12.5 pl of a 1 M stock solution) IPTG.
CGXII minimal medium (according to Keilhauer et al., J Bacteriol. 1993, 175:5595-5603):
20 g NH4)2SO4 5 g urea 1 g K2HPO4 1 g KH2PO4 42 g MOPS
1 ml MgSO4 x 7 H20 (25 g/100 ml, sterile-filtered) 1 ml CaCl2 x 2 H2O (1.32 g/100 ml, sterile-filtered) The salts were dissolved in approx. 800 ml of double-distilled water and the pH was adjusted to 7 with KOH. For this purpose, approx. 20-25 KOH
pellets were added, followed by titration to pH 7 with 10 N KOH. Double-distilled water was then added to the media components to 900 ml, followed by autoclaving.
After autoclaving, 1 ml of trace salt solution was added.
Trace salt solution:
1 g FeSO4 x 7 H20 1 g MnSO4 x H20 0.1 g ZnSO4 x 7 H20 0.02 g CuSO4 0.002 g NiC12 x 6 H20 The salts are dissolved in 100 ml of deionized H20 and acidified with HC1 (pH paper, approx. pH 1). The solution is then sterile-filtered.
The medium was admixed with 100 ml of 50% strength glucose (final concentration 5%), with 80 ml of 50%
strength glucose and 20 ml of sterile double-distilled water being added for a final concentration of 4%.
The medium was supplemented with 1 ml of biotin (20 mg/100 ml), 60 pg/1 coenzyme B12 (after 7 h), 0.1 mM propionate (after 22 h) and trace salt solution.
After 27 h, 6 mg/1 3-hydroxyisobutyric acid were detected in the sample by ion chromatography (Metrohm Compact IC 761 with autosampler, mobile phase: 8 mM NaOH; column: Dionex AS15 4 x 250 mm +
precolumn AG15 4 x 50 mm; column temperature: 25 C, flow: 1.4 ml/min, detector: conductivity; injection volume: 10 pl; run time: 30 min) (Figure 26). The identity of 3-hydroxyisobutyric acid was confirmed by adding chemically pure 3-hydroxyisobutyric acid (30 mg/1) (Figure 27).
5. Dehydration of 3-hydroxyisobutyric acid to give methacrylate 5 ml of a solution of 3-hydroxyisobutyric acid (0.2 g/l), produced according to Example 4 above, is admixed with NaOH (0.06 mg) with stirring. The solution is incubated with stirring and reflux condensation at 185-195 C under vacuum (300 torr). A
further 0.5 mg of 3-hydroxyisobutyric acid in 5 ml are added every hour over a period of 5 h. The solution contains 0.4 percent by weight p-methoxy-phenol in order to prevent methacrylate from polymerizing. The reaction is stopped after 24 h of incubation. Conversion of 3-hydroxyisobutyric acid to methacrylate is above 90%. Methacrylic acid is removed from the reaction mixture by distillation.
Example 4 The present invention is furthermore illustrated in Example 4 on the basis of the production of methacrylic acid by a recombinant E. coli cell which is capable of producing 3-hydroxyisobutyric acid via methylmalonate semialdehyde as precursor and via acryloyl-coenzyme A as intermediate.
To convert the carbon source glycerol to 3-hydroxy-isobutyric acid using recombinant E. coli cells, the genes of seven different enzymes were cloned into a number of expression plasmids. This involved the utilization of Duet vectors (Merck, Germany). These are a system of four expression vectors, all of which are compatible with one another and in addition have different antibiotic resistance markers.
1. In detail, the genes coding for the following enzymes were cloned into expression vectors for converting glycerol to 3-hydroxyisobutyric acid:
a) Klebsie1la pneumoniae glycerol dehydratase (EC 4.2.1.30) (GD). The enzyme catalyzed the adenosylcobalamine-dependent dehydration of glycerol to 3-HPA (3-hydroxypropionaldehyde). It consists of 3 subunits (GD-alpha, GD-beta and GD-gamma) which are encoded in K. pneumoniae by 3 genes (g1dA, gldB and gldC) in a single operon.
b) K. pneumoniae reactivating factor.
Since adenosylcobalamine-dependent glycerol dehydratases are inactivated by glycerol, conversion of glycerol to 3-HPA additionally requires the activity of a reactivating factor.
The reactivating factor for K. pneumoniae glycerol dehydratase is encoded by the genes gdrA
and gdrB
c) E. coil aldehyde dehydrogenase, AldH. To convert 3-HPA to 3-hydroxypropionic acid (3-HP), the E.
coli a/dH-gene was amplified.
d) Chloroflexus aurantiacus propionyl-coenzyme A
synthase (Pcs) (encoded by the pcs gene).
Propionyl-coenzyme A synthase catalyzes the conversion of 3-HP to propionyl-coenzyme A. It is a tri-functional enzyme and includes three functional domains. The acyl-coenzyme A
synthetase (ACS) domain catalyzes activation of 3-HP to 3-hydroxypropionyl-00A. This is followed by dehydration to acrylyl-CoA, catalyzed by the enoyl-CoA hydratase (ECH) domain of Pcs. Finally, the enoyl-CoA reductase (ECR) domain of Pcs catalyzes the NADPH-dependent reduction of acrylyl-CoA to give propionyl-CoA. However, this reaction is irrelevant to the project described because the intermediate acrylyl-CoA is immediately further converted here by the next enzyme (crotonyl-CoA carboxylase/reductase, see below).
e) Crotonyl-coenzyme A carboxylase/reductase (enzyme E62) (Ccr) of Rhodobacter sphaeroides (encoded by the ccR gene). The main activity of Ccr is the reductive carboxylation of crotonyl-coenzyme A to give ethylmalonyl-CoA. However, the enzyme exhibits a broad substrate specificity and converts acrylyl-coenzyme A to methylmalonyl-coenzyme A very efficiently.
f) Sulfolobus tokodaii malonyl-CoA reductase (Mcr, E2 and E3) (encoded by the mcr gene). Mcr preferentially catalyzes the NADPH-dependent reduction of malonyl-coenzyme A to malonate semialdehyde. However, it also exhibits a secondary activity with methylmalonyl-coenzyme A
as substrate which is converted to methylmalonate semialdehyde.
g) Thermus the rmophilus 3-hydroxyisobutyrate dehydrogenase (ELI) (3-HIB-DH) (encoded by the MmsB gene). This enzyme catalyzes the NADPH-dependent, reversible conversion of methyl-malonate semialdehyde to 3-hydroxyisobutyric acid (3-HIB).
2. The cloning strategy for heterologous overexpression of the above-described enzymes is described in detail below.
a) Construction of plasmid pACYCDuet-KpGDRF for overexpression of glycerol dehydratase reactivating factor (GDRF).
First, the genes gdrA (synonym: ORF4) and gdrB
(synonym: ORF2b), which encode the two subunits of K. pneumoniae GDRF, were amplified by means of PCR. The template used was chromosomal DNA of the strain K. pneumoniae DSM2026.
gdrA was amplified using the following oligonucleotides:
orf4fw (SEQ ID No. 26):
5'-TGAAGATCCTAGGAGGTTTAAACATATGCCGTTAATAGCCGGGATTG-3') orf4Salrv (SEQ ID No. 27):
5'-TATATAGTCGACTTAATTCGCCTGACCGGCCAG-3';
(Sail recognition sequence is underlined).
gdrB was amplified using the following oligonucleotides orf2bPcifw (SEQ ID No. 28):
5'-TATATAACATGTCGCTTTCACCGCCAGGC-3' (PciI recognition sequence is underlined) orf2brv (SEQ ID No. 29):
5'-CATATGTTTAAACCTCCTAGGATCTTCAGTTTCTCTCACTTAACGGGCA
GG-3') The PCR products obtained were then fused to one another by crossover PCR.
To this end, the following oligonucleotides were used:
orf2bNcofw (SEQ ID No. 30):
(5'-TATATACCATGGCGCTTTCACCGCCAGGC-3' (NcoI recognition sequence is underlined) orf4Salrv (SEQ ID No. 31):
5'-TATATAGTCGACTTAATTCGCCTGACCGGCCAG-3' (Sail recognition sequence is underlined).
The PCR product (2,220 bp) was purified by means of the QIAquick PCR purification kit from Qiagen, Hilden, Germany, according to the manufacturer's information and ligated into the per-BluntII-TOPO
vector, yielding the pCR-BluntII-Topo-KpGDRF
vector. Ligation and subsequent transformation into E. coli cells are carried out according to the information by the manufacturer, Invitrogen Corporation, Carlsbad (Zero Blunt TOPO PCR
Cloning Kit).
The GDRF sequence was then excised from the vector by digesting pCR-BluntII-Topo-KpGDRF with PciI and Sall and ligated into the NcoI and Sall-cut pACYC-Duet expression vector, resulting in pACYCDuet-KpGDRF (6142 bp).
b) Construction of plasmid pAS5O_Ec_aldH for over-expression of K. pneumoniae glycerol dehydratase (GD) and E. coli aldehyde dehydrogenase, aldH.
