CA2565679C

CA2565679C - Device and method for detecting molecular interactions

Info

Publication number: CA2565679C
Application number: CA2565679A
Authority: CA
Inventors: Alexandra Dworrak; Thomas Ellinger; Eugen Ermantraut; Torsten Schulz; Thomas Ullrich; Thomas Kaiser; Ralf Bickel
Original assignee: Clondiag Chip Technologies GmbH
Current assignee: Clondiag Chip Technologies GmbH
Priority date: 2004-05-06
Filing date: 2005-05-06
Publication date: 2019-08-20
Anticipated expiration: 2025-05-06
Also published as: EP2280267B1; JP4958770B2; WO2005108604A2; JP2007536541A; DK1761641T3; PT2299257T; EP2299257A2; DE502005010078D1; EP2299257B1; EP2256478B1; CN102121054A; ES2350638T3; DE102004022263A1; AU2011201671A1; EP2280267A2; EP2256478A2; EP2290351A3; CA3041596A1; EP1761641B1; BRPI0510680B1

Abstract

The invention relates to devices and methods for detecting specific interactions between target and probe molecules. In particular, the invention relates to a device for qualitatively and/or quantitatively detecting molecular interactions between probe and target molecules, comprising: a) a micro-array on a substrate onto which probe molecules are immobilized on array elements, said micro-array being disposed on a first surface of the device; and b) a reaction chamber formed between the first surface including the micro-array disposed thereon, and a second surface, the distance between said micro-array and the second surface being variable.

Description

- -Device and method for detecting molecular interactions The invention relates to devices and methods for detecting specific interactions between target and probe molecules.
Biomedical tests are often based on the detection of an interaction between a molecule, which is present in known amount and position (the molecular probe), and an unknown molecule to be detected or unknown molecules to be detected (the molecular target molecules). In modern tests, probes are laid out in the form of a substance library on supports, the so-called microarrays or chips, so that a sample can be analyzed simultaneously at various probes in a parallel manner (see, for example, J. Lockhart, E. A. Winzeler, Genomics, gene expression and DNA arrays; Nature 2000, 405, 827-836). The probes are herein usually immobilized on a suitable matrix, as is for example described in WO 00/12575 (see, for example, US 5,412,087, WO 98/36827), or synthetically produced (see, for example, US
5,143,854) in a predetermined manner for the preparation of the microarrays.
It is a prerequisite for binding, for example, a target molecule labeled with a fluorescence group in the form of a DNA or RNA molecule to a nucleic acid probe of the microarray, that both target molecule and probe molecule are present in the form of a single-stranded nucleic acid. Efficient and specific hybridization can only occur between such molecules. Single-stranded nucleic acid target molecules and nucleic acid probe molecules can normally be obtained by means of heat denaturation and optimal selection of parameters like temperature, ionic strength, and concentration of helix-destabilizing molecules. Thus, it is ensured that only probes having virtually perfectly complementary, i.e. corresponding to each other, sequences remain paired with the target sequence (A.A. Leitch, T.
Schwarzacher, D. Jackson, I. J. Leitch, 1994, In vitro Hybridisierung, Spektrum Akademischer Verlag, Heidelberg / Berlin / Oxford).
A typical example for the use of microarrays in biological test methods is the detection of microorganisms in samples in biomedical diagnostics. Herein, it is taken advantage of the fact that the genes for ribosomal RNA (rRNA) are dispersed ubiquitously and have sequence portions, which are characteristic for the respective species. These species-characteristic

- 2 -sequences are applied onto a microarray in the form of single-stranded DNA
oligonucleotides.
The target DNA molecules to be examined are first isolated from the sample to be examined and are equipped with markers, for example fluorescent markers. Subsequently, the labeled target DNA molecules are incubated in a solution with the probes fixed on the microarray;
unspecifically occurring interactions are removed by means of corresponding washing steps and specific interactions are detected by means of fluorescence-optical evaluation. In this manner, it is possible to detect, for example, several microorganisms simultaneously in one sample by means of one single test. In this test method, the number of detectable microorganisms theoretically only depends on the number of the specific probes, which have been applied onto the microarray.
A variety of methods and technical systems, some of which are also commercially available, are described for the detection of molecular interactions with the aid of microarrays and probe arrays, respectively, on solid surfaces.
Classical systems for the detection of molecular interactions are based on the comparison of the fluorescence intensities of spectrally excited target molecules labeled with fluorophores.
Fluorescence is the capacity of particular molecules to emit their own light when excited by light of a particular wavelength. Herein, a characteristic absorption and emission behavior ensues. In analysis, a proportional increase of the fluorescence signal is assumed as labeled molecule density on the functionalized surface increases, for example, due to increasing efficiency of the molecular interaction between target and probe molecules.
In particular, quantitative detection of fluorescence signals is performed by means of modified methods of fluorescence microscopy. Herein, the light having the absorption wavelength is separated from the light having the emission wavelength by means of filters or dichroites and the measured signal is imaged on suitable detectors, like for example two-dimensional CCD arrays, by means of optical elements like objectives and lenses. In general, analysis is performed by means of digital image processing.
Hitherto known technical solutions vary regarding their optical setup and the components used. Problems and limitations can result from the signal noise (the background), which is basically determined by effects like bleaching and quenching of the dyes used,

- 3 -autofluorescence of the media, assembling elements, and optical components as well as by dispersions, reflections, and secondary light sources within the optical setup.
This leads to great technical effort for the setup of highly sensitive fluorescence detectors for the qualitative and quantitative comparison of probe arrays. In particular, for screening with medium and high throughputs, specially adapted detection systems are necessary, which exhibit a certain degree of automation.
For optimizing standard epifluorescence setups for reading out molecular arrays, CCD-based detectors are known, which implement the excitation of the fluorophores in the dark field by means of incident light or transmitted light for the discrimination of optical effects like dispersion and reflections (see, for example, C. E. Hooper et al., Quantitative Photon Imaging in the Life Sciences Using Intensified CCD Cameras, Journal of Bioluminescence and Chemi-luminescence (1990), p. 337-344). Herein, imaging of the arrays is performed either in exposure or by means of rasterizing using higher resolution optics. The use of multispectral light sources allows a comparatively easy access to different fluorophores by means of using different excitation filters (combinations). However, it is a disadvantage that autofluorescence and system-related optical effects like the illumination homogeneity above the array necessitate complicated illumination optics and filter systems.
Further methods for the quantitative detection of fluorescence signals are based on confocal fluorescence microscopy. Confocal scanning systems, as for example described in US 5,304,810, are based on the selection of fluorescence signals along the optical axis by means of two pinholes. This results in a great adjustment effort for the samples or establishing an efficient autofocus system. Such systems are highly complex with respect to their technical solution. Required components like lasers, pinholes, optionally cooled detectors, like for example PMT, avalanche diodes, or CCD, complex and highly exact mechanical translation elements and optics have to be optimized and integrated with considerable effort (see, for example, US 5,459,325; US 5,192,980; US 5,834,758). Degree of miniaturization and price are limited by multiplicity and functionality of the components.
Currently, analyses based on probe arrays are normally read out fluorescence-optically (see, for example, A. Marshall and J. Hodgson, DNA Chips: An array of possibilities, Nature

- 4 -Biotechnology, 16, 1998, 27-31; G. Ramsay, DNA Chips: State of the Art, Nature Biotechnology, 16, Jan. 1998, 40-44). However, the disadvantages of the above-described detection devices and methods are the high signal background leading to limited precision, the sometimes considerable technical effort, and the high costs in connection with the detection methods.
A variety of, in particular, confocal systems are known, which are suitable for the detection of small-scale integrated substance libraries in array format, which are installed in fluidic chambers (see, for example, US 5,324,633, US 6,027,880, US 5,585,639, WO
00/12759).
However, the above-described methods and systems can only be adapted in a very limited way for the detection of large-scale integrated molecular arrays, which are, in particular, installed in fluidic systems, in particular due to the dispersions, reflections, and optical aberrations occurring therein. Furthermore, in such large-scale integrated arrays, great demands are made concerning the spatial resolution, which could, however, up to now technically not be implemented.
Thus, there is a need for highly integrated arrays, wherein the interaction between probes and targets can be detected qualitatively and / or quantitatively with great precision and with comparatively little technical effort.
The increase in selectivity and the access to alternative components motivate the establishment of alternative imaging technologies like fluorescence polarization and time-resolved fluorescence for assays bound to solid bodies. The effect of twisting the polarization axis by means of fluorophores excited in a polarized manner is used for quantification in microtiter format. Furthermore, there are approaches to set up inexpensive systems having a high throughput (HTS systems) by means of using correspondingly modified polymer foils as polarization filters (see I. Gryczcynski et al., Polarisation sensing with visual detection, Anal.
Chem. 1999, 71, 1241-1251).
More recent developments utilize the fluorescence of inorganic materials, like lanthanides (M.
Kwiatowski et al., Solid-phase synthesis of chelate-labelled oligonucleotides:
application in triple-color ligase-mediated gene analysis, Nucleic Acids Research, 1994, 22, 13) and

- 5 -quantum dots (M. P. Bruchez et. al., Semiconductor nanocrystals as fluorescent biological labels, Science 1998, 281, 2013). Dyes exhibiting long emission time within a range of microseconds, like lanthanide chelates, necessitate a conversion of the dyes to a mobile phase, so that a locally resolved detection is not possible.
Optical setups for the detection of samples labeled by means of gold beads and their visualization by means of silver amplification are described in the International Patent Application WO 00/72018. The devices described therein are only suitable for detection in static measurement, however. In static measurement, subsequently to the interaction of the targets with the probes laid out on the probe array as well as subsequently to the beginning of the reaction leading to precipitation on those array elements, where an interaction has occurred, an image is recorded and assigned to the measured gray value concentrations, which depend on the degree of precipitation formation.
A method for the qualitative and / or quantitative detection of targets in a sample by means of molecular interactions between probes and targets on probe arrays was provided in WO 02/02810, wherein the time-dependent behavior of precipitation formation at the array elements is detected in the form of signal intensities, i.e. dynamic measurement is performed.
On the basis of a curve function describing precipitation formation as a function of time, a value quantifying the interaction between probe and target on an array element and therefore the amount of targets bound is assigned to each array element.
Such dynamic measurement requires the recording of image series under, for example, particular thermal conditions or in a particular phase of a procedure, for example in the presence of specific solutions at the time of the recording. This requires complex cooperation of the individual components of a highly integrated array, in particular in uses in the field of genotyping.
Furthermore, in many tests in biomedical diagnostics, the problem arises that the target molecules are at first not present in an amount sufficient for detection and therefore often first have to be amplified from the sample before the actual test procedure.
Typically, the amplification of DNA molecules is performed by means of the polymerase chain reaction (PCR). For the amplification of RNA, the RNA molecules have to be converted to

- 6 -correspondingly complementary DNA (cDNA) by means of reverse transcription.
Said cDNA
can then also be amplified by means of PCR. PCR is a standard laboratory method (like, for example, in Sambrook et al. (2001) Molecular Cloning: A laboratory manual, 3rd edition, Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press).
The amplification of DNA by means of PCR is comparatively fast, allows a high sample throughput in small setup volumes by means of miniaturized methods, and is efficient in operation due to automation.
However, a characterization of nucleic acids by means of mere amplification is not possible.
It is rather necessary to use analysis methods like nucleic acid sequence determinations, hybridization, and / or electrophoretic separation and isolation methods for the characterization of the PCR products subsequently to the amplification.
In general, devices and methods for the amplification of nucleic acids and their detection should be designed in such a way that as few experimenters' interventions as possible are required. The advantages of methods allowing multiplication of nucleic acids and their detection, and in the course of which the experimenter has to intervene only minimally, are obvious. On the one hand, contaminations are avoided. On the other hand, the reproducibility of such methods is substantially increased, as they are accessible to automation. This is also extremely important considering the legal admission of diagnostic methods.
At present, there are a multiplicity of methods for the amplification of nucleic acids and their detection, wherein first the target material is amplified by means of PCR
amplification and subsequently the identity or the genetic state of the target sequences is determined by means of hybridization against a probe array. In general, amplification of the nucleic acid molecules or the target molecules to be detected is necessary in order to have at one's disposal amounts sufficient for a qualitative and quantitative detection within the scope of the hybridization.
Both PCR amplification of nucleic acids and their detection by means of hybridization are subject to several elementary problems. This applies in the same manner to methods combining PCR amplification of nucleic acids and their detection by means of hybridization.

- 7 -If detectable markers, for example in the form of fluorescence labeled primers, are inserted into the nucleic acid molecules to be detected or target molecules to be detected in a method, which combines PCR amplification and its detection by means of hybridization, a washing step is usually performed before the actual detection. Such a washing step serves the removal of the non-converted primers, which are present in great abundance compared to the amplification product, as well as of such nucleotides equipped with a fluorescence marker, which do not participate in the detection reaction or do not specifically hybridize with the nucleic acid probes of the microarray. In this manner, the high-level signal background caused by these molecules is supposed to be reduced. However, such an additional procedure step considerably slows down the detection method. Furthermore, the detectable signal is considerably reduced also for those nucleic acids to be detected, which specifically hybridize with the nucleic acid probes of the microaiTay. The latter is largely based on the fact that the equilibrium between the targets bound by means of hybridization and the dissolved targets does not exist anymore after the washing step. Nucleic acids, which had already hybridized with the nucleic acid probes located on the array, are detached from the binding site by washing and are therefore washed away together with the dissolved molecules.
Altogether, there only remains a detectable signal, if the washing or rinsing step of the dissolved molecules is performed faster than the detachment of the nucleic acids already hybridized.
Therefore, there is a need for highly integrated arrays, wherein the interaction between probes and targets can be detected qualitatively and / or quantitatively with great precision and with comparatively little technical effort.
Furthermore, there is a need for devices which allow the performance of PCR
and analysis reaction, like for example a hybridization reaction, in one reaction space.
It is therefore a problem underlying the present invention to overcome the above-mentioned problems of the art, which in particular arise due to the lack of compatibility of the assay with the test system.
In particular, it is a problem underlying the present invention to provide methods and devices, respectively, wherein molecular interactions between probes and targets on probe arrays can

- 8 -be qualitatively and / or quantitatively detected with great precision and high sensitivity as well as in an easy-to-do and cost-efficient manner.
Furthermore, it is a problem underlying the present invention to provide methods and devices, respectively, for the amplification and for the qualitative and quantitative detection of nucleic acids, wherein experimenters' interventions in the detection procedure can be minimized.
It is a further problem underlying the present invention to provide methods and devices, respectively, for the qualitative and quantitative detection of nucleic acids, wherein a high signal-to-noise ratio in the detection of interactions on the microarray is ensured without impairing the interaction between the target molecules and the probe molecules on the array.
It is a further problem underlying the present invention to provide devices and methods, respectively, by means of which a high dynamic resolution in detection is achieved, i.e. the detection of weak probe / target interactions among strong signals remains ensured.
Furthermore, it is a problem underlying the present invention to provide devices and methods, respectively, which allow almost simultaneous amplification and characterization of nucleic acids at a high throughput rate.
These and further problems underlying the present invention are solved by means of providing the embodiments characterized in the patent claims.
According to the present invention, methods for the qualitative and / or quantitative detection of molecular interactions between probe molecules and target molecules are provided, wherein the replacement and / or the removal of solutions, i.e. in particular washing or rinsing steps, can be omitted.
Such methods according to the present invention in particular comprise the following steps:
a) feeding a sample containing target molecules into a reaction chamber having a microarray, wherein the microarray comprises a substrate onto which probe molecules are immobilized on array elements;

- 9 -b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate, wherein no replacement of solutions in the reaction chamber and / or removal of solutions from the reaction chamber is performed subsequently to feeding the sample containing target molecules as well as before and during the detection procedure.
Furthermore, devices are provided within the scope of the present invention, which are suitable for conducting such methods.
In particular, a device for the qualitative and / or quantitative detection of molecular interactions between probe and target molecules is provided within the scope of the present invention, comprising:
a) a microarray having a substrate, whereon probe molecules are immobilized on array elements, wherein the microarray is arranged on a first surface of the device;
and b) a reaction chamber, which is formed between the first surface with the microarray arranged upon it and a second surface, wherein the distance between the microarray and the second surface is variable.
In particular, the variability of the distance between microarray and second surface, which usually forms the detection plane of the device according to the present invention, allows that the signal background, which is caused by labeled target molecules, which do not have a specific affinity to the probe molecules of the microarray and therefore do not interact with them, is considerably reduced or entirely avoided.
Furthermore, according to the present invention, a method for the qualitative and / or quantitative detection of molecular interactions between probe and target molecules is provided, which comprises the following steps:
a) feeding a sample solution comprising target molecules into a reaction chamber of a device according to the present invention as described above; and b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate.

