CA2425643A1 - Cancer-linked genes as targets for chemotherapy - Google Patents
Cancer-linked genes as targets for chemotherapy Download PDFInfo
- Publication number
- CA2425643A1 CA2425643A1 CA 2425643 CA2425643A CA2425643A1 CA 2425643 A1 CA2425643 A1 CA 2425643A1 CA 2425643 CA2425643 CA 2425643 CA 2425643 A CA2425643 A CA 2425643A CA 2425643 A1 CA2425643 A1 CA 2425643A1
- Authority
- CA
- Canada
- Prior art keywords
- leu
- glu
- ser
- val
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Hospice & Palliative Care (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- General Engineering & Computer Science (AREA)
Abstract
Cancer-linked gene sequences, and derived amino acid sequences, are disclose d along with processes for assaying potential antitumor agents based on their modulation of the expression of these cancer-linked genes. Also disclosed ar e antibodies that react with the disclosed polypeptides and methods of diagnosing and treating cancer using the gene sequences. A novel gene and polypeptide are also disclosed.
Description
CANCER-LINKED GENES AS TARGETS FOR
CHEMOTHERAPY
This application claims the benefit of U.S. provisional application Serial No. 60/239,294, filed 11 October 2000; 60/239,297, filed 11 October 2000;
60/239,605, filed 11 October 2000; 60/239,802, filed 12 October 2000;
60/239,805, filed 12 October 2000; 60/239,806, filed 12 October 2000;
60/240,622, filed 16 October 2000; 60/241,682, filed 19 October 2000;
60/241,723, filed 19 October 2000; and 60/244,932, filed 31 October 2000, the disclosures of which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to methods of screening cancer-linked genes and expression products for involvement in the cancer initiation and facilitation process and the use of such genes for screening potential anti-cancer agents, including small organic compounds and other molecules.
BACKGROUND OF THE INVENTION
Cancer-linked genes are valuable in that they indicate genetic differences between cancer cells and normal cells, such as where a gene is expressed in a cancer cell but not in a non-cancer cell, or where said gene is over-expressed or expressed at a higher level in a cancer as opposed to normal or non-cancer cell. In addition, the expression of such a gene in a normal cell but not in a cancer cell, especially of the same type of tissue, can indicate important functions in the cancerous process. For example, screening assays for novel drugs are based on the response of model cell based systems in vitro to treatment with specific compounds. Various measures of cellular response have been utilized, including the release of cytokines, alterations in cell surface markers, activation of specific enzymes, as well as alterations in ion flux and/or pH. Some such screens rely on specific genes, such as oncogenes (or gene mutations). In accordance with the present invention, a cancer-linked gene has been identified and its putative amino acid sequence worked out. Such gene is useful in the diagnosing of cancer, the screening of anticancer agents and the treatment of cancer using such agents, especially in that these genes encode polypeptides that can act as markers, such as cell surface markers, thereby providing ready targets for anti-tumor agents such as antibodies, preferably antibodies complexed to cytotoxic agents, including apoptotic agents. .
BRIEF SUMMARY OF THE INVENTION
In accordance with the present invention, there is provided herein a set of genes related to, or linked to, cancer, or otherwise involved in the cancer initiating and facilitating process and the derived amino acid sequences thereof.
In a particular embodiment, such genes are those corresponding to the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and which encode polypeptides, including those comprising a sequence of SEQ ID NO:
CHEMOTHERAPY
This application claims the benefit of U.S. provisional application Serial No. 60/239,294, filed 11 October 2000; 60/239,297, filed 11 October 2000;
60/239,605, filed 11 October 2000; 60/239,802, filed 12 October 2000;
60/239,805, filed 12 October 2000; 60/239,806, filed 12 October 2000;
60/240,622, filed 16 October 2000; 60/241,682, filed 19 October 2000;
60/241,723, filed 19 October 2000; and 60/244,932, filed 31 October 2000, the disclosures of which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to methods of screening cancer-linked genes and expression products for involvement in the cancer initiation and facilitation process and the use of such genes for screening potential anti-cancer agents, including small organic compounds and other molecules.
BACKGROUND OF THE INVENTION
Cancer-linked genes are valuable in that they indicate genetic differences between cancer cells and normal cells, such as where a gene is expressed in a cancer cell but not in a non-cancer cell, or where said gene is over-expressed or expressed at a higher level in a cancer as opposed to normal or non-cancer cell. In addition, the expression of such a gene in a normal cell but not in a cancer cell, especially of the same type of tissue, can indicate important functions in the cancerous process. For example, screening assays for novel drugs are based on the response of model cell based systems in vitro to treatment with specific compounds. Various measures of cellular response have been utilized, including the release of cytokines, alterations in cell surface markers, activation of specific enzymes, as well as alterations in ion flux and/or pH. Some such screens rely on specific genes, such as oncogenes (or gene mutations). In accordance with the present invention, a cancer-linked gene has been identified and its putative amino acid sequence worked out. Such gene is useful in the diagnosing of cancer, the screening of anticancer agents and the treatment of cancer using such agents, especially in that these genes encode polypeptides that can act as markers, such as cell surface markers, thereby providing ready targets for anti-tumor agents such as antibodies, preferably antibodies complexed to cytotoxic agents, including apoptotic agents. .
BRIEF SUMMARY OF THE INVENTION
In accordance with the present invention, there is provided herein a set of genes related to, or linked to, cancer, or otherwise involved in the cancer initiating and facilitating process and the derived amino acid sequences thereof.
In a particular embodiment, such genes are those corresponding to the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and which encode polypeptides, including those comprising a sequence of SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
More particularly, such genes whose expression is changed in cancerous, as compared to non-cancerous cells, from a specific tissue, for example, lung, where the gene would include a polynucleotide corresponding to the nucleotide sequence of SEQ ID NO: 1 or sequences that are substantially identical to said sequence and/or encode the polypeptide with amino acid sequence of SEQ ID NO: 2 or a polypeptide differing therefrom by conservative amino acid substitutions..
It is another object of the present invention to provide methods of using such characteristic genes as a basis for assaying the potential ability of selected chemical agents to modulate upward or downward the expression of said cancer characteristic, or related, genes.
It is a further object of the present invention to provide methods of detecting the expression, or non-expression, or amount of expression, of said characteristic gene, or portions thereof, as a means of determining the cancerous, or non-cancerous, status (or potential cancerous status) of selected cells as grown in culture or as maintained in situ.
It is a still further object of the present invention to provide methods for treating cancerous conditions utilizing selected chemical agents as determined from their ability to modulate (i.e., increase or decrease) the characteristic gene, or its protein product.
The present invention also relates to a process for treating cancer comprising contacting a cancerous cell with an agent having activity against an expression product encoded by the genes, which process may be conducted either ex vivo or in vivo and which product is disclosed herein.
Such agents may comprise an antibody or other molecule or portion that is specific for said expression product. In a preferred embodiment, the polypeptide product of such genes is a polypeptide as disclosed herein, such as SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
DETAILED SUMMARY OF THE INVENTION
The present invention relates to processes for utilizing a nucleotide sequence for a cancer-linked gene (SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19) and the derived amino acid sequence (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20) as targets for chemotherapeutic agents, especially anti-cancer agents.
More particularly, such genes whose expression is changed in cancerous, as compared to non-cancerous cells, from a specific tissue, for example, lung, where the gene would include a polynucleotide corresponding to the nucleotide sequence of SEQ ID NO: 1 or sequences that are substantially identical to said sequence and/or encode the polypeptide with amino acid sequence of SEQ ID NO: 2 or a polypeptide differing therefrom by conservative amino acid substitutions..
It is another object of the present invention to provide methods of using such characteristic genes as a basis for assaying the potential ability of selected chemical agents to modulate upward or downward the expression of said cancer characteristic, or related, genes.
It is a further object of the present invention to provide methods of detecting the expression, or non-expression, or amount of expression, of said characteristic gene, or portions thereof, as a means of determining the cancerous, or non-cancerous, status (or potential cancerous status) of selected cells as grown in culture or as maintained in situ.
It is a still further object of the present invention to provide methods for treating cancerous conditions utilizing selected chemical agents as determined from their ability to modulate (i.e., increase or decrease) the characteristic gene, or its protein product.
The present invention also relates to a process for treating cancer comprising contacting a cancerous cell with an agent having activity against an expression product encoded by the genes, which process may be conducted either ex vivo or in vivo and which product is disclosed herein.
Such agents may comprise an antibody or other molecule or portion that is specific for said expression product. In a preferred embodiment, the polypeptide product of such genes is a polypeptide as disclosed herein, such as SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
DETAILED SUMMARY OF THE INVENTION
The present invention relates to processes for utilizing a nucleotide sequence for a cancer-linked gene (SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19) and the derived amino acid sequence (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20) as targets for chemotherapeutic agents, especially anti-cancer agents.
Characteristic gene sequences whose expression, or non-expression, or change in expression, are indicative of the cancerous or non-cancerous status of a given cell and whose expression is changed in cancerous, as compared to non-cancerous cells, from a specific tissue, are genes that include the nucleotide sequences disclosed herein or sequences that are substantially identical to said sequence, at least about 90% identical, preferably 95% identical, most preferably at least about 98% identical and especially where such gene has the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. Such sequences have been searched within the GenBank database, with the following results.
The present invention relates to nucleotide sequences and derived polypeptides having the following characteristics:
A nucleotide sequence with Genbank Accession Numbers:
NM 014109 and AA235448, representing an amplified bromodomain-containing protein in cancer that was identified with the following specific characteristics: UniGene Cluster: Hs. 46677; Locus Link ID: none;
Sequence Information: 1934 by mRNA (cDNA is SEQ ID NO: 1) 1086 by ORF and 362 amino acids (SEQ ID NO: 2) with Chromosomal Location:
8q24 (based on alignment to mapped human genomic sequence). The deposited information represented a prediction of coding sequence deduced from a cDNA clone of unknown function. In accordance with the present invention, this message was up-regulated by at least 3-fold in lung cancer versus normal lung tissue. A search against the Prosite database reveals a domain with 100% similarity to the bromodomain 2 sequence, which is contained in a number of transcription factors. A key role for bromodomain proteins in maintaining normal proliferation is indicated by the implication of several bromodomain proteins in cancer, with four of these identified at translocation breakpoints.
A novel gene identified based upon EST sequences present within dbEST. This novel gene represents a novel member of the family of Toll-like receptors and a portion of the polypeptide derived therefrom has at least 39%
sequence identity to human toll-like receptor 1. Five of the human Toll-like receptors (called TLRs 1-5) may be direct homologs of the corresponding fly molecule and may constitute an important component of innate immunity in humans. Expression analysis shows that this gene is specifically expressed by B-lymphocytes. Characteristics were: Genbank Accession Number for sample EST in cluster: AA648836; UniGene Cluster: Hs.89206; Locus Link ID: 10330; Cluster Name: ESTs, Weakly similar to TLR6 [H.sapiens];
Sequence Information: 1274 by mRNA (cDNA is SEQ ID NO: 3 with encoded polypeptide SEQ ID NO: 4. The UniGene cluster is composed of 10 sequences, all derived from tonsil. Microarray expression analysis indicates specific expression in B-lymphocytes.
A nucleotide sequence with Genbank Accession Number: AB015631 with the following specific characteristics: Genbank Accession Number:
AB015631; UniGene Cluster: Hs.8752; Locus Link ID: 10330; Cluster Name: Transmembrane protein 4; Sequence Information: 814 by mRNA
(cDNA is SEQ ID NO: 5 with encoded polypeptide as SEQ ID NO: 6) and Chromosomal Location: 12. The UniGene cluster is composed of over 22 sequences derived from a number of tissues. Strongest levels of expression in normal tissues were detected in skeletal muscle.
A nucleotide sequence with Genbank Accession Number: NM 014397, AB026289 and with the following specific characteristics: UniGene Cluster:
Hs.9625; Locus Link ID: 27073; Public Cluster Name: SIDE-1512, putative serine-threonine protein kinase; Sequence Information: 1597 by mRNA
(SEQ ID NO: 7), 921 by ORF and 307 amino acids (and SEQ ID NO: 8) with Chromosomal Location: 9q33. From the record in Genbank the complete mRNA and protein sequences are obtained. SIDE-1512 shares sequence similarity with murine NEK1, a kinase involved in cell cycle regulation. The UniGene cluster contains over 150 EST sequences from a variety of tissue sources. The top BLAST score was to protein kinase nek1, which contains an N-terminal protein kinase domain with about 42% identity to the catalytic domain of NIMA, a protein kinase that controls initiation of mitosis in Aspergillus nidulans. In addition, both Nek1 and NIMA have a long, basic C-terminal extension and are therefore similar in overall structure.
A nucleotide sequence with Genbank Accession Number: NM 006035, 6 AF128625 and with the following specific characteristics: UniGene Cluster:
Hs.12908; Locus Link ID: 9578; Cluster Name: CDC42-binding protein kinase beta (DMPK-like; MRCKbeta); Sequence information: 6780 by mRNA (SEQ ID NO: 9), 5136 by ORF and 1711 amino acids (SEQ ID NO: 10) with Chromosomal Location: 14q32.3. The UniGene cluster contained over 215 EST sequences from a variety of tissue sources. The p21 GTPases, Rho and Cd~2, regulate numerous cellular functions by binding to members of a serine/threonine protein kinase subfamily. These functions include the remodeling of the cell cytoskeleton that is a feature of cell growth and differentiation. Two of these p21 GTPase-regulated kinases, the myotonic dystrophy protein kinase-related Cdc42-binding kinases (MRCKalpha and beta), have been demonstrated to phosphorylate nonmuscle myosin light chain, a prerequisite for the activation of actin-myosin contractility. A
BLAST
search showed A portion of SEQ ID NO: 10 to have about 49% identity to human myotonic dystrophy kinase.
A nucleotide sequence with Genbank Accession Number: NM 002654 with the following specific characteristics: UniGene Cluster: Hs.198281;
Locus Link ID: 5315; Cluster Name: Pyruvate kinase, muscle; Sequence Information:2287 by mRNA (SEQ 1D NO: 11 with derived amino acid sequence SEQ ID NO: 12)) with Chromosomal Location: 15q22. This gene in a member of a small sub-family within the cdk family of protein kinases.
PCTIARE-3 appears to play a role in signal transduction in terminally differentiated cells. The cloning of the human and murine PCTAIRE-3 genes have been described but no other information is available in the scientific literature. The UniGene cluster is composed of 64 sequences derived from a number of tissues. PCTAIRE-3 was expressed in colon adenocarcinomas tested and was expressed at a lower level or not at all in normal colon tissue samples tested.
A nucleotide sequence with Genbank Accession Number: NM 006293 with the following specific characteristics: UniGene Cluster: Hs.301; Locus Link ID: 7301; Cluster Name: TYR03 protein tyrosine kinase; Sequence lnformation:4364 by mRNA (SEQ ID NO: 13 with derived amino acid sequence SEQ ID NO: 14) with Chromosomal Location: 15q15.1-q21.1.
The UniGene cluster is composed of over 45 sequences derived from a number of tissues. Strongest levels of expression in normal tissues detected in brain. SEQ ID NO: 14 displays appreciable homology to a variety of receptor tyrosine kinases. For example, a portion of SEQ ID NO: 14 has at least about 43% identity to AXL receptor tyrosine kinase. Over-expression of axl cDNA in NIH 3T3 cells induces neoplastic transformation with the concomitant appearance of a 140 kD axl tyrosine-phosphorylated protein.
A nucleotide sequence with Genbank Accession Number: NM 002969 with the following specific characteristics: UniGene Cluster: Hs.55039;
Locus Link ID: 6300; Cluster Name: Mitogen-activated protein kinase 12;
Sequence Information: 1457 by mRNA (SEQ ID NO: 15 with derived amino acid sequence of SEQ ID NO: 16) with Chromosomal Location: 22q13.33.
The UniGene cluster is composed of over 22 sequences derived from a number of tissues. The strongest levels of expression in normal tissues were detected in skeletal muscle. This sequence displays appreciable homology to a variety of mitogen-activated protein kinases, for example, with human mitogen-activated protein kinase p38delta. The p38 mitogen-activated protein kinases (MAPK) play a crucial role in stress and inflammatory responses and are also involved in activation of the human immunodeficiency virus gene expression.
A nucleotide sequence with Genbank Accession Number: W31344 with the following specific characteristics: UniGene Cluster: Hs.55444; Locus Link ID: unknown; Cluster Name: ESTs; Chromosomal Location: unknown.
The UniGene cluster is composed of over 9 sequences, all of which are derived from parathyroid. The GenBank database shows an exact match to AF153819 (Homo sapiens inwardly-rectifying potassium channel Kir2.1). This match is entirely confined to the 3' untranslated region of the GenBank entry.
The present invention relates to nucleotide sequences and derived polypeptides having the following characteristics:
A nucleotide sequence with Genbank Accession Numbers:
NM 014109 and AA235448, representing an amplified bromodomain-containing protein in cancer that was identified with the following specific characteristics: UniGene Cluster: Hs. 46677; Locus Link ID: none;
Sequence Information: 1934 by mRNA (cDNA is SEQ ID NO: 1) 1086 by ORF and 362 amino acids (SEQ ID NO: 2) with Chromosomal Location:
8q24 (based on alignment to mapped human genomic sequence). The deposited information represented a prediction of coding sequence deduced from a cDNA clone of unknown function. In accordance with the present invention, this message was up-regulated by at least 3-fold in lung cancer versus normal lung tissue. A search against the Prosite database reveals a domain with 100% similarity to the bromodomain 2 sequence, which is contained in a number of transcription factors. A key role for bromodomain proteins in maintaining normal proliferation is indicated by the implication of several bromodomain proteins in cancer, with four of these identified at translocation breakpoints.
A novel gene identified based upon EST sequences present within dbEST. This novel gene represents a novel member of the family of Toll-like receptors and a portion of the polypeptide derived therefrom has at least 39%
sequence identity to human toll-like receptor 1. Five of the human Toll-like receptors (called TLRs 1-5) may be direct homologs of the corresponding fly molecule and may constitute an important component of innate immunity in humans. Expression analysis shows that this gene is specifically expressed by B-lymphocytes. Characteristics were: Genbank Accession Number for sample EST in cluster: AA648836; UniGene Cluster: Hs.89206; Locus Link ID: 10330; Cluster Name: ESTs, Weakly similar to TLR6 [H.sapiens];
Sequence Information: 1274 by mRNA (cDNA is SEQ ID NO: 3 with encoded polypeptide SEQ ID NO: 4. The UniGene cluster is composed of 10 sequences, all derived from tonsil. Microarray expression analysis indicates specific expression in B-lymphocytes.
A nucleotide sequence with Genbank Accession Number: AB015631 with the following specific characteristics: Genbank Accession Number:
AB015631; UniGene Cluster: Hs.8752; Locus Link ID: 10330; Cluster Name: Transmembrane protein 4; Sequence Information: 814 by mRNA
(cDNA is SEQ ID NO: 5 with encoded polypeptide as SEQ ID NO: 6) and Chromosomal Location: 12. The UniGene cluster is composed of over 22 sequences derived from a number of tissues. Strongest levels of expression in normal tissues were detected in skeletal muscle.
A nucleotide sequence with Genbank Accession Number: NM 014397, AB026289 and with the following specific characteristics: UniGene Cluster:
Hs.9625; Locus Link ID: 27073; Public Cluster Name: SIDE-1512, putative serine-threonine protein kinase; Sequence Information: 1597 by mRNA
(SEQ ID NO: 7), 921 by ORF and 307 amino acids (and SEQ ID NO: 8) with Chromosomal Location: 9q33. From the record in Genbank the complete mRNA and protein sequences are obtained. SIDE-1512 shares sequence similarity with murine NEK1, a kinase involved in cell cycle regulation. The UniGene cluster contains over 150 EST sequences from a variety of tissue sources. The top BLAST score was to protein kinase nek1, which contains an N-terminal protein kinase domain with about 42% identity to the catalytic domain of NIMA, a protein kinase that controls initiation of mitosis in Aspergillus nidulans. In addition, both Nek1 and NIMA have a long, basic C-terminal extension and are therefore similar in overall structure.
A nucleotide sequence with Genbank Accession Number: NM 006035, 6 AF128625 and with the following specific characteristics: UniGene Cluster:
Hs.12908; Locus Link ID: 9578; Cluster Name: CDC42-binding protein kinase beta (DMPK-like; MRCKbeta); Sequence information: 6780 by mRNA (SEQ ID NO: 9), 5136 by ORF and 1711 amino acids (SEQ ID NO: 10) with Chromosomal Location: 14q32.3. The UniGene cluster contained over 215 EST sequences from a variety of tissue sources. The p21 GTPases, Rho and Cd~2, regulate numerous cellular functions by binding to members of a serine/threonine protein kinase subfamily. These functions include the remodeling of the cell cytoskeleton that is a feature of cell growth and differentiation. Two of these p21 GTPase-regulated kinases, the myotonic dystrophy protein kinase-related Cdc42-binding kinases (MRCKalpha and beta), have been demonstrated to phosphorylate nonmuscle myosin light chain, a prerequisite for the activation of actin-myosin contractility. A
BLAST
search showed A portion of SEQ ID NO: 10 to have about 49% identity to human myotonic dystrophy kinase.
A nucleotide sequence with Genbank Accession Number: NM 002654 with the following specific characteristics: UniGene Cluster: Hs.198281;
Locus Link ID: 5315; Cluster Name: Pyruvate kinase, muscle; Sequence Information:2287 by mRNA (SEQ 1D NO: 11 with derived amino acid sequence SEQ ID NO: 12)) with Chromosomal Location: 15q22. This gene in a member of a small sub-family within the cdk family of protein kinases.
PCTIARE-3 appears to play a role in signal transduction in terminally differentiated cells. The cloning of the human and murine PCTAIRE-3 genes have been described but no other information is available in the scientific literature. The UniGene cluster is composed of 64 sequences derived from a number of tissues. PCTAIRE-3 was expressed in colon adenocarcinomas tested and was expressed at a lower level or not at all in normal colon tissue samples tested.
A nucleotide sequence with Genbank Accession Number: NM 006293 with the following specific characteristics: UniGene Cluster: Hs.301; Locus Link ID: 7301; Cluster Name: TYR03 protein tyrosine kinase; Sequence lnformation:4364 by mRNA (SEQ ID NO: 13 with derived amino acid sequence SEQ ID NO: 14) with Chromosomal Location: 15q15.1-q21.1.
The UniGene cluster is composed of over 45 sequences derived from a number of tissues. Strongest levels of expression in normal tissues detected in brain. SEQ ID NO: 14 displays appreciable homology to a variety of receptor tyrosine kinases. For example, a portion of SEQ ID NO: 14 has at least about 43% identity to AXL receptor tyrosine kinase. Over-expression of axl cDNA in NIH 3T3 cells induces neoplastic transformation with the concomitant appearance of a 140 kD axl tyrosine-phosphorylated protein.
A nucleotide sequence with Genbank Accession Number: NM 002969 with the following specific characteristics: UniGene Cluster: Hs.55039;
Locus Link ID: 6300; Cluster Name: Mitogen-activated protein kinase 12;
Sequence Information: 1457 by mRNA (SEQ ID NO: 15 with derived amino acid sequence of SEQ ID NO: 16) with Chromosomal Location: 22q13.33.
The UniGene cluster is composed of over 22 sequences derived from a number of tissues. The strongest levels of expression in normal tissues were detected in skeletal muscle. This sequence displays appreciable homology to a variety of mitogen-activated protein kinases, for example, with human mitogen-activated protein kinase p38delta. The p38 mitogen-activated protein kinases (MAPK) play a crucial role in stress and inflammatory responses and are also involved in activation of the human immunodeficiency virus gene expression.
A nucleotide sequence with Genbank Accession Number: W31344 with the following specific characteristics: UniGene Cluster: Hs.55444; Locus Link ID: unknown; Cluster Name: ESTs; Chromosomal Location: unknown.