The three subunits of K. pneumoniae GD are naturally organized in a single operon (genes gldA, gldB and gldC). They were amplified by means of PCR, again using chromosomal DNA of K. pneumoniae D5M2026 as template.
The following oligonucleotides were used for the amplification:
KpGDNdefw (SEQ ID No. 32) 5'-TATATACATATGAAAAGATCAAAACGATTTGCAGTACTGG-3' (NdeI recognition sequence is underlined) KpGDSalrv (SEQ ID No. 33):
5'-TATATAGTCGACTTAGCTTCCTTTACGCAGCTTATGC-3' (Sail recognition sequence is underlined) The amplicon was ligated into the pCR-BluntII-TOPO vector, yielding the vector pCR-BluntII-Topo-KpGD vector. Ligation and subsequent transformation into E. coil cells were carried out according to the information by the manufacturer, Invitrogen Corporation, Carlsbad (Zero Blunt TOPO PCR Cloning Kit).
The GD-encoding fragment was excised from the pCR-BluntII-Topo-KpGD vector by XbaI (blunted by Klenow fill in) and NdeI and ligated into a pET-Duet expression vector cut with NdeI and EcoRV, resulting in the plasmid pAS50(8161 bp).
The E. coli aldH gene was then amplified. For this, chromosomal DNA of E. coil K12 was used as template, with the PCR primers used being the oligonucleotides 1228 ald fp (SEQ ID No. 34):
_ _ 5'-AAAACATATGAATTTTCATCATCTGGCTTACTGG-3' (NdeI recognition sequence is underlined) and 1228 ald rp (SEQ ID No. 35):
_ _ 5'-AAAACATATGTATATTTCCTTCTTTCAGGCCTCCAGGCTTATCCAGATG-3') (NdeI recognition sequence is underlined).
The PCR amplicon was gel-purified and then ligated by means of digestion of NdeI into the NdeI site of plasmid pAS50, producing the plasmid pAS5O_Ec_aldH (9666 bp).
c) Construction of plasmid pCDFDuet-l_Rs-ccR Cau_pcs for overexpression of Chloroflexus aurantiacus propionyl-coenzyme A synthase (Pcs) and of Rhodobacter sphaeroides crotonyl-coenzyme A
carboxylase/reductase (CCR).
For heterologous expression in E. coli and purification of CCR, the gene was cloned into the pET3d expression vector, yielding plasmid pTE13:
the R. sphaeroides ccr gene was amplified by PCR
using the oligonucleotides ccr-fw (SEQ ID No. 36):
5'-GGAGGCAACCATGGCCCTCGACGTGCAGAG-3' (NcoI recognition sequence is underlined) and ccr-rev (SEQ ID No. 37):
5'-GAGACTTGCGGATCCCTCCGATCAGGCCTTGC-3' (BamHI recognition sequence is underlined), using chromosomal DNA of the strain T.
sphaeroides 2.4.1. (DSMZ 158) as template. The PCR product was ligated by way of an NcoI/BamHI
fragment into the NcoI/BamHI-cut vector pET3d (Merck, Germany), producing the plasmid pTE13.
The ccr gene was subcloned by way of an NcoI/BamHI fragment from pTE13 into the NcoI/BamHI cleavage sites of the pCDFDuet-1 plasmid (Merck, Germany), producing the plasmid pCDFDuet-1 Rs ccr.
The C. aurantiacus pcs gene was then amplified by PCR using the oligonucleotides 1228 Cau pcs fp(71) (SEQ ID No. 38):
_ _ _ 5'-AAAACATATGATCGACACTGCGCCCCTTGC-3' (NdeI recognition sequence is underlined) and 1228 Cau pcs rp(74) (SEQ ID No. 39):
_ _ _ 5'-AAGACGTCCTACCGCTCGCCGGCCGTCC-3' (AatII recognition sequence is underlined), using chromosomal DNA of the strain C.
aurantiacus OK-70-fl (DSM 636) as template. The amplicon was purified by gel extraction and then ligated, via digestion with NdeI/AatII, into the correspondingly cut vector pCDFDuet-1 Rs_ccr, producing the plasmid pCDFDuet-1 Rs ccr_Cau_pcs (10 472 bp).
d) Construction of plasmid pCOLADuet St mcr oCg Tth HIBDH oCg for _ _ _ over-expression of Sulfolobus tokodaii malonyl-CoA
reductase (Mcr) and of Thermus thermophilus 3-hydroxyisobutyrate dehydrogenase (3-HIB-DH) First, a variant of the S. tokodaii mcr gene was synthesized in line with the codon usage of Corynebacterium glutamicum (St_mcr oCg). The synthesis was carried out at GeneArt, Germany, and the artificial gene, St_mcr oCg, was provided in the form of the plasmid pGA4_MMCoAR_ST (SEQ ID
No. 40). pGA4 MMCoAR_ST DNA was used as PCR
template in order to amplify the artificial gene, St mcr oCg, using the oligonucleotides 1228 MMCoAR fp (SEQ ID No. 41):
5'-AACCATGGGCCGCACCCTGAAGG-3' (NcoI recognition sequence is underlined) and 1228 MMCoAR rp (SEQ ID No. 42) 5'-AAGGATCCTTACTTTTCGATGTAGCCCTTTTCC-3' (BamHI recognition sequence is underlined).
The amplicon was purified by gel extraction and then digested with NcoI/BamHI and ligated into the corresponding cleavage sites of the pCOLADuet_l plasmid (Merck, Germany), producing the plasmid pCOLADuet_St_mcr_oCg.
A variant of the T. the rmophilus MmsB gene (encoding a 3-HIB-DH), which is in line with the codon usage of Corynebacterium glutamicum, was likewise provided by gene synthesis (GeneArt, Germany), to be precise in the form of the plasmid pGA4_3HIBDH TT (SEQ ID No. 43).
pGA4_3HIBDH TT was used as PCR template in order to amplify the artificial gene, Tth_HIBDH oCg, using the oligonucleotides 1228 Tth HIBDH fp (SEQ ID No. 44):
_ _ 5'-AAAACATATGGAAAAGGTGGCATTCATCG-3' (NdeI recognition sequence is underlined) and 1228 Tth HIBDH rp (SEQ ID No. 45):
_ _ 5'-AAAAGATCTTTAGCGGATTTCCACACCGCC-3' (BglII recognition sequence is underlined).
The amplicon was gel-extracted and then cut with Ndel/Bg111 and ligated into the NdeI/BglII
cleavage sites of the plasmid pCOLADuet St mcr oCg, producing the plasmid _ _ _ pCOLADuet_St mcr oCg Tth HIBDH_oCg (5,620 bp).
e) The 4 plasmids, pACYCDuet-KpGDRF, pAS5O_Ec-aldH, pCDFDuet-1 Rs ccR Cau pcs and _ _ _ _ pCOLADuet_St_mcr_oCg_Tth_HIBDH_oCg, were then co-transformed into commercially available, chemically competent E. coli BL21 (DE3) cells (Merck, Germany), according to the manufacturer's protocol. Selection was carried out on LB agar supplemented with ampicillin (25 pg/ml), chloramphenicol (17 pg/ml), kanamycin (15 pg/ml) and streptomycin (25 pg/ml).
f) Induction of expression plasmids in E. coli The plasmid-carrying E. coli strains described in e) above were cultured in modified M9 medium (6.8 g/1 Na2HPO4 x 2 H20; 3 g/1 KH2PO4; 0.5 g/1 NaCl; 1 g/1 NH4C1; 1.25 g/1 yeast extract; 1% v/v glycerol; 15 mg/1 CaCl2 x 2 H20; 250 mg/1 MgSO4 x 7 H20; 1% v/v Gibco MEM Vitamin solution;
41.9 g/1 MOPS). The medium was supplemented with ampicillin (25 pg/ml), chloramphenicol (17 pg/ml), kanamycin (15 pg/ml) and streptomycin (25 pg/ml). The entire cultivation (pre- and main cultures) was carried out on a shaker with temperature control at 37 C. The strains were first cultured in 5 ml of medium overnight.
Subsequently, 20 ml of medium in a 100 ml flask with baffles were then inoculated from the overnight culture at a ratio of 1:20 and cultured further. At OD600 of approx. 0.8, 6 pM cobalamine and 1 pM IPTG were added, and the culture was incubated for another 4 hours. At this time, 2.5 ml of cell suspension were removed and stored at -20 C until analysis.
g) Detection and quantification of 3-HIB were carried out by means of ion chromatography (IC) and conductivity detection. For this, 2.5 ml of samples are thawed at room temperature and centrifuged (10 min, 13 200 rpm). The supernatant is purified using a syringe filter (pore size 0.44 pm). The measurement is carried out using a Metrohm Compact IC 761 with autosampler. Mobile phase: 8 mM NaOH. Column: Dionex AS15 4 x 250 mm, precolumn AG15 4 x 50 mm. Column temperature: 25 C. Flow rate: 1.4 ml/min.
Injection volume: 10 pl.
h) Dehydration of 3-hydroxyisobutyric acid to methacrylate 5 ml of a concentrated solution of 3-hydroxy-isobutyric acid (0.2 g/l), produced by the process described in f) above, are admixed with NaOH (0.06 mg) with stirring. The solution is incubated with stirring and reflux condensation at 185-195 C under vacuum (300 torr). A further 0.5 mg of 3-hydroxyisobutyric acid in 5 ml are added every hour over a period of 5 h. The solution contains 0.4 percent by weight p-methoxyphenol in order to prevent methacrylate from polymerizing. The reaction is stopped after 24 h of incubation. Conversion of 3-hydroxy-isobutyric acid to methacrylate is above 90%.
Methacrylic acid is removed from the reaction mixture by distillation.