- 10 -The methods and devices according to the present invention for detecting target molecules are designed in such a way, that as few experimenters' interventions in the reaction chamber as possible are required for performing the detection method and, optionally, an amplification of the target molecules. This offers the essential advantage that contaminations are thereby avoided. Furthermore, the reproducibility of the methods according to the present invention is considerably increased compared to conventional methods, as the method according to the present invention is accessible to automation due to the minimization of external interventions. The above-mentioned advantages play an important role in terms of the admission of diagnostic methods.
In accordance with an aspect of the present invention there is provided a device for qualitatively and/or quantitatively detecting molecular interactions between probe molecules and target molecules, comprising:
a. a micro-array on a substrate, onto which probe molecules are immobilized on array elements, said micro-array being disposed on a first surface of the device; and b. a reaction chamber formed between the first surface including the micro-array disposed thereon and a second surface, the distance between said micro-array and the second surface being variable, wherein the first surface is configured at least in the zone below said micro-array such that said micro-array may be guided relative to the second surface so that the distance between said micro-array and the second surface is variable, and wherein the first surface is deformable at least in the zone below said micro-array.
In accordance with a further aspect of the present invention there is provided a method of qualitatively and/or quantitatively detecting molecular interactions between probe and target molecules, comprising the following steps:
a) introducing a probe solution containing target molecules into a reaction chamber having a microarray on a substrate onto which probe molecules are immobilized on array elements, said microarray being disposed on a first surface, wherein the reaction chamber is formed between the first surface including tghe microarray disposed thereon and a second surface, the distance between said microarray and the second surface being variable; and b) detecting an interaction between the target molecules and the probe molecules immobilized on said substrate, - 10a -wherein between introducing the probe containing target molecules in the reaction chamber and detecting, replacing solutions in the reaction chamber and/or removing solutions from the reaction chamber is avoided and wherein in step (b) the distance between said micro-array and second surface is varied such that the probe solution between said micro-array and second surface is essentially removed.
In accordance with an aspect of the present invention there is provided a device for qualitatively and/or quantitatively detecting molecular interactions between probe molecules and target molecules, the device comprising:
a. a micro-array on a substrate onto which probe molecules are immobilized on array elements, said micro-array being disposed on a first surface of the device; and b. a compressible reaction chamber formed between the first surface including the micro-array disposed thereon and a second surface, the distance between said micro-array and the second surface being variable, wherein the first surface is elastically deformable in at least a zone below said micro-array such that said micro-array disposed on the first surface is moveable towards the second surface to become flush with the second surface causing displacement of a sample solution containing labeled molecules that do not interact with the probe molecules before performing detection.
In accordance with a further aspect of the present invention there is provided a method for detection of molecular interactions between probe and target molecules comprising:
(a) introducing a sample solution comprising target molecules into a reaction chamber which is formed between a first surface having a microarray arranged thereon and a second surface, wherein the microarray comprises a substrate with array elements having probe moleucles immobilized thereon;
(b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate, wherein between introducing the sample solution comprising target molecules into the reaction chamber and detecting, no removal of solutions from the reaction chamber occurs, and wherein in step (b) the distance between the microarray and the second surface is varied such that the sample solution between the microarray and the second surface is essentially removed.

- 10b-In accordance with a further aspect of the present invention there is provided a device for qualitative and/or quantitative detection of molecular interactions between probe molecules and target molecules in a sample solution, comprising:
a microarray having probe molecules immobilized on array elements, wherein the microarray is arranged on a first surface of the device; and a reaction chamber which is formed between the first surface having the microarray arranged thereon and a second surface, wherein laterally limiting compensation zones are provided for the reaction chamber which keep the volume within the reaction chamber essentially constant upon reduction of the distance between the microarray and the second surface such that the sample solution between the microarray and the second surface is essentially removed, further wherein the first surface is elastically deformable at least in the zone below the microarray such that the microarray may be guided relative to the second surface so that the distance between the microarray and the second surface is variable such that the sample solution between the microarray and the second surface is essentially removed.
Furthermore, the following definitions are used, inter alio, for the description of the present invention:
Within the scope of the present invention, a probe or a probe molecule or a molecular probe is understood to denote a molecule, which is used for the detection of other molecules due to a particular characteristic binding behavior or a particular reactivity. Each type of molecules, which can be coupled to solid surfaces and have a specific affinity, can be used as probes laid out on the array. In a preferred embodiment, these are biopolymers, in particular biopolymers from the classes of peptides, proteins, antigens, antibodies, carbohydrates, nucleic acids, and / or analogs thereof and / or mixed polymers of the above-mentioned biopolymers.
Particularly preferably, the probes are nucleic acids and / or nucleic acid analogs. In particular, nucleic acid molecules of defined and known sequence, which are used for the detection of target molecules in hybridization methods, are referred to as probe. Both DNA
and RNA molecules can be used as nucleic acids. For example, the nucleic acid probes or oligonucleotide probes can be oligonucicotides having a length of 10 to 100 bases, preferably of 15 to 50 bases, and particularly preferably of 20 to 30 bases. Typically, according to the present invention, the probes are single-stranded nucleic acid molecules or molecules of nucleic acid analogs, preferably single-stranded DNA molecules or RNA
molecules having at - 10c -least one sequence region, which is complementary to a sequence region of the target molecules. Depending on detection method and use, the probes can be immobilized on a solid support substrate, for example in the form of a microarray. Furthermore, depending on the

- 11 -detection method, they can be labeled radioactively or non-radioactively, so that they are detectable by means of detection methods conventional in the state of the art.
Within the scope of the present invention, a target or a target molecule is understood to denote a molecule to be detected by means of a molecular probe. In a preferred embodiment of the present invention, the targets to be detected are nucleic acids. However, the probe array according to the present invention can also be used in an analogous manner for the detection of peptide / probe interactions, protein / probe interactions, carbohydrate /
probe interactions, antibody / probe interactions etc..
If, within the scope of the present invention, the targets are nucleic acids or nucleic acid molecules, which are detected by means of a hybridization against probes laid out on a probe array, said target molecules normally comprise sequences of a length of 40 to 10,000 bases, preferably of 60 to 2,000 bases, also preferably of 60 to 1,000 bases, particularly preferably of 60 to 500 bases and most preferably of 60 to 150 bases. Optionally, their sequence comprises the sequences of primers as well as the sequence regions of the template, which are defined by the primers. In particular, the target molecules can be single-stranded or double-stranded nucleic acid molecules, one or both strands of which are labeled radioactively or non-radioactively, so that they are detectable by means of a detection method conventional in the state of the art.
According to the present invention, a target sequence denotes the sequence region of the target, which is detected by means of hybridization with the probe. According to the present invention, this is also referred to as said region being addressed by the probe.
Within the scope of the present invention, a substance library is understood to denote a multiplicity of different probe molecules, preferably at least two to 1,000,000 different molecules, particularly preferably at least 10 to 10,000 different molecules, and most preferably between 100 to 1,000 different molecules. In special embodiments, a substance library can also comprise only at least 50 or less or at least 30,000 different molecules.
Preferably, the substance library is laid out in the form of an array on a support inside the reaction chamber of the device according to the present invention.

- 12 -Within the scope of the present invention, a probe array is understood to denote a layout of molecular probes or a substance library on a support, wherein the position of each probe is defined separately. Preferably, the array comprises defined sites or predetermined regions, so-called array elements, which are particularly preferably laid out in a particular pattern, wherein each array element usually comprises only one species of probes.
Herein, the layout of the molecules or probes on the support can be generated by means of covalent or non-covalent interactions. Herein, the probes are laid out at the side of the support facing the reaction chamber. A position within the layout, i.e. within the array, is usually referred to as spot.
Within the scope of the present invention, an array element, or a predetermined region, or a spot, or an array spot is understood to denote an area, which is determined for the deposition of a molecular probe, on a surface; the entirety of all occupied array elements is the probe array.
Within the scope of the present invention, a support element, or support, or substance library support, or substrate is understood to denote a solid body, on which the probe array is set up.
Support, usually also referred to as substrate or matrix, can for example denote an object support or a wafer or ceramic materials In a special embodiment, the probes can also be immobilized directly on the first surface, preferably on a partition of the first surface.
The entirety of molecules laid out in array layout on the substrate or on the detection surface, or the substance library laid out in array layout on the substrate or the detection surface and of the support or substrate is also often referred to as "chip", "microarray", "DNA chip", "probe array" etc..
Within the scope of the present invention, a detection plane is understood to denote the second surface of the device according to the present invention. Preferably, the probes laid out on the microarray are substantially located in the detection plane during detection of the interaction between probes and target, in particular due to the fact that the distance between microarray and second surface is reduced to approximately zero.

- 13 -Within the scope of the present invention, a chamber body is understood to denote the solid body forming the reaction chamber. The substance library support or the chip is usually part of the chamber body, wherein the substance library support can be made of a different material than the rest of the chamber body.
Within the scope of the present invention, a reaction chamber or a reaction space is understood to denote the space formed between microarray and second surface or detection plane and preferably designed as a variable capillary gap. The reaction space is laterally limited by side walls, which can, for example, be implemented as elastic seals. The probes immobilized on the microarray are located on the side facing the interior of the reaction chamber. The base of the reaction chamber or of the reaction space is defined by the first surface or the second surface of the array. In particular, the distance between second surface or detection plane and surface of the substrate or of the microarray is referred to as thickness of the reaction space or of the reaction chamber or of the capillary gap.
Within the scope of the present invention, a reaction space usually has only a small thickness, for example a thickness of at most 1 cm, preferably of at most 5 mm, particularly preferably of at most 3 mm and most preferably of at most 1 mm.
Within the scope of the present invention, the distance between the microarray and the second surface is understood to denote the distance between the surface of the microarray substrate, i.e. the side of the microarray facing the reaction space, and the side of the second surface facing the reaction space. If the distance between microarray and second surface is approximately zero, this means that the surface of the substrate rests evenly on the second surface.
Within the scope of the present invention, a capillary gap is understood to denote a reaction space, which can be filled by means of capillary forces acting between the microarray and the second surface. Usually, a capillary gap has a small thickness, for example of at most 1 mm, preferably of at most 750 gm and particularly preferably of at most 500 pm.
According to the present invention, a thickness in the range of 10 pm to 300 lam, of 15 1.1m to 200 i_tm and / or of 25 i.tm to 150 jim is preferred as thickness of the capillary gap. In special embodiments of the present invention, the capillary gap has a thickness of 50 gm, 60 gm, 70 gm, 80 gm or 90 !um. Within the scope of the present invention, if the reaction space or the reaction

- 14 -chamber has a thickness of more than 2 mm, the reaction space or reaction chamber will not be referred to as a capillary gap anymore.
Within the scope of the present invention, a cartridge or reaction cartridge is understood to denote the unit of the reaction chamber with a chamber body and a corresponding casing.
Within the scope of the present invention, a confocal fluorescence detection system is understood to denote a fluorescence detection system, wherein the object is illuminated in the focal plane of the objective by means of a point light source. Herein, point light source, object and point light detector are located on exactly optically conjugated planes.
Examples for confocal systems are described in A. Diaspro, Confocal and 2-photon-microscopy:
Foundations, Applications and Advances, Wiley-Liss, 2002.
Within the scope of the present invention, a fluorescence optical system imaging the entire volume of the reaction chamber is understood to denote a non-confocal fluorescence detection system, i.e. a fluorescence detection system, wherein the illumination by means of a point light source is not limited to the object. Such a fluorescence detection system therefore has no focal limitation.
Conventional arrays or microarrays within the scope of the present invention comprise about 50 to 10,000, preferably 150 to 2,000 different species of probe molecules on a, preferably square, surface of, for example, 1 mm to 4 mm x 1 mm to 4 mm, preferably of 2 mm x 2 mm.
In further embodiments within the scope of the present invention, microarrays comprise about 50 to about 80,000, preferably about 100 to about 65,000, particularly preferably about 1,000 to about 10,000 different species of probe molecules on a surface of several mm2 to several cm2, preferably about 1 mm2 to 10 cm2, particularly preferably 2 mm2 to 1 cm2, and most preferably about 4 mm2 to 6.25 mm2. For example, a conventional microarray has 100 to 65,000 different species of probe molecules on a surface of 2 mm x 2 mm.
Within the scope of the present invention, a label or a marker is understood to denote a detectable unit, for example a fluorophore or an anchor group, whereto a detectable unit can be coupled.

- 15 -Within the scope of the present invention, an amplification reaction usually comprises 10 to 50 or more amplification cycles, preferably about 25 to 45 cycles, particularly preferably about 40 cycles. Within the scope of the present invention, a cyclic amplification reaction preferably is a polymerase chain reaction (PCR).
Within the scope of the present invention, an amplification cycle denotes a single enhancing step of the cyclic amplification reaction. An enhancing step of the PCR is also referred to as PCR cycle.
Within the scope of the present invention, an amplification product denotes a product resulting from the enhancement or the copying or the amplification of the nucleic acid molecules to be amplified by means of the cyclic amplification reaction, preferably by means of the PCR. A nucleic acid molecule amplified by means of PCR is also referred to as PCR
product.
Within the scope of the present invention, the denaturation temperature is understood to denote the temperature at which double-stranded DNA is separated in the amplification cycle.
Usually, the denaturation temperature, in particular in a PCR, is higher than 90 C, preferably about 95 C.
Within the scope of the present invention, the annealing temperature is understood to denote the temperature at which the primers hybridize to the nucleic acid to be detected. Usually, the annealing temperature, in particular in a PCR, lies in a range of 50 C to 65 C
and preferably is about 60 C.
Within the scope of the present invention, the chain extension temperature or extension temperature is understood to denote the temperature at which the nucleic acid is synthesized by means of insertion of the monomer components. Usually, the extension temperature, in particular in a PCR, lies within a range of about 68 C to about 75 C and preferably is about 72 C.
Within the scope of the present invention, an oligonucleotide primer or primer denotes an oligonucleotide, which binds or hybridizes the DNA to be detected, also referred to as target

- 16 -DNA, wherein the synthesis of the complementary strand of the DNA to be detected in a cyclic amplification reaction starts from the binding site. In particular, primer denotes a short DNA or RNA oligonucleotide having preferably about 12 to 30 bases, which is complementary to a portion of a larger DNA or RNA molecule and has a free 3-0H
group at its 3'-end. Due to said free 3'0H group, the primer can serve as substrate for any optional DNA or RNA polymerases, which synthesize nucleotides to the primer in 5'-3'-direction.
Herein, the sequence of the newly synthesized nucleotides is predetermined by that sequence of the template hybridized with the primer, which lies beyond the free 3'0H
group of the primer. Primers of conventional length comprise between 12 and 50 nucleotides, preferably between 15 and 30 nucleotides.
A double-stranded nucleic acid molecule or a nucleic acid strand serving as template for the synthesis of complementary nucleic acid strands is usually referred to as template or template strand.
Within the scope of the present invention, a molecular interaction or an interaction is understood to denote a specific, covalent or non-covalent bond between a target molecule and an immobilized probe molecule. In a preferred embodiment of the present invention, the interaction between probe and target molecules is a hybridization.
The formation of double-stranded nucleic acid molecules or duplex molecules from complementary single-stranded nucleic acid molecules is referred to as hybridization. Herein, the association preferably always occurs in pairs of A and T or G and C.
Within the scope of a hybridization, for example DNA-DNA duplexes, DNA-RNA duplexes, or RNA-RNA
duplexes can be formed. By means of a hybridization, duplexes with nucleic acid analogs can also be formed, like for example DNA-PNA duplexes, RNA-PNA duplexes, DNA-LNA
duplexes, and RNA-LNA duplexes. Hybridization experiments are usually used for detecting the sequence complementarity and therefore the identity of two different nucleic acid molecules.
Within the scope of the present invention, processing is understood to denote purification, concentration, labeling, amplification, interaction, hybridization, and / or washing and rinsing

- 17 -steps as well as further method steps performed when detecting targets with the aid of substance libraries. Detection itself does not fall under the term processing.
Within the scope of the present invention, a sample or sample solution or analyte or solution is a liquid to be analyzed, which in particular contains the target molecules to be detected and, optionally, to be amplified. Furthermore, beside conventional additives such as, for example, buffers, such a solution can, inter alia, also contain substances required for performing amplification reactions, like primers.
Within the scope of the present invention, a replacement of solutions in the reaction chamber from the reaction chamber refers, in particular, to rinsing or washing steps.
A replacement of solutions serves, for example, for removing molecules labeled with detectable markers, which do not specifically interact with probes on the microarray, by means of replacing the sample solution with a non-labeled solution subsequently to the completed interaction. Molecules not specifically interacting with probes on the microarray are, for example, primers labeled with a detectable marker, which have not been converted during the amplification reaction, or target molecules labeled with a detectable marker, which do not have a complementary probe on the array, which specifically interacts with said target molecule.
Within the scope of the present invention, a removal of solutions from the reaction chamber is understood to denote steps, by means of which molecules labeled with detectable markers, which do not specifically interact with probes on the microarray, are removed from the reaction chamber. Molecules not specifically interacting with probes on the microarray are, for example, primers labeled with a detectable marker, which have not been converted during the amplification reaction, or target molecules labeled with a detectable marker, which do not have a complementary probe on the array, which specifically interacts with said target molecule.
If, within the scope of the present invention, no replacement of solutions in the reaction chamber and / or removal of solutions from the reaction chamber is performed between feeding of the sample containing target molecules into a reaction chamber and detecting the interaction, it is, however, conceivable that during this time period solutions can additionally

- 18 -be fed into the reaction chamber without performing replacement or removal of the solutions already present in the reaction chamber.
Thus, a first object of the present invention comprises a method for qualitatively and / or quantitatively detecting molecular interactions between probes and target molecules comprising, in particular, the following steps:
a) feeding a sample containing target molecules into a reaction chamber having a microarray, wherein the microarray comprises a substrate onto which probe molecules are immobilized on array elements;
b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate, wherein subsequently to charging the sample containing target molecules and before or during detection no replacement of solutions in the reaction chamber and / or removal of solutions from the reaction chamber is performed.
In this aspect of the present invention, it is a substantial characteristic of the method according to the present invention that the detection of an interaction between the target molecules to be detected and the probe molecules immobilized on the substrate of the microarray is performed without replacing solutions in the reaction chamber or removing solutions from the reaction chamber. I.e., detecting the interaction between targets and probes can be performed without rinsing or washing steps being required subsequently to the interaction reaction and / or without molecules, which do not specifically interact with probes on the microarray, being removed from the reaction chamber subsequently to the interaction reaction.
In the method according to the present invention, this can, in particular, be ensured by means of foci-selective detection methods, like for example by means of confocal techniques or by means of the evanescent de-coupling of excitation light (TIRF) in the sample substrate based on the use of a depth-selective illumination due to, for example, total reflection, or the use of methods based on waveguides. Such foci-selective methods are to be particularly preferred in cases when a further exclusion of the background signals caused by the fluorescence molecules present in the liquid, i.e. not hybridized, in order to increase sensitivity. With the use of fluorescence-labeled target molecules, the specific interaction signals can thus be