The UniGene cluster is composed of over 9 sequences, all of which are derived from parathyroid. The GenBank database shows an exact match to AF153819 (Homo sapiens inwardly-rectifying potassium channel Kir2.1). This match is entirely confined to the 3' untranslated region of the GenBank entry.
The translation product of thyrocarcin and the Kir2.1 gene are identical;
however, we cannot formally rule out the possibility that thyrocarcin is a completely different gene that shares some splicing with Kir2.l. SEQ ID NO:
17 shows the nucleotide sequence for Kir2.1 and SEQ ID NO: 21 shows EST
cluster identified from expression analysis that is specific for thyroid adenocarcinoma. The derived amino acid sequence from SEQ ID NO: 17 is shown as SEQ ID NO: 18. The sequence of the EST cluster displays no obvious homology to known proteins. However,, for the case where the EST
cluster is simply the 3'-untranslated region of Kir2.1, this gene is an inwardly-rectifying potassium channel.
A nucleotide sequence with Genbank Accession Number: AA133334, representing a Sox2-like HMG-box Oncogenically Expressed Sequence with the following specific characteristics: UniGene Cluster: Hs.129911; Locus Link ID: none; Sequence Information: 1050 by mRNA (bp = base pair, SEQ
ID NO: 19), 264 by ORF and 88 amino acids (SEQ ID NO: 20) with Chromosomal Location: unknown. SEQ ID NO: 19 is present as an EST
(Expressed Sequence Tag) in the Gene Logic database. It has been elongated to 1050 by by overlapping contigs in the public databases. The unigene cluster indicates widespread expression and it was found that the message is upregulated by at least 3-fold in lung cancer versus normal lung tissue. This sequence significant homolgy with Ovis aries SOX-2 gene, and to a slightly lesser extent the murine SOX-2. The Sox gene family consists of a large number of embryonically expressed genes related via the possession of a 79-amino-acid DNA-binding domain known as the HMG box. These genes are transcription factors likely to be involved in the regulation of gene expression.
The nucleotides and polypeptides, as gene products, used in the processes of the present invention may comprise a recombinant polynucleotide or polypeptide, a natural polynucleotide or polypeptide, or a synthetic polynucleotide or polypeptide, preferably a recombinant polynucleotide or . polypeptide.
Fragments of such polynucleotides and polypeptides as are disclosed herein may also be useful in practicing the processes of the present invention.
For example, a fragment, derivative or analog of the polypeptide (SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18 and 20) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
In one aspect, the present invention relates to an isolated polynucleotide comprising a polynucleotide at least 65% identical to the polynucleotide of SEQ
ID NO: 3, or its complement. In preferred embodiments, said isolated polynucleotide comprises a polynucleotide that has sequence identity of at least 80%, preferably at least about 90%, most preferably at least about 95%, especially at least about 98% and most especially is identical to the sequence of SEQ ID NO: 3. An isolated polynucleotide of the invention may also include the complement of any of the foregoing.
In another aspect, the present invention relates to an isolated polypeptide, including a purified polypeptide, comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 4.
In preferred embodiments, said isolated polypeptide comprises an amino acid sequence having sequence identity of at least 95%, preferably at least about 98%, and especially is identical to, the sequence of SEQ ID NO: 4. The present invention also includes isolated active fragments of such polypeptides where said fragments retain the biological activity of the polypeptide or where such active fragments are useful as specific targets for cancer treatment, prevention or diagnosis.
The polynucleotides and polypeptides useful in practicing the processes of the present invention may likewise be obtained in an isolated or purified form.
In addition, the polypeptide disclosed herein as being useful in practicing the processes of the invention include different types of proteins in terms of function so that, as recited elsewhere herein, some are enzymes, some are transcription factors and other may be cell surface receptors. Precisely how such cancer-linked proteins are used in the processes of the invention may thus differ depending on the function and cellular location of the protein and therefore modification, or optimization, of the methods disclosed herein may be desirable in light of said differences. For example, a cell-surface receptor is an excellent target for cytotoxic antibodies whereas a transcription factor or enzyme is a useful target for a small organic compound with anti-neoplastic activity.
As used herein, the term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). It could also be produced recombinantly and subsequently purified.
For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides, for example, those prepared recombinantly, could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment. In one embodiment of the present invention, such isolated, or purified, polypeptide is useful in generating antibodies for practicing the invention, or where said antibody is attached to a cytotoxic or cytolytic agent, such as an apoptotic agent.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
The sequence information disclosed herein, as derived from the GenBank submissions, can readily be utilized by those skilled in the art to prepare the corresponding full-length polypeptide by peptide synthesis. The same is true for either the polynucleotides or polypeptides disclosed herein for use in the methods of the invention.
As used herein, the terms "portion," "segment," and "fragment," when used in relation to polypeptides, refer to a continuous sequence of residues, such as amino acid residues, which sequence forms a subset of a larger sequence. For example, if a polypeptide were subjected to treatment with any of the common endopeptidases, such as trypsin or chymotrypsin, the oligopeptides resulting from such treatment would represent portions, segments or fragments of the starting polypeptide. When used in relation to a polynucleotides, such terms refer to the products produced by treatment of said polynucleotides with any of the common endonucleases.
The present invention further relates to a vector comprising any of the polynucleotides disclosed herein and to a recombinant cell comprising such vectors, or such polynucleotides or expressing the polypeptides disclosed herein, especially the polypeptide whose amino acid sequence is the sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
Methods of producing such cells and vectors are well known to those skilled in the molecular biology art. See, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), Wu et al, Methods in Gene Biotechnology (CRC Press, New York, NY, 1997), and Recombinant Gene Expression Protocols, in Methods in Molecular Biology, Vol. 62, (Tuan, ed., Humana Press, Totowa, NJ, 1997), the disclosures of which are hereby incorporated by reference.
In another aspect, the present invention relates to a process for identifying an agent that modulates the activity of a cancer-related gene comprising:
(a) contacting a compound with a cell containing a gene that corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and under conditions promoting the expression of said gene; and (b) detecting a difference in expression of said gene relative to when said compound is not present thereby identifying an agent that modulates the activity of a cancer-related gene.
In specific embodiments of the present invention, the genes useful for the invention comprise genes that correspond to polynucleotides having a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, or may comprise the sequence of any of the polynucleotides disclosed herein (where the latter are cDNA sequences). As used herein, "corresponding genes" refers to genes that encode an RNA that is at least 90% identical, preferably at least 95% identical, most preferably at least 98% identical, and especially identical, to an RNA encoded by one of the nucleotide sequences disclosed herein (i.e., SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19). Such genes will also encode the same polypeptide sequence as any of the sequences disclosed herein, preferably SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, but may include differences in such amino acid sequences where such differences are limited to conservative amino acid substitutions, such as where the same overall three dimensional structure, and thus the same antigenic character, is maintained. Thus, amino acid sequences may be within the scope of the present invention where they react with the same antibodies that react with polypeptides comprising the sequences of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 as disclosed herein.
As used herein, the term "conservative amino acid substitution" are defined herein as exchanges within one of the following five groups:
I. Small aliphatic, nonpolar or slightly polar residues:
Ala, Ser, Thr, Pro, Gly;
II. Polar, negatively charged residues and their amides:
Asp, Asn, Glu, Gln;
III. Polar, positively charged residues:
His, Arg, Lys;
IV. Large, aliphatic, nonpolar residues:
Met Leu, Ile, Val, Cys V. Large, aromatic residues:
Phe, Tyr, Trp In accordance with the present invention, model cellular systems using cell lines, primary cells, or tissue samples are maintained in growth medium and may be treated with compounds that may be at a single concentration or at a range of concentrations. At specific times after treatment, cellular RNAs are isolated from the treated cells, primary cells or tumors, which RNAs are indicative of expression of selected genes. The cellular RNA is then divided and subjected to analysis that detects the presence and/or quantity of specific RNA transcripts, which transcripts may then be amplified for detection purposes using standard methodologies, such as, for example, reverse transcriptase polymerase chain reaction (RT-PCR), etc. The presence or absence, or levels, of specific RNA transcripts are determined from these measurements and a metric derived for the type and degree of response of the sample to the treated compound compared to control samples.
In accordance with the foregoing, there is thus disclosed herein processes for using a cancer-linked gene sequence (SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19) whose expression is, or can be, as a result of the methods of the present invention, linked to, or used to characterize, the cancerous, or non-cancerous, status of the cells, or tissues, to be tested.
Thus, the processes of the present invention identify novel anti-neoplastic agents based on their alteration of expression of the polynucleotide sequence disclosed herein in specific model systems. The methods of the invention may therefore be used with a variety of cell lines or with primary samples from tumors maintained in vitro under suitable culture conditions for varying periods of time, or in situ in suitable animal models.
More particularly, genes have been identified that is expressed at a level in cancer cells that is difFerent from the expression level in non-cancer cells. In one instance, the identified genes are expressed at higher levels in cancer cells than in normal cells.
The polynucleotides of the invention can include fully operation genes with attendant control or regulatory sequences or merely a polynucleotide sequence encoding the corresponding polypeptide or an active fragment or analog thereof.
In one embodiment of the present invention, said gene modulation is downward modulation, so that, as a result of exposure to the chemical agent to be tested, one or more genes of the cancerous cell will be expressed at a lower level (or not expressed at all) when exposed to the agent as compared to the expression when not exposed to the agent. For example, the gene encoding the polypeptide of SEQ ID NO: 2 is expressed at a higher level in cells of lung cancer than in normal lung cells.
In a preferred embodiment a selected set of said genes are expressed in the reference cell, including the genes) sequences identified for use according to the present invention, but are not expressed in the cell to be tested as a result of the exposure of the cell to be tested to the chemical agent. Thus, where said chemical agent causes the gene, or genes, of the tested cell to be expressed at a lower level than the same genes of the reference, this is indicative of downward modulation and indicates that the chemical agent to be tested has anti-neoplastic activity.
Sequences encoding the same proteins as any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, regardless of the percent identity of such sequences, are also specifically contemplated by any of the methods of the present invention that rely on any or all of said sequences, regardless of how they are otherwise described or limited. Thus, any such sequences are available for use in carrying out any of the methods disclosed according to the invention. Such sequences also include any open reading frames, as defined herein, present within the sequence of SEQ ID NO: 1.
The genes identified by the present disclosure are considered "cancer-s related" genes, as this term is used herein, and include genes expressed at higher levels (due, for example, to elevated rates of expression, elevated extent of expression or increased copy number) in cancer cells relative to expression of these genes in normal (i.e., non-cancerous) cells where said cancerous state or status of test cells or tissues has been determined by methods known in the art, such as by reverse transcriptase polymerase chain reaction (RT-PCR) as described in the Example below. In specific embodiments, this relates to the genes whose sequences correspond to the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. As used herein, the term "correspond" means that the gene has the indicated nucleotide sequence or that it encodes substantially the same RNA as would be encoded by the indicated sequence, the term "substantially" meaning about at least 90% identical as defined elsewhere herein and includes splice variants thereof.
The sequences disclosed herein may be genomic in nature and thus represent the sequence of an actual gene, such as a human gene, or may be a cDNA sequence derived from a messenger RNA (mRNA) and thus represent contiguous exonic sequences derived from a corresponding genomic sequence or they may be wholly synthetic in origin for purposes of practicing the processes of the invention. Because of the processing that may take place in transforming the initial RNA transcript into the final mRNA, the sequences disclosed herein may represent less than the full genomic sequence. They may also represent sequences derived from ribosomal and transfer RNAs. Consequently, the genes present in the cell (and representing the genomic sequences) and the sequences disclosed herein, which are mostly cDNA sequences, may be identical or may be such that the cDNAs contain less than the full genomic sequence. Such genes and cDNA
sequences are still considered corresponding sequences because they both encode similar RNA sequences. Thus, by way of non-limiting example only, a gene that encodes an RNA transcript, which is then processed into a shorter mRNA, is deemed to encode both such RNAs and therefore encodes an RNA
complementary to (using the usual Watson-Crick complementarity rules), or that would otherwise be encoded by, a cDNA (for example, a sequence as disclosed herein). Thus, the sequences disclosed herein correspond to genes contained in the cancerous or normal cells used to determine relative levels of expression because they represent the same sequences or are complementary to RNAs encoded by these genes. Such genes also include different alleles and splice variants that may occur in the cells used in the processes of the invention.
The genes of the invention "correspond to" a polynucleotide having a sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 if the gene encodes an RNA (processed or unprocessed, including naturally occurring splice variants and alleles) that is at least 90% identical, preferably at least 95% identical, most preferably at least 98% identical to, and especially identical to, an RNA that would be encoded by, or be complementary to, such as by hybridization with, a polynucleotide having the indicated sequence. In addition, genes including sequences at least 90% identical to a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, preferably at least about 95% identical to such a sequence, more preferably at least about 98% identical to such sequence and most preferably comprising such sequence are specifically contemplated by all of the processes of the present invention as being genes that correspond to these sequences. In addition, sequences encoding the same proteins as any of these sequences, regardless of the percent identity of such sequences, are also specifically contemplated by any of the methods of the present invention that rely on any or all of said sequences, regardless of how they are otherwise described or limited. Thus, any such sequences are available for use in carrying out any of the methods disclosed according to the invention. Such sequences also include any open reading frames, as defined herein, present within any of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
Further in accordance with the present invention, the term "percent identity" or "percent identical," when referring to a sequence, means that a sequence is compared to a claimed or described sequence after alignment of the sequence to be compared (the "Compared Sequence") with the described or claimed sequence (the "Reference Sequence"). The Percent Identity is then determined according to the following formula:
Percent Identity = 100 [1-(C/R)]
wherein C is the number of differences between the Reference Sequence and the Compared Sequence over the length of alignment between the Reference Sequence and the Compared Sequence wherein (i) each base or amino acid in the Reference Sequence that does not have a corresponding aligned base or amino acid in the Compared Sequence and (ii) each gap in the Reference Sequence and (iii) each aligned base or amino acid in the Reference Sequence that is difFerent from an aligned base or amino acid in the Compared Sequence, constitutes a difference; and R is the number of bases or amino acids in the Reference Sequence over the length of the alignment with the Compared Sequence with any gap created in the Reference Sequence also being counted as a base or amino acid.
If an alignment exists between the Compared Sequence and the Reference Sequence for which the percent identity as calculated above is about equal to or greater than a specified minimum Percent Identity then the Compared Sequence has the specified minimum percent identity to the Reference Sequence even though alignments may exist in which the hereinabove calculated Percent Identity is less than the specified Percent Identity.
As used herein and except as noted otherwise, all terms are defined as given below.
In accordance with the present invention, the term "DNA segment" or "DNA sequence" refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the segment and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector. Such segments are provided in the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Sequences of non-translated DNA may be present downstream from the open reading frame, where the same do not interfere with manipulation or expression of the coding regions.
The term "coding region" refers to that portion of a gene which either naturally or normally codes for the expression product of that gene in its natural genomic environment, i.e., the region coding in vivo for the native expression product of the gene. The coding region can be from a normal, mutated or altered gene, or can even be from a DNA sequence, or gene, wholly synthesized in the laboratory using methods well known to those of skill in the art of DNA synthesis.
In accordance with the present invention, the term "nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. Generally, DNA
segments encoding the proteins provided by this invention are assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit comprising regulatory elements derived from a microbial or viral operon.
The term "expression product" means that polypeptide or protein that is the natural translation product of the gene and any nucleic acid sequence coding equivalents resulting from genetic code degeneracy and thus coding for the same amino acid(s).
The term "active fragment," when referring to a coding sequence, means a portion comprising less than the complete coding region whose expression product retains essentially the same biological function or activity as the expression product of the complete coding region.
The term "primer" means a short nucleic acid sequence that is paired with one strand of DNA and provides a free 3'-OH end at which a DNA
polymerase starts synthesis of a deoxyribonucleotide chain.
The term "promoter" means a region of DNA involved in binding of RNA
polymerase to initiate transcription. The term "enhancer" refers to a region of DNA that, when present and active, has the effect of increasing expression of a different DNA sequence that is being expressed, thereby increasing the amount of expression product formed from said different DNA sequence.
The term "open reading frame (ORF)" means a series of triplets coding for amino acids without any termination codons and is a sequence (potentially) translatable into protein.
As used herein, reference to a DNA sequence includes both single stranded and double stranded DNA. Thus, the specific sequence, unless the context indicates otherwise, refers to the single strand DNA of such sequence, the duplex of such sequence with its complement (double stranded DNA) and the complement of such sequence.
The present invention also relates to methods of assaying potential antitumor agents based on their modulation of the expression of the gene sequence according to the invention and methods for diagnosing cancerous, or potentially cancerous, conditions as a result of the patterns of expression of the gene sequence disclosed herein as well as related gene sequence based on common expression or regulation of such genes.
In carrying out the foregoing assays, relative antineoplastic activity may be ascertained by the extent to which a given chemical agent modulates the expression of genes present in a cancerous cell. Thus, a first chemical agent that modulates the expression of a gene associated with the cancerous state (i.e., a gene that includes one of the sequences of the invention as disclosed herein and present in cancerous cells) to a larger degree than a second chemical agent tested by the assays of the invention is thereby deemed to have higher, or more desirable, or more advantageous, anti-neoplastic activity than said second chemical agent.
The gene expression to be measured is commonly assayed using RNA
expression as an indicator. Thus, the greater the level of RNA (messenger RNA) detected the higher the level of expression of the corresponding gene. Thus, gene expression, either absolute or relative, is determined by the relative expression of the RNAs encoded by such genes.
RNA may be isolated from samples in a variety of ways, including lysis and denaturation with a phenolic solution containing a chaotropic agent (e.g., triazol) followed by isopropanol precipitation, ethanol wash, and resuspension in aqueous solution; or lysis and denaturation followed by isolation on solid support, such as a Qiagen resin and reconstitution in aqueous solution; or lysis and denaturation in non-phenolic, aqueous solutions followed by enzymatic conversion of RNA to DNA template copies.
Normally, prior to applying the processes of the invention, steady state RNA expression levels for the genes, and sets of genes, disclosed herein will have been obtained. It is the steady state level of such expression that is affected by potential anti-neoplastic agents as determined herein. Such steady state levels of expression are easily determined by any methods that are sensitive, specific and accurate. Such methods include, but are in no way limited to, real time quantitative polymerase chain reaction (PCR), for example, using a Perkin-Elmer 7700 sequence detection system with gene specific primer probe combinations as designed using any of several commercially available software packages, such as Primer Express software., solid support based hybridization array technology using appropriate internal controls for quantitation, including filter, bead, or microchip based arrays, solid support based hybridization arrays using, for example, chemiluminescent! fluorescent, or electrochemical reaction based detection systems.
The gene patterns indicative of a cancerous state need not be characteristic of every cell found to be cancerous. Thus, the methods disclosed herein are useful for detecting the presence of a cancerous condition within a tissue where less than all cells exhibit the complete pattern.
Thus, for example, a set of selected genes, comprising sequences corresponding to the sequence of SEQ ID NO: 1, may be found, using appropriate probes, either DNA or RNA, to be present in as little as 60% of cells derived from a sample of tumorous, or malignant, tissue while being absent from as much as 60% of cells derived from corresponding non-cancerous, or otherwise normal, tissue (and thus being present in as much as 40% of such normal tissue cells). In a preferred embodiment, such gene pattern is found to be present in at least 50% of cells drawn from a cancerous tissue, such as the lung cancer disclosed herein. In an additional .
embodiment, such gene pattern is found to be present in at least 100% of cells drawn from a cancerous tissue and absent from at least 100% of a corresponding normal, non-cancerous, tissue sample, although the latter embodiment may represent a rare occurrence.
In another aspect the present invention relates to a process for determining the cancerous status of a test cell, comprising determining expression in said test cell of a gene sequence as disclosed herein and then comparing said expression to expression of said at least one gene in at least one cell known to be non-cancerous whereby a difference in said expression indicates that said cell is cancerous.
In one embodiment, said change in expression is a change in copy number, including either an increase or decrease in copy number. In accordance with the present invention, said change in gene copy number may be determined by determining a change in expression of messenger RNA
encoded by said gene sequence.
Changes in gene copy number may be determined by determining a change in expression of messenger RNA encoded by a particular gene sequence, especially that of Such change in gene copy number may be determined by determining a change in expression of messenger RNA
encoded by a particular gene sequence, especially that of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. Also in accordance with the present invention, said gene may be a cancer initiating gene, a'cancer facilitating gene, or a cancer suppressing gene. In carrying out the methods of the present invention, a cancer facilitating gene is a gene that, while not directly initiating or suppressing tumor formation or growth, said gene acts, such as through the actions of its expression product, to direct, enhance, or otherwise facilitate the progress of the cancerous condition, including where such gene acts against genes, or gene expression products, that would otherwise have the effect of decreasing tumor formation and/or growth.
Although the presence or absence of expression of a gene corresponding to a sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 may be indicative of a cancerous status for a given cell, the mere presence or absence of such a gene may not alone be sufficient to achieve a malignant condition and thus the level of expression of such gene pattern may also be a significant factor in determining the attainment of a cancerous state. Thus, while a pattern of genes may be present in both cancerous and non-cancerous cells, the level of expression, as determined by any of the methods disclosed herein, all of which are well known in the art, may differ between the cancerous versus the non-cancerous cells. Thus, it becomes essential to also determine the level of expression of a gene such as that disclosed herein, including substantially similar sequences and sequences comprising said sequence, as a separate means of diagnosing the presence of a cancerous status for a given cell, groups of cells, or tissues, either in culture or in situ.
The level of expression of the polypeptides disclosed herein is also a measure of gene expression, such as polypeptides having sequence identical, or similar to any polypeptide encoded by the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, such as the polypeptide whose amino acid sequence is the sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
In accordance with the foregoing, the present invention further relates to a process for determining the cancerous status of a cell to be tested, comprising determining the level of expression in said cell of at least one gene that includes one of the nucleotide sequences selected from the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, including sequences substantially identical to said sequences, or characteristic fragments thereof, or the complements of any of the foregoing and then comparing said expression to that of a cell known to be non-cancerous whereby the difference in said expression indicates that said cell to be tested is cancerous.
In accordance with the invention, although gene expression for a gene that includes as a portion thereof one of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, is preferably determined by use of a probe that is a fragment of such nucleotide sequence, it is to be understood that the probe may be formed from a different portion of the gene. Expression of the gene may be determined by use of a nucleotide probe that hybridizes to messenger RNA (mRNA) transcribed from a portion of the gene other than the specific nucleotide sequence disclosed herein. , It should be noted that there are a variety of different contexts in which genes have been evaluated as being involved in the cancerous process.
Thus, some genes may be oncogenes and encode proteins that are directly involved in the cancerous process and thereby promote the occurrence of cancer in an animal. In addition, other genes may serve to suppress the cancerous state in a given cell or cell type and thereby work against a cancerous condition forming in an animal. Other genes may simply be involved either directly or indirectly in the cancerous process or condition and may serve in an ancillary capacity with respect to the cancerous state. All such types of genes are deemed with those to be determined in accordance with the invention as disclosed herein. Thus, the gene determined by said process of the invention may be an oncogene, or the gene determined by said process may be a cancer facilitating gene, the latter including a gene that directly or indirectly affects the cancerous process, either in the promotion of a cancerous condition or in facilitating the progress of cancerous growth or otherwise modulating the growth of cancer cells, either in vivo or ex vivo. In addition, the gene determined by said process may be a cancer suppressor gene, which gene works either directly or indirectly to suppress the initiation or progress of a cancerous condition. Such genes may work indirectly where their expression alters the activity of some other gene or gene expression product that is itself directly involved in initiating or facilitating the progress of a cancerous condition. For example, a gene that encodes a polypeptide, either wild or mutant in type, which polypeptide acts to suppress of tumor suppressor gene, or its expression product, will thereby act indirectly to promote tumor growth.
In accordance with the foregoing, the process of the present invention includes cancer modulating agents that are themselves either polypeptides, or small chemical entities, that affect the cancerous process, including initiation, suppression or facilitation of tumor growth, either in vivo or ex vivo. Said cancer modulating agent may have the effect of increasing gene expression or said cancer modulating agent may have the effect of decreasing gene expression as such terms have been described herein.