Claims (20)

1. A process for the preparation of methacrylic acid or a methacrylic ester, comprising the process steps of:
preparing a 3-hydroxyisobutyric acid by a process comprising the process step of:
bringing a cell which has been genetically modified in comparison with its wild type in such a way that it forms more 3-hydroxyisobutyric acid, or polyhydroxy-alkanoates based on 3-hydroxyisobutyric acid, in comparison with its wild type, into contact with a nutrient medium comprising, as carbon source, a carbohydrate, glycerol, carbon dioxide, methane, methanol, L-valine or L-glutamate under conditions under which 3-hydroxyisobutyric acid or polyhydroxy-alkanoates based on 3-hydroxyisobutyric acid are formed from the carbon source;
if appropriate, isolating the 3-hydroxyisobutyric acid from the nutrient medium; and also, if appropriate, neutralizing the 3-hydroxyisobutyric acid;
wherein the formation of 3-hydroxyisobutyric acid or of polyhydroxyalkanoates based on 3-hydroxyisobutyric acid takes place via:
(i) methylmalonate semialdehyde as precursor and succinyl-coenzyme A as intermediate;
(ii) methylmalonate semialdehyde as precursor and propionyl-coenzyme A as intermediate;
(iii) methylmalonate semialdehyde as precursor and acryloyl-coenzyme A as intermediate; or (iv) 3-hydroxybutyryl-coenzyme A as precursor and isobutyryl coenzyme A as intermediate;