- 19 -discriminated from the background fluorescence by the use of methods like total internal reflection fluorescence microscopy (TIRF) or confocal fluorescence microscopy.
Examples for this are CCD-based detectors, which implement the excitation of the fluorophores in the dark field by means of incident light or transmitted light for the purpose of discriminating optical effects like dispersion and reflections (see for example C. E. Hooper et al., Quantitative Photone Imaging in the Life Sciences Using Intensified CCD
Cameras, Journal of Bioluminescence and Chemoluminescence (1990), 337-344). Further alternatives for fluorescence detection systems, which can be used in the method according to the present invention, are white light setups, like for example described in WO 00/12759, WO 00/25113, and WO 96/27025; confocal systems, like for example described in US 5,324,633, US 6,027,880, US 5,585,639, and WO 00/12759; confocal excitation systems based on Nipkow discs in confocal imaging, as for example described in US 5,760,950;
systems based on structured excitation distribution, as for example described in WO
98/57151; large-scale integrated fluorescence detection systems using micro-optics, like for example described in WO 99/27140; and laser scanning systems, as for example described in WO
00/12759. A
general progression of fluorescence detection methods using such conventional fluorescence detection systems is, for example, described in US 5,324,633.
The devices described in WO 2004/087951, wherein the reaction chamber is formed by a capillary gap, are particularly suitable for performing a detection method according to the present invention without replacing solutions in the reaction chamber and / or removing solutions from the reaction chamber. The relevant contents of WO 2004/087951 are hereby explicitly referred to.
In a further embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by performing the detection by means of detecting the mass alteration on the array surface, as described, for example, in WO
03/004699. The relevant contents of WO 03/004699 are hereby explicitly referred to.
In a further embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by performing the detection by means of

- 20 -detecting acoustic surface waves, as is described, for example, in Z.
Guttenberg et al., Lab Chip. 2005; 5(3):308-17.
In a further embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by performing the detection by means of electrochemical detection via electrodes on the surface of the array, like, for example, by means of measuring the alteration of redox potentials (see, for example, X.
Zhu et al., Lab Chip. 2004; 4(6):581-7) or cyclic voltometry (see, for example, J. Liu et al., Anal Chem.
2005; 77(9):2756-2761; J. Wang, Anal Chem. 2003; 75(15):3941-5).
In a further embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by performing the detection by means of electric detection via electrodes on the surface of the array, like, for example, by means of impedance measurement (see, inter alia, S.M. Radke et al., Biosens Bioelectron. 2005;
20(8):1662-7).
In a further embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by employing a microarray having FRET
probes (FRET,fluorescence resonance energy transfer). The use of such FRET
probes is based on the formation of fluorescence quencher pairs, so that a fluorescence signal only occurs, if a target molecule has bound to the complementary probe on the surface. The use of FRET probes is, for example, described in B. Liu et al., PNAS 2005, 102, 3, 589-593; K. Usui et al., Mol Divers. 2004; 8(3):209-18; J.A. Cruz-Aguado et al., Anal Chem.
2004;
76(14):4182-8 and J. Szollosi et al., J Biotechnol. 2002;82(3):251-66.
In a further particularly preferred embodiment of this aspect of the present invention, replacing and / or removing solutions from the reaction chamber is avoided by employing a device according to the present invention, as is described in detail in the following, for qualitatively and / or quantitatively detecting molecular interactions between probe and target molecules, wherein said device comprises:
a) a microarray having a substrate, onto which probe molecules are immobilized on array elements, wherein the microarray is arranged on a first surface of the device;
and

- 21 -b) a reaction chamber formed between the first surface, whereon the microarray is arranged, and a second surface, and wherein the distance between the microarray and the second surface is variable.
A further object of the present invention relates to the use of FRET probe molecules, as described above, and / or detection methods selected from the group consisting of total internal reflection fluorescence microscopy (TIRF), as described above, confocal fluorescence microscopy, as described above, methods for detecting mass alterations, as described above, methods for detecting acoustic surface waves, as described above, methods for the electrochemical and / or electric detection, as described above, for avoiding replacement of solutions in a reaction chamber and / or removal of solutions from a reaction chamber during or after feeding a sample containing target molecules into the reaction chamber and before or during the detection in a method for qualitatively and / or quantitatively detecting molecular interactions between probe and target molecules, in particular comprising the following steps:
a) feeding a sample containing target molecules into a reaction chamber having a microarray, wherein the microarray comprises a substrate, onto which probe molecules are immobilized on array elements;
b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate.
A further object of the present invention is, in particular, a device for qualitatively and / or quantitatively detecting molecular interactions between probe and target molecules, comprising:
a) a microarray having a substrate, onto which probe molecules are immobilized on array elements, wherein the microarray is arranged on a first surface of the device;
and b) a reaction chamber formed between the first surface, on which the microarray is arranged, and a second surface, wherein the distance between the microarray and the second surface is variable.
Subsequently to the completed interaction between probe molecules and target molecules, an undesired background is caused by the labeled molecules present in the sample solution, which do not interact with the probe molecules. In case the probe and / or target molecules are

- 22 -nucleic acids and / or nucleic acid analogs, said background is caused, in particular, by the labeled primers and / or labeled nucleic acids present in the sample solution, which are not hybridized with the probe molecules.
A known possibility of removing disturbing background signals is the replacement of the sample solution after completed interaction with a non-labeled, for example non-fluorescent, solution. However, this variant is generally lavish and prone to interference owing to corrosion, aging of the solutions and impermeability problems.
It is a substantial characteristic of the device according to the present invention that the distance between the microarray and the second surface is variable. Variable distance between microarray and second surface means that the reaction chamber of the device according to the present invention is compressible. In particular, the distance between microarray and second surface is variable in such a way that the microarray can rest evenly and / or reversibly on the second surface, or can be pressed onto said surface, with its active side, i.e. the side, onto which the nucleic acid probes are immobilized.
A compressible reaction chamber therefore allows displacement of sample solution containing labeled molecules, which do not interact with the probe molecules and therefore constitute an undesired background, by reducing the distance between microarray and detection plane before performing the detection. In this manner, a detection of interactions between probe and target molecules using any optical detection systems is possible without replacing the sample solution with a non-labeled solution before the detection. For example, simple fluorescence-microscopic imaging of the DNA chip for detecting the interaction signals by means of the device according to the present invention without replacing the sample solution with a non-labeled, in particular weakly fluorescent, liquid, is possible.
It is finally ensured, in particular by means of the embodiments of the device according to the present invention described in the following, that focusing of optical detection systems is not necessary anymore. Thus, the device according to the present invention allows, for example, the use of a simple fluorescence microscope device without autofocus function as reading device for the detection of the hybridization between targets and probes without necessitating liquid-handling steps like, in particular, washing steps, for removing target molecules not

- 23 -bound to the array, like for example non-hybridized target nucleic acids, contrarily to the fluorescence-optical detection systems hitherto used for the detection of nucleic acids.
Despite multifunctional sample treatment and analysis, which is feasible by means of the device according to the present invention, a very cost-efficient system for detecting and, optionally, amplifying target molecules in a sample is provided. The devices according to the present invention, in particular in connection with an optical detection system, are furthermore robust to such an extent that they are also suitable for mobile use.
By means of suitably selecting chip, processing protocols, and analysis chemicals, the device according to the present invention can be employed for the most different types of gene analyses, like for example predisposition diagnostics, germ diagnostics and typing. Thus, a complete genetic analysis is conductible with little equipment effort in the device according to the present invention, which can also be implemented as a disposable cartridge. Therefore, the device according to the present invention allows performing detection methods on-site, for example during blood donation. A measured result can be quickly obtained, preferably within 0.5 to 2 hours. All the steps practicable with the device according to the present invention, like purification, processing, amplification of nucleic acids, and the actual hybridization can be conducted automatically. The operator only needs to be familiar with sample withdrawal, sample feeding into the device according to the present invention, and taking notice of the analysis results.
Preferably, the distance between the microarray and the second surface is variable in a range of about 0 to about 1 mm. Further preferred lower limits for the distance between microarray and second surface are about 0.1 pm, about 1 um, and about 10 um. Further preferred upper limits for the distance between microarray and second surface are about 0.01 mm, about 0.5 mm, about 1 mm and most preferably about 0.3 mm. Surprisingly, the interaction between probes and targets on the array surface is not even affected if the distance between substrate surface and second surface is approximately zero or about zero.
Preferably, the device according to the present invention further comprises a detection system.
Herein, it is preferred that the detection system is an optical system.
Examples for systems suitable within the scope of the present invention are detection systems based on fluorescence,

- 24 -optical absorption, resonance transfer, and the like. Preferably, the optical detection system is a fluorescence-optical system. Particularly preferably, the fluorescence-optical system is a fluorescence microscope without autofocus, for example a fluorescence microscope with fixed focus.
In a further embodiment, the detection system is connected with at least one spacer, which adjusts a distance between the detection system and the second surface when resting upon the second surface. If the distance between microarray and second surface is about zero, the spacer also determines the distance between the surface of the chip and the optical system of the detection device. It is thus possible to keep the variance of the distance between optical detection device and microarray surface very small. The variance only comprises the thickness variance of the second surface, in general a glass surface, the deflection of the second surface, and the thickness of a layer caused by possible impurities at the pressing surfaces between chip and detection plane or between spacer and detection plane. This renders re-focusing for bringing the optical system into focus unnecessary, which considerably simplifies the operation of the device and / or renders an expensive autofocus installation unnecessary.
In a further embodiment, laterally limiting compensation regions, which keep the volume in the reaction chamber basically constant when the distance between microarray and second surface is reduced, are provided for the reaction space formed between the first and the second surface.
Preferably, the reaction space formed between the first and the second surface is furthermore laterally limited by elastic seals. Particularly preferably, the elastic seals are made of silicone rubber.
In order to ensure the detection of interactions between probe and target molecules, the second surface is, in particular, made of an optically transparent material, preferably glass.
In a further embodiment of the device according to the present invention, the first surface is, at least in the region below the microarray, developed in such a way that the microarray can

- 25 -be guided relatively to the second surface in such a way that the distance between the microarray and the second surface is variable.
Herein, the first surface can, at least in the region below the microarray, be developed in such a way that the microarray can be guided in the direction toward the second surface so that the distance between the microarray and the second surface can be reduced and / or that the microarray can be guided in a direction away from the second surface so that the distance between the microarray and the second surface can be increased.
In this embodiment, it is preferred that the first surface can, at least in the region below the microarray, be elastically deformed. Particularly preferably, the first surface is made of an elastic synthetic material, for example an elastic membrane.
It can further be preferred that the first surface is formed by two superimposed layers, wherein an outer layer of the two superimposed layers has a recess at least in the region below the microarray. In this embodiment, it is preferred that an inner layer of the two superimposed layers is formed by an elastic seal or a sealing membrane, which usually also limits the reaction space laterally (see Figure 6). The sealing membrane can be guided toward the second surface. The sealing membrane closes a recess in the outer layer, which usually corresponds to the lower side of the chamber body. During the performance of a PCR in the reaction chamber, an internal pressure, which renders the reaction chamber pressure-resistant despite the relatively labile sealing membrane, is generated due to the higher temperatures prevailing in a PCR. This embodiment thus corresponds to a self-closing valve.
In order to ensure the elasticity of the sealing membrane, the membrane is preferably provided with a compensation fold (see Figure 6).
It can further be provided that the device comprises at least one means, by means of which the microarray can be guided relatively to the second surface. In the following, said means will be referred to as means for guiding the first surface. Said means for guiding the first surface is preferably selected from the group consisting of a rod, a pin, a tappet, and a screw.
Herein, the device can comprise at least one means for guiding the first surface, by means of which the microarray can be guided toward the second surface in such a way that the distance

- 26 -between the microarray and the second surface can be reduced and / or by means of which the microarray can be guided away from the second surface in such a way that the distance between the microarray and the second surface can be increased.
Particularly preferably, the microarray can be guided relatively to the second surface by means of pressure and / or traction, which is exerted on the first surface by the means.
Herein, the above-mentioned spacers resting on the second surface can serve as holders for the means for guiding the first surface.
It can further be preferred that the first surface can be caused to vibrate by the means for guiding the first surface, in particular to vibrate at a frequency of 10 to 30 Hz, particularly preferably of about 20 Hz. In this manner, bubbles present above the chip, which would impede a detection, can be removed and / or the interaction speed, for example the hybridization speed, can be increased by a thorough mixing owing to the vibration of the means for guiding the first surface.
It can also be preferred that the second surface can be guided relatively to the first surface in such a way that the distance between the microarray and the second surface is variable.
Herein, the second surface can be guided relatively to the first surface in such a way that the distance between the microarray and the second surface can be reduced and / or that the distance between the microarray and the second surface can be increased.
In particular, this can be ensured by the second surface being guidable relatively to the first surface by means of the spacer exerting pressure and / or traction on the second surface, such that the distance between the microarray and the second surface is variable.
In a further preferred embodiment of the device according to the present invention, both the first surface and the second surface can be guided in such a way that the distance between the microarray and the second surface is variable.

- 27 -In a further embodiment, the device according to the present invention is developed in such a way that, already in the original state, the microarray mounted on the first surface rests, preferably evenly, on the second surface forming the detection plane. The first surface can be guided in such a way that the distance between the microarray and the second surface can be increased. Herein, the first surface is preferably made of an elastic material.
In a further embodiment of the device according to the present invention, the first surface is developed in a pivotable manner around a rotation axis. The rotation axis divides the first surface into two sides. In this embodiment, the microarray is arranged on a first flanking portion of the first surface. Preferably, the rotation axis for the swiveling motion runs through the center of the first surface, i.e. the two flanking portions preferably are of equal size. The first surface is preferably made of an elastic material.
In a first position of the pivotable first surface, the first surface is arranged basically parallel to the second surface. In the first position, the surface of the microarray contacts the second surface basically evenly, i.e. the substrate surface with the probe molecules immobilized thereon is basically not moistened by the sample solution. In said first position, a space, which is also referred to as processing chamber in the following, is formed between the second flanking portion of the first surface and the second surface. Said processing chamber can serve as chamber for processing the sample solution.
In a second position of the pivotable first surface, the first surface is arranged at an angle other than 180 in relation to the second surface. In said second position, the surface of the microarray does not contact the second surface, i.e. the probe molecules immobilized on the substrate of the microarray are freely accessible for the target molecules present in the sample solution and can therefore interact with the latter. In the second position, the processing chamber is compressed.
The pivotable first surface can preferably be swiveled by means of exerting traction on the first flanking portion of the first surface and / or by means of exerting pressure on the second flanking portion of the first surface. Pressure and / or traction can be exerted by means of a means for guiding the first surface, as described above.

- 28 -The chip or the substrate or the first surface can preferably consist of silicon, ceramic materials like aluminum oxide ceramics, borofloat glasses, quartz glass, single-crystal CaF2, sapphire discs, topaz, PMMA, polycarbonate, and / or polystyrene. The selection of the materials is also to be made dependent on the intended use of the device or the chip. If, for example, the chip is used for characterizing PCR products, only those materials may be used, which can resist a temperature of 95 C.
Preferably, the chips are functionalized by means of nucleic acid molecules, in particular by means of DNA or RNA molecules. However, they can also be functionalized by means of peptides and / or proteins, like for example antibodies, receptor molecules, pharmaceutically active peptides, and / or hormones, carbohydrates and / or mixed polymers of said biopolymers.
In a further preferred embodiment, the molecular probes are immobilized on the substrate surface via a polymeric linker, for example a modified silane layer. Such a polymeric linker can serve for the derivative preparation of the substrate surface and therefore for the immobilization of the molecular probes. In the case of covalent binding of the probes, polymers, for example silanes, are used, which have been functionalized or modified by means of reactive functionalities like epoxides or aldehydes. Furthermore, the person skilled in the art is also familiar with the activation of a surface by means of isothiocyanate, succinimide, and imido esters. To this end, amino-functionalized surfaces are often correspondingly derivatized. Furthermore, the addition of coupling reagents, like for example dicyclohexylcarbodiimide, can ensure corresponding immobilizations of the molecular probes The chamber body of the reaction chamber preferably consists of materials like glass, synthetic material, and / or metals like high-grade steel, aluminum, and brass. For its manufacturing, for example synthetic materials suitable for injection molding can be used.
Inter alia, synthetic materials like macrolon, nylon, PMMA, and teflon are conceivable. In special embodiments, electrically conductive synthetic materials like polyamide with 5 to 30% carbon fibers, polycarbonate with 5 to 30% carbon fibers, polyamide with 2 to 20% stainless steel fibers, and PPS with 5 to 40% carbon fibers and, in particular, 20 to 30% carbon fibers are preferred. Alternatively and / or in addition, the reaction space between first and second surface can be closed by means of septa, which, for example, allow filling of'