In keeping with the disclosure herein, the present invention also relates to a process for treating cancer comprising contacting a cancerous cell with an agent having activity against an expression product encoded by a gene sequence as disclosed herein, such as the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
The proteins encoded by the genes disclosed herein due to their expression, or elevated expression, in cancer cells, represent highly useful therapeutic targets for "targeted therapies" utilizing such affinity structures as, for example, antibodies coupled to some cytotoxic agent. In such methodology, it is advantageous that nothing need be known about the endogenous ligands or binding partners for such cell surface molecules.
Rather, an antibody or equivalent molecule that can specifically recognize the cell surface molecule (which could include an artificial peptide, a surrogate ligand, and the like) that is coupled to some agent that can induce cell death or a block in cell cycling offers therapeutic promise against these proteins.
Thus, such approaches include the use of so-called suicide "bullets" against intracellular proteins With the advent of methods of molecular biology and recombinant technology, it is now possible to produce antibody molecules by recombinant means and thereby generate gene sequences that code for specific amino acid sequences found in the polypeptide structure of the antibodies. Such antibodies can be produced by either cloning the gene sequences encoding the polypeptide chains of said antibodies or by direct synthesis of said polypeptide chains, with in vitro assembly of the synthesized chains to form active tetrameric (H~L2) structures with affinity for specific epitopes and antigenic determinants. This has permitted the ready production of antibodies having sequences characteristic of neutralizing antibodies from different species and sources.
Regardless of the source of the antibodies, or how they are recombinantly constructed, or how they are synthesized, in vitro or in vivo, using transgenic animals, such as cows, goats and sheep, using large cell cultures of laboratory or commercial size, in bioreactors or by direct chemical synthesis employing no living organisms at any stage of the process, all antibodies have a similar overall 3 dimensional structure.
This structure is often given as HZL2 and refers to the fact that antibodies commonly comprise 2 light (L) amino acid chains and 2 heavy (H) amino acid chains. Both chains have regions capable of interacting with a structurally complementary antigenic target. The regions interacting with the target are referred to as "variable" or "V" regions and are characterized by differences in amino acid sequence from antibodies of different antigenic specificity.
The variable regions of either H or L chains contains the amino acid sequences capable of specifically binding to antigenic targets. Within these sequences are smaller sequences dubbed "hypervariable" because of their extreme variability between antibodies of differing specificity.
Such hypervariable regions are also referred to as "complementarity determining regions" or "CDR" regions. These CDR regions account for the basic specificity of the antibody for a particular antigenic determinant structure.
The CDRs represent non-contiguous stretches of amino acids within the variable regions but, regardless of species, the positional locations of these critical amino acid sequences within the variable heavy and light chain regions have been found to have similar locations within the amino acid sequences of the variable chains. The variable heavy ana light chains of all antibodies each have 3 CDR regions, each non-contiguous with the others (termed L1, L2, L3, H 1, H2, H3) for the respective light (L) and heavy (H) chains. The accepted CDR regions have been described by ICabat et al, J. Biol. CHem. 252:6609-6616 (1977).
The numbering scheme is shown in the figures, where the CDRs are underlined and the numbers follow the Kabat scheme.
In all mammalian species, antibody polypeptides contain constant (i.e., highly conserved) and variable regions, and, within the latter, there are the CDRs and the so-called "framework regions" made up of amino acid sequences within the variable region of the heavy or light chain but outside the CDRs.
The antibodies disclosed according to the invention may also be wholly synthetic, wherein the polypeptide chains of the antibodies are synthesized and, possibly, optimized for binding to the polypeptides disclosed herein as being receptors. Such antibodies may be chimeric or humanized antibodies and may be fully tetrameric in structure, or may be dimeric and comprise only a single heavy and a single light chain. Such antibodies may also include fragments, such as Fab and F(ab2)' fragments, capable of reacting with and binding to any of the polypeptides disclosed herein as being receptors.
In one aspect, the present invention relates to immunoglobulins, or antibodies, as described herein, that react with, especially where they are specific for, the polypeptides having amino acid sequences as disclosed herein, preferably those having an amino acid sequence of one of SEQ ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20. Such antibodies may commonly be in the form of a composition, especially a pharmaceutical composition.
The pharmaceutical compositions useful herein also contain a pharmaceutically acceptable carrier, including any suitable diluent or excipient, which includes any pharmaceutical agent that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which may be administered without undue toxicity.
Pharmaceutically acceptable carriers include, but are not limited to, liquids such as water, saline, glycerol and ethanol, and the like, including carriers useful in forming sprays for nasal and other respiratory tract delivery or for delivery to the ophthalmic system. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub.
Co., N.J. current edition).
The process of the present invention includes embodiments of the above-recited processes wherein the cancer cell is contacted in vivo as well as ex vivo, preferably wherein said agent comprises a portion, or is part of an overall molecular structure, having affinity for said expression product. In one such embodiment, said portion having affinity for said expression product is an antibody, especially where said expression product is a polypeptide or oligopeptide or comprises an oligopeptide portion, or comprises a polypeptide.
Such an agent can therefore be a single molecular structure, comprising both affinity portion and anti-cancer activity portions, wherein said portions are derived from separate molecules, or molecular structures, possessing such activity when separated and wherein such agent has been formed by combining said portions into one larger molecular structure, such as where said portions are combined into the form of an adduct. Said anti-cancer and affinity portions may be joined covalently, such as in the form of a single polypeptide, or polypeptide-like, structure or may be joined non-covalently, such as by hydrophobic or electrostatic interactions, such structures having been formed by means well known in the chemical arts.
Alternatively, the anti-cancer and affinity portions may be formed from separate domains of a single molecule that exhibits, as part of the same chemical structure, more than one activity wherein one of the activities is against cancer cells, or tumor formation or growth, and the other activity is affinity for an expression product produced by expression of genes related to the cancerous process or condition.
In one embodiment of the present invention, a chemical agent, such as a protein or other polypeptide, is joined to an agent, such as an antibody, having affinity for an expression product of a cancerous cell, such as a polypeptide or protein encoded by a gene related to the cancerous process, especially a gene as disclosed herein according to the present invention.
Thus, where the presence of said expression product is essential to tumor initiation and/or growth, binding of said agent to said expression product will have the effect of negating said tumor promoting activity. In one such embodiment, said agent is an apoptosis-inducing agent that induces cell suicide, thereby killing the cancer cell and halting tumor growth..
Other genes within the cancer cell that are regulated in a manner similar to that of the genes disclosed herein and thus change their expression in a coordinated way in response to chemical compounds represent genes that are located within a common metabolic, signaling, physiological, or functional pathway so that by analyzing and identifying such commonly regulated groups of genes (groups that include the gene, or similar sequences, disclosed according to the invention, one can (a) assign known genes and novel genes to specific pathways and (b) identify specific functions and functional roles for novel genes that are grouped into pathways with genes for which their functions are already characterized or described. For example, one might identify a group of 10 genes, at least one of which is the gene as disclosed herein, that change expression in a coordinated fashion and for which the function of one, such as the polypeptide encoded by the sequence disclosed herein, is known then the other genes are thereby implicated in a similar function or pathway and may thus play a role in the cancer-initiating or cancer-facilitating process. In the same way, if a gene were found in normal cells but not in cancer cells, or happens to be expressed at a higher level in normal as opposed to cancer cells, then a similar conclusion may be drawn as to its involvement in cancer, or other diseases.
Therefore, the processes disclosed according to the present invention at once provide a novel means of assigning function to genes, i.e. a novel method of functional genomics, and a means for identifying chemical compounds that have potential therapeutic effects on specific cellular pathways. Such chemical compounds may have therapeutic relevance to a variety of diseases outside of cancer as well, in cases where such diseases are known or are demonstrated to involve the specific cellular pathway that is affected.
The polypeptides disclosed herein, preferably those of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, also find use as vaccines in that, where the polypeptide represents a surface protein present on a cancer cell, such polypeptide may be administered to an animal, especially a human being, for purposes of activating cytotoxic T lymphocytes (CTLs) that will be specific for, and act to lyze, cancer cells in said animal. Where used as vaccines, such polypeptides are present in the form of a pharmaceutical composition. The present invention may also employ polypeptides that have the same, or similar, immunogenic character as the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 and thereby elicit the same, or similar, immunogenic response after administration to an animal, such as an animal at risk of developing cancer, or afflicted therewith. Thus, the polypeptides disclosed according to the invention will commonly find use as immunogenic compositions.
The present invention also relates to a process that comprises a method for producing a product comprising identifying an agent according to one of the disclosed processes for identifying such an agent (i.e., the therapeutic agents identified according to the assay procedures disclosed herein) wherein said product is the data collected with respect to said agent as a result of said identification process, or assay, and wherein said data is sufficient to convey the chemical character and/or structure and/or properties of said agent. For example, the present invention specifically contemplates a situation whereby a user of an assay of the invention may use the assay to screen for compounds having the desired enzyme modulating activity and, having identified the compound, then conveys that mtorma~ion y.e., information as to structure, dosage, etc) to another user who then utilizes the information to reproduce the agent and administer it for therapeutic or research purposes according to the invention. For example, the user of the assay (user 1) may screen a number of test compounds without knowing the structure or identity of the compounds (such as where a number of code numbers are used the first user is simply given samples labeled with said code numbers) and, after performing the screening process, using one or more assay processes of the present invention, then imparts to a second user (user 2), verbally or in writing or some equivalent fashion, sufficient information to identify the compounds having a particular modulating activity (for example, the code number with the corresponding results). This transmission of information from user 1 to user 2 is specifically contemplated by the present invention.
The genes useful in the methods of the invention disclosed herein are genes corresponding to a polynucleotide having the sequence of SEQ ID NO:
1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 and represent genes that may be over-expressed in malignant cancer, such as is a gene corresponding to SEQ ID
NO: 1 for lung, the latter being expressed at least three fold higher in lung cancer samples as compared to normal lung tissues. In addition, in any given sample, not all cancer cells may express this gene a substantial expression thereof in a substantial number of such cells is sufficient to warrant a determination of a cancerous, or potentially cancerous, condition.
Thus, the polynucleotide sequences disclosed according to the present invention are expressed in cancer compared to normal tissue samples or may be expressed at a higher level in cancer as compared to normal tissues.
Further, such polynucleotide, or gene, sequence expression in normal tissues may correlate with individuals having a family history of cancer.
Such gene sequences may play a direct role in cancer progression, such as in cancer initiation or cancer cell proliferation/survival. For example, one or more genes encoding the same polypeptide as one or more of the sequences disclosed herein represent novel individual gene targets for screening and discovery of small molecules that inhibit enzyme or other cellular functions, e.g. kinase inhibitors. Such molecules represent valuable therapeutics for cancer. In addition, small molecules or agents, such as small organic molecules, that down-regulate the expression of these genes in cancer would represent valuable anti-cancer therapeutics. Expression of the gene in normal tissues may indicate a predisposition towards development of lung cancer. The encoded polypeptide might represent a potentially useful cell surface target for therapeutic molecules such as cytolytic antibodies, or antibodies attached to cytotoxic, or cytolytic, agents. .
It should be cautioned that, in carrying out the procedures of the present invention as disclosed herein, any reference to particular buffers, media, reagents, cells, culture conditions and the like are not intended to be limiting, but are to be read so as to include all related materials that one of ordinary skill in the art would recognize as being of interest or value in the particular context in which that discussion is presented. For example, it is often possible to substitute one buffer system or culture medium for another and still achieve similar, if not identical, results. Those of skill in the art will have sufficient knowledge of such systems and methodologies so as to be able, without undue experimentation, to make such substitutions as will optimally serve their purposes in using the methods and procedures disclosed herein.
The present invention will now be further described by way of the following non-limiting example. In applying the disclosure of the example, it should be kept clearly in mind that other and different embodiments of the methods disclosed according to the present invention will no doubt suggest themselves to those of skill in the relevant art. The following example shows how a potential anti-neoplastic agent may be identified using one or more of the genes disclosed herein.
EXAMPLE
SW480 cells are grown to a density of 105 cells/cm2 in Leibovitz's L-15 medium supplemented with 2 mM L-glutamine (90%) and 10% fetal bovine serum. The cells are collected after treatment with 0.25% trypsin, 0.02%
EDTA at 37°C for 2 to 5 minutes. The trypsinized cells are then diluted with 30 ml growth medium and plated at a density of 50,000 cells per well in a 96 well plate (200 p.l/well). The following day, cells are treated with either compound buffer alone, or compound buffer containing a chemical agent to be tested, for 24 hours. The media is then removed, the cells lysed and the RNA recovered using the RNAeasy reagents and protocol obtained from Qiagen. RNA is quantitated and 10 ng of sample in 1 p,1 are added to 24 p,1 of Taqman reaction mix containing 1X PCR buffer, RNAsin, reverse transcriptase, nucleoside triphosphates, amplitaq gold, tween 20, glycerol, bovine serum albumin (BSA) and specific PCR primers and probes for a reference gene (18S RNA) and a test gene (Gene X). Reverse transcription is then carried out at 48°C
for 30 minutes. The sample is then applied to a Perlin Elmer 7700 sequence detector and heat denatured for 10 minutes at 95°C. Amplification is performed through 40 cycles using 15 seconds annealing at 60°C followed by a 60 second extension at 72°C and 30 second denaturation at 95°C. Data files are then captured and the data analyzed with the appropriate baseline windows and thresholds.
The quantitative difference between the target and reference gene is then calculated and a relative expression value determined for all of the samples used. This procedure is then repeated for other genes functionally related to the gene as disclosed herein and the level of function, or expression, noted. The relative expression ratios for each pair of genes is determined (i.e., a ratio of expression is determined for each target gene versus each of the other genes for which expression is measured, where each gene's absolute expression is determined relative to the reference gene for each compound, or chemical agent, to be screened). The samples are then scored and ranked according to the degree of alteration of the expression profile in the treated samples relative to the control. The overall expression of the particular gene relative to the controls, as modulated by one chemical agent relative to another, is also ascertained. Chemical agents having the most effect on a given gene, or set of genes, are considered the most anti-neoplastic.
SEQUENCE LISTING
<110> Young, Paul Horrigan, Stephen Weaver, Zoe Endress, Gregory <120> Cancer-Linked Genes as Targets for Chemotherapy <130> 689290-79 <150> US/60/239,294 <151> 2000-10-11 <150> US/60/239,297 <151> 2000-10-11 <150> US/60/239,605 <151> 2000-10-11 <150> US/60/239,802 <151> 2000-10-12 <150> US/60/239,805 <151> 2000-10-12 <150> US/60/239,806 <151> 2000-10-12 <150> US/60/240,622 <151> 2000-10-16 <150> US/60/241,682 <151> 2000-10-19 <150> US/60/241,723 <151> 2000-10-19 <150> US/60/244,932 <151> 2000-10-31 <160> 21 <170> PatentIn version 3.0 <210> 1 <211> 1934 <212> DNA