dehydrating the 3-hydroxyisobutyric acid with formation of methacrylic acid; and also, where appropriate, esterifying the methacrylic acid.
2. The process as claimed in claim 1, where the cell features an activity of an enzyme E1, which catalyzes the conversion of succinyl-coenzyme A into methylmalonyl-coenzyme A, which is increased in comparison with its wild type.
3. The process as claimed in claim 2, where the enzyme E1 is a methylmalonyl-coenzyme A mutase (EC 5.4.99.2).
4. The process as claimed in any one of claims 1 to 3, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E2, which catalyzes the conversion of methylmalonyl-coenzyme A into methyl malonate;
E3, which catalyzes the conversion of methyl malonate into methylmalonate semialdehyde; or E4 which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyrate;
or any combination thereof.
5. The process as claimed in claim 4, wherein:
E2 is a methylmalonyl-coenzyme A hydrolase (EC 3.1.2.17);
E3 is an aldehyde dehydrogenase (EC 1.2.1.3) or an aldehyde oxidase (EC 1.2.3.1); and E4 is a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or a 3-hydroxyacyl-coenzyme A dehydrogenase (EC 1.1.1.35).
6. The process as claimed in any one of claims 1 to 3, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E4, which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyric acid;
E5, which catalyzes the conversion of propionyl-coenzyme A
into methylmalonate semialdehyde;
E6, which catalyzes the conversion of (R) methylmalonyl-coenzyme A into (S) methylmalonyl-coenzyme A; or E7, which catalyzes the conversion of (S) methylmalonyl-coenzyme A into propionyl-coenzyme A;
or any combination thereof.
7. The process as claimed in claim 6, wherein:
E4 is a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or a 3-hydroxyacyl-coenzyme A dehydrogenase (EC 1.1.1.35);
E5 is a methylmalonate-semialdehyde dehydrogenase (EC
1.2.1.27);
E6 is a methylmalonyl-coenzyme A epimerase (EC 5.1.99.1);
and E7 is a methylmalonyl-coenzyme A decarboxylase (EC
4.1.1.41).
8. The process as claimed in any one of claims 1 to 3, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E46, which catalyzes the conversion of L-glutamate into 2-oxoglutarate; or E28 which catalyzes the conversion of 2-oxoglutarate into succinyl-coenzyme A;
or a combination thereof.
9. The process as claimed in claim 8, wherein:
E46 is a glutamate synthase (EC 1.4.1.13 or EC 1.4.1.14), a glutamate dehydrogenase (EC 1.4.1.2, EC 1.4.1.3 or EC
1.4.1.4) or an aspartate transaminase (EC 2.6.1.1 or EC
2.6.1.2); and E28 is a 2-oxoglutarate synthase (EC 1.2.7.3).
10. The process as claimed in claim 1, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E4, which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyrate;
E5, which catalyzes the conversion of propionyl-coenzyme A
into methylmalonate semialdehyde;
E47, which catalyzes the conversion of acetyl-coenzyme A
into malonyl-coenzyme A;
E48, which catalyzes the conversion of malonyl-coenzyme A
into malonate semialdehyde;
E49, which catalyzes the conversion of malonate semialdehyde into 3-hydroxypropionate;
E50, which catalyzes the conversion of 3-hydroxypropionate into 3-hydroxypropionyl-coenzyme A;
E51, which catalyzes the conversion of 3-hydroxypropionyl-coenzyme A into acryloyl-coenzyme A; or E52, which catalyzes the conversion of acryloyl-coenzyme A
into propionyl-coenzyme A;
or any combination thereof.
11. The process as claimed in claim 10, wherein:
E4 is a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or a 3-hydroxyacyl-coenzyme A dehydrogenase (EC 1.1.1.35);