- 29 -the reaction space by means of syringes. In a preferred embodiment, the chamber body consists of optically transparent materials like glass, PMMA, polycarbonate, polystyrene, and / or topaz. Herein, the selection of materials is to be adjusted to the intended use of the device. For example, the temperatures the device will be exposed to are to be considered when selecting the materials. If, for example, the device is to be used for performing a PCR, for example, only those synthetic materials may be used, which remain stable for longer periods at temperatures like 95 C.
In particular, the chamber body is developed in such a way that the microarray can be pressed against the second surface evenly and / or reversibly with its active side, i.e. the side of the array, whereon the nucleic acid probes are immobilized.
In a special embodiment, the device according to the present invention comprises modules selected from the group consisting of a chamber body, preferably made of a synthetic material, a septum or a seal sealing the reaction chamber, a DNA chip, and /
or a second optically transparent surface, preferably a glass pane, wherein the second surface can optionally also serve as chip simultaneously (see Figure 2 and Figure 3). In this embodiment, chamber body and seal are developed elastically, so that the DNA chip can be pressed evenly and reversibly to the glass cover with its active side. Thereby, the labeled analysis liquid located between DNA chip and detection surface is entirely displaced (see Figure 5 and Figure 6). In this manner, a highly sensitive fluorescence detection, for example a computer-imaging fluorescence microscopy, can be conducted without being impaired by a background fluorescence of the sample solution,.
Preferably, the second surface of the chamber body consists of transparent materials like glass and / or optically permeable synthetic materials, for example PMMA, polycarbonate, polystyrene, or acryl.
Preferably, the reaction chamber is developed between the second surface and the microarray in the form of a capillary gap having variable thickness. By forming a capillary gap between chip and detection plane, capillary forces can be utilized for safely filling the reaction chamber. Said capillary forces already occur in the non-compressed state of the reaction

- 30 -chamber; they can, however, be increased by compressing the reaction chamber.
Particularly preferably, the capillary gap has a thickness in the range of about 0 i.tm to about 100 [tm.
From the possibility of being able to compress the reaction space and therefore to reduce the width of the gap between microarray and detection plane, further possibilities of handling the liquid within the reaction chamber arise. Thus, in a further embodiment of the present invention, several sub-chambers are provided instead of one single chamber, wherein the partitions between said sub-chambers do not reach the height of the second surface, so that a fluid connection is generated between the sub-chambers in a non-compressed state of the reaction chamber. By compressing the reaction chamber, the chambers can be separated.
Thus, by compressing, the partitions between the chambers can be operated like valves.
A special embodiment of said sub-chambers separated by valves is the subdivision of the reaction space of the device according to the present invention into different PCR chambers.
In each chamber, individual primers are presented. In the beginning, the sub-chambers are simultaneously filled with the analyte. Subsequently, the reaction space is compressed. After that, the reaction space is subjected to the temperature cycle for the PCR. As each sub-chamber is filled with different primers, a different amplification reaction takes place in each chamber. An exchange between the chambers does not occur.
After the PCR has been conducted, hybridization takes place. Herein, each sub-chamber can contain an individual chip region or an individual chip. However, it is also possible to facilitate a fluid connection between the sub-chambers by increasing the distance between microarray and second surface, so that the different substances to be amplified mix and in this manner hybridize to a chip surface.
The advantage of this embodiment having sub-chambers separated by valves is the increase in multiplexity of the PCR, i.e. the number of independent PCRs with one sample, which is limited for biochemical reasons in a one-stage reaction. Thus, it is possible to adjust the number of PCRs to the possible number of probes on the chip surface.
In a further embodiment of the present invention, the reaction chamber thus comprises at least two sub-chambers, wherein in a first non-compressed state the sub-chambers are in fluid

-31 -connection and in a second compressed state there is no fluid connection between the sub-chambers.
Particularly preferably, each sub-chamber is assigned to a defined region of the microarray.
In particular, the sub-chambers can be formed by equipping the microarray and / or the second surface with cavities, which serve as walls between the sub-chambers.
Particularly preferably, the walls between the sub-chambers are formed by elastic seals.
Of course, this embodiment of the process unit having sub-chambers separated by valves can arbitrarily be combined with any of the above-described compression principles.
In a further embodiment of the device according to the present invention, the first surface is made of a partially deformable elastic material, for example an elastic membrane. In that only a part of the reaction space can be compressed, sub-chambers, wherein the chip is guided toward the second surface, sub-chambers, which cannot be separated from each other, and sub-chambers, which cannot be altered, can, inter alia, be generated. Thereby, simple pump systems, which can, for example, be used for pumping salts into the hybridization chamber at the end of an amplification reaction, can be implemented in the reaction space. This can, for example, be advantageous for optimizing the chemical hybridization conditions of the PCR
buffer, wherein the PCR buffer is optimized only for the conduction of the PCR.
When subdividing the reaction chamber into several sub-chambers, it is preferred to use several means for agitating. Usually, the means for agitating are identical with the means for guiding the first surface. Thereby, individual chambers can be specifically agitated. This can, for example, be appropriate for implementing separate amplification spaces and / or hybridization spaces.
Of course, this embodiment of the device according to the present invention having several means for agitating can also be arbitrarily combined with any of the above-described compression principles.

- 32 -The above-described components or modules of the device according to the present invention selected from the group consisting of a chamber body, seals laterally limiting the reaction space, micro-array, and detection plane form the so-called process unit of the device according to the present invention. In the process unit, PCR, hybridization reactions, detection and / or evaluation can be conducted. This is similarly true for probes and targets being, for example, antibodies and proteins to be detected, thus a PCR does not have to be carried out.
However, the following explanations are particularly done with regard to detection techniques using nucleic acid targets and ¨probes. However, it is clear to the person skilled in the art how to modify the units described in the following to adapt them for other applications.
Preferably, the process unit of the device according to the present invention is constructed in a modular manner. This means that the process unit can comprise any arbitrary combination of the modules. The modules can also be exchanged during analysis.
In a further preferred embodiment, the device according to the present invention in addition comprises a temperature controlling and / or regulating unit for controlling and / or regulating the temperature in the reaction chamber. Such a temperature controlling and /
or regulating unit for controlling and / or regulating the temperature in the reaction chamber in particular comprises heating and / or cooling elements or temperature blocks. Herein, the heating and / or cooling elements or the temperature blocks can be arranged in such a way that they contact the first surface and / or the second surface. By means of contacting both the first and the second surface, particularly efficient temperature controlling and regulating is ensured.
In this embodiment, the substrate of the microarray or the first surface and /
or the second surface is connected with heating and / or cooling elements and / or temperature blocks and should then preferably consist of materials with good heat-conducting properties. Such heat conductive materials offer the considerable advantage of ensuring a homogenous temperature profile throughout the entire surface of the reaction space and therefore allowing temperature-dependent reactions, like for example a PCR, to be conducted homogenously throughout the entire reaction chamber, delivering high yields, and controllably or regulatably with high exactness.

- 33 -Thus, in a preferred embodiment, the substrate of the microarray or the first surface or the second surface consist of materials having a good heat conductivity, preferably having a heat conductivity in a range of 15 to 500 Wm-IK-1, particularly preferably in a range of 50 to 300 Wm-IK-1, and most preferably in a range of 100 to 200 Wm-IK-1, wherein the materials are usually not optically transparent. Examples for suitable heat conductive materials are silicon, ceramic materials like aluminum oxide ceramics, and / or metals like high-grade steel, aluminum, copper, or brass.
If the substrate of the microarray or the first surface or the second surface of the device according to the present invention substantially consists of ceramic materials, the use of aluminum oxide ceramics is preferred. Examples for such aluminum oxide ceramics are the ceramics A-473, A-476, and A-493 by Kyocera (Neuss, Germany).
Preferably, the substrate of the microarray or the first surface or the second surface is equipped with optionally miniaturized temperature sensors and / or electrodes or has heater structures on its back side, i.e. the side facing away from the reaction chamber, so that tempering the sample liquid and mixing the sample liquid by means of an induced electro-osmotic flow is possible.
The temperature sensors, for example, can be developed as nickel-chromium thin film resistance temperature sensors.
The electrodes, for example, can be developed as gold-titanium electrodes and, in particular, as quadrupole.
The heating and / or cooling elements can preferably be selected in such a way that fast heating and cooling of the liquid in the reaction chamber is possible. Herein, fast heating and cooling is understood to denote that temperature alterations in a range of 0.2 K / s to 30 K / s, preferably of 0.5 K / s to 15 K / s, particularly preferably of 2 K / s to 15 K / s, and most preferably of 8 K / s to 12 K / s or about 10 K / s can be mediated by the heating and / or cooling elements. Preferably, temperature alterations of 1 K / s to 10 K / s can also be mediated by the heating and / or cooling elements.

- 34 -The heating and / or cooling elements, for example resistance heaters, can, for example, be developed as nickel-chromium thin film resistance heaters.
For further details on the specification and dimension of the temperature sensors, heating and / or cooling elements or means for increasing the temperature and of the electrodes, it is referred to the contents of the International Patent Application WO 01/02094.
In a preferred embodiment, tempering of the reaction chamber is ensured by using a chamber body consisting of electrically conductive material. Such an electrically conductive material is preferably an electrically conductive synthetic material, like for example polyamide, optionally having 5 to 30% carbon fibers, polycarbonate, optionally having 5 to 30% carbon fibers, and / or polyamide, optionally having 2 to 20% stainless steel fibers.
Preferably, PPS
(polyphenylenesulfide) with 5 to 40% carbon fibers, particularly preferably 20 to 30% carbon fibers, is used as electrically conductive synthetic material. It is further preferred that the chamber body is developed in such a way that it has swellings and tapers. Such swellings or tapers in the chamber body allow specific heating of the reaction chamber or the corresponding surfaces. Furthermore, the use of such volume conductors has the advantage that, also with optionally lower heat conductivity of the material used, homogenous tempering of the chamber or the corresponding surfaces is ensured, as heat is released in each volume element.
Coupling and educing heat into the reaction space can be conducted in different ways. Inter alia, it is intended to bring in heat via external microwave radiation, internal or external resistance heating, internal induction coils or surfaces, water cooling and heating, friction, irradiation with light, in particular with IR light, air cooling and / or heating, friction, temperature emitters, and peltier elements.
Measuring the temperature in the reaction space can be conducted in different ways, for example by means of integrated resistance sensors, semi-conductor sensors, light waveguide sensors, polychromatic dyes, polychromatic liquid crystals, external pyrometers like IR
radiation and / or temperature sensors of all types, which are integrated in the means for guiding the microarray.

- 35 -Measuring the temperature in the reaction chamber can furthermore be conducted by means of integrating a temperature sensor in the chamber body, for example by means of injection in the course of the production process of the chamber body, by means of non-contact measurement with the aid of a pyrometer, an IR sensor, and / or thermopiles, by means of contact measurement, for example with a thermal sensor integrated in the device and contacting a suitable surface or a suitable volume of the chamber body or the chamber, by means of measuring the temperature-dependent alteration of the refraction index at the detection plane, by means of measuring the temperature-dependent alteration of the color of specific molecules, for example in the solution, on the probe array, or in the chamber seal, and / or by means of measuring the temperature-dependent alteration of the pH-value of the solution used by means of measuring the color alteration of a pH-sensitive indicator, for example by means of measuring its absorption.
Furthermore, automatic limitation of temperature can occur due to a surge of the resistance of the heater, wherein the corresponding threshold temperature preferably lies in a range of 95 C
to 110 C. When reaching the threshold temperature, the resistance of the heater surges, whereby virtually no current flows and therefore virtually no heat is emitted anymore. In particular, polymers, like electrically conductive polyamides, whose resistance increases at the threshold temperature due to the alteration of the matrix of the polymer or a phase alteration, can be used for such heaters.
In one embodiment, the temperature controlling and regulating unit can be integrated in the first surface and / or the second surface. In said embodiment, the process unit is, in particular, equipped with a heater (see Figure 4), which serves for implementing the temperature alterations in PCR and hybridization.
Preferably, the process unit has a low heat capacity, so that maximum temperature alteration speeds of, for example, at least 5 K / s are practicable at a low power demand. In order to ensure fast cooling of the process unit, another preferred embodiment intends providing a cooling system, for example an air cooling system.
Preferably, cooling of the process unit can also be achieved by means of permanently tempering the space surrounding the process unit to a lowered temperature and thereby

- 36 -passively cooling the cartridge. This renders active cooling of the reaction cartridge unnecessary.
In a further embodiment, the temperature controlling and regulating unit can comprise temperature blocks, which are each pre-heated to a defined temperature. In said embodiment the process unit, in particular, has no integrated heater. Owing to the omission of an integrated heating system, the process unit can be provided even more cost-efficiently.
Heat transfer between the temperature blocks of the temperature controlling and regulating unit is preferably ensured in that the temperature blocks contact the first surface and / or second surface of the device according to the present invention. Preferably, the temperature blocks can be arranged linearly or on a rotary disc and, for example, be integrated in the detection device in this manner. Figure 7 shows a rotary disc having several temperature blocks, each of which is adjusted to a defined temperature. By means of exchanging the temperature blocks below the process unit, the process unit is brought to a specific temperature defined by the temperature block. Preferably, the temperature blocks are manufactured in such a way, that they have a significantly higher heat capacity than the process unit, so that maximal temperature alteration speeds of, for example, at least 5 K / s are also practicable in this embodiment. Preferably, the temperature blocks are only thennostaticized instead of heated or cooled, so that the energy demand is also minimal in this case. In this embodiment, cooling or heating the process unit can be omitted.
In a further embodiment, the temperature controlling and regulating unit is integrated in the mean / s for guiding the first surface and / or in the mean / s for agitating, and / or in the spacer. In this embodiment, heat transfer is conducted by means of contacting the means and / or the spacer with the first surface and / or the second surface.
Preferably, the device additionally comprises a reprocessing unit for purifying and / or re-concentrating the sample solution and / or for controlling the loading and unloading of the reaction chamber with fluids. Within the scope of the present invention, fluids are understood to denote liquids and gases. Furthermore, the analysis solution can be re-buffered in the reprocessing unit. The reprocessing unit can finally also be used for providing the necessary

- 37 -analysis chemicals. The connection of the fluid containers with the reaction chamber can, for example, be developed as described in the International Patent Application WO
01 / 02094.
In this embodiment, the reaction chamber and the reprocessing unit are particularly preferably connected via two cannulas, wherein the cannulas are arranged in such a way that a first cannula ensures the feeding of fluids from the reprocessing unit into the reaction chamber and a second cannula ensures the escape of air dislocated by the fed fluids from the reaction chamber. A sample fed into the reprocessing unit can thus reach the reaction chamber of the process unit via the cannulas. To this end, the cannulas are arranged in such a way that they reach into the reaction chamber via the cannula guide.
The reprocessing unit can be developed in such a way that it can be separated from the process unit. After filling the reaction chamber with the sample solution and, optionally, with further reaction liquids, the reprocessing unit can thus be separated from the process unit, preferably be disengaged, and, optionally, be discarded.
In the following, embodiments of integrated or non-integrated units for filling the reaction chamber, which will also be referred to in the following as filling unit or reprocessing unit, will be described.
Conventionally, the reaction solution is brought into a specific opening of the filling unit by means of a suitable tool, for example, a pipette. The transport of liquids into the device is performed via the pressure exerted by the pipette or by means of another pressure-generating tool, like for example a syringe or an automated unit, which is, for example, a functional component of a processing automat.
Preferably, the filling unit is developed for manual operation in an ergonomically suitable way. Furthermore, it preferably has easily accessible additional openings at the outsides for feeding the reactive substances.
Preferably, a filling unit furthermore has a suitable fluid interface for penetrating the seal of the chamber body. To this end, specific cannulas are used, which, for example, consist of high-grade steel or polymers and usually have a diameter of 0.05 mm to 2 mm.
Preferably, at

- 38 -least one or more cannulas are arranged, particularly preferably two, wherein one can be used for filling with a reactive liquid and another for ventilation of the reaction space and for taking up surplus fluids. Such cannulas can be connected with the filling unit in a fixed or an interchangeable manner, wherein preferably a connection, which cannot be detached by the operator, for implementing disposable filling items is implemented.
The filling unit can furthermore comprise a unit for covering the cannulas, so that any possible injury of the operator or contamination of the environment can be avoided after separation of the systems.
Preferably, the filling unit furthermore comprises a suitable mechanical interface for snug-fit contacting of the reaction cartridge. Said interface can be developed, for example, in the form of specific snaps. In this manner, penetration of the seal of the chamber body at preferred sites can be ensured.
When processing the reaction cartridge in corresponding processing automats, suitable mechanical measures are to be taken, which allow adjustment and accurate positioning in the devices. This particularly applies to the positioning for the replacement and / or the feeding of liquids and the positioning of the reaction cartridge for detection of the signals after conduction of the reactions in the reaction chamber.
The device or the filling unit can furthermore comprise an integrated waste container, which serves for taking up surplus or dislocated gaseous or liquid media, like for example protective gas fillings or buffers. The waste container can, for example, be filled with a further gaseous, liquid, or solid medium, which binds the liquid or gaseous substances reversibly or irreversibly, like for example cellulose, filter materials, silica gels. In addition, the waste container can have a ventilation opening or can exhibit a negative pressure for improving the filling behavior of the entire unit.
Alternatively, the waste container can also be developed as separate module.
In this case, the filling unit is equipped with corresponding fluid interfaces which can correspond to commercial standards, like for example LuerLock, and which lead to the outside. Such interfaces can have a form or force connection with continuing systems.