<213> Homo sapiens <400> 1 ctgtcattca tgctttggaa aagtttactg tatatacatt agacattcct gttctttttg 60 gagttagtac tacatcccct gaagaaacat gtgcccaggt gattcgtgaa gctaagagaa 120 cagcaccaag tatagtgtat gttcctcata tccacgtgtg gtgggaaata gttggaccga 180 cacttaaagc cacatttacc acattattac agaatattcc ttcatttgct ccagttttac 240 tacttgcaac ttctgacaaa ccccattccg ctttgccaga agaggtgcaa gaattgttta 300 tccgtgatta tggagagatt tttaatgtcc agttaccgga taaagaagaa cggacaaaat 360 tttttgaaga tttaattcta aaacaagctg ctaagcctcc tatatcaaaa aagaaagcag 420 ttttgcaggctttggaggtactcccagtagcaccaccacctgagccaagatcactgacag480 cagaagaagtgaaacgactagaagaacaagaagaagatacatttagagaactgaggattt540 tcttaagaaatgttacacataggcttgctattgacaagcgattccgagtgtttactaagc600 ctgttgaccctgatgaggttcctgattatgtcactgtaataaagcaaccaatggaccttt660 catctgtaatcagtaaaattgatctacacaagtatctgactgtgaaagactatttgagag720 atattgatctaatctgtagtaatgccttagaatacaatccagatagagatcctggagatc780 gtcttattaggcatagagcctgtgctttaagagatactgcctatgccataattaaagaag840 aacttgatgaagactttgagcagctctgtgaagaaattcaggaatctagaaagaaaagag900 gttgtagctcctccaaatatgccccgtcttactaccatgtgatgccaaagcaaaattcca960 ctcttgttggtgataaaagatcagacccagagcagaatgaaaagctaaagacaccgagta1020 ctcctgtggcttgcagcactcctgctcagttgaagaggaaaattcgcaaaaagtcaaact1080 ggtacttaggcaccataaaaaagcgaaggaagatttcacaggcaaaggatgatagccaga1140 atgccatagatcacaaaattgagagtgatacagaggaaactcaagacacaagtgtagatc1200 ataatgagaccggaaacacaggagagtcttcggtggaagaaaatgaaaaacagcaaaatg1260 cctctgaaagcaaactggaattgagaaataattcaaatacttgtaatatagagaatgagc1320 ttgaagactctaggaagactacagcatgtacagaattgagagacaagattgcttgtaatg1380 gagatgcttctagctctcagataatacatatttctgatgaaaatgaaggaaaagaaatgt1440 gtgttctgcgaatgactcgagctagacgttcccaggtagaacagcagcagctcatcactg1500 ttgaaaaggctttggcaattctttctcagcctacaccctcacttgttgtggatcatgagc1560 gattaaaaaatcttttgaagactgttgttaaaaaaagtcaaaactacaacatatttcagt1620 tggaaaatttgtatgcagtaatcagccaatgtatttatcggcatcgcaaggaccatgata1680 aaacatcacttattcagaaaatggagcaagaggtagaaaacttcagttgttccagatgat1740 gatgtcatggtatcgagtattctttatattcagttcctatttaagtcatttttgtcatgt1800 ccgcctaattgatgtagtatgaaaccctgcatctttaaggaaaagattaaaatagtaaaa1860 taaaagtatttaaactttcctgatatttatgtacatattaagataaatgtcatgtgtaag1920 ataactgataaata 1934 <210> 2 <211> 362 <212> PRT
<213> Homo Sapiens <400> 2 Met Asp Leu Ser Ser Val Ile Ser Lys Ile Asp Leu His Lys Tyr Leu Thr Val Lys Asp Tyr Leu Arg Asp Ile Asp Leu Ile Cys Ser Asn Ala Leu Glu Tyr Asn Pro Asp Arg Asp Pro Gly Asp Arg Leu Ile Arg His Arg Ala Cys Ala Leu Arg Asp Thr Ala Tyr Ala Ile Ile Lys Glu Glu Leu Asp Glu Asp Phe Glu Gln Leu Cys Glu Glu Ile Gln Glu Ser Arg Lys Lys Arg Gly Cys Ser Ser Ser Lys Tyr Ala Pro Ser Tyr Tyr His Va1 Met Pro Lys Gln Asn Ser Thr Leu Val Gly Asp Lys Arg Ser Asp Pro G1u Gln Asn Glu Lys Leu Lys Thr Pro Ser Thr Pro Val Ala Cys Ser Thr Pro Ala Gln Leu Lys Arg Lys Ile Arg Lys Lys Ser Asn Trp Tyr Leu Gly Thr Ile Lys Lys Arg Arg Lys Ile Ser Gln Ala Lys Asp l45 150 155 160 Asp Ser Gln Asn Ala Ile Asp His Lys Ile Glu Ser Asp Thr Glu Glu Thr Gln Asp Thr Ser Val Asp His Asn Glu Thr Gly Asn Thr Gly Glu Ser Ser Val Glu Glu Asn Glu Lys Gln Gln Asn Ala Ser Glu Ser Lys Leu Glu Leu Arg Asn Asn Ser Asn Thr Cys Asn Ile Glu Asn Glu Leu Glu Asp Ser Arg Lys Thr Thr Ala Cys Thr Glu Leu Arg Asp Lys Ile Ala Cys Asn Gly Asp Ala Ser Ser Ser Gln Ile Ile His I1e Ser Asp Glu Asn Glu Gly Lys Glu Met Cys Val Leu Arg Met Thr Arg A1a Arg Arg Ser Gln Va1 Glu Gln Gln Gln Leu Ile Thr Val Glu Lys Ala Leu Ala Ile Leu Ser Gln Pro Thr Pro Ser Leu Val Val Asp His Glu Arg Leu Lys Asn Leu Leu Lys Thr Val Val Lys Lys Ser Gln Asn Tyr Asn 21e Phe Gln Leu Glu Asn Leu Tyr Ala Val Ile Ser Gln Cys Ile Tyr Arg His Arg Lys Asp His Asp Lys Thr Ser Leu Ile Gln Lys Met G1u Gln Glu Val Glu Asn Phe Ser Cys Ser Arg <210> 3 <211> 1274 <212> DNA
<213> Homo Sapiens <400> 3 cacgaggcagactgaagattgtggcttggtattcacaggcaggtttcagacatttagatc 60 tttcttttaatgactaacaccatgcctatctgtggagaagctggcaacatgtcacacctg 120 gaaattgtttttcaacattaatactattatttggcagtaatccagattgcttttgccacc 180 aacctgaagacatatagaggcagaaggacaggaataattctatttgtttcctgttttgaa 240 acttccatctgtaaggctatcaaaaggagatgtgagagagggtattgagtctggcctgac 300 aatgcagttcttaaaccaaaggtccattatgcttctcctctctgagaatcctgacttacc 360 tcaacaacggagacatggcacagtagccagcttggagacttctcagccaatgctctgaga 420 tcaagtcgaagacccaatatacagggttttgagctcatcttcatcattcatatgaggaaa 480 taagtggtaaaatccttggaaatacaatgagactcatcagaaacatttacatattttgta 540 gtattgttatgacagcagagggtgatgctccagagctgccagaagaaagggaactgatga600 ccaactgctccaacatgtctctaagaaaggttcccgcagacttgaccccagccacaacga660 cactggatttatcctataacctcctttttcaactccagagttcagattttcattctgtct720 ccaaactgagagttttgattctatgccataacagaattcaacagctggatctcaaaacct780 ttgaattcaacaaggagttaagatatttagatttgtctaataacagactgaagagtgtaa840 cttggtatttactggcaggtctcaggtatttagatctttcttttaatgactttgacacca900 tgcctatctgtgaggaagctggcaacatgtcacacctggaaatcctaggtttgagtgggg960 caaaaatacaaaaatcagatttccagaaaattgctcatctgcatctaaatactgtcttct1020 taggattcagaactcttcctcattatgaagaaggtagcctgcccatcttaaacacaacaa1080 aactgcacattgttttaccaatggacacaaatttctgggttcttttgcgtgatggaatca1140 agacttcaaaaatattagaaatgacaaatatagatggcaaaagccaatttgtaagttatg1200 aaatgcaacgaaatcttagtttagaacatgctaagacatcggttctattgcttaataaag1260 ttgatttactctgg 1274 <210> 4 <211> 256 <212> PRT
<213> Homo sapiens <400> 4 Met Arg Leu Ile Arg Asn Ile Tyr Ile Phe Cys Ser Ile Val Met Thr Ala Glu Gly Asp Ala Pro Glu Leu Pro Glu Glu Arg Glu Leu Met Thr Asn Cys Ser Asn Met Ser Leu Arg Lys Val Pro Ala Asp Leu Thr Pro A1a Thr Thr Thr Leu Asp Leu Ser Tyr Asn Leu Leu Phe Gln Leu Gln Ser Ser Asp Phe His Ser Val Ser Lys Leu Arg Val Leu Ile Leu Cys His Asn Arg Ile Gln Gln Leu Asp Leu Lys Thr Phe Glu Phe Asn Lys Glu Leu Arg Tyr Leu Asp Leu Ser Asn Asn Arg Leu Lys Ser Val Thr Trp Tyr Leu Leu Ala Gly Leu Arg Tyr Leu Asp Leu Ser Phe Asn Asp Phe Asp Thr Met Pro Ile Cys Glu G1u A1a Gly Asn Met Ser His Leu Glu Ile Leu Gly Leu Ser Gly Ala Lys Ile Gln Lys Ser Asp Phe Gln Lys Ile Ala His Leu His Leu Asn Thr Val Phe Leu Gly Phe Arg Thr Leu Pro His Tyr Glu Glu Gly Ser Leu Pro Ile Leu Asn Thr Thr Lys Leu His Ile Val Leu Pro Met Asp Thr Asn Phe Trp Val Leu Leu Arg Asp Gly Ile Lys Thr Ser Lys Ile Leu Glu Met Thr Asn I1e Asp Gly Lys Ser Gln Phe Val Ser Tyr Glu Met Gln Arg Asn Leu Ser Leu Glu His Ala Lys Thr Ser Val Leu Leu Leu Asn Lys Val Asp Leu Leu Trp <210>
<211>
<212>
DNA
<213> Sapiens Homo <400>
agaatcccggacagccctgc tccctgcagccaggtgtagtttcgggagcc actggggcca60 aagtgagagtccagcggtct tccagcgcttgggccacggcggcggccctg ggagcagagg120 tggagcgaccccattacgct aaagatgaaaggctggggttggctggccct gcttctgggg180 gccctgctgggaaccgcctg ggctcggaggagccaggatctccactgtgg agcatgcagg240 gctctggtggatgaactaga atgggaaattgcccaggtggaccccaagaa gaccattcag300 atgggatctttccggatcaa tccagatggcagccagtcagtggtggaggt gccttatgcc360 cgctcagaggcccacctcac agagctgctggaggagatatgtgaccggat gaaggagtat420 ggggaacagattgatccttc cacccatcgcaagaactacgtacgtgtagt gggccggaat480 ggagaatccagtgaactgga cctacaaggcatccgaatcgactcagatat tagcggcacc540 ctcaagtttgcgtgtgagag cattgtggaggaatacgaggatgaactcat tgaattcttt600 tcccgagaggctgacaatgt taaagacaaactttgcagtaagcgaacaga tctttgtgac660 catgccctgcacatatcgca tgatgagctatgaaccactggagcagccca cactggcttg720 atggatcacccccaggaggg gaaaatggtggcaatgccttttatatatta tgtttttact780 gaaattaactgaaaaaatat gaaaccaaaagtac 814 <2l0>
<211>
<212>
PRT
<213>
Homo Sapiens <400>
Met Lys Leu Leu Gly Ala Leu Leu Gly Gly Trp Leu Gly Trp Leu Ala Thr Ala Asp Leu Cys Gly Ala Cys Arg Trp Ala His Arg Arg Ser Gln Ala Leu Glu Ile Gln Val Asp Pro Lys Val Asp Ala Glu Leu Glu Trp Lys Thr Arg Ile Pro Asp Gly Ser Gln Ile Gln Asn Met Gly Ser Phe Ser Val Arg Ser A1a His Leu Thr Glu Val Glu Glu Val Pro Tyr Ala Leu Leu Met Lys Tyr Gly Glu Gln Tle Glu Glu Glu Ile Cys Asp Arg Asp Pro Tyr Val Val Val Gly Arg Asn Ser Thr Arg His Arg Lys Asn 100 105 1l0 Gly Glu Ser Ser Glu Leu Asp Leu Gln Gly Ile Arg Ile Asp Ser Asp Ile Ser Gly Thr Leu Lys Phe Ala Cys Glu Ser Ile Val Glu G1u Tyr Glu Asp Glu Leu Ile Glu Phe Phe Ser Arg Glu Ala Asp Asn Val Lys Asp Lys Leu Cys Ser Lys Arg Thr Asp Leu Cys Asp His Ala Leu His Ile Ser His Asp Glu Leu <210> 7 <211> 1597 <212> DNA
<213> Homo Sapiens <400>
gcggccgctgcgccgcaaactcgtgtgggacgcaccgctccagccgcccgcgggccagcg caccggtcccccagcggcagccgagcccgcccgcgcgccgttcgtgccctcgtgaggctg120 gcatgcaggatggcaggacagcccggccacatgccccatggagggagttccaacaacctc180 tgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtct240 tttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagc300 gaggtgtacaaggccacctgcctgctggacaggaagacagtggctctgaagaaggtgcag360 atctttgagatgatggacgccaaggcgaggcaggactgtgtcaaggagatcggcctcttg420 aagcaactgaaccacccaaatatcatcaagtatttggactcgtttatcgaagacaacgag480 ctgaacattgtgctggagttggctgacgcaggggacctctcgcagatgatcaagtacttt540 aagaagcagaagcggctcatcccggagaggacagtatggaagtactttgtgcagctgtgc600 agcgccgtggagcacatgcattcacgccgggtgatgcaccgagacatcaagcctgccaac660 gtgttcatcacagccacgggcgtcgtgaagctcggtgaccttggtctgggccgcttcttc720 agctctgagaccaccgcagcccactccctagtggggacgccctactacatgtcaccggag780 aggatccatgagaacggctacaacttcaagtccgacatctggtccttgggctgtctgctg840 tacgagatggcagccctccagagccccttctatggagataagatgaatctcttctccctg900 tgccagaagatcgagcagtgtgactaccccccactccccggggagcactactccgagaag960 ttacgagaactggtcagcatgtgcatctgccctgacccccaccagagacctgacatcgga1020 tacgtgcaccaggtggccaagcagatgcacatctggatgtccagcacctgagcgtggatg1080 caccgtgccttatcaaagccagcaccactttgccttacttgagtcgtcttctcttcgagt1140 ggccacctggtagcctagaacagctaagaccacagggttcagcaggttccccaaaaggct1200 gcccagccttacagcagatgctgaaggcagagcagctgagggaggggcgctggccacatg1260 tcactgatggtcagattccaaagtcctttctttatactgttgtggacaatctcagctggg1320 tcaataagggcaggtggttcagcgagccacggcagccccctgtatctggattgtaatgtg1380 aatctttagggtaattcctccagtgacctgtcaaggcttatgctaacaggagacttgcag1440 gagaccgtgtgatttgtgtagtgagcctttgaaaatggttagtaccgggttcagtttagt1500 tcttggtatcttttcaatcaagctgtgtgcttaatttactctgttgtaaagggataaagt1560 ggaaatcatttttttccgtggaaaaaaaaaaaaaaaa 1597 <210> 8 <211> 306 <212> PRT
<213> Homo Sapiens 400> 8 Met Pro His Gly Gly Ser Ser Asn Asn Leu Cys His Thr Leu Gly Pro Val His Pro Pro Asp Pro Gln Arg His Pro Asn Thr Leu Ser Phe Arg Cys Ser Leu Ala Asp Phe Gln Ile Glu Lys Lys Ile Gly Arg Gly Gln Phe Ser Glu Val Tyr Lys Ala Thr Cys Leu Leu Asp Arg Lys Thr Val Ala Leu Lys Lys Val Gln Ile Phe Glu Met Met Asp Ala Lys Ala Arg Gln Asp Cys Val Lys Glu Ile Gly Leu Leu Lys Gln Leu Asn.His Pro Asn Ile Ile Lys Tyr Leu Asp Ser Phe Ile Glu Asp Asn Glu Leu Asn Ile Val Leu Glu Leu Ala Asp Ala Gly Asp Leu Ser Gln Met Ile Lys Tyr Phe Lys Lys Gln Lys Arg Leu Ile Pro Glu Arg Thr Val Trp Lys Tyr Phe Val Gln Leu Cys Ser Ala Val Glu His Met His Ser Arg Arg Val Met His Arg Asp Ile Lys Pro Ala Asn Val Phe Ile Thr Ala Thr Gly Val Val Lys Leu Gly Asp Leu Gly Leu Gly Arg Phe Phe Ser Ser l80 185 190 Glu Thr Thr Ala Ala His Ser Leu Val Gly Thr Pro Tyr Tyr Met Ser Pro Glu Arg Ile His Glu Asn Gly Tyr Asn Phe Lys Ser Asp Ile Trp Ser Leu Gly Cys Leu Leu Tyr Glu Met Ala Ala Leu Gln Ser Pro Phe Tyr Gly Asp Lys Met Asn Leu Phe Ser Leu Cys Gln Lys Ile Glu Gln Cys Asp Tyr Pro Pro Leu Pro Gly Glu His Tyr Ser Glu Lys Leu Arg Glu Leu Val Ser Met Cys Ile Cys Pro Asp Pro His Gln Arg Pro Asp Ile Gly Tyr Val His Gln Val Ala Lys Gln Met His Ile Trp Met Ser Ser Thr <210> 9 <211> 6780 <212> DNA
<213> Homo Sapiens <220>
<221> misc_feature <223> n=a,t,g or c <400>
gggcggggctgagggcggcgggggcgggccgcccgagctgggagggcggcggcgccgagg ggaggagagcggcccatggacccgcggggcccggcgccccagactctgcgccgtcgggac 120 ggagcccaagatgtcggcctaggccggggcgcgacgacgcggacggggcggcgaggaggc 180 gccgctgctgccggggctcgcagccgccgagcccccgagggcgcgccctgacggactggc 240 cgagccggcggtgagaggccggcgcgtctggagcgggccgcgcggcaccatgtcggccaa 300 ggtgcggctcaagaagctggagcagctgctcctggacgggccctggcgcaacgagagcgc 360 cctgagcgtggaaacgctgctcgacgtgctcgtctgcctgtacaccgagtgcagccactc 420 ggccctgcgccgcgacaagtacgtggccgagttcctcgagtgggctaaaccatttacaca 480 gctggtgaaagaaatgcagcttcatcgagaagactttgaaataattaaagtaattggaag 540 aggtgcttttggtgaggttgctgttgtcaaaatgaagaatactgaacgaatttatgcaat 600 gaaaatcctcaacaagtgggagatgctgaaaagagcagagaccgcgtgcttccgagagga 660 gcgcgatgtgctggtgaacggcgactgccagtggatcaccgcgctgcactacgcctttca 720 ggacgagaaccacctgtacttagtcatggattactatgtgggtggtgatttactgaccct 780 gctcagcaaatttgaagacaagcttccggaagatatggcgaggttctacattggtgaaat 840 ggtgctggccattgactccatccatcagcttcattacgtgcacagagacattaaacctga 900 caatgtccttttggacgtgaatggtcatatccgcctggctgactttggatcatgtttgaa 960 gatgaatgatgatggcactgtgcagtcctccgtggccgtgggcacacctgactacatctc 1020 gccggagatcctgcaggcgatggaggacggcatgggcaaatacgggcctgagtgtgactg 1080 gtggtctctgggtgtctgcatgtatgagatgctctatggagaaacgccgttttatgcgga 1140 gtcactcgtggagacctatgggaagatcatgaaccatgaagagcgattccagttcccatc 1200 ccatgtcacggatgtatctgaagaagcgaaggacctcatccagagactgatctgcagtag 1260 agaacgccggctggggcagaatggaatagaggatttcaaaaagcatgcgttttttgaagg 1320 tctaaattgggaaaatatacgaaacctagaagcaccttatattcctgatgtgagcagtcc 1380 ctctgacacatccaacttcgacgtggatgacgacgtgctgagaaacacggaaatattacc 1440 tcctggttctcacacaggcttttctggattacatttgccattcattggttttacattcac 1500 aacggaaagctgtttttctgatcgaggctctctgaagagcataatgcagtccaacacatt 1560 aaccaaagatgaggatgtgcagcgggacctggagcacagcctgcagatggaagcttacga 1620 gaggaggattcggaggctggaacaggagaagctggagctgagcaggaagctgcaagagtc 1680 cacccagaccgtgcagtccctccacggctcatctcgggccctcagcaattcaaaccgaga 1740 taaagaaatcaaaaagctaaatgaagaaatcgaacgcttgaagaataaaatagcagattc 1800 aaacaggctggagcgacagcttgaggacacagtggcgcttcgccaagagcgtgaggactc 1860 cacgcagcggctgcgggggctggagaagcagcaccgcgtggtccggcaggagaaggagga 1920 gctgcacaagcaactggttgaagcctcagagcggttgaaatcccaggccaaggaactcaa 1980 agatgcccatcagcagcgaaagctggccctgcaggagttctcggagctgaacgagcgcat 2040 ggcagagctccgtgcccagaagcagaaggtgtcccggcagctgcgagacaaggaggagga 2100 gatggaggtggccacgcagaaggtggacgccatgcggcaggaaatgcggagagctgagaa 2160 gctcaggaaagagctggaagctcagcttgatgatgctgttgctgaggcctccaaggagcg 2220 caagcttcgtgagcacagcgagaacttctgcaagcaaatggaaagcgagctggaggccct 2280 caaggtgaagcaaggaggccggggagcgggtgccaccttagagcaccagcaagagatttc 2340 caaaatcaaatccgagctggagaagaaagtcttattttatgaagaggaattggtcagacg 2400 tgaggcctcccatgtgctagaagtgaaaaatgtgaagaaggaggtgcatgattcagaaag 2460 ccaccagctggccctgcagaaagaaatcttgatgttaaaagataagttagaaaagtcaaa 2520 gcgagaacggcataacgagatggaggaggcagtaggtacaataaaagataaatacgaacg 2580 agaaagagcgatgctgtttgatgaaaacaagaagctaactgctgaaaatgaaaagctctg 2640 ttcctttgtggataaactcacagctcaaaatagacagctggaggatgagctgcaggatct 2700 ggcagccaagaaggagtcagtggcccactgggaagctcagattgcggaaatcattcagtg 2760 ggtcagtgacgagaaagatgcccggggttaccttcaagctcttgcttccaagatgaccga 2820 agagctcgaggctttgaggagttctagtctggggtcaagaacactggacccgctgtggaa 2880 ggtgcgccgcagccagaagctggacatgtccgcgcggctggagctgcagtcggccctgga 2940 ggcggagatccgggccaagcagcttgtccaggaggagctcaggaaggtcaaggacgccaa 3000 cctcaccttggaaagcaaactaaaggattccgaagccaaaaacagagaattattagaaga 3060 aatggaaattttgaagaaaaagatggaagaaaaattcagagcagatactgggctcaaact 3120 g tccagatttt caggattcca tttttgagta tttcaacact gctcctcttg cacatgacct 3180 gacatttaga accagctcag ctagtgagca agaaacacaa gctccgaagc cagaagcgtc 3240 cccgtcgatg tctgtggctg catcagagca gcaggaggac atggctcggc ccccgcagag 3300 gccatccgct gtgccgttgc ccaccacgca ggccctggtt ctggctggac cgaagccaaa 3360 agctcaccag ttcagcatca agtccttctc cagccctact cagtgcagcc actgcacctc 3420 cctgatggtt gggctgatcc ggcagggcta cgcctgcgag gtgtgttcct ttgcttgcca 3480 cgtgtcctgc aaagacggtg ccccccaggt gtgcccaata cctcccgagc agtccaagag 3540 gcctctgggc gtggacgtgc agcgaggcat cggaacagcc tacaaaggcc atgtcaaggt 3600 cccaaagccc acgggggtga agaagggatg gcagcgcgca tatgcagtcg tctgtgagtg 3660 caagctcttc ctgtatgatc tgcctgaagg aaaatccacc cagcctggtg tcattgcgag 3720 ccaagtcttg gatctcagag atgacgagtt ttccgtgagc tcagtcctgg cctcagatgt 3780 cattcatgct acacgccgag atattccatg tatattcagg gtgacggcct ctctcttagg 3840 tgcaccttct aagaccagct cgctgctcat tctgacagaa aatgagaatg aaaagaggaa 3900 gtgggttggg attctagaag gactccagtc catccttcat aaaaaccggc tgaggaatca 3960 ggtcgtgcat gttcccttgg aagcctacga cagctcgctg cctctcatca aggccatcct 4020 gacagctgcc atcgtggatg cagacaggat tgcagtcggc ctagaagaag ggctctatgt 4080 catagaggtc acccgagatg tgatcgtccg tgccgctgac tgtaagaagg tacaccagat 4140 cgagcttgct cccagggaga agatcgtaat cctcctctgt ggccggaacc accatgtgca 4200 cctctatccg tggtcgtccc ttgatggagc ggaaggcagc tttgacatca agcttccgga 4260 aaccaaaggc tgccagctca tggccacggc cacactcaag aggaactctg gcacctgcct 4320 gtttgtggcc gtgaaacggc tgatcctttg ctatgagatc cagagaacga agccattcca 4380 cagaaagttc aatgagattg tggctcccgg cagcgtgcag tgcctggcgg tgctcaggga 4440 caggctctgt gtgggctacc cttctgggtt ctgcctgctg agcatccagg gggacgggca 4500 gcctctaaac ctggtaaatc ccaatgaccc ctcgcttgcg ttcctctcac aacagtcttt 4560 tgatgccctt tgtgctgtgg agctcgaaag cgaggagtac ctgctttgct tcagccacat 4620 gggactgtac gtggacccgc aaggccggag ggcacgcgcg caggagctca tgtggcctgc 4680 ggctcctgtc gcctgtagtt gcagccccac ccacgtcacg gtgtacagcg agtatggcgt 4740 ggacgtcttt gatgtgcgca ccatggagtg ggtgcagacc atcggcctgc ggaggataag 4800 gcccctgaac tctgaaggca ccctcaacct cctcaactgc gagcctccac gcttgatcta 4860 cttcaagagc aagttctcgg gagcggttct caacgtgccg gacacctccg acaacagcaa 4920 gaagcagatg ctgcgcacca ggagcaaaag gcggttcgtc ttcaaggtcc cagaggaaga 4980 gagactgcag cagaggcgag agatgcttag agacccagaa ttgagatcca aaatgatatc 5040 caacccaacc aacttcaacc acgtggccca catgggccca ggcgacggca tgcaggtgct 5100 catggacctg cctctgagtg ctgtgccccc ctcccaggag gaaaggccgg gccccgctcc 5160 caccaacctg gctcgccagc ctccatccag gaacaagccc tacatctcgt ggccctcatc 5220 aggtggatcg gagcctagcg tgactgtgcc tctgagaagt atgtctgatc cagaccagga 5280 ctttgacaaa gagcctgatt cggactccac caaacactca actccatcga atagctccaa 5340 CCCCagCggC CCaCCgagCC CCaaCtCCCC CC3CaggagC CagCt CCCCC tcgaaggcct 5400 ggagcagccg gcctgtgaca cctgaagccg ccagctcgcc acaggggcca gggagctgga 5460 gatggcctcc agcgtcagtg ccaagactga gcgggccctc cagtgttgtc caaggaaatg 5520 tagaatcact ttgtagatat ggagatgaag aagacaaatc tttattataa tattgatcag 5580 ttttatgccg cattgttcgt ggcagtagac cacatctgtt cgtctgcaca gctgtgaggc 5640 gatgctgttc catctgcaca tgaaggaccc ccatacagcc tgtctcccac ccctgacaac 5700 ccgagagggc atatggggcc ctgccaacac cacttcctca gcagaaaccc gtcatgacgc 5760 ggctgcttcg gaagcagaca tctggggaca cagcctcagt acccagtctt ttccctagtt 5820 cctgaaactt tcctaggacc ttaagagaat agtaggaggt cctatagcat tcccagtgtc 5880 actagaattt tgaagacagg aaagtggagg ttagtctgtg gccttttttt catttagcca 5940 ttgcacagtc agctgcagaa gtcctgctga ccacctagtc atggacaaag gcccaggacc 6000 agtgacaccc tgcgtccctg tgtgcgttaa gttcattctg ggtcgcagcc atgaagtgtc 6060 accagtatct actactgtga agtcagctgt gctgttttcc attcgcttcc acggcttctg 6120 cctcctgcca taaaaccagc gagtgtcgtg gtgcaggcag gccctgtggc ctgctgggct 6180 gagggaagtc agagccccag ggcgccacga agcagccact gggatacccc accccgcccc 6240 gccnnccccc ccccccccnc cagtcnagnc ccgaaatgga gcccccgtga ttagtagccc 6300 gtatgatcac gtagacccac ccaacacact cctgcacact ggccccggcc cacggcacag 6360 caatcccctg cgcgtggatt tcacctcacc ctttgtacca gatgttgagt gaccagctct 6420 gtggccctgt gtcgtcagag gcttgtgatt aactgtggcg gcagacacag cttgtccaca 6480 gcttgggcca ggcttcccct gtcctcccac cggtcggctg cttggcaagg ctgttcagga 6540 cgtgcacttc cccaagtcgg cactgagtgg cccagcacca cctagccctg ccaccccact 6600 gccctcctgg gccttctgct ggatgggcac ctggggggtt ctggtttttt acttttttaa 6660 tgtaagtctc agtctttgta attaattatt gaattgtgag aacatttttg aacaatttac 6720 ctgtcaataa agcagaagac ggcagtttta aagttaaaaa aaaaaaaaaa aaaaaaaaaa 6780 <210> 10 <211> 1711 <212> PRT
<213> Homo Sapiens <400> 10 Met Ser Ala Lys Val Arg Leu Lys Lys Leu Glu Gln Leu Leu Leu Asp G1y Pro Trp Arg Asn Glu Ser Ala Leu Ser Val Glu Thr Leu Leu Asp Val Leu Val Cys Leu Tyr Thr Glu Cys Ser His Ser Ala Leu Arg Arg Asp Lys Tyr Val Ala G1u Phe Leu Glu Trp Ala Lys Pro Phe Thr Gln Leu Val Lys Glu Met Gln Leu His Arg Glu Asp Phe Glu Ile Ile Lys Val Ile Gly Arg Gly Ala Phe Gly Glu Val Ala Val Val Lys Met Lys Asn Thr Glu Arg Ile Tyr Ala Met Lys Ile Leu Asn Lys Trp Glu Met Leu Lys Arg Ala Glu Thr Ala Cys Phe Arg Glu Glu Arg Asp Val Leu Val Asn Gly Asp Cys Gln Trp Ile Thr Ala Leu His Tyr Ala Phe Gln Asp Glu Asn His Leu Tyr Leu Val Met Asp Tyr Tyr Val Gly Gly Asp Leu Leu Thr Leu Leu Ser Lys Phe Glu Asp Lys Leu Pro Glu Asp Met Ala Arg Phe Tyr Ile Gly Glu Met Va1 Leu Ala Ile Asp Ser I1e His Gln Leu His Tyr Val His Arg Asp Ile Lys Pro Asp Asn Val Leu Leu Asp Val Asn Gly His Ile Arg Leu Ala Asp Phe Gly Ser Cys Leu Lys Met Asn Asp Asp Gly Thr Val Gln Ser Ser Val Ala Val Gly Thr Pro Asp Tyr Ile Ser Pro Glu Ile Leu Gln Ala Met Glu Asp Gly Met Gly Lys Tyr Gly Pro Glu Cys Asp Trp Trp Ser Leu Gly Val Cys Met Tyr 1~