E5 is a methylmalonate-semialdehyde dehydrogenase (EC
1.2.1.27);
E47 is a malonyl-coenzyme A decarboxylase (EC 4.1.1.9), a malonate coenzyme A transferase (EC 2.8.3.3), a methylmalonyl-coenzyme A carboxy-transferase (EC 2.1.3.1) or an acetyl-coenzyme A carboxylase (EC 6.4.1.2);
E48 is a malonate-semialdehyde dehydrogenase (EC
1.2.1.18);
E49 is a 3-hydroxypropionate dehydrogenase (EC 1.1.1.59);
E50 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC
3.1.2.4);
E51 is an enoyl-coenzyme A hydratase (EC 4.2.1.17); and E52 is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3).
12. The process as claimed in claim 1, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E2, which catalyzes the conversion of methylmalonyl-coenzyme A into methyl malonate;
E3, which catalyzes the conversion of methyl malonate into methylmalonate semialdehyde;
E4, which catalyzes the conversion of methylmalonate semialdehyde into 3-hydroxyisobutyric acid;
E56, which catalyzes the conversion of acrylyl-coenzyme A
into methylmalonyl-coenzyme A;
E72, which catalyzes the conversion of beta-alanine into beta-alanyl-coenzyme A; or E73, which catalyzes the conversion of beta-alanyl-coenzyme A into acrylyl-coenzyme A;
or any combination thereof.
13. The process as claimed in claim 12, wherein:
E2 is a methylmalonyl-coenzyme A hydrolase (EC 3.1.2.17);