- 39 -In a first special embodiment, filling is conducted by means of a detachable filling unit having an integrated waste container. In particular, the filling unit serves for non-recurrent filling of the reaction chamber. The filling unit is, for example, developed in such a way that it is plugged or temporarily attached to the cartridge, the samples are fed into the reaction space, and, after filling is completed, the filling unit is again separated from the cartridge and is discarded. In this special first embodiment, the filling unit further comprises an integrated waste container, which can be developed as described above. An example for this embodiment is shown in Figure 22. The procedure for filling a reaction cartridge by means of a modular filling unit is shown in Figure 23.
In a second special embodiment, filling is conducted by means of an integrated filling unit.
Herein, the filling unit is an integrated component of the reaction cartridge and is therefore not separated from the latter; discarding the filling unit and the cartridge is conducted simultaneously. Herein, the filling unit is preferably used for non-recurrent filling of the reaction chamber and possibly for further process-internal fluid steps. In this embodiment, the filling unit furthermore preferably comprises a technical device, which implements a preferred position of the cannulas in the system, in particular for preventing inadvertent piercing of the cannulas into the seal of the chamber body. It is, however, also conceivable that the cannulas pierce the seal of the chamber body in said preferred position. Said technical device can, for example, be implemented by means of establishing springs, elastic elements, or specific recesses and bumps for implementing a catch. In this embodiment, the filling unit further comprises a filling and waste channel, which comprises corresponding fluid interfaces, which can also correspond to commercial standards, like for example LuerLock, and which lead to the outside. Such interfaces can have a positive or non-positive interlocking with continuing systems and serve for feeding and / or removing gaseous and / or liquid media. An example for this embodiment is shown in Figure 24. The procedure for filling a reaction cartridge having an integrated filling unit is shown in Figure 25.
In a third special embodiment, filling is conducted via an integrated filling unit having an integrated waste container. In said embodiment, the filling unit is an integrated component of the reaction cartridge and is therefore not separated from the latter; filling unit and cartridge

- 40 -are discarded simultaneously. Herein, the filling unit is preferably used for non-recurrent filling of the reaction chamber and possibly for further process-internal fluid steps.
In this embodiment, the filling unit furthermore preferably also comprises a technical device, which implements a preferred position of the cannulas in the system, preferably for preventing inadvertent piercing of the cannulas into the seal of the chamber body. It is, however, also conceivable that the cannulas pierce the seal of the chamber body in said preferred position. Said technical device can, for example, be implemented by means of establishing springs, elastic elements, or specific recesses and bumps for implementing a catch. In this embodiment, the filling unit furthermore comprises an integrated waste container, which can be developed as described above. An example for this embodiment is shown in Figure 26. The procedure for filling a reaction cartridge with an integrated filling unit and integrated waste container can, for example, be conducted by means of combining the procedures described in Figures 23 and 25.
In the following, a special embodiment for arranging cannulas for pressure balance during the compression procedure will be described. The cannulas of a filling tool for the cartridge can, for example, be arranged in such a way that both filling in a non-compressed state and transfer of surplus reaction solutions during a compression of the reaction space is possible.
This can preferably be achieved by means of adapted construction of the seal and a cannula arrangement, wherein the cannulas preferably pierce the compensation regions within the reaction chamber. Such an arrangement is particularly suitable, if the surplus volume cannot be taken up by means of a special seal design. An example for a possible vertical cannula arrangement with unaltered form of the seal is shown in Figure 27.
The device according to the present invention can further comprise a unit, which is connected to the detection system, for controlling the test procedure and / or for processing the signals recorded by means of the detection system. The controlling and / or processing unit can be a micro-controller or an industrial computer. This coupling of detection unit and processing unit, which ensures the conversion of the reaction results to the analysis result, allows, inter alia, the use of the device according to the present invention as hand-held device, for example, in medical diagnostics.

- 41 -In addition, the device according to the present invention furthermore preferably has an interface for external computers. Inter alio., this allows the transfer of data for external storage.
In a further preferred embodiment, the device is equipped with a coding, preferably a data matrix and / or a bar code, containing information on the substance library and / or the conduction of the amplification and / or detection reaction. By means of such an individual identification number, the reading or detection device can automatically recognize, which test has been conducted. To this end, a data record containing information on the substance library, the conduction of the detection reaction, and the like is stored in a database when manufacturing the device according to the present invention. Thus, the data record can, in particular, contain information on the layout of the probes on the array and information as to how evaluation is to be conducted in the most advantageous manner. The data record or the data matrix can further contain information on the temperature-time regime of a PCR to be optionally conducted for amplifying the target molecules. The data record thus obtained is preferably given a number, which is attached to the holder in the form of the data matrix. Via the number recorded in the data matrix, the set data record can then optionally be called when reading out the substance library. Finally, the data matrix can be read out by the temperature controlling or regulating unit and other controllers, like for example a control for filling and unloading of the reaction chamber via the fluid containers, and an automatic conduction of amplification and detection reaction can thus be ensured.
The coding, like a data matrix, does not compellingly have to contain the entire information.
It can also simply contain an identification or access number, by means of which the necessary data are then downloaded from a computer or a data carrier.
The device according to the present invention can be very easily manufactured.
In Figure 3 it is shown that the process unit can consist of only four individual components, which are simply fit into one another. Figures 10 and 11 show embodiments, which can also be easily manufactured due to the construction according to the present invention, although they consist of several components. The geometric tolerances of the dimensions of the individual components can be very large with, for example, 1 / 10 to 2 / 10 mm, so that, for example, the large-scale injection molding of seal and chamber body can be conducted in a very cost-efficient manner. The low tolerances are facilitated by means of pressing the chip against the

- 42 -detection plane, as thereby the optical path to the detection microscope is hardly influenced by the components of the process unit. The only geometric quantities having a low tolerance are the x,y-position of the chip and the thickness of the detection plane. The variance of the z-position of the chip, however, only plays a subordinate part. Despite these low technical requirements, a focusing device at the optical system, for example a fluorescence detection microscope, is not required. These properties clearly show the suitability of the device according to the present invention for mobile on-site use.
In a further aspect of the present invention, a method for qualitatively and /
or quantitatively detecting molecular interactions between probe and target molecules is provided, which comprises the following steps:
a) feeding a sample, preferably a sample solution comprising target molecules, into a reaction chamber of a device according to the present invention as described above;
and b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate.
The method according to the present invention allows the qualitative and / or quantitative detection of molecular interactions between probe and target molecules in a reaction chamber, without necessitating a replacement of the sample or reaction liquids in order to remove a disturbing background after the interaction is completed and before the detection.
Within the scope of the present invention, the detection of an interaction between the probe and the target molecule is usually conducted as follows: Subsequently to fixing the probe or the probes to a specific matrix in the form of a microarray in a predetermined manner or subsequently to providing a microarray, the targets are contacted with the probes in a solution and are incubated under defined conditions. As a result of the incubation, a specific interaction or hybridization occurs between probe and target. The bond occurring herein is significantly more stable than the bond of target molecules to probes, which are not specific for the target molecule.
The detection of the specific interaction between a target and its probe can be performed by means of a variety of methods, which normally depend on the type of the marker, which has been inserted into target molecules before, during or after the interaction of the target

- 43 -molecule with the microarray. Typically, such markers are fluorescent groups, so that specific target / probe interactions can be read out fluorescence-optically with high local resolution and, compared to other conventional detection methods, in particular mass-sensitive methods, with little effort (see, for example, A. Marshall, J. Hodgson, DNA chips: An array of possibilities, Nature Biotechnology 1998, 16, 27-31; G. Ramsay, DNA Chips:
State of the art, Nature Biotechnology 1998, 16, 40-44).
Depending on the substance library immobilized on the microarray and the chemical nature of the target molecules, interactions between nucleic acids and nucleic acids, between proteins and proteins, and between nucleic acids and proteins can be examined by means of this test principle (for survey see F. Lottspeich, H. Zorbas, 1998, Bioanalytik, Spektrum Akademischer Verlag, Heidelberg / Berlin, Germany).
Herein, antibody libraries, receptor libraries, peptide libraries, and nucleic acid libraries are considered as substance libraries, which can be immobilized on microarrays or chips.
The nucleic acid libraries play the most important role by far. These are microarrays, on which deoxyribonucleic acid (DNA) molecules or ribonucleic acid (RNA) molecules are immobilized.
In a preferred embodiment of the method according to the present invention, the distance between microarray and second surface is kept in a position, which allows processing of the sample solution and / or the interaction between the target molecules and the probe molecules immobilized on the substrate, for example amplification of nucleic acids to be detected and / or hybridization between nucleic acids to be detected and the nucleic acid probes immobilized on the substrate, before detection in step b).
It is further preferred that in step b) the distance between the microarray and the second surface is altered, preferably reduced. I.e. the detection is preferably conducted with a reduced distance between microarray and detection plane. Particularly preferably, the distance between microarray and detection plane is about zero during detection.

- 44 -In one embodiment, the microarray is guided toward the second surface in order to reduce the distance between microarray and second surface. Preferably, this is ensured by means of pushing the first surface by means of pressure exerted by at least one means for guiding the first surface, for example a tappet, a rod, a pin and / or a screw, wherein the point of pressure of the means is located, in particular, below the microarray.
Pressing the microarray against the second surface or the detection plane can be facilitated in that the first surface is elastically deformable at least in the region below the microarray.
Alternatively, the first surface can be developed by means of two superimposed layers, wherein one outer layer of the two superimposed layers has a recess at least in the region below the microarray, and an inner layer of the two superimposed layers is formed by an elastic seal. Pressure is then exerted on the inner layer in the vicinity of the recess by the means for guiding the first surface.
The means for guiding the first surface, for example a pin, a rod, a tappet and / or a screw, cannot only serve for exerting a pressure on the first surface, however. In the event that bubbles should form on the DNA chip, which would impede the detection, these bubbles can be removed by means of agitation by the means for guiding the first surface, for example by means of a vibration frequency of about 20 Hz applied to the first surface, in particular in the form of an elastic membrane.
Furthermore, there is often the problem that the interaction, for example the hybridization, at the chip surface takes a very long time. Among other reasons, this is due to the fact that the speed of interaction or hybridization is determined by diffusion. Preferably, the interaction or hybridization speed can be increased by means of agitation via the means for guiding the first surface, for example by means of a vibration frequency of about 20 Hz applied to the first surface, in particular in the form of an elastic membrane, as the agitation or vibration leads to mixing in the reaction chamber.
In a further embodiment, the second surface is guided toward the first surface in order to reduce the distance between microarray and second surface. In particular, this can be ensured in that the second surface is guided toward the first surface by means of pressure exerted on the second surface by the spacer.

- 45 -In a further embodiment, the first surface is guided toward the second surface and the second surface is guided toward the first surface in order to reduce the distance between microarray and second surface.
In the following, further embodiments for guiding the first surface relatively to the second surface or the second surface relatively to the first surface will be described. Said embodiments are not only suitable for positioning the first surface or the probe array relatively to the second surface or the detection surface, but can, in particular, also be used for moving the probe array relatively to the detection surface. By means of such a motion, for example an agitation of the solution in the reaction chamber can be achieved.
In one embodiment, the probe array is moved relatively to the detection surface or moved within the chamber by means of a magnetic field. The probe array and / or the second surface, for example, contains a magnetic material or contains a component, whereto a magnetic material has been added, and / or is mounted in a holder consisting of an entirely or partially magnetic material. It can further be preferred that the probe array and / or the second surface is moved passively by moving a magnetic body, which is arranged below the respective surface and is, for example, connected with said surface, by means of a magnetic field.
In a further embodiment, the probe array is moved and / or positioned relatively to the detection surface by means of gravitational impact.
In a further embodiment, the probe array is moved and / or positioned relatively to the detection surface by means of a stream generated in the reaction chamber. To this end, the device can, for example, be developed in such a way that, in case the probe array is surrounded by a liquid stream, a negative pressure is generated at one side of the reaction chamber and a positive pressure is generated at the opposite side, which leads to movement of the probe array in the reaction chamber. Such a stream can, for example, be implemented by means of thermal convection, which is caused by local temperature differences in the chamber.
In a further embodiment, the probe array is moved and / or positioned relatively to the detection surface by means of impact of an electric field.

- 46 -In a further embodiment, a gas bubble is generated below the probe array by means of local overheating, due to which the chip is moved in the chamber or is guided toward the detection surface.
By means of reducing the distance between microarray and second surface before the detection, the sample solution preferably is substantially entirely removed from the region between microarray and detection plane. Hereby, background signals, which are caused by labeled molecules, which are not bound to the array surface, for example by labeled primers and / or labeled target nucleic acids, which are not bound to the array surface, are reduced.
Thus, in the detection of step b), the distance between the microarray and the second surface is preferably altered in such a way that the sample solution between the microarray and the second surface is essentially removed. The microarray is then essentially located in the detection plane and a disturbing background is virtually avoided.
In a further alternative embodiment, the microarray rests evenly on the second surface forming the detection plane already in the original state of the device and is not only brought into the detection plane by means of guiding the first surface toward the second surface and / or guiding the second surface toward the first surface. In this embodiment, the microarray is not moistened by the sample solution during the processing steps. For conducting the interaction reaction, for example a hybridization, the first surface, which is preferably made of an elastic material, for example an elastic membrane, is guided away from the detection surface. Thereby, the chip surface is moved away from the detection surface and is moistened by the sample solution. The interaction, for example a hybridization, can take place. For conducting the detection and further processing, the first surface, for example in the form of an elastic membrane, is released again, due to which it leaps back to its originally adjusted position, which can be accelerated by means of pressure exerted by a means for guiding the first surface, for example a pin, a rod, a screw and / or a tappet. Thereby, the microarray is pressed against the detection plane again and the detection can be conducted without a background.

- 47 -In a further embodiment of the method according to the present invention, a device according to the present invention, as described above, is used, the first surface of which is developed in a pivotable manner around a rotation axis.
In a first position, which is also referred to as initial position, the surface of the microarray arranged on the first flanking portion rests essentially evenly on the second surface, i.e. the substrate surface with the probe molecules immobilized thereon is essentially not moistened by the sample solution. In the space formed in the first position between the second flanking portion of the first surface and the second surface, the processing chamber, the processing of the reaction solution is preferably conducted, i.e. in particular purification, re-concentration, washing and rinsing and / or amplification steps.
Subsequently, the pivotable first surface is brought to a second position, wherein the first surface is arranged relatively to the second surface at an angle other than 180 , preferably at an angle of 45 . Preferably, this is conducted by means of traction exerted on the first flanking portion of the first surface and / or pressure exerted on the second flanking portion of the first surface by means of a means for guiding the first surface, as described above.
By means of guiding the first surface to the second position, the microarray is guided away from the second surface and the sample solution penetrates the cavity forming between microarray and second surface. The probe molecules immobilized on the substrate of the microarray are freely accessible for the target molecules present in the sample solution, so that an interaction reaction between probe and target molecules can occur. In this embodiment of the method according to the present invention, pressure and / or traction exerted on the first surface has the advantage that, in this manner, the sample solution is moved and thus the interaction reaction can be accelerated.
For conducting the detection and, optionally, further processing, the pivotable first surface is guided back to the first position, for example by means of pressure exerted on the first flanking portion of the first surface and / or traction exerted on the second flanking portion of the first surface or, in the case of elastic development of the first surface, by means of releasing the first flanking portion. Now, the microarray again rests essentially evenly on the second surface, so that the sample solution between the second surface and the microarray is

- 48 -essentially displaced in this position and an essentially background-free detection can take place.
The targets to be examined can be present in any kind of sample, preferably in a biological sample.
Preferably, the targets are isolated, purified, copied, and / or amplified before their detection and quantification by means of the method according to the present invention.
The method according to the present invention further allows the amplification and the qualitative and / or quantitative detection of nucleic acids in a reaction chamber, wherein the detection of molecular interactions or hybridizations can be conducted after completion of a cyclic amplification reaction without necessitating replacement of the sample or reaction liquids. The method according to the present invention further also ensures a cyclic detection of hybridization events in an amplification, i.e. a detection of the hybridization even during the cyclic amplification reaction. Finally, with the aid of the method according to the present invention, the amplification products can be quantified during the amplification reaction and after completion of the amplification reaction.
Usually, the amplification is performed by means of conventional PCR methods or by means of a method for the parallel performance of amplification of the target molecules to be analyzed by means of PCR and detection by means of hybridization of the target molecules with the substance library support, as is described above..
In a further embodiment, the amplification is performed as a multiplex PCR in a two-step process (see also WO 97/45559). In a first step, a multiplex PCR is performed by means of using fusion primers, whose 3'-ends are gene specific and whose 5'-ends represent a universal region. The latter is the same in all forward and reverse primers used in the multiplex reaction. In this first stage, the amount of primer is limiting. Hereby, all multiplex products can be amplified until a uniform molar level is achieved, given that the number of cycles is adequate for reaching primer limitation for all products. In a second stage, universal primers identical to the 5'-regions of the fusion primers are present. Amplification is performed until the desired amount of DNA is obtained.

- 49 -In a further preferred embodiment of the method according to the present invention, detection is performed during the cyclic amplification reaction and / or after completion of the cyclic amplification reaction. Preferably, detection is performed during the amplification reaction, in every amplification cycle. Alternatively, detection can also be determined in every second cycle or every third cycle or in any arbitrary intervals.
In the conduction of a linear amplification reaction, wherein the target amount increases by a certain amount with each step, or an exponential amplification reaction, for example a PCR, wherein the DNA target amount multiplies with each step, in the process unit, the chip can thus be pressed against the detection plane after every amplification step and therefore the detection can be conducted. It is thus possible to perform on-line surveillance of the amplification reaction. In particular in the case of non-linear amplification reactions, it is thereby possible to determine the initial concentration of the DNA target amount.
In this manner, the number of amplification steps can furthermore be optimized on-line. As soon as the DNA target amount has reached a specific concentration, the amplification is discontinued. If the initial target concentration is low, the number of amplification steps is increased in order to be able to conduct an assured analysis of the products.
In the case of reduced reaction time of positive controls, the analysis process can be discontinued very early.
The chemicals necessary for conducting an amplification reaction, like for example polymerase, buffer, magnesium chloride, primers, labeled, in particular fluorescence-labeled primers, dNTPs and the like, can be provided in the reaction chamber, for example in freeze-dried form.
Preferably, the cyclic amplification reaction is a PCR. In a PCR, three temperatures for each PCR cycle are usually passed through. Preferably, the hybridized nucleic acids detach from the microarray at the highest temperature, i.e. the denaturation temperature.
A preferred value for the denaturation temperature is 95 C. Therefore, a hybridization signal, which serves as zero value or reference value for the nucleic acids detected in the respective PCR cycle, can be determined at this denaturation temperature.