Glu Met Leu Tyr Gly G1u Thr Pro. Phe Tyr Ala Glu Ser Leu Val Glu Thr Tyr Gly Lys Ile Met Asn His Glu Glu Arg Phe Gln Phe Pro Ser His Val Thr Asp Val Ser Glu Glu A1a Lys Asp Leu Ile Gln Arg Leu Ile Cys Ser Arg Glu Arg Arg Leu Gly Gln Asn Gly Ile Glu Asp Phe Lys Lys His Ala Phe Phe Glu Gly Leu Asn Trp Glu Asn I1e Arg Asn Leu Glu Ala Pro Tyr Ile Pro Asp Val Ser Ser Pro Ser Asp Thr Ser Asn Phe Asp Val Asp Asp Asp Val Leu Arg Asn Thr Glu Ile Leu Pro Pro Gly Ser His Thr Gly Phe Ser Gly Leu His Leu Pro Phe Ile Gly Phe Thr Phe Thr Thr Glu Ser Cys Phe Ser Asp Arg Gly Ser Leu Lys Ser Ile Met Gln Ser Ann Thr Leu Thr Lys Asp Glu Asp Val Gln Arg Asp Leu Glu His 5er Leu Gln Met Glu Ala Tyr Glu Arg Arg Ile Arg Arg Leu Glu Gln Glu Lys Leu Glu Leu Ser Arg Lys Leu Gln Glu Ser Thr Gln Thr Val Gln Ser Leu His Gly Ser Ser Arg Ala Leu Ser Asn Ser Asn Arg Asp Lys Glu Ile Lys Lys Leu Asn Glu Glu Ile G1u Arg Leu Lys Asn Lys Ile Ala Asp Ser Asn Arg Leu Glu Arg Gln Leu Glu Asp Thr Val Ala Leu Arg Gln Glu Arg Glu Asp Ser Thr Gln Arg Leu Arg Gly Leu Glu Lys Gln His Arg Val Val Arg Gln Glu Lys Glu Glu Leu His Lys G1n Leu Val Glu Ala Ser Glu Arg Leu Lys Ser Gln Ala Lys Glu Leu Lys Asp Ala His Gln Gln Arg Lys Leu Ala Leu Gln Glu Phe Ser Glu Leu Asn Glu Arg Met Ala Glu Leu Arg Ala Gln Lys Gln Lys Val Ser Arg Gln Leu Arg Asp Lys Glu Glu Glu Met Glu Val Ala Thr Gln Lys Val Asp Ala Met Arg Gln Glu Met Arg Arg Ala Glu Lys Leu Arg Lys Glu Leu Glu Ala Gln Leu Asp Asp Ala Val Ala Glu Ala Ser Lys Glu Arg Lys Leu Arg G1u His Ser Glu Asn Phe Cys Lys Gln Met Glu Ser Glu Leu Glu Ala Leu Lys Val Lys Gln Gly Gly Arg Gly Ala Gly A1a Thr Leu Glu His Gln Gln Glu Ile Ser Lys Ile Lys Ser Glu Leu Glu Lys Lys Val Leu Phe Tyr Glu Glu Glu Leu Val Arg Arg Glu Ala Ser His Val Leu Glu Val Lys Asn Va1 Lys Lys Glu Val His Asp Ser Glu Ser His Gln Leu Ala Leu Gln Lys Glu Ile Leu Met Leu Lys Asp Lys Leu Glu Lys Ser Lys Arg Glu Arg His Asn Glu Met Glu Glu Ala Val Gly Thr Ile Lys Asp Lys Tyr Glu Arg Glu Arg Ala Met Leu Phe Asp Glu Asn Lys Lys Leu Thr Ala Glu Asn Glu Lys Leu Cys Ser Phe Val Asp Lys Leu Thr Ala Gln Asn Arg Gln Leu Glu Asp Glu Leu Gln Asp Leu Ala A1a Lys Lys Glu Ser Val Ala His Trp Glu Ala Gln Ile Ala Glu Ile Ile Gln Trp Val Ser Asp Glu Lys Asp Ala Arg Gly Tyr Leu Gln Ala Leu Ala Ser Lys Met Thr Glu Glu Leu Glu Ala Leu Arg Ser Ser Ser Leu Gly Ser Arg Thr Leu Asp Pro Leu Trp Lys Val Arg Arg Ser Gln Lys T~eu Asp Met Ser Ala Arg Leu Glu Leu Gln Ser Ala Leu Glu A1a Glu Ile Arg Ala Lys Gln Leu Val Gln Glu Glu Leu Arg Lys Val Lys Asp Ala Asn Leu Thr Leu Glu Ser Lys Leu Lys Asp Ser Glu Ala Lys Asn Arg Glu Leu Leu Glu Glu Met Glu Ile Leu Lys Lys Lys Met Glu Glu Lys Phe Arg Ala Asp Thr Gly Leu Lys Leu Pro Asp Phe Gln Asp Ser Ile Phe Glu Tyr Phe Asn Thr Ala Pro Leu Ala His Asp Leu Thr Phe Arg Thr Ser Ser Ala Ser Glu Gln Glu Thr Gln Ala Pro Lys Pro Glu Ala Ser Pro Ser Met Ser Val Ala Ala Ser Glu Gln Gln Glu Asp Met Ala Arg Pro Pro Gln Arg Pro Ser Ala Val gg5 1000 1005 Pro Leu Pro Thr Thr Gln Ala Leu Val Leu Ala Gly Pro Lys Pro Lys Ala His Gln Phe Ser Ile Lys Ser Phe Ser Ser Pro Thr Gln Cys Ser His Cys Thr Ser Leu Met Val Gly Leu Ile Arg Gln Gly Tyr Ala Cys Glu Val Cys Ser Phe Ala Cys His Val Ser Cys Lys Asp Gly Ala Pro Gln Val Cys Pro Ile Pro Pro Glu Gln Ser Lys Arg Pro Leu Gly Val Asp Val Gln Arg Gly Ile Gly Thr Ala Tyr Lys Gly His Val Lys Val Pro Lys Pro Thr Gly Val Lys Lys Gly Trp Gln Arg Ala Tyr Ala Val Val Cys Glu Cys Lys Leu Phe Leu Tyr Asp Leu Pro Glu Gly Lys Ser Thr Gln Pro Gly Val Ile Ala Ser Gln Val Leu Asp Leu Arg Asp Asp Glu Phe Ser Val Ser Ser Val Leu Ala Ser Asp Val Ile His Ala Thr Arg Arg Asp Ile Pro Cys Ile Phe Arg Val Thr Ala Ser Leu Leu Gly Ala Pro Ser Lys Thr Ser Ser Leu Leu Ile Leu Thr Glu Asn Glu Asn Glu Lys Arg Lys Trp Val G1y Ile Leu Glu Gly Leu Gln Ser Ile Leu His Lys Asn Arg Leu Arg Asn Gln Val Val His Val Pro Leu Glu Ala Tyr Asp Ser Ser Leu Pro Leu Ile Lys Ala I1e Leu Thr Ala A1a Ile Val Asp Ala Asp Arg Ile Ala Val Gly Leu Glu Glu Gly Leu Tyr Val Ile Glu Val Thr Arg Asp Val Ile Val Arg Ala Ala Asp Cys Lys Lys Val His Gln Ile Glu Leu Ala Pro Arg Glu Lys Ile Val 1280 1285 ' 1290 Ile Leu Leu Cys Gly Arg Asn His His Val His Leu Tyr Pro Trp Ser Ser Leu Asp Gly Ala Glu Gly Ser Phe Asp Ile Lys Leu Pro Glu Thr Lys Gly Cys Gln Leu Met A1a Thr Ala Thr Leu Lys Arg Asn Ser Gly Thr Cys Leu Phe Val Ala Val Lys Arg Leu Ile Leu Cys Tyr Glu Ile Gln Arg Thr Lys Pro Phe His Arg Lys Phe Asn Glu Ile Val Ala Pro Gly Ser Val Gln Cys Leu Ala Val Leu Arg Asp Arg Leu Cys Val Gly Tyr Pro Ser Gly Phe Cys Leu Leu Ser Ile Gln Gly Asp Gly Gln Pro Leu Asn Leu Val Asn Pro Asn Asp Pro Ser Leu Ala Phe Leu Ser Gln Gln Ser Phe Asp Ala Leu Cys Ala Val Glu Leu Glu Ser Glu Glu Tyr Leu Leu Cys Phe Ser His Met Gly Leu Tyr Val Asp Pro Gln Gly Arg Arg Ala Arg Ala Gln Glu Leu Met Trp Pro Ala Ala Pro Val Ala Cys Ser Cys Ser Pro Thr His Val Thr Val Tyr Ser G1u Tyr Gly Val Asp Val Phe Asp Val Arg Thr Met Glu Trp Val Gln Thr Ile Gly Leu Arg Arg Ile Arg Pro Leu Asn Ser Glu Gly Thr Leu Asn Leu Leu Asn Cys Glu Pro Pro Arg Leu Ile Tyr Phe Lys Ser Lys Phe Ser Gly Ala Val Leu Asn Val Pro Asp Thr Ser Asp Asn Ser Lys Lys Gln Met Leu Arg Thr Arg Ser Lys Arg Arg Phe Val Phe Lys Val Pro Glu G1u Glu Arg Leu Gln Gln Arg Arg Glu Met Leu Arg Asp Pro Glu Leu Arg Ser Lys Met Ile Ser Asn Pro Thr Asn Phe Asn His Val Ala His Met Gly Pro Gly Asp Gly Met Gln Val Leu Met Asp Leu Pro Leu Ser Ala Val Pro Pro Ser Gln Glu Glu Arg Pro Gly Pro Ala Pro Thr Asn Leu Ala Arg G1n Pro Pro Ser Arg Asn Lys Pro Tyr Ile Ser Trp Pro Ser Ser Gly Gly Ser Glu Pro Ser Val Thr Val Pro Leu Arg Ser Met Ser Asp Pro Asp Gln Asp Phe Asp Lys Glu Pro Asp Ser Asp Ser Thr Lys His Ser Thr Pro Ser Asn Ser Ser Asn Pro Ser Gly Pro Pro Ser Pro Asn Ser Pro His Arg Ser Gln Leu Pro Leu Glu Gly Leu G1u Gln Pro Ala Cys Asp Thr <210> 11 <211> 2287 <212> DNA
<213> Homo sapiens <400>
ggctgaggcagtggctccttgcacagcagctgcacgcgccgtggctccggatcttcttcg 60 tctttgcagcgtagcccgagtcggtcagcgccagaggacctcagcagccatgtcgaagcc 120 ccatagtgaagccgggactgccttcattcagacccagcagctgcacgcagccatggctga 180 cacattcctggagcacatgtgccgcctggacattgattcaccacccatcacagcccggaa 240 cactggcatcatctgtaccattggcccagcttcccgatcagtggagacgttgaaggagat 300 gattaagtctggaatgaatgtggctcgtctgaacttctctcatggaactcatgagtacca 360 tgcggagaccatcaagaatgtgcgcacagccacggaaagctttgcttctgaccccatcct 420 ctaccggcccgttgctgtggctctagacactaaaggacctgagatccgaactgggctcat480 caagggcagcggcactgcagaggtggagctgaagaagggagccactctcaaaatcacgct540 ggataacgcctacatggaaaagtgtgacgagaacatcctgtggctggactacaagaacat600 ctgcaaggtggtggaagtgggcagcaagatctacgtggatgatgggcttatttctctcca660 ggtgaagcagaaaggtgccgacttcctggtgacggaggtggaaaatggtggctccttggg720 cagcaagaagggtgtgaaccttcctggggctgctgtggacttgcctgctgtgtcggagaa780 ggacatccaggatctgaagtttggggtcgagcaggatgttgatatggtgtttgcgtcatt840 catccgcaaggcatctgatgtccatgaagttaggaaggtcctgggagagaagggaaagaa900 catcaagattatcagcaaaatcgagaatcatgagggggttcggaggtttgatgaaatcct960 ggaggccagtgatgggatcatggtggctcgtggtgatctaggcattgagattcctgcaga1020 gaaggtcttccttgctcagaagatgatgattggacggtgcaaccgagctgggaagcctgt1080 catctgtgctactcagatgctggagagcatgatcaagaagccccgccccactcgggctga1140 aggcagtgatgtggccaatgcagtcctggatggagccgactgcatcatgctgtctggaga1200 aacagccaaaggggactatcctctggaggctgtgcgcatgcagaacctgattgcccgtga1260 ggcagaggctgccatctaccacttgcaattatttgaggaactccgccgcctggcgcccat1320 taccagcgaccccacagaagccaccgccgtgggtgccgtggaggcctccttcaagtgctg1380 cagtggggccataatcgtcctcaccaagtctggcaggtctgctcaccaggtggccagata1440 ccgcccacgtgcccccatcattgctgtgacccggaatccccagacagctcgtcaggccca1500 cctgtaccgtggcatcttccctgtgctgtgcaaggacccagtccaggaggcctgggctga1560 ggacgtggacctccgggtgaactttgccatgaatgttggcaaggcccgaggcttcttcaa1620 gaagggagatgtggtcattgtgctgaccggatggcgccctggctccggcttcaccaacac1680 catgcgtgttgttcctgtgccgtgatggaccccagagcccctcctccagcccctgtccca1740 cccccttcccccagcccatccattaggccagcaacgcttgtagaactcactctgggctgt1800 aacgtggcactggtaggttgggacaccagggaagaagatcaacgcctcactgaaacatgg1860 ctgtgtttgcagcctgctctagtgggacagcccagagcctggctgccccatcatgtggcc1920 ccacccaatcaagggaagaaggaggaatgctggactggaggcccctggagccagatggca1980 agagggtgacagcttcctttcctgtgtgtactctgtccagttcctttagaaaaaatggat2040 gcccagaggactcccaaccctggcttggggtcaagaaacagccagcaagagttaggggcc2100 ttagggcactgggctgttgttccattgaagccgactctggccctggcccttacttgcttc2160 tctagctctctaggcctctccagtttgcacctgtccccaccctccactcagctgtcctgc2220 agcaaacactccaccctccaccttccattttcccccactactgcagcacctccaggcctg2280 ttgccgc 2287 <210> 12 <211> 531 <212> PRT
<213> HomoSapiens <400> 12 Met Ser ProHis SerGluAla GlyThrAla PheIleGln ThrGln Lys G1n Leu AlaAla MetAlaAsp ThrPheLeu GluHisMet CysArg His Leu Asp AspSer ProProIle ThrAlaArg AsnThrGly IleIle Ile Cys Thr GlyPro AlaSerArg SerValGlu ThrLeuLys GluMet Ile Ile Lys GlyMet AsnValAla ArgLeuAsn PheSerHis GlyThr Ser His Glu HisAla GluThrIle LysAsnVal ArgThrAla ThrGlu Tyr Ser Phe Ala Ser Asp Pro Ile Leu Tyr Arg Pro Val A1a Val Ala Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr Gly Leu Ile Lys Gly Ser Gly Thr Ala Glu Val Glu Leu Lys Lys Gly Ala Thr Leu Lys Ile Thr Leu Asp Asn Ala Tyr Met Glu Lys Cys Asp Glu Asn Ile Leu Trp Leu Asp Tyr Lys Asn Ile Cys Lys Val Val Glu Val Gly Ser Lys Ile Tyr Val Asp Asp Gly Leu Ile Ser Leu Gln Val Lys Gln Lys Gly Ala Asp Phe Leu Va1 Thr Glu Val Glu Asn Gly Gly Ser Leu Gly Ser Lys Lys Gly Val Asn Leu Pro Gly Ala Ala Val Asp Leu Pro Ala Val Ser Glu Lys Asp Ile Gln Asp Leu Lys Phe Gly Val Glu Gln Asp Val Asp Met Val Phe Ala Ser Phe Ile Arg Lys Ala Ser Asp Val His Glu Val Arg Lys Val Leu Gly Glu Lys Gly Lys Asn Ile Lys Ile Ile Ser Lys Ile Glu Asn His Glu Gly Val Arg Arg Phe Asp Glu Ile Leu Glu Ala Ser Asp Gly Ile Met Val Ala Arg Gly Asp Leu Gly Ile Glu Ile Pro Ala Glu Lys Val Phe Leu Ala Gln Lys Met Met Ile Gly Arg Cys Asn Arg Ala Gly Lys Pro Val Ile Cys Ala Thr Gln Met Leu Glu Ser Met Ile Lys Lys Pro Arg Pro Thr Arg Ala Glu Gly Ser Asp Val Ala Asn Ala Val Leu Asp Gly Ala Asp Cys Ile Met Leu Ser Gly Glu Thr Ala Lys Gly Asp Tyr Pro Leu Glu Ala Val Arg Met G1n Asn Leu Ile Ala Arg Glu Ala Glu Ala A1a Ile Tyr His Leu Gln Leu Phe Glu Glu Leu Arg Arg Leu Ala Pro Ile Thr Ser Asp Pro Thr Glu Ala Thr Ala Val Gly Ala 1~
Val Glu Ala Ser Phe Lys Cys Cys Ser Gly Ala Ile Ile Val Leu Thr Lys Ser Gly Arg Ser Ala His Gln Val Ala Arg Tyr Arg Pro Arg Ala Pro Ile Ile Ala Val Thr Arg Asn Pro Gln Thr Ala Arg Gln Ala His Leu Tyr Arg Gly Ile Phe Pro Val Leu Cys Lys Asp Pro Val Gln Glu Ala Trp Ala Glu Asp Val Asp Leu Arg Val Asn Phe Ala Met Asn Val Gly Lys Ala Arg Gly Phe Phe Lys Lys Gly Asp Val Val I1e Val Leu Thr Gly Trp Arg Pro Gly Ser Gly Phe Thr Asn Thr Met Arg Val Val 5l5 520 525 Pro Val Pro <210> 13 <211> 4364 <212> DNA
<213> Homo Sapiens <400>
cattagatctttacatgaaagtaaaatttataagatttctagaaagtcaaaagatgataa60 ctatttcttaggatactaaaagcactcacattatagaaaaaaaatcagttaactatactc120 cacaaacattaaaggctccctataaaaaaacatttttaataggcaagccacagaaagggc180 aaatattaatagtttgcaatacatatgtatgaaaaggaattgaatctagaatatttaaca240 aagctttacaactcaaaaaatacaaagaaaatatttttcttccaattggcaaattactta300 aacagaaccttcacaaaagaagataagaatgtttaataaacatttgaagccataataatg360 acatcattagccatgatggaaatgcaaatttaagtaccacttcacatccacaagaaaaag420 ataaaaataaaaggactgagctcaccaaacattggtgaggatgtggtaatactgaaattc480 ttgtaccgtgctcctgagggtataacatattacaggatttttttgaaaactagtggttcc540 ttataaacttaatgccctggcaacctcacacctatttacttaagaatgaaagggccccgc600 cctcctccctcctcgctcgcgggccgggcccggcatggtgcggcgtcgccgccgatggcg660 ctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcgg720 ctcgggctgctgctggcggagtccgccgccgcaggtctgaagctcatgggagccccggtg780 aagctgacagtgtctcaggggcagccggtgaagctcaactgcagtgtggaggggatggag840 gagcctgacatccagtgggtgaaggatggggctgtggtccagaacttggaccagttgtac900 atcccagtcagcgagcagcactggatcggcttcctcagcctgaagtcagtggagcgctct960 gacgccggccggtactggtgccaggtggaggatgggggtgaaaccgagatctcccagcca1020 gtgtggctcacggtagaaggtgtgccatttttcacagtggagccaaaagatctggcagtg1080 ccacccaatgcccctttccaactgtcttgtgaggctgtgggtccccctgaacctgttacc1140 attgtctggtggagaggaactacgaagatcgggggacccgctccctctccatctgtttta1200 aatgtaacaggggtgacccagagcaccatgttttcctgtgaagctcacaacctaaaaggc1260 ctggcctcttctcgcacagccactgttcaccttcaagcactgcctgcagcccccttcaac1320 atcaccgtgacaaagctttccagcagcaacgctagtgtggcctggatgccaggtgctgat1380 ggccgagctctgctacagtcctgtacagttcaggtgacacaggccccaggaggctgggaa1440 gtcctggctgttgtggtccctgtgcccccctttacctgcctgctccgggacctggtgcct1500 gccaccaactacagcctcagggtgcgctgtgccaatgccttggggccctctccctatgct1560 gactgggtgccctttcagaccaagggtctagccccagccagcgctccccaaaacctccat1620 gccatccgcacagattcaggcctcatcttggagtgggaagaagtgatccccgaggcccct1680 ttggaaggccccctgggaccctacaaactgtcctgggttcaagacaatggaacccaggat1740 gacag tggaggggaccagggccaatttgacaggctgggatccccaaaaggacctg1800 gagct . tgtgcgtctccaatgcagttggctgtggaccctggagtcagccactggtg1860 atcgtacgtg gtctcttctcatgaccgtgcaggccagcagggccctcctcacagccgcacatcctgggta1920 cctgtggtccttggtgtgctaacggccctggtgacggctgctgccctggccctcatcctg1980 cttcgaaagagacggaaagagacgcggtttgggcaagcctttgacagtgtcatggcccgg2040 ggagagccagccgttcacttccgggcagcccggtccttcaatcgagaaaggcccgagcgc2100 atcgaggccacattggacagcttgggcatcagcgatgaactaaaggaaaaactggaggat2160 gtgctcatcccagagcagcagttcaccctgggccggatgttgggcaaaggagagtttggt2220 tcagtgcgggaggcccagctgaagcaagaggatggctcctttgtgaaagtggctgtgaag2280 atgctgaaagctgacatcattgcctcaagcgacattgaagagttcctcagggaagcagct2340 tgcatgaaggagtttgaccatccacacgtggccaaacttgttggggtaagcctccggagc2400 agggctaaaggccgtctccccatccccatggtcatcttgcccttcatgaagcatggggac2460 ctgcatgccttcctgctcgcctcccggattggggagaacccctttaacctacccctccag2520 accctgatccggttcatggtggacattgcctgcggcatggagtacctgagctctcggaac2580 ttcatccaccgagacctggctgctcggaattgcatgctggcagaggacatgacagtgtgt2640 gtggctgacttcggactctcccggaagatctacagtggggactactatcgtcaaggctgt2700 gcctccaaactgcctgtcaagtggctggccctggagagcctggccgacaacctgtatact2760 gtgcagagtgacgtgtgggcgttcggggtgaccatgtgggagatcatgacacgtgggcag2820 acgccatatgctggcatcgaaaacgctgagatttacaactacctcattggcgggaaccgc2880 ctgaaacagcctccggagtgtatggaggacgtgtatgatctcatgtaccagtgctggagt2940 gctgaccccaagcagcgcccgagctttacttgtctgcgaatggaactggagaacatcttg3000 ggccagctgtctgtgctatctgccagccaggaccccttatacatcaacatcgagagagct3060 gaggagcccactgtgggaggcagcctggagctacctggcagggatcagccctacagtggg3120 gctggggatggcagtggcatgggggcagtgggtggcactcccagtgactgtcggtacata3180 ctcacccccggagggctggctgagcagccagggcaggcagagcaccagccagagagtccc3240 ctcaatgagacacagaggcttttgctgctgcagcaagggctactgccacacagtagctgt3300 tagcccacaggcagagggcatcggggccatttggccggctctggtggccactgagctggc3360 tgactaagccccgtctgaccccagcccagacagcaaggtgtggaggctcctgtggtagtc3420 ctcccaagctgtgctgggaagcccggactgaccaaatcacccaatcccagttcttcctgc3480 aaccactctgtggccagcctggcatcagtttaggccttggcttgatggaagtgggccagt3540 cctggttgtctgaacccaggcagctggcaggagtggggtggttatgtttccatggttacc3600 atgggtgtggatggcagtgtggggagggcaggtccagctctgtgggccctaccctcctgc3660 tgagctgcccctgctgcttaagtgcatgcattgagctgcctccagcctggtggcccagct3720 attaccacacttggggtttaaatatccaggtgtgcccctccaagtcagaaagagatgtcc3780 ttgtaatattcccttttaggtgagggttggtaaggggttggtatctcaggtctgaatctt3840 caccatctttctgattccgcaccctgcctacgccaggagaagttgaggggagcatgcttc3900 cctgcagctgaccgggtcacacaaaggcatgctggagtacccagcctatcaggtgcccct3960 cttccaaaggcagcgtgccgagccagcaagaggaaggggtgctgtgaggcttgcccagga4020 gcaagtgaggccggagaggagttcaggaacccttctccatacccacaatctgagcacgct4080 accaaatctcaaaatatcctaagactaacaaaggcagctgtgtctgagcccaacccttct4140 aaacggtgacctttagtgccaacttcccctctaactggacagcctcttctgtcccaagtc4200 tccagagagaaatcaggcctgatgagggggaattcctggaacctggaccccagccttggt4260 gggggagcctctggaatgcatggggcgggtcctagctgttagggacatttccaagctgtt4320 agttgctgtttaaaatagaaataaaattgaagactaaagaccta 4364 <210> 14 <211> 882 <212> PRT
<213> Homo Sapiens <400> 14 Met A1a Leu Arg Arg Ser Met Gly Arg Pro Gly Leu Pro Pro Leu Pro Leu Pro Pro Pro Pro Arg Leu Gly Leu Leu Leu Ala Glu Ser Ala Ala Ala Gly Leu Lys Leu Met Gly Ala Pro Val Lys Leu Thr Val Ser Gln Gly Gln Pro Val Lys Leu Asn Cys Ser Val Glu Gly Met Glu Glu Pro Asp Ile Gln Trp Val Lys Asp Gly Ala Val Val Gln Asn Leu Asp Gln Leu Tyr Ile Pro Val Ser Glu Gln His Trp Ile Gly Phe Leu Ser Leu Lys Ser Val Glu Arg Ser Asp Ala Gly Arg Tyr Trp Cys Gln Val Glu Asp Gly Gly Glu Thr Glu Ile Ser Gln Pro Val Trp Leu Thr Val Glu G1y Val Pro Phe Phe Thr Val Glu Pro Lys Asp Leu Ala Val Pro Pro Asn Ala Pro Phe Gln Leu Ser Cys Glu Ala Val Gly Pro Pro Glu Pro Val Thr Ile Val Trp Trp Arg Gly Thr Thr Lys Ile Gly Gly Pro Ala Pro Ser Pro Ser Val Leu Asn Val Thr Gly Val Thr Gln Ser Thr Met Phe Ser Cys Glu Ala His Asn Leu Lys Gly Leu Ala Ser Ser Arg Thr Ala Thr Val His Leu Gln Ala Leu Pro Ala Ala Pro Phe Asn Ile Thr Val Thr Lys Leu Sex Ser Ser Asn Ala Ser Val Ala Trp Met Pro Gly Ala Asp Gly Arg Ala Leu Leu Gln Ser Cys Thr Val Gln Val Thr Gln Ala Pro Gly G1y Trp Glu Val Leu Ala Val Val Val Pro Val Pro Pro Phe Thr Cys Leu Leu Arg Asp Leu Val Pro Ala Thr Asn Tyr Ser Leu Arg Val Arg Cys Ala Asn Ala Leu Gly Pro Ser Pro Tyr Ala Asp Trp Val Pro Phe Gln Thr Lys Gly Leu Ala Pro Ala Ser Ala Pro Gln Asn Leu His Ala Ile Arg Thr Asp Ser Gly Leu I1e Leu Glu Trp Glu Glu Val Ile Pro Glu Ala Pro Leu Glu Gly Pro Leu Gly Pro Tyr Lys Leu Ser Trp Val Gln Asp Asn Gly Thr Gln Asp Glu Leu Thr Val Glu Gly Thr Arg Ala Asn Leu Thr Gly Txp Asp Pro Gln Lys Asp Leu Ile Val Arg Val Cys Val Ser Asn Ala Val Gly Cys Gly Pro Trp Ser Gln Pro Leu Val Val Ser Ser His Asp Arg Ala Gly Gln Gln Gly Pro Pro His Ser Arg Thr Ser Trp Val Pro Val Val Leu Gly Val Leu Thr Ala Leu Val Thr Ala Ala Ala Leu Ala Leu I1e Leu Leu Arg Lys Arg Arg Lys Glu Thr Arg Phe Gly Gln Ala Phe Asp Ser Val Met Ala Arg Gly Glu Pro Ala Val His Phe Arg Ala Ala Arg Ser Phe Asn Arg Glu Arg Pro Glu Arg Ile Glu Ala Thr Leu Asp Ser Leu Gly Ile Ser Asp Glu Leu Lys Glu Lys Leu Glu Asp Val Leu Ile Pro Glu Gln Gln Phe Thr Leu Gly Arg Met Leu Gly Lys Gly Glu Phe Gly Ser Va1 Arg Glu Ala Gln Leu Lys Gln Glu Asp Gly Ser Phe Val Lys Val Ala Val Lys Met Leu Lys Ala Asp Ile Ile Ala Ser Ser Asp Ile Glu Glu Phe Leu Arg Glu Ala Ala Cys Met Lys Glu Phe Asp His Pro His Val Ala Lys Leu Val Gly Val Ser Leu Arg Ser Arg Ala Lys G1y Arg Leu Pro Ile Pro Met Va1 Ile Leu Pro Phe Met Lys His Gly Asp Leu His Ala Phe Leu Leu Ala Ser Arg Ile Gly Glu Asn Pro Phe Asn Leu Pro Leu Gln Thr Leu Ile Arg Phe Met Val Asp Ile Ala Cys Gly Met Glu Tyr Leu Ser Ser Arg Asn Phe Ile His Arg Asp Leu Ala Ala Arg Asn Cys Met Leu Ala Glu Asp Met Thr Val Cys Val Ala Asp Phe Gly Leu Ser Arg Lys Ile Tyr Ser Gly Asp Tyr Tyr Arg Gln Gly Cys Ala Ser Lys Leu Pro Val Lys Trp Leu Ala Leu Glu Ser Leu Ala Asp Asn Leu Tyr Thr Val Gln Ser Asp Val Trp Ala Phe Gly Val Thr Met Trp Glu Ile Met Thr Arg Gly Gln Thr Pro Tyr Ala Gly 21e Glu Asn Ala Glu Ile Tyr Asn Tyr Leu Ile Gly Gly Asn Arg Leu Lys Gln Pro Pro Glu Cys Met Glu Asp Val Tyr Asp Leu Met Tyr Gln Cys Trp Ser Ala Asp Pro Lys Gln Arg Pro Ser Phe Thr Cys Leu Arg Met Glu Leu Glu Asn Ile Leu Gly G1n Leu Ser Val Leu Ser Ala Ser Gln Asp Pro Leu Tyr Ile Asn 21e Glu Arg Ala Glu Glu Pro Thr Val Gly Gly Ser Leu Glu Leu Pro Gly Arg Asp Gln Pro Tyr Ser Gly Ala Gly Asp Gly Ser Gly Met Gly Ala Val Gly Gly Thr Pro Ser Asp Cys Arg Tyr Ile Leu Thr Pro Gly Gly Leu Ala Glu Gln Pro Gly Gln Ala G1u His Gln Pro Glu Ser Pro Leu Asn Glu Thr Gln Arg Leu Leu Leu Leu Gln Gln Gly Leu Leu Pro His Ser Ser Cys <210>
however, we cannot formally rule out the possibility that thyrocarcin is a completely different gene that shares some splicing with Kir2.l. SEQ ID NO:
17 shows the nucleotide sequence for Kir2.1 and SEQ ID NO: 21 shows EST
cluster identified from expression analysis that is specific for thyroid adenocarcinoma. The derived amino acid sequence from SEQ ID NO: 17 is shown as SEQ ID NO: 18. The sequence of the EST cluster displays no obvious homology to known proteins. However,, for the case where the EST
cluster is simply the 3'-untranslated region of Kir2.1, this gene is an inwardly-rectifying potassium channel.