E3 is an aldehyde dehydrogenase (EC 1.2.1.3) or an aldehyde oxidase (EC 1.2.3.1);
E4 is a 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31) or a 3-hydroxyacyl-coenzyme A dehydrogenase (EC 1.1.1.35);
E56 is a crotonyl-coenzyme A decarboxylase;
E72 is a coenzyme A transferase (EC 2.8.3.1) or coenzyme A
synthetase; and E73 is a beta-alanyl-coenzyme A ammonia-lyase (EC
4.3.1.6).
14. The process as claimed in claim 13, wherein E72 is a coenzyme A transferase.
15. The process as claimed in claim 1, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E8, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A into 3-hydroxyisobutyrate;
E60, which catalyzes the conversion of isobutyryl-coenzyme A into methacrylyl-coenzyme A;
E61, which catalyzes the conversion of methacrylyl-coenzyme A into 3-hydroxyisobutyryl-coenzyme A;
E76, which catalyzes the conversion of pyruvate into 2-acetolactate;
E77, which catalyzes the conversion of 2-acetolactate into 2,3-dihydroxyisovalerate;
E78, which catalyzes the conversion of 2,3-dihydroxyisovalerate into 2-oxoisovalerate; or E79, which catalyzes the conversion of 2-oxoisovalerate into isobutyryl-coenzyme A;
or any combination thereof.
16. The process as claimed in claim 15, wherein:

E8 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC
3.1.2.4);
E60 is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3), a butyryl-coenzyme A dehydrogenase (EC 1.3.99.2) or a 2-methylacyl-coenzyme A dehydrogenase (EC 1.3.99.12);
E61 is an enoyl-coenzyme A hydratase (EC 4.2.1.17);
E76 is an acetolactate synthase (EC 2.2.1.6);
E77 is a dihydroxyisovalerate dehydrogenase (EC 1.1.1.86);
E78 is a 2,3-dihydroxyisovalerate dehydratase (EC
4.2.1.9); and E79 is a 2-oxoisovalerate dehydrogenase (EC 1.2.1.25 or EC
1.2.4.4).
17. The process as claimed in claim 1, where the cell comprises an enzyme which has an increased activity in comparison with its wild type, wherein the enzyme is:
E8, which catalyzes the conversion of 3-hydroxyisobutyryl-coenzyme A into 3-hydroxyisobutyrate;
E60, which catalyzes the conversion of isobutyryl-coenzyme A into methacrylyl-coenzyme A;
E61, which catalyzes the conversion of methacrylyl-coenzyme A into 3-hydroxyisobutyryl-coenzyme A;
E79, which catalyzes the conversion of 2-oxoisovalerate into isobutyryl-coenzyme A; or E80, which catalyzes the conversion of L-valine into 2-oxoisovalerate;
or any combination thereof.
18. The process as claimed in claim 17, wherein:
E8 is a 3-hydroxyisobutyryl-coenzyme A hydrolase (EC
3.1.2.4);
E60 is an acyl-coenzyme A dehydrogenase (EC 1.3.99.3), a butyryl-coenzyme A dehydrogenase (EC 1.3.99.2) or a 2-methylacyl-coenzyme A dehydrogenase (EC 1.3.99.12);
E61 is an enoyl-coenzyme A hydratase (EC 4.2.1.17);
E79 is a 2-oxoisovalerate dehydrogenase (EC 1.2.1.25 or EC
1.2.4.4); and E80 is an amino acid transferase (EC 2.6.1.42).
19. The process as claimed in claim 1, where the cell is obtained by a process for preparing a genetically modified cell, comprising the process step of increasing, in the cell, the activity of at least one enzyme as defined in any one of claims 2 to 18.
20. A process of preparing polymethacrylic acid or a polymethacrylic ester, comprising the process steps of:
preparing methacrylic acid by a process as defined in any one of claims 1 to 19;
free-radical polymerization of the methacrylic acid; and if appropriate, esterifying at least in part the carboxyl groups of the methacrylic acid or the carboxylate group of the methacrylate before or after the free-radical polymerization reaction.
CA2688292A 2007-06-01 2008-05-30 A process for preparing methacrylic acid or methacrylic esters Expired - Fee Related CA2688292C (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EPPCT/EP2007/055394 2007-06-01
PCT/EP2007/055394 WO2007141208A2 (en) 2006-06-02 2007-06-01 Microbiological production of 3-hydroxyisobutyric acid
PCT/EP2008/056707 WO2008145737A1 (en) 2007-06-01 2008-05-30 A process for preparing methacrylic acid or methacrylic esters

Publications (2)

Publication Number Publication Date
CA2688292A1 CA2688292A1 (en) 2008-12-04
CA2688292C true CA2688292C (en) 2015-01-27

Family

ID=39736879

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2688292A Expired - Fee Related CA2688292C (en) 2007-06-01 2008-05-30 A process for preparing methacrylic acid or methacrylic esters

Country Status (10)

Country Link
EP (1) EP2152659B1 (en)
JP (1) JP5449142B2 (en)
KR (1) KR20100031525A (en)
CN (1) CN101679187B (en)
AU (1) AU2008257512A1 (en)
CA (1) CA2688292C (en)
MX (1) MX2009012867A (en)
MY (1) MY154910A (en)
RU (1) RU2491346C9 (en)
WO (1) WO2008145737A1 (en)