- 50 -At the temperature following in the PCR cycle, an annealing temperature of, for example, about 60 C, a hybridization between the nucleic acids to be detected and the nucleic acids immobilized on the substrate of the microarray is facilitated. Therefore, in one embodiment of the method according to the present invention, the detection of target nucleic acids present in a PCR cycle is performed at the annealing temperature.
In order to enhance the sensitivity of the method according to the present invention, it can further be advantageous to lower the temperature below the annealing temperature, so that the detection is preferably performed at a temperature below the annealing temperature of an amplification cycle. For example, the detection can he performed at a temperature in a range of 25 C to 50 C and preferably in a range of 30 C to 45 C.
In a further alternative embodiment of the method according to the present invention, the hybridization between nucleic acids to be detected and the nucleic acids immobilized on the substrate of the microarray is at first performed at a low temperature, in order to subsequently raise the hybridization temperature. Such an embodiment has the advantage that the hybridization time is reduced compared to hybridizations at temperatures of more than 50 C
without losing specificity in the interactions.
If the zero value or reference value determined at denaturation temperature is subtracted from the measured value determined at or below the annealing temperature, a measured result free of disturbances, in which fluctuation and drift are eliminated, can be obtained.
Usually, the target molecules to be detected are equipped with a detectable marker. In the method according to the present invention, the detection is thus preferably conducted by means of equipping the bound targets with at least one label, which is detected in step b).
As already mentioned above, the label coupled to the targets or probes preferably is a detectable unit or a detectable unit coupled to the targets or probes via an anchor group. With respect to the possibilities for detection or labeling, the method according to the present invention is very flexible. Thus, the method according to the present invention is compatible with a variety of physical, chemical, or biochemical detection methods. The only prerequisite

-51 -is that the unit or structure to be detected can directly be coupled or can be linked via an anchor group, which can be coupled with the oligonucleotide, to a probe or a target, for example an oligonucleotide.
The detection of the label can be based on fluorescence, magnetism, charge, mass, affinity, enzymatic activity, reactivity, a gold label, and the like. Thus, the label can, for example, be based on the use of fluorophore-labeled structures or components. In connection with fluorescence detection, the label can be an arbitrary dye, which can be coupled to targets or probes during or after their synthesis. Examples are Cy dyes (Amersham Pharmacia Biotech, Uppsala, Sweden), Alexa dyes, Texas Red, Fluorescein, Rhodamin (Molecular Probes, Eugene, Oregon, USA), lanthanides like samarium, ytterbium, and europium (EG&G, Wallae, Freiburg, Germany).
Particularly preferably, said detectable marker is a fluorescence marker. As already mentioned above, the use of the device according to the present invention in the method according to the present invention ensures the detection of the fluorescence markers by means of a fluorescence microscope without autofocus, for example a fluorescence microscope with fixed focus.
Beside fluorescence markers, luminescence markers, metal markers, enzyme markers, radioactive markers, and / or polymeric markers can also be used within the scope of the present invention as labeling and / or detection unit, which is coupled to the targets or the probes.
Likewise, a nucleic acid, which can be detected by means of hybridization with a labeled reporter (sandwich hybridization), can be used as label (tag). Diverse molecular biological detection reactions like primer extension, ligation, and RCA are used for the detection of the tag.
In an alternative embodiment of the method according to the present invention, the detectable unit is coupled with the targets or probes via an anchor group. Preferably used anchor groups are biotin, digoxigenin, and the like. In a subsequent reaction, the anchor group is converted by means of specifically binding components, for example streptavidin conjugates or antibody

- 52 -conjugates, which in turn are detectable or trigger a detectable reaction.
With the use of anchor groups, the conversion of the anchor groups to detectable units can be performed before, during, or after the addition of the sample comprising the targets, or, optionally, before, during, or after the cleavage of a selectively cleavable bond in the probes. Such selectively cleavable bonds in the probes are, for example, described in the International Patent Application WO 03/018838, the relevant contents of which are hereby explicitly referred to.
According to the present invention, labeling can also be performed by means of interaction of a labeled molecule with the probe molecules. For example, labeling can be performed by means of hybridization of an oligonucleotide labeled as described above with an oligonucleotide probe or an oligonucleotide target.
Further labeling methods and detection systems suitable within the scope of the present invention are described, for example, in Lottspeich and Zorbas, Bioanalytik, Spektrum Akademischer Verlag, Heidelberg, Berlin, Germany 1998, chapter 23.3 and 23.4.
In a preferred embodiment of the method according to the present invention, detection methods are used, which in result yield an adduct having a particular solubility product, which leads to a precipitation. For labeling, in particular substrates or educts are used, which can be converted to a hardly soluble, usually stained product. In this labeling reaction, for example, enzymes can be used, which catalyze the conversion of a substrate to a hardly soluble product. Reactions suitable for leading to a precipitation at the array elements as well as possibilities for the detection of the precipitation are, for example, described in the International Patent Application WO 00/72018 and in the International Patent Application WO 02/02810, whose relevant contents are hereby explicitly referred to.
In a particularly preferred embodiment of the method according to the present invention, the bound targets are equipped with a label catalyzing the reaction of a soluble substrate or educt to form a hardly soluble precipitation at the array element, where a probe /
target interaction has occurred or acting as a crystal nucleus for the conversion of a soluble substrate or educt to a hardly soluble precipitation at the array element, where a probe / target interaction has occurred.

- 53 -In this manner, the use of the method according to the present invention allows the simultaneous qualitative and quantitative analysis of a variety of probe /
target interactions, wherein individual array elements having a size of < 1000 um, preferably of <
100 um, and particularly preferably of < 50 gm can be implemented.
The use of enzymatic labels is known in immunocytochemistry and in immunological tests based on microtiter plates (see E. Lidell and I. Weeks, Antibody Technology, BIOS Scientific Publishers Limited, 1995). Thus, for example, enzymes catalyze the conversion of a substrate to a hardly soluble, usually stained product.
Particularly preferably, the reaction leading to precipitation formation at the array elements is a conversion of a soluble substrate or educt to a hardly soluble product, catalyzed by an enzyme. In a special embodiment, the reaction leading to precipitation formation at the array elements is an oxidation of 3,3',5,5'-tetramethylbenzidine, catalyzed by a peroxidase.
Preferably, horseradish peroxidase is used for the oxidation of 3,3',5,5'-tetramethylbenzidine.
However, the person skilled in the art knows further peroxidases, which can be used for the oxidation of 3,3',5,5'-tetramethylbenzidine.
It is assumed that 3,3',5,5'-tetramethylbenzidine, under the catalytic impact of a peroxidase, is oxidized in a first step to form a blue-stained radical cation (see for example Gallati and Pracht, J. Clin. Chem. Clin. Biochem. 1985, 23, 8, 454). This blue-stained radical cation is precipitated in the form of a complex by means of a polyanion, like for example dextran sulfate. The precipitation reaction by means of peroxidase-catalyzed oxidation of 3,3',5,5'-tetramethylbenzidine is, for example, described in EP 0 456 782.
Without claiming to be complete, the following Table 1 offers a survey of several reactions possibly suitable for leading to a precipitation at array elements, where an interaction between target and probe has occurred:
Table 1

- 54 -catalyst or substrate or educt crystal nucleus horseradish peroxidase DAB (3,3`-diaminobenzidine) 4-CN (4-chloro-l-naphthol) AEC (3-amino-9-ethylcarbazole) HYR (p-phenylenediamine-HCl and pyrocatechol) TMB (3,3`,5,5`-tetramethylbenzidine) naphthol / pyronin alkaline phosphatase brom-chlor-indolyl-phosphate (BCIP) and nitroblue tetrazolium (NBT) glucose oxidase t-NBT and m-PMS
(nitroblue tetrazolium chloride and phenazine methosulfate gold particles silver nitrate silver tartrate The detection of probe / target interactions via insoluble precipitates is, in particular, described in WO 02/02810.
In the following, embodiments of the present invention are described, which can serve for overcoming problems usually likely to arise in the detection of molecular interactions on solid supports, like for example for preventing the possible formation of Newton's rings between detection plane and probe array.
The manifestation of Newton's rings is essentially determined by the type of illumination, the wavelength of the light used for detection, the distance between detection plane and probe array, and the refraction index of the solution located in the chamber. Such Newton's rings can, for example, be prevented by means of altering the wavelength of the light used for detection, using a solution having the same or a similar refraction index as the detection plane and / or the probe array, and / or using an immersion liquid between detection plane and probe array.

- 55 -Furthermore, Newton's rings can be prevented by means of applying spacers on the chip and / or on the side of the detection plane facing the chip.
Furthermore, Newton's rings can be prevented by means of applying the probe arrays onto a rough support surface.
Furthermore, Newton's rings can be prevented by means of applying the probe arrays onto a light-absorbing surface.
It is a further possibility to permanently vary the contact pressure, by means of which the chip is guided relatively to the dctcction surface. Thus, the thickness of the gap between chip and detection surface, and therefore also the position of Newton's rings, is altered. By means of integrating the fluorescence signal to be detected over time, a distortion of the measured values of the spots in relation to each other is prevented in this manner.
It is a further particularly preferably possibility of preventing Newton's rings to use several light sources from different directions for illuminating and therefore agitating the fluorophores of the bound targets.
Background fluorescence, which has been caused by fluorophores of unbound targets in the displaced liquid, can lead to distortion of the signal detected. This can preferably be prevented by means of using a shade, which is, for example, mounted on the detection surface or the chip and / or around the chip or in the imaging optics, and is developed in such a way that only the surface of the probe array is illuminated or imaged.
With the use of corresponding light sources, like for example lasers, there can arise inhomogeneities in illumination due to coherence of the light. Such inhomogeneities can be reduced or prevented by means of using waveguides and / or combining filters and / or light of different wavelengths. Likewise, movement of the light source in order to eliminate such effects is also conceivable.
By means of using an organic or inorganic light-absorbing layer, which is non-fluorescent in the selected range of wavelengths, on the support of the probe array, fluorescence background

- 56 -signal, which is caused by the probe support and / or elements located behind the latter, can be reduced or prevented. Preferably, a black chromium layer is employed as protective layer.
In all of the above-described embodiments of the method according to the present invention, a pre-amplification of the material to be analyzed is not required. From the sample material extracted from bacteria, blood, or other cells, specific partitions can be amplified and hybridized to the support with the aid of a PCR (polymerase chain reaction), in particular in the presence of the device according to the present invention or the substance library support, as is described in DE 102 53 966. This signifies a substantial reduction of labor effort.
Thus, the method according to the present invention is particularly suitable for parallel performance of amplification of the target molecules to be analyzed by means of PCR and the detection by means of hybridization of the target molecules with the substance library support. Herein, the nucleic acid to be detected is first amplified by means of a PCR, wherein preferably at least one competitor inhibiting the formation of one of the two template strands amplified by means of the PCR is added to the reaction in the beginning. In particular, a DNA
molecule, which competes against one of the primers used for the PCR
amplification of the template for binding to the template and which can not be extended enzymatically, is added to the PCR. The single-stranded nucleic acid molecules amplified by means of the PCR are then detected by means of hybridization with a complementary probe. Alternatively, the nucleic acid to be detected is first amplified in single strand surplus by means of a PCR and is detected by means of a subsequent hybridization with a complementary probe, wherein a competitor, which is a DNA molecule or a molecule of a nucleic acid analog capable of hybridizing to one of the two strands of the template but not to the region detected by means of probe hybridization and which cannot be enzymatically extended, is added to the PCR
reaction at the beginning.
Every molecule causing a preferred amplification of only one of the two template strands present in the PCR reaction can be used as competitor in the PCR. Thus, according to the present invention, competitors can be proteins, peptides, DNA ligands, intercalators, nucleic acids or analogs thereof. Proteins or peptides, which are capable of binding single-stranded nucleic acids with sequence specificity and which have the above-defined properties, are

- 57 -preferably used as competitors. Particularly preferably, nucleic acid molecules and nucleic acid analog molecules are used as secondary structure breakers.
The formation of one of the two template strands is substantially inhibited by initial addition of the competitor to the PCR during the amplification. "Substantially inhibited" means that within the scope of the PCR a single strand surplus and an amount of the other template strand is produced, which is sufficient to allow an efficient detection of the amplified strand by means of hybridization. Therefore, the amplification does not follow exponential kinetics of the form 2 (with n = number of cycles), but rather attenuated amplification kinetics of the form <2'.
The single strand surplus obtained by means of the PCR in relation to the non-amplified strand has the factor 1.1 to 1,000, preferably the factor 1.1 to 300, also preferably the factor 1.1 to 100, particularly preferably the factor 1.5 to 100, also particularly preferably the factor 1.5 to 50, in particular preferably the factor 1.5 to 20, and most preferably the factor 1.5 to 10.
Typically, the function of a competitor will be to bind selectively to one of the two template strands and therefore to inhibit the amplification of the corresponding complementary strand.
Therefore, competitors can be single-stranded DNA- or RNA-binding proteins having specificity for one of the two template strands to be amplified in a PCR. They can also be aptamers sequence-specifically binding only to specific regions of one of the two template strands to be amplified.
Nucleic acids or nucleic acid analogs are preferably used as competitors.
Conventionally, the nucleic acids or nucleic acid analogs will act as competitors of the PCR by either competing against one of the primers used for the PCR for the primer binding site or by being capable of hybridizing with a region of a template strand to be detected due to a sequence complementarity. This region is not the sequence detected by the probe. Such nucleic acid competitors are enzymatically not extendable.
The nucleic acid analogs can, for example, be so-called peptide nucleic acids (PNA).
However, nucleic acid analogs can also be nucleic acid molecules, in which the nucleotides are linked to one another via a phosphothioate bond instead of a phosphate bond. They can

- 58 -also be nucleic acid analogs, wherein the naturally occurring sugar components ribose or deoxyribose have been replaced with alternative sugars, like for example arabinose or trehalose or the like. Furthermore, the nucleic acid derivative can be "locked nucleic acid"
(LNA). Further conventional nucleic acid analogs are known to the person skilled in the art.
DNA or RNA molecules, in particular preferably DNA or RNA oligonucleotides or their analogs, are preferably used as competitors.
Depending on the sequence of the nucleic acid molecules or nucleic acid analogs used as competitors, the inhibition of the amplification of one of the two template strands within the scope of the PCR reaction is based on different mechanisms. By way of the example of a DNA molecule, this is discussed in the following.
If, for example, a DNA molecule is used as competitor, it can have a sequence, which is at least partially identical to the sequence of one of the primers used for the PCR in such a way that a specific hybridization of the DNA competitor molecule with the corresponding template strand is possible under stringent conditions. As, according to the present invention, the DNA
molecule used for competition in this case is not extendable by means of a DNA
polymerase, the DNA molecule competes for binding to the template against the respective primer during the PCR reaction. According to the ratio of the DNA competitor molecule and the primer, the amplification of the template strand defined by the primer can thus be inhibited in such a way that the production of this template strand is significantly reduced. Herein, the PCR proceeds according to exponential kinetics higher than would be expected with the amounts of competitors used. In this manner, a single strand surplus emerges in an amount, which is sufficient for the efficient detection of the amplified target molecules by means of hybridization.
In this embodiment, the nucleic acid molecules or nucleic acid analogs used for competition must not be enzymatically extendable. "Enzymatically not extendable" means that the DNA
or RNA polymerase used for the amplification cannot use the nucleic acid competitor as primer, i.e. it is not capable of synthesizing the corresponding opposite strand of the template 3' from the sequence defined by the competitor.

- 59 -Alternatively to the above-depicted possibility, the DNA competitor molecule can also have a sequence complementary to a region of the template strand to be detected, which is not addressed by one of the primer sequences and which is enzymatically not extendable. Within the scope of the PCR, the DNA competitor molecule will then hybridize to this template strand and correspondingly block the amplification of this strand.
The person skilled in the art knows that the sequences of DNA competitor molecules or, in general, nucleic acid competitor molecules can be selected correspondingly. If the nucleic acid competitor molecules have a sequence, which is not substantially identical to the sequence of one of the primers used for the PCR, but is complementary to another region of the template strand to be detected, this sequence is to be selected in such a way that it does not fall within the region of the template sequence, which is detected with a probe within the scope of the hybridization. This is necessary because there does not have to occur a processing reaction between the PCR and the hybridization reaction. If a nucleic acid molecule, which falls within the region to be detected, were used as competitor, it would compete for binding to the probe against the single-stranded target molecule.
Such competitors preferably hybridize near the template sequence detected by the probe.
Herein, according to the present invention, the position specification "near"
is to be understood in the same way as given for secondary structure breakers. However, the competitors according to the present invention can also hybridize in the immediate proximity of the sequence to be detected, i.e. at exactly one nucleotide's distance from the target sequence to be detected.
If enzymatically not extendable nucleic acids or nucleic acid analogs are used as competing molecules, they are to be selected with respect to their sequence and structure in such a way that they cannot be enzymatically extended by DNA or RNA polymerases.
Preferably, the 3'-end of a nucleic acid competitor is designed in such a way that it has no complementarity to the template and / or has at its 3 '-end a substituent other than the 3-0H
group.
If the 3' end of the nucleic acid competitor has no complementarity to the template, regardless of whether the nucleic acid competitor binds to one of the primer binding sites of the template or to one of the sequences of the template to be amplified by means of the PCR, the nucleic

- 60 -acid competitor cannot be extended by the conventional DNA polymerases due to the lack of base complementarity at its 3'-end. This type of non-extensibility of nucleic acid competitors by DNA polymerases is known to the person skilled in the art. Preferably, the nucleic acid competitor has no complementarity to its target sequence at its 3'-end with respect to the last 4 bases, particularly preferably to the last 3 bases, in particular preferably to the last 2 bases, and most preferably to the last base. In the mentioned positions, such competitors can also have non-natural bases, which do not allow hybridization.
Nucleic acid competitors, which are enzymatically not extendable, can also have a 100%
complementarity to their target sequence, if they are modified in their backbone or at their 3'-end in such a way that they are enzymatically not extendable.
If the nucleic acid competitor has at its 3'-end a group other than the OH
group, these substituents are preferably a phosphate group, a hydrogen atom (dideoxynucleotide), a biotin group, or an amino group. These groups cannot be extended by the conventional polymerases.
The use of a DNA molecule, which competes for binding to the template against one of the two primers used for the PCR and which was equipped with an amino link at its 3'-end during chemical synthesis, as a competitor in such a method is particularly preferred. Such competitors can have 100 % complementary tot heir target sequence.
However, nucleic acid analog competitors, like for example PNAs do not have to have a blocked 3'-OH group or a non-complementary base at their 3'-end as they are not recognized by the DNA polymerases because of the backbone modified by the peptide bond and thus are not extended. Other corresponding modifications of the phosphate group, which are not recognized by the DNA polymerases, are known to the person skilled in the art.
Among those are, inter alia, nucleic acids having backbone modifications, like for example 2`-5` amide bonds (Chan et al. (1999) J. Chem. Soc., Perkin Trans. 1, 315-320), sulfide bonds (Kawai et al. (1993) Nucleic Acids Res., 1(6), 1473-1479), LNA (Sorensen et al. (2002) J. Am. Chem.
Soc., 124 (10), 2164-2176) and TNA (Selioning et al. (2000) Science, 290 (5495), 1347-1351).