A nucleotide sequence with Genbank Accession Number: AA133334, representing a Sox2-like HMG-box Oncogenically Expressed Sequence with the following specific characteristics: UniGene Cluster: Hs.129911; Locus Link ID: none; Sequence Information: 1050 by mRNA (bp = base pair, SEQ
ID NO: 19), 264 by ORF and 88 amino acids (SEQ ID NO: 20) with Chromosomal Location: unknown. SEQ ID NO: 19 is present as an EST
(Expressed Sequence Tag) in the Gene Logic database. It has been elongated to 1050 by by overlapping contigs in the public databases. The unigene cluster indicates widespread expression and it was found that the message is upregulated by at least 3-fold in lung cancer versus normal lung tissue. This sequence significant homolgy with Ovis aries SOX-2 gene, and to a slightly lesser extent the murine SOX-2. The Sox gene family consists of a large number of embryonically expressed genes related via the possession of a 79-amino-acid DNA-binding domain known as the HMG box. These genes are transcription factors likely to be involved in the regulation of gene expression.
The nucleotides and polypeptides, as gene products, used in the processes of the present invention may comprise a recombinant polynucleotide or polypeptide, a natural polynucleotide or polypeptide, or a synthetic polynucleotide or polypeptide, preferably a recombinant polynucleotide or . polypeptide.
Fragments of such polynucleotides and polypeptides as are disclosed herein may also be useful in practicing the processes of the present invention.
For example, a fragment, derivative or analog of the polypeptide (SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18 and 20) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
In one aspect, the present invention relates to an isolated polynucleotide comprising a polynucleotide at least 65% identical to the polynucleotide of SEQ
ID NO: 3, or its complement. In preferred embodiments, said isolated polynucleotide comprises a polynucleotide that has sequence identity of at least 80%, preferably at least about 90%, most preferably at least about 95%, especially at least about 98% and most especially is identical to the sequence of SEQ ID NO: 3. An isolated polynucleotide of the invention may also include the complement of any of the foregoing.
In another aspect, the present invention relates to an isolated polypeptide, including a purified polypeptide, comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 4.
In preferred embodiments, said isolated polypeptide comprises an amino acid sequence having sequence identity of at least 95%, preferably at least about 98%, and especially is identical to, the sequence of SEQ ID NO: 4. The present invention also includes isolated active fragments of such polypeptides where said fragments retain the biological activity of the polypeptide or where such active fragments are useful as specific targets for cancer treatment, prevention or diagnosis.
The polynucleotides and polypeptides useful in practicing the processes of the present invention may likewise be obtained in an isolated or purified form.
In addition, the polypeptide disclosed herein as being useful in practicing the processes of the invention include different types of proteins in terms of function so that, as recited elsewhere herein, some are enzymes, some are transcription factors and other may be cell surface receptors. Precisely how such cancer-linked proteins are used in the processes of the invention may thus differ depending on the function and cellular location of the protein and therefore modification, or optimization, of the methods disclosed herein may be desirable in light of said differences. For example, a cell-surface receptor is an excellent target for cytotoxic antibodies whereas a transcription factor or enzyme is a useful target for a small organic compound with anti-neoplastic activity.
As used herein, the term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). It could also be produced recombinantly and subsequently purified.
For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides, for example, those prepared recombinantly, could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment. In one embodiment of the present invention, such isolated, or purified, polypeptide is useful in generating antibodies for practicing the invention, or where said antibody is attached to a cytotoxic or cytolytic agent, such as an apoptotic agent.
As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
The sequence information disclosed herein, as derived from the GenBank submissions, can readily be utilized by those skilled in the art to prepare the corresponding full-length polypeptide by peptide synthesis. The same is true for either the polynucleotides or polypeptides disclosed herein for use in the methods of the invention.
As used herein, the terms "portion," "segment," and "fragment," when used in relation to polypeptides, refer to a continuous sequence of residues, such as amino acid residues, which sequence forms a subset of a larger sequence. For example, if a polypeptide were subjected to treatment with any of the common endopeptidases, such as trypsin or chymotrypsin, the oligopeptides resulting from such treatment would represent portions, segments or fragments of the starting polypeptide. When used in relation to a polynucleotides, such terms refer to the products produced by treatment of said polynucleotides with any of the common endonucleases.
The present invention further relates to a vector comprising any of the polynucleotides disclosed herein and to a recombinant cell comprising such vectors, or such polynucleotides or expressing the polypeptides disclosed herein, especially the polypeptide whose amino acid sequence is the sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
Methods of producing such cells and vectors are well known to those skilled in the molecular biology art. See, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), Wu et al, Methods in Gene Biotechnology (CRC Press, New York, NY, 1997), and Recombinant Gene Expression Protocols, in Methods in Molecular Biology, Vol. 62, (Tuan, ed., Humana Press, Totowa, NJ, 1997), the disclosures of which are hereby incorporated by reference.
In another aspect, the present invention relates to a process for identifying an agent that modulates the activity of a cancer-related gene comprising:
(a) contacting a compound with a cell containing a gene that corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and under conditions promoting the expression of said gene; and (b) detecting a difference in expression of said gene relative to when said compound is not present thereby identifying an agent that modulates the activity of a cancer-related gene.
In specific embodiments of the present invention, the genes useful for the invention comprise genes that correspond to polynucleotides having a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, or may comprise the sequence of any of the polynucleotides disclosed herein (where the latter are cDNA sequences). As used herein, "corresponding genes" refers to genes that encode an RNA that is at least 90% identical, preferably at least 95% identical, most preferably at least 98% identical, and especially identical, to an RNA encoded by one of the nucleotide sequences disclosed herein (i.e., SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19). Such genes will also encode the same polypeptide sequence as any of the sequences disclosed herein, preferably SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, but may include differences in such amino acid sequences where such differences are limited to conservative amino acid substitutions, such as where the same overall three dimensional structure, and thus the same antigenic character, is maintained. Thus, amino acid sequences may be within the scope of the present invention where they react with the same antibodies that react with polypeptides comprising the sequences of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 as disclosed herein.
As used herein, the term "conservative amino acid substitution" are defined herein as exchanges within one of the following five groups:
I. Small aliphatic, nonpolar or slightly polar residues:
Ala, Ser, Thr, Pro, Gly;
II. Polar, negatively charged residues and their amides:
Asp, Asn, Glu, Gln;
III. Polar, positively charged residues:
His, Arg, Lys;
IV. Large, aliphatic, nonpolar residues:
Met Leu, Ile, Val, Cys V. Large, aromatic residues:
Phe, Tyr, Trp In accordance with the present invention, model cellular systems using cell lines, primary cells, or tissue samples are maintained in growth medium and may be treated with compounds that may be at a single concentration or at a range of concentrations. At specific times after treatment, cellular RNAs are isolated from the treated cells, primary cells or tumors, which RNAs are indicative of expression of selected genes. The cellular RNA is then divided and subjected to analysis that detects the presence and/or quantity of specific RNA transcripts, which transcripts may then be amplified for detection purposes using standard methodologies, such as, for example, reverse transcriptase polymerase chain reaction (RT-PCR), etc. The presence or absence, or levels, of specific RNA transcripts are determined from these measurements and a metric derived for the type and degree of response of the sample to the treated compound compared to control samples.
In accordance with the foregoing, there is thus disclosed herein processes for using a cancer-linked gene sequence (SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19) whose expression is, or can be, as a result of the methods of the present invention, linked to, or used to characterize, the cancerous, or non-cancerous, status of the cells, or tissues, to be tested.
Thus, the processes of the present invention identify novel anti-neoplastic agents based on their alteration of expression of the polynucleotide sequence disclosed herein in specific model systems. The methods of the invention may therefore be used with a variety of cell lines or with primary samples from tumors maintained in vitro under suitable culture conditions for varying periods of time, or in situ in suitable animal models.
More particularly, genes have been identified that is expressed at a level in cancer cells that is difFerent from the expression level in non-cancer cells. In one instance, the identified genes are expressed at higher levels in cancer cells than in normal cells.
The polynucleotides of the invention can include fully operation genes with attendant control or regulatory sequences or merely a polynucleotide sequence encoding the corresponding polypeptide or an active fragment or analog thereof.
In one embodiment of the present invention, said gene modulation is downward modulation, so that, as a result of exposure to the chemical agent to be tested, one or more genes of the cancerous cell will be expressed at a lower level (or not expressed at all) when exposed to the agent as compared to the expression when not exposed to the agent. For example, the gene encoding the polypeptide of SEQ ID NO: 2 is expressed at a higher level in cells of lung cancer than in normal lung cells.
In a preferred embodiment a selected set of said genes are expressed in the reference cell, including the genes) sequences identified for use according to the present invention, but are not expressed in the cell to be tested as a result of the exposure of the cell to be tested to the chemical agent. Thus, where said chemical agent causes the gene, or genes, of the tested cell to be expressed at a lower level than the same genes of the reference, this is indicative of downward modulation and indicates that the chemical agent to be tested has anti-neoplastic activity.
Sequences encoding the same proteins as any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, regardless of the percent identity of such sequences, are also specifically contemplated by any of the methods of the present invention that rely on any or all of said sequences, regardless of how they are otherwise described or limited. Thus, any such sequences are available for use in carrying out any of the methods disclosed according to the invention. Such sequences also include any open reading frames, as defined herein, present within the sequence of SEQ ID NO: 1.
The genes identified by the present disclosure are considered "cancer-s related" genes, as this term is used herein, and include genes expressed at higher levels (due, for example, to elevated rates of expression, elevated extent of expression or increased copy number) in cancer cells relative to expression of these genes in normal (i.e., non-cancerous) cells where said cancerous state or status of test cells or tissues has been determined by methods known in the art, such as by reverse transcriptase polymerase chain reaction (RT-PCR) as described in the Example below. In specific embodiments, this relates to the genes whose sequences correspond to the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. As used herein, the term "correspond" means that the gene has the indicated nucleotide sequence or that it encodes substantially the same RNA as would be encoded by the indicated sequence, the term "substantially" meaning about at least 90% identical as defined elsewhere herein and includes splice variants thereof.
The sequences disclosed herein may be genomic in nature and thus represent the sequence of an actual gene, such as a human gene, or may be a cDNA sequence derived from a messenger RNA (mRNA) and thus represent contiguous exonic sequences derived from a corresponding genomic sequence or they may be wholly synthetic in origin for purposes of practicing the processes of the invention. Because of the processing that may take place in transforming the initial RNA transcript into the final mRNA, the sequences disclosed herein may represent less than the full genomic sequence. They may also represent sequences derived from ribosomal and transfer RNAs. Consequently, the genes present in the cell (and representing the genomic sequences) and the sequences disclosed herein, which are mostly cDNA sequences, may be identical or may be such that the cDNAs contain less than the full genomic sequence. Such genes and cDNA
sequences are still considered corresponding sequences because they both encode similar RNA sequences. Thus, by way of non-limiting example only, a gene that encodes an RNA transcript, which is then processed into a shorter mRNA, is deemed to encode both such RNAs and therefore encodes an RNA
complementary to (using the usual Watson-Crick complementarity rules), or that would otherwise be encoded by, a cDNA (for example, a sequence as disclosed herein). Thus, the sequences disclosed herein correspond to genes contained in the cancerous or normal cells used to determine relative levels of expression because they represent the same sequences or are complementary to RNAs encoded by these genes. Such genes also include different alleles and splice variants that may occur in the cells used in the processes of the invention.
The genes of the invention "correspond to" a polynucleotide having a sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 if the gene encodes an RNA (processed or unprocessed, including naturally occurring splice variants and alleles) that is at least 90% identical, preferably at least 95% identical, most preferably at least 98% identical to, and especially identical to, an RNA that would be encoded by, or be complementary to, such as by hybridization with, a polynucleotide having the indicated sequence. In addition, genes including sequences at least 90% identical to a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, preferably at least about 95% identical to such a sequence, more preferably at least about 98% identical to such sequence and most preferably comprising such sequence are specifically contemplated by all of the processes of the present invention as being genes that correspond to these sequences. In addition, sequences encoding the same proteins as any of these sequences, regardless of the percent identity of such sequences, are also specifically contemplated by any of the methods of the present invention that rely on any or all of said sequences, regardless of how they are otherwise described or limited. Thus, any such sequences are available for use in carrying out any of the methods disclosed according to the invention. Such sequences also include any open reading frames, as defined herein, present within any of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
Further in accordance with the present invention, the term "percent identity" or "percent identical," when referring to a sequence, means that a sequence is compared to a claimed or described sequence after alignment of the sequence to be compared (the "Compared Sequence") with the described or claimed sequence (the "Reference Sequence"). The Percent Identity is then determined according to the following formula:
Percent Identity = 100 [1-(C/R)]
wherein C is the number of differences between the Reference Sequence and the Compared Sequence over the length of alignment between the Reference Sequence and the Compared Sequence wherein (i) each base or amino acid in the Reference Sequence that does not have a corresponding aligned base or amino acid in the Compared Sequence and (ii) each gap in the Reference Sequence and (iii) each aligned base or amino acid in the Reference Sequence that is difFerent from an aligned base or amino acid in the Compared Sequence, constitutes a difference; and R is the number of bases or amino acids in the Reference Sequence over the length of the alignment with the Compared Sequence with any gap created in the Reference Sequence also being counted as a base or amino acid.
If an alignment exists between the Compared Sequence and the Reference Sequence for which the percent identity as calculated above is about equal to or greater than a specified minimum Percent Identity then the Compared Sequence has the specified minimum percent identity to the Reference Sequence even though alignments may exist in which the hereinabove calculated Percent Identity is less than the specified Percent Identity.
As used herein and except as noted otherwise, all terms are defined as given below.
In accordance with the present invention, the term "DNA segment" or "DNA sequence" refers to a DNA polymer, in the form of a separate fragment or as a component of a larger DNA construct, which has been derived from DNA isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials and in a quantity or concentration enabling identification, manipulation, and recovery of the segment and its component nucleotide sequences by standard biochemical methods, for example, using a cloning vector. Such segments are provided in the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Sequences of non-translated DNA may be present downstream from the open reading frame, where the same do not interfere with manipulation or expression of the coding regions.
The term "coding region" refers to that portion of a gene which either naturally or normally codes for the expression product of that gene in its natural genomic environment, i.e., the region coding in vivo for the native expression product of the gene. The coding region can be from a normal, mutated or altered gene, or can even be from a DNA sequence, or gene, wholly synthesized in the laboratory using methods well known to those of skill in the art of DNA synthesis.
In accordance with the present invention, the term "nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. Generally, DNA
segments encoding the proteins provided by this invention are assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit comprising regulatory elements derived from a microbial or viral operon.
The term "expression product" means that polypeptide or protein that is the natural translation product of the gene and any nucleic acid sequence coding equivalents resulting from genetic code degeneracy and thus coding for the same amino acid(s).
The term "active fragment," when referring to a coding sequence, means a portion comprising less than the complete coding region whose expression product retains essentially the same biological function or activity as the expression product of the complete coding region.
The term "primer" means a short nucleic acid sequence that is paired with one strand of DNA and provides a free 3'-OH end at which a DNA
polymerase starts synthesis of a deoxyribonucleotide chain.
The term "promoter" means a region of DNA involved in binding of RNA
polymerase to initiate transcription. The term "enhancer" refers to a region of DNA that, when present and active, has the effect of increasing expression of a different DNA sequence that is being expressed, thereby increasing the amount of expression product formed from said different DNA sequence.
The term "open reading frame (ORF)" means a series of triplets coding for amino acids without any termination codons and is a sequence (potentially) translatable into protein.
As used herein, reference to a DNA sequence includes both single stranded and double stranded DNA. Thus, the specific sequence, unless the context indicates otherwise, refers to the single strand DNA of such sequence, the duplex of such sequence with its complement (double stranded DNA) and the complement of such sequence.
The present invention also relates to methods of assaying potential antitumor agents based on their modulation of the expression of the gene sequence according to the invention and methods for diagnosing cancerous, or potentially cancerous, conditions as a result of the patterns of expression of the gene sequence disclosed herein as well as related gene sequence based on common expression or regulation of such genes.
In carrying out the foregoing assays, relative antineoplastic activity may be ascertained by the extent to which a given chemical agent modulates the expression of genes present in a cancerous cell. Thus, a first chemical agent that modulates the expression of a gene associated with the cancerous state (i.e., a gene that includes one of the sequences of the invention as disclosed herein and present in cancerous cells) to a larger degree than a second chemical agent tested by the assays of the invention is thereby deemed to have higher, or more desirable, or more advantageous, anti-neoplastic activity than said second chemical agent.
The gene expression to be measured is commonly assayed using RNA
expression as an indicator. Thus, the greater the level of RNA (messenger RNA) detected the higher the level of expression of the corresponding gene. Thus, gene expression, either absolute or relative, is determined by the relative expression of the RNAs encoded by such genes.
RNA may be isolated from samples in a variety of ways, including lysis and denaturation with a phenolic solution containing a chaotropic agent (e.g., triazol) followed by isopropanol precipitation, ethanol wash, and resuspension in aqueous solution; or lysis and denaturation followed by isolation on solid support, such as a Qiagen resin and reconstitution in aqueous solution; or lysis and denaturation in non-phenolic, aqueous solutions followed by enzymatic conversion of RNA to DNA template copies.