Families Citing this family (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2009242615A1 (en) 2008-05-01 2009-11-05 Genomatica, Inc. Microorganisms for the production of methacrylic acid
KR20120068021A (en) * 2009-09-09 2012-06-26 게노마티카 인코포레이티드 Microorganisms and methods for the co-production of isopropanol with primary alcohols, diols and acids
DE102009029651A1 (en) * 2009-09-22 2011-03-24 Evonik Röhm Gmbh Process for the preparation of free carboxylic acids
MX2012003604A (en) 2009-09-27 2012-09-12 Opx Biotechnologies Inc Method for producing 3-hydroxypropionic acid and other products.
SG192706A1 (en) * 2011-02-11 2013-09-30 Univ Minnesota Cells and methods for producing isobutyric acid
US9133487B2 (en) * 2011-04-01 2015-09-15 Genomatica, Inc. Microorganisms for producing methacrylic acid and methacrylate esters and methods related thereto
WO2012174451A1 (en) 2011-06-17 2012-12-20 Invista Technologies S.A.R.L. Use of hydrolases to increase monomer content in waste stream
EP2726627A2 (en) 2011-06-30 2014-05-07 Invista Technologies S.à.r.l. Bioconversion process for producing nylon-7, nylon-7,7 and polyesters
CN103703122B (en) 2011-07-29 2019-04-26 三井化学株式会社 The microorganism of the fixed cycles of carbon dioxide is imported
EP2602329A1 (en) * 2011-12-05 2013-06-12 Evonik Degussa GmbH Biotechnological production of 3-hydroxyisobutyric acid
US9102960B2 (en) 2011-12-16 2015-08-11 Invista North America S.á.r.l. Methods of producing 6-carbon chemicals via CoA-dependent carbon chain elongation associated with carbon storage
US9102958B2 (en) 2011-12-16 2015-08-11 Invista North America S.á.r.l. Methods of producing 6-carbon chemicals via CoA-dependent carbon chain elongation associated with carbon storage
KR102139454B1 (en) 2012-07-03 2020-08-03 가오 가부시키가이샤 Useful Microorganism, And Method For Producing Desired Substance
US20140051136A1 (en) 2012-08-10 2014-02-20 Opx Biotechnologies, Inc. Micoorganisms and Methods for the Production of Fatty Acids and Fatty Acid Derived Products
CN113957103A (en) * 2012-09-10 2022-01-21 三菱化学株式会社 Method for producing methacrylic acid and/or ester thereof
CN104619851B (en) 2012-09-10 2019-03-19 三菱化学株式会社 The manufacturing method of methacrylate
WO2014071286A1 (en) 2012-11-05 2014-05-08 Genomatica, Inc. Microorganisms for enhancing the availability of reducing equivalents in the presence of methanol, and for producing 1,2-propanediol
BR112015013413A2 (en) 2012-12-14 2017-11-14 Invista Tech Sarl method for biosynthesizing a recombinant product and host
EP2938733A2 (en) 2012-12-31 2015-11-04 Invista North America S.a.r.l. Methods of producing 7-carbon chemicals via methyl-ester shielded carbon chain elongation
EP2938734A2 (en) 2012-12-31 2015-11-04 Invista Technologies S.A R.L. Methods of producing 7-carbon chemicals via aromatic compounds
CN105073214A (en) 2012-12-31 2015-11-18 英威达技术有限责任公司 Methods of producing 6-carbon chemicals via methyl-ester shielded carbon chain elongation
WO2014105788A2 (en) 2012-12-31 2014-07-03 Invista North America S.A.R.L. Methods of producing 7-carbon chemicals via carbon chain elongation associated with cyclohexane carboxylate synthesis
EP2938736A2 (en) 2012-12-31 2015-11-04 Invista Technologies S.A R.L. Methods of producing 7-carbon chemicals via c1 carbon chain elongation associated with coenzyme b synthesis
EP2938732A1 (en) 2012-12-31 2015-11-04 Invista Technologies S.à.r.l. Methods of producing 7-carbon chemicals from long chain fatty acids via oxidative cleavage
CN105026569A (en) 2012-12-31 2015-11-04 英威达技术有限责任公司 Methods of producing 7-carbon chemicals via pyruvate and succinate semialdehyde aldol condensation
DE102013000602A1 (en) 2013-01-16 2014-07-17 Evonik Industries Ag Process for the production of acrylic acid
KR101714943B1 (en) 2013-01-24 2017-03-09 미쓰이 가가쿠 가부시키가이샤 Microorganism having carbon dioxide fixation cycle introduced thereinto
WO2014145332A1 (en) * 2013-03-15 2014-09-18 Opx Biotechnologies, Inc. Monfunctional mcr + 3-hp dehydrogenase
EP2976141A4 (en) 2013-03-15 2016-10-05 Cargill Inc Flash evaporation for production purification and recovery
US10047383B2 (en) 2013-03-15 2018-08-14 Cargill, Incorporated Bioproduction of chemicals
JP2016165225A (en) 2013-07-09 2016-09-15 味の素株式会社 Method for producing useful substance
US10337038B2 (en) 2013-07-19 2019-07-02 Cargill, Incorporated Microorganisms and methods for the production of fatty acids and fatty acid derived products
US11408013B2 (en) 2013-07-19 2022-08-09 Cargill, Incorporated Microorganisms and methods for the production of fatty acids and fatty acid derived products
EP3029145B1 (en) 2013-08-01 2020-05-13 Mitsubishi Chemical Corporation Method for producing methacrylyl-coa
EP3039151A2 (en) * 2013-08-28 2016-07-06 Invista Technologies S.A R.L. Methods for biosynthesizing methacrylate
KR20160108546A (en) 2014-03-07 2016-09-19 미쯔비시 레이온 가부시끼가이샤 Method for producing methacrylic acid ester, and novel methacrylic acid ester synthase
BR112016026461A2 (en) 2014-05-15 2017-12-12 Invista Tech Sarl 6-carbon chemical production methods using 2,6-diaminopimelate as precursor for 2-aminopimelate
BR112016029399A2 (en) 2014-06-16 2017-10-17 Invista Tech Sarl methods, reagents and cells to biosynthesize compound
BR112016029375A2 (en) 2014-06-16 2017-10-17 Invista Tech Sarl methods, reagents and cells to biosynthesize compounds
US20170152531A1 (en) 2014-06-16 2017-06-01 North America S.A.R.L. Process for producing glutarate and glutaric acid methyl ester
EP3155106A2 (en) 2014-06-16 2017-04-19 Invista Technologies S.à.r.l. Methods, reagents and cells for biosynthesizing compound
DE102014213016A1 (en) * 2014-07-04 2016-01-07 Evonik Röhm Gmbh Dehydration of alpha-substituted carboxylic acids in the presence of water at high pressures
EP2993228B1 (en) 2014-09-02 2019-10-09 Cargill, Incorporated Production of fatty acid esters
CA2985279A1 (en) * 2015-05-19 2016-11-24 Lucite International Uk Limited Process for the biological production of methacrylic acid and derivatives thereof
DE102016212497B4 (en) 2015-07-13 2024-04-25 Sk Innovation Co., Ltd. Mutant microorganism comprising a gene encoding methylmalonyl-CoA reductase and its use
JP6800019B2 (en) * 2015-10-23 2020-12-16 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Biological production of methyl methacrylate
KR102547252B1 (en) * 2016-01-08 2023-06-23 에스케이이노베이션 주식회사 Method for Manufacturing Vapor Dehydration Reaction Feed of Organic Material
JP2020506702A (en) 2017-02-02 2020-03-05 カーギル インコーポレイテッド Genetically modified cells producing C6-C10 fatty acid derivatives
GB201808424D0 (en) 2018-05-23 2018-07-11 Lucite Int Uk Ltd Methods for producing BMA and MMA using genetically modified microorganisms