- 61 -Several competitors hybridizing to different regions of the template (for example, inter alia, the primer binding site) can also simultaneously be used in a PCR. The efficiency of the hybridization can additionally be increased, if the competitors have properties of secondary structure breakers.
In an alternative embodiment, the DNA competitor molecule can also have a sequence complementary to one of the primers. Depending on the ratio of antisense DNA
competitor molecule and primer, such, for example, antisense DNA competitor molecules can then be used to titrate the primer in the PCR reaction, so that it will no longer hybridize with the corresponding template strand and, correspondingly, only the template strand defined by the other primer is amplified. The person skilled in the art is aware of the fact that, in this embodiment of the invention, the nucleic acid competitor can, but does not have to, be enzymatically extendable.
If, within the scope of the present invention, it is talked about nucleic acid competitors, this includes nucleic acid analog competitors, unless a different meaning arises from the respective context. The nucleic acid competitor can bind to the corresponding strand of the template reversibly or irreversibly. The bond can take place via covalent or non-covalent interactions.
Preferably, binding of the nucleic acid competitor takes place via non-covalent interactions and is reversible. In particular preferably, binding to the template takes place via formation of Watson-Crick base pairings.
The sequences of the nucleic acid competitors normally adapt to the sequence of the template strand to be detected. In the case of antisense primers, though, they adapt to the primer sequences to be titrated, which are in turn defined by the template sequences, however.
PCR amplification of nucleic acids is a standard laboratory method, the various possibilities of variation and development of which are familiar to the person skilled in the art. In principle, a PCR is characterized in that the double-stranded nucleic acid template, usually a double-stranded DNA molecule, is first subjected to heat denaturation for 5 minutes at 95 C, whereby the two strands are separated from each other. After cooling down to the so-called

- 62 -"annealing" temperature (defined by the primer with the lower melting temperature), the forward and reverse primers present in the reaction solution accumulate at those sites in the respective template strands, which are complementary to their own sequence.
Herein, the "annealing" temperature of the primers adapts to the length and base composition of the primers. It can be calculated on the basis of theoretical considerations.
Information on the calculation of "annealing" temperatures can be found, for example, in Sambrook et al. (vide supra).
Annealing of the primers, which is typically performed in a range of temperatures between 40 to 75 C, preferably between 45 to 72 C and in particular preferably between 50 to 72 C, is followed by an elongation step, wherein deoxyribonucleotides are linked with the 3'-end of the primers by the activity of the DNA polymerase present in the reaction solution. Herein, the identity of the inserted dNTPs depends on the sequence of the template strand hybridized with the primer. As normally thermostable DNA polymerases are used, the elongation step usually runs at between 68 to 72 C.
In a symmetrical PCR, an exponential amplification of the nucleic acid region of the target defined by the primer sequences is achieved by means of repeating the described cycle of denaturation, annealing and elongation of the primers. With respect to the buffer conditions of the PCR, the usable DNA polymerases, the production of double-stranded DNA
templates, the design of primers, the selection of the annealing temperature, and variations of the classic PCR, the person skilled in the art has numerous works of literature at his disposal.
The person skilled in the art is familiar with the fact that also, for example, single-stranded RNA, like for example mRNA, can be used as template. Usually, it is previously transcribed into a double-stranded cDNA by means of a reverse transcription.
In a preferred embodiment, a thermostable DNA-dependent polymerase is used as polymerase. In a particularly preferred embodiment, a thermostable DNA-dependent DNA
polymerase is used, which is selected from the group consisting of Taq-DNA
polymerase (Eppendorf, Hamburg, Germany and Qiagen, Hilden, Germany), Pfii-DNA polymerase (Stratagene, La Jolla, USA), Tth-DNA polymerase (Biozym Epicenter Technol., Madison,

- 63 -USA), Vent-DNA polymerase, DeepVent-DNA polymerase (New England Biolabs, Beverly, USA), Expand-DNA polymerase (Roche, Mannheim, Germany).
The use of polymerases, which have been optimized from naturally occurring polymerases by means of specific or evolutive alteration, is also preferred. When performing the PCR in the presence of the substance library support, the use of the Taq-polymerase by Eppendorf (Germany) and of the Advantage cDNA Polymerase Mix by Clontech (Palo Alto, CA, USA) is in particular preferred.
A further aspect of the present invention relates to the use of the device according to the present invention for performing microarray-based tests.
In the following, special embodiments of the device according to the present invention or the method according to the present invention are depicted.
In Figure 5 it is shown that the first surface, an elastic membrane herein, in which preferably a heating device is integrated, is deformed by means of a pin or a tappet and the chip is thereby pushed toward the detection plane. Furthermore, the detection plane is pushed into the reaction chamber by means of a spacer on the second surface and thus approaches the DNA
chip from above until the liquid between DNA chip and detection plane is almost entirely dislocated. The elastic seals sealing the reaction chamber are compressed by means of guiding the detection surface toward the chip. The dislocated fluid deforms the seal in such a way that the air is compressed in air compensation chambers.
However, the process unit can also be developed in such a way that either only the first surface, for example in the form of an elastic membrane, is deformed or only the detection plane is pushed into the chamber.
In Figure 6, a further technical embodiment for compressing the process unit is depicted. The reaction chamber is enclosed by a sealing membrane, whereon a DNA chip is fixed, laterally and at the side opposite the detection plane. At the level of the DNA chip, the sealing membrane seals a hole in the lower side of the chamber body. The hole is slightly smaller than the DNA chip. When conducting a PCR in the reaction chamber, the hole is tightly

- 64 -sealed by the internal pressure forming due to the raised temperatures connected with the PCR. Therefore, despite the labile sealing membrane, the chamber is pressure-proof (principle of the self-closing valve). For detection, a pin or a tappet is pushed through the lower side hole. The sealing membrane is lifted and the DNA chip is pressed against the detection plane.
In order to ensure the required elasticity of the sealing membrane, the membrane can be provided with a compensation fold. In this embodiment, the pressure compensation chambers are also compressed by the dislocated liquid.
The following examples serve the purpose of illustrating the invention and are not to be interpreted restrictively.
Examples Example 1: Structure of a reaction cartridge having integrated heating In Figures 8 and 9, an embodiment of a processing unit without integrated heating and a device for guiding the DNA chip toward the detection plane are depicted. The DNA chip in the device shown can be read out by means of a conventional fluorescence microscope (for example Axioskop, Zeiss, Jena, Germany).
Example 2: Structure of a reaction cartridge having a silicon heating substrate The variant of the processing unit of the device according to the present invention, which is shown in Figures 10 and 11, is a miniaturized reaction cartridge having an integrated probe array (DNA chip), a silicon heating substrate having an integrated temperature sensor ("heating substrate") for adjusting distinctive temperatures in the reaction chamber as well as a circuit board optionally having an EPROM for electrically contacting the heating substrate.
The individual components are embedded in two shells made of synthetic material. The entire unit is a spatially closed system, in which all required reactions (for example PCR) can be conducted in a temperature-controlled manner.

- 65 -First, the circuit board is inserted into the provided shaft in the lower shell (with the EPROM
facing downward). On the upper side of the circuit board, three electric contact pads are arranged, which ensure the electric connection with the subsequently inserted heating substrate, which in turn bears the contact pads. Said heating substrate has a size of 8 mm x 6 mm and a thickness of about 0.6 mm. The heating substrate ensures exact adjustment of different temperatures (for example of 40 C to 95 C) within the scope of the examination conducted. Herein, measuring the temperature in the reaction chamber can be conducted either via the sensor integrated in the heating substrate or via an external measuring unit, which measures the temperature directly on the surface of the heating substrate. In the latter case, the integrated sensor in the heating substrate can be omitted.
The integrated components used for heating and / or temperature measurement can, for example, be diodes or also transistors. The surface of the silicon heating substrate, which is facing toward the reaction space, contains no electric systems whatsoever and is coated with an SiO2 passivating layer.
The next component is an elastic seal, which laterally limits the reaction space.
In the center of the reaction space, the DNA chip is attached in such a way that the probe array is facing toward the detection plane. After inserting the detection plane in the form of a glass surface, said surface still protrudes from the lower shell by 0.2 mm. By subsequently joining the upper shell, which is guided by means of locating pins, the glass surface is pressed against the seal and thus ensures optimal sealing of the reaction chamber.
Subsequently, the reaction chamber can be filled with reaction solution.
Herein, it is to be noted that only the inner space containing the chip is filled, but not the outer chambers. The liquids required are injected into the reaction space with cannulas via the provided cannula guide.
Subsequently, biochemical reactions controlled via the silicon heating substrate, like for example PCR and / or hybridization, can be conducted in the reaction chamber.
For detecting the intermediate results or the final result, the detection plane is pressed against the DNA chip from above by means of the spacers of the detection unit, until the distance

- 66 -between detection plane and probe array is about zero. Herein, the surrounding liquid is dislocated into the outer chambers, where it compresses the local air. This process is reversible and can, for example, be conducted after each PCR cycle.
Due to its compact design and the internal circuit board having an EPROM and the integrated heating substrate, this variant of the device according to the present invention is particularly suitable for mobile use.
Example 3: Detection of the decrease of the background signal by dislocating the analvte All fluorescence measurements described in this Example were conducted by means of a fluorescence microscope (Zeiss, Jena, Germany). Excitation was conducted in incident light using a white light source and a filter set suitable for Cyanine 3. The signals were recorded by means of a CCD camera (PCO-Sensicam, Kehlheim, Germany). In the following, the thickness of the gap denotes the distance between microarray and detection plane.
a) Measuring the fluorescence signal of the analyte depending on the thickness of the gap Channel shells having defined channel depth (5 um, 10 um, 28 um) were cast of Sylgard. The channels had a width of 125 p.m. A glass chip was laid across the unequally deep channels.
The channels were then filled with a 200 nM solution of a Cy3-labeled oligonucleotide in 2 x SSC + 0.2 % SDS and the signal was measured with an exposure time of 1.5 s.
In Figure 12, the measured results are depicted. The signal increases linearly as channel depth rises. A straight regression line could be calculated (Equation 1) (Equation 1) F(x) = 6.2468x + 50.016 With the aid of the regression equation obtained (Equation 1), the layer thicknesses between DNA chip and detection plane can now be determined by means of the background fluorescence signal.

- 67 -This was checked by means of stacking two glass surfaces (chips) having structured marks on their upper sides (crosses, numbers, and data matrix in Figure 14), which could be focused.
The chips were stacked in such a way that the structured marks were oriented toward each other and were only separated by a thin liquid layer. A 200 nM solution of a Cy3-labeled oligonucleotide in 2 x SSC + 0.2 % SDS was used as liquid. With the aid of a focusing device of the microscope, which was equipped with a scale, the distance between the marks and therefore the layer thickness of the liquid film could be determined directly.
The intensity of the background is 158 gray values with an exposure time of 0.75 s. The thickness of the gap measured at the fluorescence microscope is 40 gm. Assuming that the measured gray values behave linearly in relation to exposure time (see Figure 13), the resulting thickness of the gap, using Equation 1, is 42.6 wn. The values for the thickness of the liquid layer thus obtained are well matched.
b) Experiments for reducing or eliminating the background fluorescence by means of compressing the process unit In said experiments, the hybridization signal was measured depending on the displacement of the fluorescent analyte by means of pressure exerted by a tappet. The experimental setup is sketched in Figure 15. By means of pushing the tappet, the silicon chip (3.15 x 3.15 mm) was pressed against a probe chip (DNA chip) and in this process the liquid located between the two surfaces was dislocated.
For conducting the experiment, the chamber was filled with a hybridization solution, which is a model system for the conditions in a ?CR hybridization. The hybridization solution contained a Cy3-labeled oligonucleotide (final concentration 2 nM in 2 x SSC +
0.2 % SDS), which had complementarity to the probe array. In addition, the hybridization solution contained a likewise Cy3-labeled oligonucleotide, which does not hybridize with the probe array and therefore only contributes to the fluorescence background signal in the solution, but not the specific signals at the spots.
Hybridization was conducted for 10 mm. For subsequently reading out the hybridization signals, a fixed exposure time of 1.5 s was selected. At the experimental setup, the tappet was

- 68 -pushed nearer toward the probe array (detection plane) after each recording, so that the gap between array and second surface, which is filled with hybridization solution, was reduced.
Figure 16 shows a recording of the hybridization signal with a thickness of the gap of 10 Inn.
The measured results for background signal and hybridization signal at the spots are depicted in Figure 17. According to expectations, both signals behave linearly in relation to the thickness of the gap. Thus, the spot signal corrected by the background does not change with the thickness of the gap.
When a gray value of 255 is reached, the measuring instrument is overloaded.
I.e., with a thickness of the gap of about 17 m, measuring the spot intensity is only possible by means of reducing exposure time. Therefore, measuring sensitivity is then reduced.
Thus, the dynamic measuring range is increased by reducing the thickness of the gap. By means of background adjustment of the spot signals (difference formation), the thickness of the gap can be varied in a broad range without influencing measurement and measured results. With very large thicknesses of the gap (> 20 m), measurement is strongly impaired due to overload of the detector.
c) Amplification, hybridization and detection as one-stage reaction Two process units having a structure according to Figure 15 were mounted and numbered.
Two identical reaction setups having the following composition were prepared:
Reaction setup:
20 mM dNTPs ................................................. 0.5 1 1 M potassium acetate (Kaac) ................................ 3 I
25 mM Mg-acetate Eppendorf .................................. 5 tl Clontech C-DNA PCR buffer ................................... 5 1 Eppendorf Taq-polymerase .................................... 3 1 f.tM primer CMV_DP_Cy3 ................................... 1 1

- 69 -Cy3_5`TGAGGCTGGGAARCTGACA3`
M Primer CMV_UP_NH2 ..................................... 0.66 1 5`GGGYGAGGAYAACGAAATC3' NH2 10 M primer CMV_UP ......................................... 0.33 1 5`GGGYGAGGAYAACGAAATC3`
10 M primer Entero_DP_Cy3 .................................. 1 pl Cy3_5`CCCTGAATGCGGCTAAT3' 10 pM primer Entero_UP_NH2 .................................. 0.66 p.1 5`ATTGTCACCATAAGCAGCC3LNH2 10 M primer Entero UP ....................................... 0.33 pl 5`ATTGTCACCATAAGCAGCC3' ....................................
10 M primer HSVl_DP_Cy3 ................................... 1 pl Cy3_5`CTCGTAAAATGGCCCCTCC3' 10 M primer HSVl_UP_NH2 .................................... 0.66 1 5`CGGCCGTGTGACACTATCG3' NH2 ................................
10 M primer HSV1 UP ........................................ 0.33 1 5`CGGCCGTGTGACACTATCG ......................................
10 M primer HSV2_UP_Cy3 .................................... 1 I
Cy3_5`CGCTCTCGTAAATGCTTCCCT3' ...............................
10 M primer HSV2_DP_NH2 .................................... 0.66 1 5`TCTACCCACAACAGACCCACG3`_NH2 10 ?AM primer HSV2_DP ....................................... 0.33 IA
5`TCTACCCACAACAGACCCACG3' 10 M primer VZV DP_Cy3 ..................................... 1 I
Cy3_5`TCGCGTGCTGCGGC
10 M primer VZV_UP_NH2 ..................................... 0.66 pl 5`CGGCATGGCCCGICTAT3' NH2 10 M primer VZV_UP ......................................... 0.33 pl 5'CGGCATGGCCCGTCTAT
Template CMV ................................................ 1 I
PCR grade water ............................................. 22.5 pl total ...................................................... 50 pl

- 70 -The process units were each filled with 50 I reaction setup and processed according to the following temperature-time regime.
1 Denaturation .............................................. 95 C
Duration .................................................... 300 s 2 Denaturation .............................................. 95 C
Duration .................................................... 1 0 s 3 Annealing / Extension ..................................... 60 C
Duration .................................................... 20 s Repeating steps 2 to 3 ..................................... 35 times 4 Denaturation .............................................. 95 C
Duration .................................................... 300 s Hybridization ............................................. 40 C
Duration .................................................... 3600 s Subsequently, the two process units were subjected to different treatments. In the first case (process unit 1), the background fluorescence was reduced by means of displacing the analyte. This was ensured by means of pushing the tappet upward in the direction of the detection plane, so that the gap filled with reaction solution is reduced as far as possible.
In the second case (process unit 2), the analyte was replaced by a non-fluorescent solution.
The replacement of the solution was conducted with 2 x SSC buffer at a fluctuation rate of 300 I / min and a rinsing volume of 900 1. This procedure corresponds to the state of the art.
Subsequently, both strategies for reducing background fluorescence were compared. To this end, the hybridization signals in both process units were detected with the aid of the fluorescence microscope camera setup described.