Normally, prior to applying the processes of the invention, steady state RNA expression levels for the genes, and sets of genes, disclosed herein will have been obtained. It is the steady state level of such expression that is affected by potential anti-neoplastic agents as determined herein. Such steady state levels of expression are easily determined by any methods that are sensitive, specific and accurate. Such methods include, but are in no way limited to, real time quantitative polymerase chain reaction (PCR), for example, using a Perkin-Elmer 7700 sequence detection system with gene specific primer probe combinations as designed using any of several commercially available software packages, such as Primer Express software., solid support based hybridization array technology using appropriate internal controls for quantitation, including filter, bead, or microchip based arrays, solid support based hybridization arrays using, for example, chemiluminescent! fluorescent, or electrochemical reaction based detection systems.
The gene patterns indicative of a cancerous state need not be characteristic of every cell found to be cancerous. Thus, the methods disclosed herein are useful for detecting the presence of a cancerous condition within a tissue where less than all cells exhibit the complete pattern.
Thus, for example, a set of selected genes, comprising sequences corresponding to the sequence of SEQ ID NO: 1, may be found, using appropriate probes, either DNA or RNA, to be present in as little as 60% of cells derived from a sample of tumorous, or malignant, tissue while being absent from as much as 60% of cells derived from corresponding non-cancerous, or otherwise normal, tissue (and thus being present in as much as 40% of such normal tissue cells). In a preferred embodiment, such gene pattern is found to be present in at least 50% of cells drawn from a cancerous tissue, such as the lung cancer disclosed herein. In an additional .
embodiment, such gene pattern is found to be present in at least 100% of cells drawn from a cancerous tissue and absent from at least 100% of a corresponding normal, non-cancerous, tissue sample, although the latter embodiment may represent a rare occurrence.
In another aspect the present invention relates to a process for determining the cancerous status of a test cell, comprising determining expression in said test cell of a gene sequence as disclosed herein and then comparing said expression to expression of said at least one gene in at least one cell known to be non-cancerous whereby a difference in said expression indicates that said cell is cancerous.
In one embodiment, said change in expression is a change in copy number, including either an increase or decrease in copy number. In accordance with the present invention, said change in gene copy number may be determined by determining a change in expression of messenger RNA
encoded by said gene sequence.
Changes in gene copy number may be determined by determining a change in expression of messenger RNA encoded by a particular gene sequence, especially that of Such change in gene copy number may be determined by determining a change in expression of messenger RNA
encoded by a particular gene sequence, especially that of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. Also in accordance with the present invention, said gene may be a cancer initiating gene, a'cancer facilitating gene, or a cancer suppressing gene. In carrying out the methods of the present invention, a cancer facilitating gene is a gene that, while not directly initiating or suppressing tumor formation or growth, said gene acts, such as through the actions of its expression product, to direct, enhance, or otherwise facilitate the progress of the cancerous condition, including where such gene acts against genes, or gene expression products, that would otherwise have the effect of decreasing tumor formation and/or growth.
Although the presence or absence of expression of a gene corresponding to a sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 may be indicative of a cancerous status for a given cell, the mere presence or absence of such a gene may not alone be sufficient to achieve a malignant condition and thus the level of expression of such gene pattern may also be a significant factor in determining the attainment of a cancerous state. Thus, while a pattern of genes may be present in both cancerous and non-cancerous cells, the level of expression, as determined by any of the methods disclosed herein, all of which are well known in the art, may differ between the cancerous versus the non-cancerous cells. Thus, it becomes essential to also determine the level of expression of a gene such as that disclosed herein, including substantially similar sequences and sequences comprising said sequence, as a separate means of diagnosing the presence of a cancerous status for a given cell, groups of cells, or tissues, either in culture or in situ.
The level of expression of the polypeptides disclosed herein is also a measure of gene expression, such as polypeptides having sequence identical, or similar to any polypeptide encoded by the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, such as the polypeptide whose amino acid sequence is the sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
In accordance with the foregoing, the present invention further relates to a process for determining the cancerous status of a cell to be tested, comprising determining the level of expression in said cell of at least one gene that includes one of the nucleotide sequences selected from the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, including sequences substantially identical to said sequences, or characteristic fragments thereof, or the complements of any of the foregoing and then comparing said expression to that of a cell known to be non-cancerous whereby the difference in said expression indicates that said cell to be tested is cancerous.
In accordance with the invention, although gene expression for a gene that includes as a portion thereof one of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, is preferably determined by use of a probe that is a fragment of such nucleotide sequence, it is to be understood that the probe may be formed from a different portion of the gene. Expression of the gene may be determined by use of a nucleotide probe that hybridizes to messenger RNA (mRNA) transcribed from a portion of the gene other than the specific nucleotide sequence disclosed herein. , It should be noted that there are a variety of different contexts in which genes have been evaluated as being involved in the cancerous process.
Thus, some genes may be oncogenes and encode proteins that are directly involved in the cancerous process and thereby promote the occurrence of cancer in an animal. In addition, other genes may serve to suppress the cancerous state in a given cell or cell type and thereby work against a cancerous condition forming in an animal. Other genes may simply be involved either directly or indirectly in the cancerous process or condition and may serve in an ancillary capacity with respect to the cancerous state. All such types of genes are deemed with those to be determined in accordance with the invention as disclosed herein. Thus, the gene determined by said process of the invention may be an oncogene, or the gene determined by said process may be a cancer facilitating gene, the latter including a gene that directly or indirectly affects the cancerous process, either in the promotion of a cancerous condition or in facilitating the progress of cancerous growth or otherwise modulating the growth of cancer cells, either in vivo or ex vivo. In addition, the gene determined by said process may be a cancer suppressor gene, which gene works either directly or indirectly to suppress the initiation or progress of a cancerous condition. Such genes may work indirectly where their expression alters the activity of some other gene or gene expression product that is itself directly involved in initiating or facilitating the progress of a cancerous condition. For example, a gene that encodes a polypeptide, either wild or mutant in type, which polypeptide acts to suppress of tumor suppressor gene, or its expression product, will thereby act indirectly to promote tumor growth.
In accordance with the foregoing, the process of the present invention includes cancer modulating agents that are themselves either polypeptides, or small chemical entities, that affect the cancerous process, including initiation, suppression or facilitation of tumor growth, either in vivo or ex vivo. Said cancer modulating agent may have the effect of increasing gene expression or said cancer modulating agent may have the effect of decreasing gene expression as such terms have been described herein.
In keeping with the disclosure herein, the present invention also relates to a process for treating cancer comprising contacting a cancerous cell with an agent having activity against an expression product encoded by a gene sequence as disclosed herein, such as the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
The proteins encoded by the genes disclosed herein due to their expression, or elevated expression, in cancer cells, represent highly useful therapeutic targets for "targeted therapies" utilizing such affinity structures as, for example, antibodies coupled to some cytotoxic agent. In such methodology, it is advantageous that nothing need be known about the endogenous ligands or binding partners for such cell surface molecules.
Rather, an antibody or equivalent molecule that can specifically recognize the cell surface molecule (which could include an artificial peptide, a surrogate ligand, and the like) that is coupled to some agent that can induce cell death or a block in cell cycling offers therapeutic promise against these proteins.
Thus, such approaches include the use of so-called suicide "bullets" against intracellular proteins With the advent of methods of molecular biology and recombinant technology, it is now possible to produce antibody molecules by recombinant means and thereby generate gene sequences that code for specific amino acid sequences found in the polypeptide structure of the antibodies. Such antibodies can be produced by either cloning the gene sequences encoding the polypeptide chains of said antibodies or by direct synthesis of said polypeptide chains, with in vitro assembly of the synthesized chains to form active tetrameric (H~L2) structures with affinity for specific epitopes and antigenic determinants. This has permitted the ready production of antibodies having sequences characteristic of neutralizing antibodies from different species and sources.
Regardless of the source of the antibodies, or how they are recombinantly constructed, or how they are synthesized, in vitro or in vivo, using transgenic animals, such as cows, goats and sheep, using large cell cultures of laboratory or commercial size, in bioreactors or by direct chemical synthesis employing no living organisms at any stage of the process, all antibodies have a similar overall 3 dimensional structure.
This structure is often given as HZL2 and refers to the fact that antibodies commonly comprise 2 light (L) amino acid chains and 2 heavy (H) amino acid chains. Both chains have regions capable of interacting with a structurally complementary antigenic target. The regions interacting with the target are referred to as "variable" or "V" regions and are characterized by differences in amino acid sequence from antibodies of different antigenic specificity.
The variable regions of either H or L chains contains the amino acid sequences capable of specifically binding to antigenic targets. Within these sequences are smaller sequences dubbed "hypervariable" because of their extreme variability between antibodies of differing specificity.
Such hypervariable regions are also referred to as "complementarity determining regions" or "CDR" regions. These CDR regions account for the basic specificity of the antibody for a particular antigenic determinant structure.
The CDRs represent non-contiguous stretches of amino acids within the variable regions but, regardless of species, the positional locations of these critical amino acid sequences within the variable heavy and light chain regions have been found to have similar locations within the amino acid sequences of the variable chains. The variable heavy ana light chains of all antibodies each have 3 CDR regions, each non-contiguous with the others (termed L1, L2, L3, H 1, H2, H3) for the respective light (L) and heavy (H) chains. The accepted CDR regions have been described by ICabat et al, J. Biol. CHem. 252:6609-6616 (1977).
The numbering scheme is shown in the figures, where the CDRs are underlined and the numbers follow the Kabat scheme.
In all mammalian species, antibody polypeptides contain constant (i.e., highly conserved) and variable regions, and, within the latter, there are the CDRs and the so-called "framework regions" made up of amino acid sequences within the variable region of the heavy or light chain but outside the CDRs.
The antibodies disclosed according to the invention may also be wholly synthetic, wherein the polypeptide chains of the antibodies are synthesized and, possibly, optimized for binding to the polypeptides disclosed herein as being receptors. Such antibodies may be chimeric or humanized antibodies and may be fully tetrameric in structure, or may be dimeric and comprise only a single heavy and a single light chain. Such antibodies may also include fragments, such as Fab and F(ab2)' fragments, capable of reacting with and binding to any of the polypeptides disclosed herein as being receptors.
In one aspect, the present invention relates to immunoglobulins, or antibodies, as described herein, that react with, especially where they are specific for, the polypeptides having amino acid sequences as disclosed herein, preferably those having an amino acid sequence of one of SEQ ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20. Such antibodies may commonly be in the form of a composition, especially a pharmaceutical composition.
The pharmaceutical compositions useful herein also contain a pharmaceutically acceptable carrier, including any suitable diluent or excipient, which includes any pharmaceutical agent that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which may be administered without undue toxicity.
Pharmaceutically acceptable carriers include, but are not limited to, liquids such as water, saline, glycerol and ethanol, and the like, including carriers useful in forming sprays for nasal and other respiratory tract delivery or for delivery to the ophthalmic system. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub.
Co., N.J. current edition).
The process of the present invention includes embodiments of the above-recited processes wherein the cancer cell is contacted in vivo as well as ex vivo, preferably wherein said agent comprises a portion, or is part of an overall molecular structure, having affinity for said expression product. In one such embodiment, said portion having affinity for said expression product is an antibody, especially where said expression product is a polypeptide or oligopeptide or comprises an oligopeptide portion, or comprises a polypeptide.
Such an agent can therefore be a single molecular structure, comprising both affinity portion and anti-cancer activity portions, wherein said portions are derived from separate molecules, or molecular structures, possessing such activity when separated and wherein such agent has been formed by combining said portions into one larger molecular structure, such as where said portions are combined into the form of an adduct. Said anti-cancer and affinity portions may be joined covalently, such as in the form of a single polypeptide, or polypeptide-like, structure or may be joined non-covalently, such as by hydrophobic or electrostatic interactions, such structures having been formed by means well known in the chemical arts.
Alternatively, the anti-cancer and affinity portions may be formed from separate domains of a single molecule that exhibits, as part of the same chemical structure, more than one activity wherein one of the activities is against cancer cells, or tumor formation or growth, and the other activity is affinity for an expression product produced by expression of genes related to the cancerous process or condition.
In one embodiment of the present invention, a chemical agent, such as a protein or other polypeptide, is joined to an agent, such as an antibody, having affinity for an expression product of a cancerous cell, such as a polypeptide or protein encoded by a gene related to the cancerous process, especially a gene as disclosed herein according to the present invention.
Thus, where the presence of said expression product is essential to tumor initiation and/or growth, binding of said agent to said expression product will have the effect of negating said tumor promoting activity. In one such embodiment, said agent is an apoptosis-inducing agent that induces cell suicide, thereby killing the cancer cell and halting tumor growth..
Other genes within the cancer cell that are regulated in a manner similar to that of the genes disclosed herein and thus change their expression in a coordinated way in response to chemical compounds represent genes that are located within a common metabolic, signaling, physiological, or functional pathway so that by analyzing and identifying such commonly regulated groups of genes (groups that include the gene, or similar sequences, disclosed according to the invention, one can (a) assign known genes and novel genes to specific pathways and (b) identify specific functions and functional roles for novel genes that are grouped into pathways with genes for which their functions are already characterized or described. For example, one might identify a group of 10 genes, at least one of which is the gene as disclosed herein, that change expression in a coordinated fashion and for which the function of one, such as the polypeptide encoded by the sequence disclosed herein, is known then the other genes are thereby implicated in a similar function or pathway and may thus play a role in the cancer-initiating or cancer-facilitating process. In the same way, if a gene were found in normal cells but not in cancer cells, or happens to be expressed at a higher level in normal as opposed to cancer cells, then a similar conclusion may be drawn as to its involvement in cancer, or other diseases.
Therefore, the processes disclosed according to the present invention at once provide a novel means of assigning function to genes, i.e. a novel method of functional genomics, and a means for identifying chemical compounds that have potential therapeutic effects on specific cellular pathways. Such chemical compounds may have therapeutic relevance to a variety of diseases outside of cancer as well, in cases where such diseases are known or are demonstrated to involve the specific cellular pathway that is affected.
The polypeptides disclosed herein, preferably those of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20, also find use as vaccines in that, where the polypeptide represents a surface protein present on a cancer cell, such polypeptide may be administered to an animal, especially a human being, for purposes of activating cytotoxic T lymphocytes (CTLs) that will be specific for, and act to lyze, cancer cells in said animal. Where used as vaccines, such polypeptides are present in the form of a pharmaceutical composition. The present invention may also employ polypeptides that have the same, or similar, immunogenic character as the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 and thereby elicit the same, or similar, immunogenic response after administration to an animal, such as an animal at risk of developing cancer, or afflicted therewith. Thus, the polypeptides disclosed according to the invention will commonly find use as immunogenic compositions.
The present invention also relates to a process that comprises a method for producing a product comprising identifying an agent according to one of the disclosed processes for identifying such an agent (i.e., the therapeutic agents identified according to the assay procedures disclosed herein) wherein said product is the data collected with respect to said agent as a result of said identification process, or assay, and wherein said data is sufficient to convey the chemical character and/or structure and/or properties of said agent. For example, the present invention specifically contemplates a situation whereby a user of an assay of the invention may use the assay to screen for compounds having the desired enzyme modulating activity and, having identified the compound, then conveys that mtorma~ion y.e., information as to structure, dosage, etc) to another user who then utilizes the information to reproduce the agent and administer it for therapeutic or research purposes according to the invention. For example, the user of the assay (user 1) may screen a number of test compounds without knowing the structure or identity of the compounds (such as where a number of code numbers are used the first user is simply given samples labeled with said code numbers) and, after performing the screening process, using one or more assay processes of the present invention, then imparts to a second user (user 2), verbally or in writing or some equivalent fashion, sufficient information to identify the compounds having a particular modulating activity (for example, the code number with the corresponding results). This transmission of information from user 1 to user 2 is specifically contemplated by the present invention.
The genes useful in the methods of the invention disclosed herein are genes corresponding to a polynucleotide having the sequence of SEQ ID NO:
1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 and represent genes that may be over-expressed in malignant cancer, such as is a gene corresponding to SEQ ID
NO: 1 for lung, the latter being expressed at least three fold higher in lung cancer samples as compared to normal lung tissues. In addition, in any given sample, not all cancer cells may express this gene a substantial expression thereof in a substantial number of such cells is sufficient to warrant a determination of a cancerous, or potentially cancerous, condition.
Thus, the polynucleotide sequences disclosed according to the present invention are expressed in cancer compared to normal tissue samples or may be expressed at a higher level in cancer as compared to normal tissues.
Further, such polynucleotide, or gene, sequence expression in normal tissues may correlate with individuals having a family history of cancer.
Such gene sequences may play a direct role in cancer progression, such as in cancer initiation or cancer cell proliferation/survival. For example, one or more genes encoding the same polypeptide as one or more of the sequences disclosed herein represent novel individual gene targets for screening and discovery of small molecules that inhibit enzyme or other cellular functions, e.g. kinase inhibitors. Such molecules represent valuable therapeutics for cancer. In addition, small molecules or agents, such as small organic molecules, that down-regulate the expression of these genes in cancer would represent valuable anti-cancer therapeutics. Expression of the gene in normal tissues may indicate a predisposition towards development of lung cancer. The encoded polypeptide might represent a potentially useful cell surface target for therapeutic molecules such as cytolytic antibodies, or antibodies attached to cytotoxic, or cytolytic, agents. .
It should be cautioned that, in carrying out the procedures of the present invention as disclosed herein, any reference to particular buffers, media, reagents, cells, culture conditions and the like are not intended to be limiting, but are to be read so as to include all related materials that one of ordinary skill in the art would recognize as being of interest or value in the particular context in which that discussion is presented. For example, it is often possible to substitute one buffer system or culture medium for another and still achieve similar, if not identical, results. Those of skill in the art will have sufficient knowledge of such systems and methodologies so as to be able, without undue experimentation, to make such substitutions as will optimally serve their purposes in using the methods and procedures disclosed herein.
The present invention will now be further described by way of the following non-limiting example. In applying the disclosure of the example, it should be kept clearly in mind that other and different embodiments of the methods disclosed according to the present invention will no doubt suggest themselves to those of skill in the relevant art. The following example shows how a potential anti-neoplastic agent may be identified using one or more of the genes disclosed herein.
EXAMPLE
SW480 cells are grown to a density of 105 cells/cm2 in Leibovitz's L-15 medium supplemented with 2 mM L-glutamine (90%) and 10% fetal bovine serum. The cells are collected after treatment with 0.25% trypsin, 0.02%
EDTA at 37°C for 2 to 5 minutes. The trypsinized cells are then diluted with 30 ml growth medium and plated at a density of 50,000 cells per well in a 96 well plate (200 p.l/well). The following day, cells are treated with either compound buffer alone, or compound buffer containing a chemical agent to be tested, for 24 hours. The media is then removed, the cells lysed and the RNA recovered using the RNAeasy reagents and protocol obtained from Qiagen. RNA is quantitated and 10 ng of sample in 1 p,1 are added to 24 p,1 of Taqman reaction mix containing 1X PCR buffer, RNAsin, reverse transcriptase, nucleoside triphosphates, amplitaq gold, tween 20, glycerol, bovine serum albumin (BSA) and specific PCR primers and probes for a reference gene (18S RNA) and a test gene (Gene X). Reverse transcription is then carried out at 48°C
for 30 minutes. The sample is then applied to a Perlin Elmer 7700 sequence detector and heat denatured for 10 minutes at 95°C. Amplification is performed through 40 cycles using 15 seconds annealing at 60°C followed by a 60 second extension at 72°C and 30 second denaturation at 95°C. Data files are then captured and the data analyzed with the appropriate baseline windows and thresholds.
The quantitative difference between the target and reference gene is then calculated and a relative expression value determined for all of the samples used. This procedure is then repeated for other genes functionally related to the gene as disclosed herein and the level of function, or expression, noted. The relative expression ratios for each pair of genes is determined (i.e., a ratio of expression is determined for each target gene versus each of the other genes for which expression is measured, where each gene's absolute expression is determined relative to the reference gene for each compound, or chemical agent, to be screened). The samples are then scored and ranked according to the degree of alteration of the expression profile in the treated samples relative to the control. The overall expression of the particular gene relative to the controls, as modulated by one chemical agent relative to another, is also ascertained. Chemical agents having the most effect on a given gene, or set of genes, are considered the most anti-neoplastic.