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3562320A (en) * 1967-04-25 1971-02-09 Escambia Chem Corp Process for producing methacrylic acid
FR2635521B1 (en) * 1988-08-16 1991-02-22 Norsolor Sa IMPROVED PROCESS FOR THE MANUFACTURE OF METHYL METHACRYLATE FROM ISOBUTYRIC ACID
EP1186592A1 (en) * 2000-09-11 2002-03-13 Mitsubishi Gas Chemical Company, Ltd. Production of methacrylates
JP4539808B2 (en) * 2000-09-11 2010-09-08 三菱瓦斯化学株式会社 Method for producing methacrylates
JP2005336110A (en) * 2004-05-27 2005-12-08 Mitsubishi Chemicals Corp Method for producing (meth)acrylic acid and (meth)acrylic acid ester

Also Published As

Publication number Publication date
WO2008145737A1 (en) 2008-12-04
EP2152659A1 (en) 2010-02-17
MX2009012867A (en) 2010-02-15
KR20100031525A (en) 2010-03-22
AU2008257512A1 (en) 2008-12-04
CA2688292A1 (en) 2008-12-04
RU2491346C2 (en) 2013-08-27
RU2009148592A (en) 2011-07-20
CN101679187A (en) 2010-03-24
EP2152659B1 (en) 2013-04-24
JP2010528597A (en) 2010-08-26
CN101679187B (en) 2013-06-05
RU2491346C9 (en) 2014-04-27
MY154910A (en) 2015-08-28
JP5449142B2 (en) 2014-03-19

Similar Documents

Publication Publication Date Title
CA2688292C (en) A process for preparing methacrylic acid or methacrylic esters
US9234218B2 (en) Process for preparing methacrylic acid or methacrylic esters
US10174349B2 (en) Recombinant cell producing 2-hydroxyisobutyric acid
JP6271494B2 (en) Process for producing 3-hydroxypropionic acid and other products
US20100190224A1 (en) enzyme for the production of methylmalonyl-coenzyme a or ethylmalonyl-coenzyme a and use thereof
US20090325248A1 (en) Microbiological Production of 3-Hydroxypropionic Acid
US20140330032A1 (en) Microbial production of chemical products and related compositions, methods and systems
CA2781400A1 (en) Production of an organic acid and/or related chemicals
US20180312887A1 (en) Microbial production of chemical products and related compositions, methods and systems
JP2022530467A (en) Generation of chemicals from renewable resources
WO2013043758A2 (en) Compositions and methods regarding direct nadh utilization to produce 3-hydroxypropionic acid, derived chemicals and further derived products
WO2013163292A2 (en) Methods and microorganisms for increasing the biological synthesis of difunctional alkanes

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20130418

MKLA Lapsed

Effective date: 20160530