- 71 -Exposure time was 5 s (see Figure 18 and Figure 19). Comparing the spot intensities was conducted using the spot with the substance CMV_S_21-3 (5' -NH2TGTTGGGCAACCACCGCACTG-3'). The location of the probes is indicated in Figures 18 and 19.
In Figure 20, the result of the experiment is summarized. By means of rinsing the reaction chamber in the process unit 2, the hybridization signal is reduced compared to the displacement in process unit 1. It is assumed that bleeding of the probes is responsible for this.
Thus, the method of analyte displacement according to the method of the present invention is to be preferred to replacement of the solutions.
In order to obtain detection of amount and integrity of the amplification product, 5 ill of each reaction solution were additionally analyzed on a 2% agarose gel. The result (ethidium bromide-stained gel detected with an UV transilluminator) can be seen in Figure 21.
Example 4: Device for processing and detecting reaction cartridges according to the present invention A device for processing and detecting reaction cartridges according to the present invention in accordance with this Example is shown in Figure 28.
The device for conducting microarray-based tests with reaction cartridges according to the present invention usually consists of several components, which can be united in one device or can be assembled modularly from several partial devices. Herein, the device can optionally be activated via an integrated computer or via an interface with an external computer. The structure of the device is illustrated in Figure 28.
An exemplary procedure occurs as follows:
The fluid interface of the reaction cartridge is manually brought in the filling position, wherein the cannulas pierce the seal of the chamber body, by the operator.
Subsequently, the

- 72 -operator feeds the reaction mixture into the reaction chamber by means of a standard laboratory pipette. Both steps can also be taken over by a correspondingly developed device.
The fluid interface is then again brought in the initial position, wherein said procedure can also be conducted by a correspondingly developed device.
The reaction cartridge is then inserted into the device. A data matrix reader, which is arranged in the device, recognizes the biunique data matrix attached to the reaction cartridge and, by way of a data record transmitted by the user, loads the data characteristic for the cartridge and for the test to be conducted into the control computer. Said computer then controls the individual process steps, which can, for example, comprise an amplification and hybridization. Via the integrated pressure mechanism, the capillary gap in the reaction chamber is subsequently reduced for detection according to the present invention.
Detection can be conducted with conventional fluorescence-optical imaging or non-imaging systems. The data obtained are subsequently transmitted to a control computer, which evaluates them and presents or stores them on an internal or external interface.
The reaction cartridge can then be taken from the device and be discarded by the operator.
Example 5: Reaction cartridge made of electrically conductive synthetic material A reaction cartridge as depicted in Figure 29 is prepared.
The lower shell (1) of the reaction cartridge consists of electrically conductive synthetic material forming the base of the reaction chamber (Conduct 2, RKT, Germany). A
foil PT-100 temperature sensor is fixed to the lower side of the chamber base with the aid of a suitable adhesive, for example Loctite 401 (Loctite, Germany). Together with the seal (3) and the covering glass (4), the lower shell forms the reaction chamber of the cartridge according to the present invention.

- 73 -The cartridge further has a threaded drill hole (2) for inserting screws for electric contacting, an upper shell (5) of the reaction cartridge, for example made of acryl, a drill hole (6) for attaching the upper shell, and a detection window (7) in the upper shell.
A standard PCR reaction mixture is prepared:
30.5 I de-ionized water 110 x PCR buffer (for example 10 x cDNA PCR reaction buffer, Clontech, Germany) 5 pl Mg-acetate, 25 mM (for example Eppendorf, Germany) 0.5 pl dNTP, 20 mM each 1 pl 16sfD1 (5'-AGAGTTTGATCCTGGCTCAG-3'), 10 mM
1 pl 16sRa (5'-TACCGTCACCATAAGGCTTCGTCCCTA-3'), 10 mM
3 I TN DNA polymerase (for example Genaxxon, Germany) I ill template By means of an insulin syringe (Becton Dickinson, Germany), the reaction chamber is filled with the reaction mixture. For ventilation during the filling procedure, a second cannula is pierced through the seal of the chamber body. After filling, ventilation cannula and insulin syringe are expertly discarded.
The chamber is then connected to a regulating unit (CLONDIAG chip technologies GmbH, Germany) via the two screws provided for this purpose. Likewise, the temperature sensor is connected to said regulating unit at the lower side of the lower shell. Said regulating unit is capable of regulating specific temperatures in the lower shell according to a predefined program.
In this manner, the following PCR program is conducted: 5 min 95 C, 30 x (30 s 95 C, 30 s 62 C, 50 s 72 C).
Figure 30 shows an image of the reaction cartridge recorded with a thermal imaging camera at a temperature of 95 C.

- 74 -After completion of the program, the reaction product is removed from the reaction chamber by means of an insulin syringe. Analogously, a cannula is pierced through the seal of the chamber body for ventilation during the emptying of the reaction chamber.
The reaction product is now analyzed by means of agarose gel electrophoresis.
To this end, IA of the reaction solution, together with a suitable buffer (for example 5 IA
250 mM in 50%
glycerin, bromphenol blue), are applied in the pocket of a 2% agarose gel and electrophoresis is conducted. The result is depicted in Figure 31.
As can clearly be seen, an amplification product of correct size and in an amount comparable to the positive control could be obtained in all cases.

- 75 -Figures Figure 1:
Survey of the device according to the present invention comprising a read out device and the process unit Figure 2:
View of the process unit according to the present invention.
Figure 3:
Exploded view of the process unit according to the present invention, comprising the detection plane, seal, DNA chip, and chamber body. The chamber body has a reversibly deformable elastic membrane.
Figure 4:
View of the chamber body having a heating meander surrounded by injection-molded synthetic material in the elastic membrane.
Figure 5:
View of the state of the process unit according to the present invention in the read out device A) during the PCR, B) before the detection, and C) during the detection.
Figure 6:
View of the mode of function of the process unit according to the present invention having membrane seal, compensation fold, and lower side hole. In A), the process unit can be seen in normal position. In B), the process unit can be seen in compressed form, wherein the fluorescent solution between DNA chip and detection plane is displaced.
Figure 7:
View of a rotary disc, whereon four temperature blocks are installed. The temperature blocks are thermostaticized to one temperature each. By means of rotating the disc and / or the process unit, the temperature in the reaction chamber can be altered.

- 76 -Figure 8:
View of an example of a milled and bolted process unit.
Figure 9:
View of an example of a compressing or crimping device for the process unit according to the present invention for detecting the hybridization signals in a conventional fluorescence microscope.
Figure 10:
View of a process unit according to the present invention having a circuit board as electric connection for heater and temperature sensor. The heater is developed as semi-conductor component.
Figure 11:
Exploded view of the process unit shown in Figure 10.
Figure 12:
View of the straight regression line for determining the width of a gap filled with fluorophore.
Figure 13:
View of the linear progress of the fluorescence signal as exposure time increases over the measured region.
Figure 14:
Fluorescence recording of two superimposed chips, the gap between which is filled with 200 nM Cy3 fluorophore. The intensity of the background is 158 gray values at an exposure time of 0.75 s. The thickness of the gap measured at the fluorescence microscope is 40.00 gm.
Assuming that the measured gray values behave linearly in relation to exposure time (see Figure 13), the resulting thickness of the gap, using Equation 1, is 42.6 gm.
The values for the thickness of the layer thus obtained are well matched..
Figure 15:
View of the experimental setup for detecting DNA arrays without rinsing.

- 77 -Figure 16:
Fluorescence recording of an array with chip pressed against it. By the white edges, the background radiation of the displaced sample solution can be seen.
Figure 17:
Decrease of absolute intensities of signal and background when the thickness of the gap is reduced. The difference of both values is constant throughout the measured region.
Figure 18.
Detection of the probe signals by means of displacing the background fluorescence. At the left edge, the non-displaced liquid can be seen.
Figure 19:
Detection of the probe signals of a DNA array, which was background-adjusted by means of rinsing.
Figure 20:
Summary of the measured results for experimental comparison of displacement and replacement of the analyte.
Figure 21:
Reference analytics of the PCR in a process unit by means of gel electrophoresis.
Figure 22:
Diagrammatic view of a detachable filling unit for filling reaction cartridges with reactive substances or buffers. Herefor, the following reference numbers are used:
1 Filling unit 1.1 Mechanical interface filling unit - cartridge 2 Cartridge 2.1 Mechanical interface cartridge ¨ filling unit 2.2 Seal 2.3 Reaction chamber

- 78 -2.4 Peferred opening in the cartridge for the cannulas 3 Filing channel 3.1 Fluidic and mechanical interface with sample-adding tools 3.2 Filling cannula 4 Waste channel with waste container 4.1 Ventilation hole 4.2 Waste cannula Figure 23:
View of the procedure for filling a reaction cartridge by means of a modular filling unit.
Figure 24:
Diagrammatic view of an integrated filling unit for filling reaction cartridges with reactive substances or buffers in the preferred position without penetration of the seal of the chamber body. Herefor, the following reference numbers are used:
1 Filling unit - cartridge 1.1 Mechanical interface cartridge ¨ filling unit 2 Reaction cartridge 2.1 Mechanical interface cartridge ¨ filling unit 2.2 Seal 2.3 Reaction space 2.4 Preferred opening for the cannulas in the cartridge casing 3 Filling channel 3.1 Fluidic and mechanical interface with sample-feeding tools 3.2 Filling cannula 4 Waste channel with waste container 4.1 Fluidic and mechanical interface with sample-deducting units 4.2 Waste cannula Equipment for preferred position, here: spring Figure 25:
View of the procedure for filling a reaction cartridge having an integrated filling unit.
Figure 26:

- 79 -Diagrammatic view of an integrated filling unit having an integrated waste container for filling reaction cartridges with reactive substances or buffers in the preferred position without penetration of the seal of the chamber body. Herefor, the following reference numbers are used in addition to the reference numbers of Figure 24:
4 Waste channel with waste container 4.1 Ventilation hole Figure 27:
a) Filling of the reaction space when deducting the surplus liquid into a waste container or channel b) Deduction of surplus liquid when reducing the reaction space for detection Herein, the following reference numbers are used:
1 Reaction chamber 2 Seal 3 Pressure mechanism 4 Fluid interface 4.1 Deducting cammla 4.2 Feeding cannula Figure 28:
Device for processing and detecting reaction cartridges according to the present invention in accordance with Example 4. Herein, the following reference numbers are used:
1 Reaction cartridge 1.1 Reaction chamber with microarray 1.2 Fluid system interface 1.3 Seal of the chamber body 1.4 Electric connections for heating system, optionally also temperature sensors 1.5 Chip 1.6 Position-securing system for implementing a preferred position and guiding the cannulas 1.7 Cannulas 2 Pressure mechanism 3 Identification system, for example bar code or data matrix

- 80 -3.1 Identification optics, for example bar code or data matrix reader 4 Detection optics Fluid connections Figure 29:
Reaction cartridge according to Example 5.
Figure 30:
Recording of the reaction cartridge according to Example 5 recorded with a thermal imaging camera at a temperature of 95 C.
Figure 31:
Analysis of the reaction product according to Example 5 by means of agarose gel electrophoresis. Herein, the reference numbers indicate:
1, 5: Positive control from the thermocycler 2-4: Reaction products from the cartridges 6: 100 bp standard

Claims

Claims:

1. A device for qualitatively and/or quantitatively detecting molecular interactions between probe molecules and target molecules, the device comprising:
a. a micro-array on a substrate onto which probe molecules are immobilized on array elements, said micro-array being disposed on a first surface of the device; and b. a compressible reaction chamber formed between the first surface including the micro-array disposed thereon and a second surface, the distance between said micro-array and the second surface being variable, wherein the first surface is elastically deformable in at least a zone below said micro-array such that said micro-array disposed on the first surface is moveable towards the second surface to become flush with the second surface causing displacement of a sample solution containing labeled molecules that do not interact with the probe molecules before performing detection.

2. The device according to claim 1, wherein the distance between said micro-array and the second surface is variable in a range of about 0 to about 1 mm.

3. The device according to claim 1 or 2, further comprising laterally limiting compensation zones for the compressible reaction chamber, said compensation zones maintaining the volume essentially constrant within the compressible reaction chamber upon reducing the distance between said micro-array and the second surface.

4. The device according to any one of claims 1 to 3, wherein said compressible reaction chamber is laterally delimited by elastic seals.

5. The device according to any one of claims 1 to 4, wherein the first surface is made of an elastic plastic.

6. The device according to claim 4 or 5, wherein the first surface is formed by two superimposed layers, the outer layer of the two superimposed layers having a recess in at least in the zone below said micro-array.

7. The device according to claim 6, wherein an inner one of the two superimposed layers is formed of an elastic seal.

8. The device according to any one of claims 4 to 7, wherein said device comprises a means by which said micro-array may be guided relative to the second surface.

9. The device according to claim 8, wherein said micro-array is guided relative to the second surface by compression and/or tension acting upon the first surface.

10. The device according to claim 8 or 9, wherein the first surface may be set into vibration by said means.

11. The device according to any one of claims 1 to 10, wherein the compressible reaction chamber is a capillary gap between the chamber carrier and said micro-array.

12. The device according to claim 11, wherein said capillary gap has a thickness in a range of about 0 µm to about 100 µm.

13. A method of qualitatively and/or quantitatively detecting molecular interactions between probe and target molecules, the method comprising:
introducing a sample solution containing target molecules into the compressible reaction chamber of the device according to any one of claims 1 through 12;
reducing the distance between said micro-array and second surface by guiding the micro-array towards the second surface; and detecting an interaction between the target molecules and the probe molecules immobilized on said substrate.

14. The method according to claim 13, wherein the distance between said micro-array and the second surface prior to detection is held in a position enabling the interaction between the target molecules and the probe molecules immobilized on said substrate.

15. The method according to claim 13 or 14, wherein in step b) the distance between said micro-array and second surface is changed so that the sample solution between said micro-array and second surface is essentially removed.

16. The method according to any one of claims 13 to 15, wherein the target molecules are provided with a detectable marker.

17. The method according to claim 16, wherein said detectable marker is a fluorescence marker.

18. The method according to any one of claims 13 to 17, wherein said probe molecules and/or target molecules are nucleic acids and/or nucleic acid analogs.

19. Use of the device according to any one of claims 1 to 12 for carrying out tests based on micro-arrays.

20. A method for detection of molecular interactions between probe and target molecules comprising:
(a) introducing a sample solution comprising target molecules into a reaction chamber which is formed between a first surface having a microarray arranged thereon and a second surface, wherein the microarray comprises a substrate with array elements having probe moleucles immobilized thereon;
(b) detecting an interaction between the target molecules and the probe molecules immobilized on the substrate, wherein between introducing the sample solution comprising target molecules into the reaction chamber and detecting, no removal of solutions from the reaction chamber occurs, and wherein in step (b) the distance between the microarray and the second surface is varied such that the sample solution between the microarray and the second surface is essentially removed.

21. A device for qualitative and/or quantitative detection of molecular interactions between probe molecules and target molecules in a sample solution, comprising:
a microarray having probe molecules immobilized on array elements, wherein the microarray is arranged on a first surface of the device; and a reaction chamber which is formed between the first surface having the microarray arranged thereon and a second surface, wherein laterally limiting compensation zones are provided for the reaction chamber which keep the volume within the reaction chamber essentially constant upon reduction of the distance between the microarray and the second surface such that the sample solution between the microarray and the second surface is essentially removed, further wherein the first surface is elastically deformable at least in the zone below the microarray such that the microarray may be guided relative to the second surface so that the distance between the microarray and the second surface is variable such that the sample solution between the microarray and the second surface is essentially removed.

22. The device according to claim 21, further comprising a means for varying the distance between the microarray and the second surface in such a way that the sample solution between the microarray and the second surface may be essentially removed.

23. The device according to claim 21 or 22, wherein the distance between the microarray and the second surface is variable in a range of about 0 to about 1 mm.

24. The device according to any one of claims 21 to 23, wherein the device additionally comprises a temperature control unit for controlling the temperature within the reaction chamber.

25. The device according to any one of claims 21 to 24, wherein the device additionally comprises a temperature regulating unit for regulating the temperature within the reaction chamber.

26. The device according to any one of claims 21 to 25, wherein the device further comprises a detection system for detection of an interaction between the target molecules to be detected and the probe molecules immobilized on the array element.

27. The device according to claim 26, wherein the detection system is a fluorescence optical system.

28. The device according to claim 27, wherein the fluorescence optical system is a fluorescence microscope without autofocus.

29. The device according to claim 26, 27 or 28, wherein the detection system is connected to a spacer which, when resting upon the second surface, adjusts a distance between the detection system and the second surface.

30. The device according to any one of claims 21 to 29, wherein the second surface is made of an optically transparent material.

31. The device according to claim 30, wherein the optically transparent material is an optically transparent plastic.

32. The device according to any one of claims 21 to 31, wherein the first surface is made of elastic plastics.

33. The device according to any one of claims 22 to 32, wherein the means for varying the distance between the microarray and the second surface is selected from one of more of pressure, tension and vibration that acts upon the first surface.

34. The device according to any one of claims 29 to 33, wherein the second surface is guidable relative to the first surface by the spacer acting upon the second surface by pressure, tension or both so that the distance between the microarray and the second surface is variable.

35. The device according to any one of claims 21 to 34, wherein the probe and/or target molecules are biopolymers selected from the group consisting of nucleic acids, peptides, proteins, antigens, antibodies, carbohydrates, analogs thereof and copolymers thereof.

36. Use of the device according to any one of claims 22 to 35 for carrying out microarray-based tests.