SEQUENCE LISTING
<110> Young, Paul Horrigan, Stephen Weaver, Zoe Endress, Gregory <120> Cancer-Linked Genes as Targets for Chemotherapy <130> 689290-79 <150> US/60/239,294 <151> 2000-10-11 <150> US/60/239,297 <151> 2000-10-11 <150> US/60/239,605 <151> 2000-10-11 <150> US/60/239,802 <151> 2000-10-12 <150> US/60/239,805 <151> 2000-10-12 <150> US/60/239,806 <151> 2000-10-12 <150> US/60/240,622 <151> 2000-10-16 <150> US/60/241,682 <151> 2000-10-19 <150> US/60/241,723 <151> 2000-10-19 <150> US/60/244,932 <151> 2000-10-31 <160> 21 <170> PatentIn version 3.0 <210> 1 <211> 1934 <212> DNA
<213> Homo sapiens <400> 1 ctgtcattca tgctttggaa aagtttactg tatatacatt agacattcct gttctttttg 60 gagttagtac tacatcccct gaagaaacat gtgcccaggt gattcgtgaa gctaagagaa 120 cagcaccaag tatagtgtat gttcctcata tccacgtgtg gtgggaaata gttggaccga 180 cacttaaagc cacatttacc acattattac agaatattcc ttcatttgct ccagttttac 240 tacttgcaac ttctgacaaa ccccattccg ctttgccaga agaggtgcaa gaattgttta 300 tccgtgatta tggagagatt tttaatgtcc agttaccgga taaagaagaa cggacaaaat 360 tttttgaaga tttaattcta aaacaagctg ctaagcctcc tatatcaaaa aagaaagcag 420 ttttgcaggctttggaggtactcccagtagcaccaccacctgagccaagatcactgacag480 cagaagaagtgaaacgactagaagaacaagaagaagatacatttagagaactgaggattt540 tcttaagaaatgttacacataggcttgctattgacaagcgattccgagtgtttactaagc600 ctgttgaccctgatgaggttcctgattatgtcactgtaataaagcaaccaatggaccttt660 catctgtaatcagtaaaattgatctacacaagtatctgactgtgaaagactatttgagag720 atattgatctaatctgtagtaatgccttagaatacaatccagatagagatcctggagatc780 gtcttattaggcatagagcctgtgctttaagagatactgcctatgccataattaaagaag840 aacttgatgaagactttgagcagctctgtgaagaaattcaggaatctagaaagaaaagag900 gttgtagctcctccaaatatgccccgtcttactaccatgtgatgccaaagcaaaattcca960 ctcttgttggtgataaaagatcagacccagagcagaatgaaaagctaaagacaccgagta1020 ctcctgtggcttgcagcactcctgctcagttgaagaggaaaattcgcaaaaagtcaaact1080 ggtacttaggcaccataaaaaagcgaaggaagatttcacaggcaaaggatgatagccaga1140 atgccatagatcacaaaattgagagtgatacagaggaaactcaagacacaagtgtagatc1200 ataatgagaccggaaacacaggagagtcttcggtggaagaaaatgaaaaacagcaaaatg1260 cctctgaaagcaaactggaattgagaaataattcaaatacttgtaatatagagaatgagc1320 ttgaagactctaggaagactacagcatgtacagaattgagagacaagattgcttgtaatg1380 gagatgcttctagctctcagataatacatatttctgatgaaaatgaaggaaaagaaatgt1440 gtgttctgcgaatgactcgagctagacgttcccaggtagaacagcagcagctcatcactg1500 ttgaaaaggctttggcaattctttctcagcctacaccctcacttgttgtggatcatgagc1560 gattaaaaaatcttttgaagactgttgttaaaaaaagtcaaaactacaacatatttcagt1620 tggaaaatttgtatgcagtaatcagccaatgtatttatcggcatcgcaaggaccatgata1680 aaacatcacttattcagaaaatggagcaagaggtagaaaacttcagttgttccagatgat1740 gatgtcatggtatcgagtattctttatattcagttcctatttaagtcatttttgtcatgt1800 ccgcctaattgatgtagtatgaaaccctgcatctttaaggaaaagattaaaatagtaaaa1860 taaaagtatttaaactttcctgatatttatgtacatattaagataaatgtcatgtgtaag1920 ataactgataaata 1934 <210> 2 <211> 362 <212> PRT
<213> Homo Sapiens <400> 2 Met Asp Leu Ser Ser Val Ile Ser Lys Ile Asp Leu His Lys Tyr Leu Thr Val Lys Asp Tyr Leu Arg Asp Ile Asp Leu Ile Cys Ser Asn Ala Leu Glu Tyr Asn Pro Asp Arg Asp Pro Gly Asp Arg Leu Ile Arg His Arg Ala Cys Ala Leu Arg Asp Thr Ala Tyr Ala Ile Ile Lys Glu Glu Leu Asp Glu Asp Phe Glu Gln Leu Cys Glu Glu Ile Gln Glu Ser Arg Lys Lys Arg Gly Cys Ser Ser Ser Lys Tyr Ala Pro Ser Tyr Tyr His Va1 Met Pro Lys Gln Asn Ser Thr Leu Val Gly Asp Lys Arg Ser Asp Pro G1u Gln Asn Glu Lys Leu Lys Thr Pro Ser Thr Pro Val Ala Cys Ser Thr Pro Ala Gln Leu Lys Arg Lys Ile Arg Lys Lys Ser Asn Trp Tyr Leu Gly Thr Ile Lys Lys Arg Arg Lys Ile Ser Gln Ala Lys Asp l45 150 155 160 Asp Ser Gln Asn Ala Ile Asp His Lys Ile Glu Ser Asp Thr Glu Glu Thr Gln Asp Thr Ser Val Asp His Asn Glu Thr Gly Asn Thr Gly Glu Ser Ser Val Glu Glu Asn Glu Lys Gln Gln Asn Ala Ser Glu Ser Lys Leu Glu Leu Arg Asn Asn Ser Asn Thr Cys Asn Ile Glu Asn Glu Leu Glu Asp Ser Arg Lys Thr Thr Ala Cys Thr Glu Leu Arg Asp Lys Ile Ala Cys Asn Gly Asp Ala Ser Ser Ser Gln Ile Ile His I1e Ser Asp Glu Asn Glu Gly Lys Glu Met Cys Val Leu Arg Met Thr Arg A1a Arg Arg Ser Gln Va1 Glu Gln Gln Gln Leu Ile Thr Val Glu Lys Ala Leu Ala Ile Leu Ser Gln Pro Thr Pro Ser Leu Val Val Asp His Glu Arg Leu Lys Asn Leu Leu Lys Thr Val Val Lys Lys Ser Gln Asn Tyr Asn 21e Phe Gln Leu Glu Asn Leu Tyr Ala Val Ile Ser Gln Cys Ile Tyr Arg His Arg Lys Asp His Asp Lys Thr Ser Leu Ile Gln Lys Met G1u Gln Glu Val Glu Asn Phe Ser Cys Ser Arg <210> 3 <211> 1274 <212> DNA
<213> Homo Sapiens <400> 3 cacgaggcagactgaagattgtggcttggtattcacaggcaggtttcagacatttagatc 60 tttcttttaatgactaacaccatgcctatctgtggagaagctggcaacatgtcacacctg 120 gaaattgtttttcaacattaatactattatttggcagtaatccagattgcttttgccacc 180 aacctgaagacatatagaggcagaaggacaggaataattctatttgtttcctgttttgaa 240 acttccatctgtaaggctatcaaaaggagatgtgagagagggtattgagtctggcctgac 300 aatgcagttcttaaaccaaaggtccattatgcttctcctctctgagaatcctgacttacc 360 tcaacaacggagacatggcacagtagccagcttggagacttctcagccaatgctctgaga 420 tcaagtcgaagacccaatatacagggttttgagctcatcttcatcattcatatgaggaaa 480 taagtggtaaaatccttggaaatacaatgagactcatcagaaacatttacatattttgta 540 gtattgttatgacagcagagggtgatgctccagagctgccagaagaaagggaactgatga600 ccaactgctccaacatgtctctaagaaaggttcccgcagacttgaccccagccacaacga660 cactggatttatcctataacctcctttttcaactccagagttcagattttcattctgtct720 ccaaactgagagttttgattctatgccataacagaattcaacagctggatctcaaaacct780 ttgaattcaacaaggagttaagatatttagatttgtctaataacagactgaagagtgtaa840 cttggtatttactggcaggtctcaggtatttagatctttcttttaatgactttgacacca900 tgcctatctgtgaggaagctggcaacatgtcacacctggaaatcctaggtttgagtgggg960 caaaaatacaaaaatcagatttccagaaaattgctcatctgcatctaaatactgtcttct1020 taggattcagaactcttcctcattatgaagaaggtagcctgcccatcttaaacacaacaa1080 aactgcacattgttttaccaatggacacaaatttctgggttcttttgcgtgatggaatca1140 agacttcaaaaatattagaaatgacaaatatagatggcaaaagccaatttgtaagttatg1200 aaatgcaacgaaatcttagtttagaacatgctaagacatcggttctattgcttaataaag1260 ttgatttactctgg 1274 <210> 4 <211> 256 <212> PRT
<213> Homo sapiens <400> 4 Met Arg Leu Ile Arg Asn Ile Tyr Ile Phe Cys Ser Ile Val Met Thr Ala Glu Gly Asp Ala Pro Glu Leu Pro Glu Glu Arg Glu Leu Met Thr Asn Cys Ser Asn Met Ser Leu Arg Lys Val Pro Ala Asp Leu Thr Pro A1a Thr Thr Thr Leu Asp Leu Ser Tyr Asn Leu Leu Phe Gln Leu Gln Ser Ser Asp Phe His Ser Val Ser Lys Leu Arg Val Leu Ile Leu Cys His Asn Arg Ile Gln Gln Leu Asp Leu Lys Thr Phe Glu Phe Asn Lys Glu Leu Arg Tyr Leu Asp Leu Ser Asn Asn Arg Leu Lys Ser Val Thr Trp Tyr Leu Leu Ala Gly Leu Arg Tyr Leu Asp Leu Ser Phe Asn Asp Phe Asp Thr Met Pro Ile Cys Glu G1u A1a Gly Asn Met Ser His Leu Glu Ile Leu Gly Leu Ser Gly Ala Lys Ile Gln Lys Ser Asp Phe Gln Lys Ile Ala His Leu His Leu Asn Thr Val Phe Leu Gly Phe Arg Thr Leu Pro His Tyr Glu Glu Gly Ser Leu Pro Ile Leu Asn Thr Thr Lys Leu His Ile Val Leu Pro Met Asp Thr Asn Phe Trp Val Leu Leu Arg Asp Gly Ile Lys Thr Ser Lys Ile Leu Glu Met Thr Asn I1e Asp Gly Lys Ser Gln Phe Val Ser Tyr Glu Met Gln Arg Asn Leu Ser Leu Glu His Ala Lys Thr Ser Val Leu Leu Leu Asn Lys Val Asp Leu Leu Trp <210>
<211>
<212>
DNA
<213> Sapiens Homo <400>
agaatcccggacagccctgc tccctgcagccaggtgtagtttcgggagcc actggggcca60 aagtgagagtccagcggtct tccagcgcttgggccacggcggcggccctg ggagcagagg120 tggagcgaccccattacgct aaagatgaaaggctggggttggctggccct gcttctgggg180 gccctgctgggaaccgcctg ggctcggaggagccaggatctccactgtgg agcatgcagg240 gctctggtggatgaactaga atgggaaattgcccaggtggaccccaagaa gaccattcag300 atgggatctttccggatcaa tccagatggcagccagtcagtggtggaggt gccttatgcc360 cgctcagaggcccacctcac agagctgctggaggagatatgtgaccggat gaaggagtat420 ggggaacagattgatccttc cacccatcgcaagaactacgtacgtgtagt gggccggaat480 ggagaatccagtgaactgga cctacaaggcatccgaatcgactcagatat tagcggcacc540 ctcaagtttgcgtgtgagag cattgtggaggaatacgaggatgaactcat tgaattcttt600 tcccgagaggctgacaatgt taaagacaaactttgcagtaagcgaacaga tctttgtgac660 catgccctgcacatatcgca tgatgagctatgaaccactggagcagccca cactggcttg720 atggatcacccccaggaggg gaaaatggtggcaatgccttttatatatta tgtttttact780 gaaattaactgaaaaaatat gaaaccaaaagtac 814 <2l0>
<211>
<212>
PRT
<213>
Homo Sapiens <400>
Met Lys Leu Leu Gly Ala Leu Leu Gly Gly Trp Leu Gly Trp Leu Ala Thr Ala Asp Leu Cys Gly Ala Cys Arg Trp Ala His Arg Arg Ser Gln Ala Leu Glu Ile Gln Val Asp Pro Lys Val Asp Ala Glu Leu Glu Trp Lys Thr Arg Ile Pro Asp Gly Ser Gln Ile Gln Asn Met Gly Ser Phe Ser Val Arg Ser A1a His Leu Thr Glu Val Glu Glu Val Pro Tyr Ala Leu Leu Met Lys Tyr Gly Glu Gln Tle Glu Glu Glu Ile Cys Asp Arg Asp Pro Tyr Val Val Val Gly Arg Asn Ser Thr Arg His Arg Lys Asn 100 105 1l0 Gly Glu Ser Ser Glu Leu Asp Leu Gln Gly Ile Arg Ile Asp Ser Asp Ile Ser Gly Thr Leu Lys Phe Ala Cys Glu Ser Ile Val Glu G1u Tyr Glu Asp Glu Leu Ile Glu Phe Phe Ser Arg Glu Ala Asp Asn Val Lys Asp Lys Leu Cys Ser Lys Arg Thr Asp Leu Cys Asp His Ala Leu His Ile Ser His Asp Glu Leu <210> 7 <211> 1597 <212> DNA
<213> Homo Sapiens <400>
gcggccgctgcgccgcaaactcgtgtgggacgcaccgctccagccgcccgcgggccagcg caccggtcccccagcggcagccgagcccgcccgcgcgccgttcgtgccctcgtgaggctg120 gcatgcaggatggcaggacagcccggccacatgccccatggagggagttccaacaacctc180 tgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtct240 tttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagc300 gaggtgtacaaggccacctgcctgctggacaggaagacagtggctctgaagaaggtgcag360 atctttgagatgatggacgccaaggcgaggcaggactgtgtcaaggagatcggcctcttg420 aagcaactgaaccacccaaatatcatcaagtatttggactcgtttatcgaagacaacgag480 ctgaacattgtgctggagttggctgacgcaggggacctctcgcagatgatcaagtacttt540 aagaagcagaagcggctcatcccggagaggacagtatggaagtactttgtgcagctgtgc600 agcgccgtggagcacatgcattcacgccgggtgatgcaccgagacatcaagcctgccaac660 gtgttcatcacagccacgggcgtcgtgaagctcggtgaccttggtctgggccgcttcttc720 agctctgagaccaccgcagcccactccctagtggggacgccctactacatgtcaccggag780 aggatccatgagaacggctacaacttcaagtccgacatctggtccttgggctgtctgctg840 tacgagatggcagccctccagagccccttctatggagataagatgaatctcttctccctg900 tgccagaagatcgagcagtgtgactaccccccactccccggggagcactactccgagaag960 ttacgagaactggtcagcatgtgcatctgccctgacccccaccagagacctgacatcgga1020 tacgtgcaccaggtggccaagcagatgcacatctggatgtccagcacctgagcgtggatg1080 caccgtgccttatcaaagccagcaccactttgccttacttgagtcgtcttctcttcgagt1140 ggccacctggtagcctagaacagctaagaccacagggttcagcaggttccccaaaaggct1200 gcccagccttacagcagatgctgaaggcagagcagctgagggaggggcgctggccacatg1260 tcactgatggtcagattccaaagtcctttctttatactgttgtggacaatctcagctggg1320 tcaataagggcaggtggttcagcgagccacggcagccccctgtatctggattgtaatgtg1380 aatctttagggtaattcctccagtgacctgtcaaggcttatgctaacaggagacttgcag1440 gagaccgtgtgatttgtgtagtgagcctttgaaaatggttagtaccgggttcagtttagt1500 tcttggtatcttttcaatcaagctgtgtgcttaatttactctgttgtaaagggataaagt1560 ggaaatcatttttttccgtggaaaaaaaaaaaaaaaa 1597 <210> 8 <211> 306 <212> PRT
<213> Homo Sapiens 400> 8 Met Pro His Gly Gly Ser Ser Asn Asn Leu Cys His Thr Leu Gly Pro Val His Pro Pro Asp Pro Gln Arg His Pro Asn Thr Leu Ser Phe Arg Cys Ser Leu Ala Asp Phe Gln Ile Glu Lys Lys Ile Gly Arg Gly Gln Phe Ser Glu Val Tyr Lys Ala Thr Cys Leu Leu Asp Arg Lys Thr Val Ala Leu Lys Lys Val Gln Ile Phe Glu Met Met Asp Ala Lys Ala Arg Gln Asp Cys Val Lys Glu Ile Gly Leu Leu Lys Gln Leu Asn.His Pro Asn Ile Ile Lys Tyr Leu Asp Ser Phe Ile Glu Asp Asn Glu Leu Asn Ile Val Leu Glu Leu Ala Asp Ala Gly Asp Leu Ser Gln Met Ile Lys Tyr Phe Lys Lys Gln Lys Arg Leu Ile Pro Glu Arg Thr Val Trp Lys Tyr Phe Val Gln Leu Cys Ser Ala Val Glu His Met His Ser Arg Arg Val Met His Arg Asp Ile Lys Pro Ala Asn Val Phe Ile Thr Ala Thr Gly Val Val Lys Leu Gly Asp Leu Gly Leu Gly Arg Phe Phe Ser Ser l80 185 190 Glu Thr Thr Ala Ala His Ser Leu Val Gly Thr Pro Tyr Tyr Met Ser Pro Glu Arg Ile His Glu Asn Gly Tyr Asn Phe Lys Ser Asp Ile Trp Ser Leu Gly Cys Leu Leu Tyr Glu Met Ala Ala Leu Gln Ser Pro Phe Tyr Gly Asp Lys Met Asn Leu Phe Ser Leu Cys Gln Lys Ile Glu Gln Cys Asp Tyr Pro Pro Leu Pro Gly Glu His Tyr Ser Glu Lys Leu Arg Glu Leu Val Ser Met Cys Ile Cys Pro Asp Pro His Gln Arg Pro Asp Ile Gly Tyr Val His Gln Val Ala Lys Gln Met His Ile Trp Met Ser Ser Thr <210> 9 <211> 6780 <212> DNA
<213> Homo Sapiens <220>
<221> misc_feature <223> n=a,t,g or c <400>
gggcggggctgagggcggcgggggcgggccgcccgagctgggagggcggcggcgccgagg ggaggagagcggcccatggacccgcggggcccggcgccccagactctgcgccgtcgggac 120 ggagcccaagatgtcggcctaggccggggcgcgacgacgcggacggggcggcgaggaggc 180 gccgctgctgccggggctcgcagccgccgagcccccgagggcgcgccctgacggactggc 240 cgagccggcggtgagaggccggcgcgtctggagcgggccgcgcggcaccatgtcggccaa 300 ggtgcggctcaagaagctggagcagctgctcctggacgggccctggcgcaacgagagcgc 360 cctgagcgtggaaacgctgctcgacgtgctcgtctgcctgtacaccgagtgcagccactc 420 ggccctgcgccgcgacaagtacgtggccgagttcctcgagtgggctaaaccatttacaca 480 gctggtgaaagaaatgcagcttcatcgagaagactttgaaataattaaagtaattggaag 540 aggtgcttttggtgaggttgctgttgtcaaaatgaagaatactgaacgaatttatgcaat 600 gaaaatcctcaacaagtgggagatgctgaaaagagcagagaccgcgtgcttccgagagga 660 gcgcgatgtgctggtgaacggcgactgccagtggatcaccgcgctgcactacgcctttca 720 ggacgagaaccacctgtacttagtcatggattactatgtgggtggtgatttactgaccct 780 gctcagcaaatttgaagacaagcttccggaagatatggcgaggttctacattggtgaaat 840 ggtgctggccattgactccatccatcagcttcattacgtgcacagagacattaaacctga 900 caatgtccttttggacgtgaatggtcatatccgcctggctgactttggatcatgtttgaa 960 gatgaatgatgatggcactgtgcagtcctccgtggccgtgggcacacctgactacatctc 1020 gccggagatcctgcaggcgatggaggacggcatgggcaaatacgggcctgagtgtgactg 1080 gtggtctctgggtgtctgcatgtatgagatgctctatggagaaacgccgttttatgcgga 1140 gtcactcgtggagacctatgggaagatcatgaaccatgaagagcgattccagttcccatc 1200 ccatgtcacggatgtatctgaagaagcgaaggacctcatccagagactgatctgcagtag 1260 agaacgccggctggggcagaatggaatagaggatttcaaaaagcatgcgttttttgaagg 1320 tctaaattgggaaaatatacgaaacctagaagcaccttatattcctgatgtgagcagtcc 1380 ctctgacacatccaacttcgacgtggatgacgacgtgctgagaaacacggaaatattacc 1440 tcctggttctcacacaggcttttctggattacatttgccattcattggttttacattcac 1500 aacggaaagctgtttttctgatcgaggctctctgaagagcataatgcagtccaacacatt 1560 aaccaaagatgaggatgtgcagcgggacctggagcacagcctgcagatggaagcttacga 1620 gaggaggattcggaggctggaacaggagaagctggagctgagcaggaagctgcaagagtc 1680 cacccagaccgtgcagtccctccacggctcatctcgggccctcagcaattcaaaccgaga 1740 taaagaaatcaaaaagctaaatgaagaaatcgaacgcttgaagaataaaatagcagattc 1800 aaacaggctggagcgacagcttgaggacacagtggcgcttcgccaagagcgtgaggactc 1860 cacgcagcggctgcgggggctggagaagcagcaccgcgtggtccggcaggagaaggagga 1920 gctgcacaagcaactggttgaagcctcagagcggttgaaatcccaggccaaggaactcaa 1980 agatgcccatcagcagcgaaagctggccctgcaggagttctcggagctgaacgagcgcat 2040 ggcagagctccgtgcccagaagcagaaggtgtcccggcagctgcgagacaaggaggagga 2100 gatggaggtggccacgcagaaggtggacgccatgcggcaggaaatgcggagagctgagaa 2160 gctcaggaaagagctggaagctcagcttgatgatgctgttgctgaggcctccaaggagcg 2220 caagcttcgtgagcacagcgagaacttctgcaagcaaatggaaagcgagctggaggccct 2280 caaggtgaagcaaggaggccggggagcgggtgccaccttagagcaccagcaagagatttc 2340 caaaatcaaatccgagctggagaagaaagtcttattttatgaagaggaattggtcagacg 2400 tgaggcctcccatgtgctagaagtgaaaaatgtgaagaaggaggtgcatgattcagaaag 2460 ccaccagctggccctgcagaaagaaatcttgatgttaaaagataagttagaaaagtcaaa 2520 gcgagaacggcataacgagatggaggaggcagtaggtacaataaaagataaatacgaacg 2580 agaaagagcgatgctgtttgatgaaaacaagaagctaactgctgaaaatgaaaagctctg 2640 ttcctttgtggataaactcacagctcaaaatagacagctggaggatgagctgcaggatct 2700 ggcagccaagaaggagtcagtggcccactgggaagctcagattgcggaaatcattcagtg 2760 ggtcagtgacgagaaagatgcccggggttaccttcaagctcttgcttccaagatgaccga 2820 agagctcgaggctttgaggagttctagtctggggtcaagaacactggacccgctgtggaa 2880 ggtgcgccgcagccagaagctggacatgtccgcgcggctggagctgcagtcggccctgga 2940 ggcggagatccgggccaagcagcttgtccaggaggagctcaggaaggtcaaggacgccaa 3000 cctcaccttggaaagcaaactaaaggattccgaagccaaaaacagagaattattagaaga 3060 aatggaaattttgaagaaaaagatggaagaaaaattcagagcagatactgggctcaaact 3120 g tccagatttt caggattcca tttttgagta tttcaacact gctcctcttg cacatgacct 3180 gacatttaga accagctcag ctagtgagca agaaacacaa gctccgaagc cagaagcgtc 3240 cccgtcgatg tctgtggctg catcagagca gcaggaggac atggctcggc ccccgcagag 3300 gccatccgct gtgccgttgc ccaccacgca ggccctggtt ctggctggac cgaagccaaa 3360 agctcaccag ttcagcatca agtccttctc cagccctact cagtgcagcc actgcacctc 3420 cctgatggtt gggctgatcc ggcagggcta cgcctgcgag gtgtgttcct ttgcttgcca 3480 cgtgtcctgc aaagacggtg ccccccaggt gtgcccaata cctcccgagc agtccaagag 3540 gcctctgggc gtggacgtgc agcgaggcat cggaacagcc tacaaaggcc atgtcaaggt 3600 cccaaagccc acgggggtga agaagggatg gcagcgcgca tatgcagtcg tctgtgagtg 3660 caagctcttc ctgtatgatc tgcctgaagg aaaatccacc cagcctggtg tcattgcgag 3720 ccaagtcttg gatctcagag atgacgagtt ttccgtgagc tcagtcctgg cctcagatgt 3780 cattcatgct acacgccgag atattccatg tatattcagg gtgacggcct ctctcttagg 3840 tgcaccttct aagaccagct cgctgctcat tctgacagaa aatgagaatg aaaagaggaa 3900 gtgggttggg attctagaag gactccagtc catccttcat aaaaaccggc tgaggaatca 3960 ggtcgtgcat gttcccttgg aagcctacga cagctcgctg cctctcatca aggccatcct 4020 gacagctgcc atcgtggatg cagacaggat tgcagtcggc ctagaagaag ggctctatgt 4080 catagaggtc acccgagatg tgatcgtccg tgccgctgac tgtaagaagg tacaccagat 4140 cgagcttgct cccagggaga agatcgtaat cctcctctgt ggccggaacc accatgtgca 4200 cctctatccg tggtcgtccc ttgatggagc ggaaggcagc tttgacatca agcttccgga 4260 aaccaaaggc tgccagctca tggccacggc cacactcaag aggaactctg gcacctgcct 4320 gtttgtggcc gtgaaacggc tgatcctttg ctatgagatc cagagaacga agccattcca 4380 cagaaagttc aatgagattg tggctcccgg cagcgtgcag tgcctggcgg tgctcaggga 4440 caggctctgt gtgggctacc cttctgggtt ctgcctgctg agcatccagg gggacgggca 4500 gcctctaaac ctggtaaatc ccaatgaccc ctcgcttgcg ttcctctcac aacagtcttt 4560 tgatgccctt tgtgctgtgg agctcgaaag cgaggagtac ctgctttgct tcagccacat 4620 gggactgtac gtggacccgc aaggccggag ggcacgcgcg caggagctca tgtggcctgc 4680 ggctcctgtc gcctgtagtt gcagccccac ccacgtcacg gtgtacagcg agtatggcgt 4740 ggacgtcttt gatgtgcgca ccatggagtg ggtgcagacc atcggcctgc ggaggataag 4800 gcccctgaac tctgaaggca ccctcaacct cctcaactgc gagcctccac gcttgatcta 4860 cttcaagagc aagttctcgg gagcggttct caacgtgccg gacacctccg acaacagcaa 4920 gaagcagatg ctgcgcacca ggagcaaaag gcggttcgtc ttcaaggtcc cagaggaaga 4980 gagactgcag cagaggcgag agatgcttag agacccagaa ttgagatcca aaatgatatc 5040 caacccaacc aacttcaacc acgtggccca catgggccca ggcgacggca tgcaggtgct 5100 catggacctg cctctgagtg ctgtgccccc ctcccaggag gaaaggccgg gccccgctcc 5160 caccaacctg gctcgccagc ctccatccag gaacaagccc tacatctcgt ggccctcatc 5220 aggtggatcg gagcctagcg tgactgtgcc tctgagaagt atgtctgatc cagaccagga 5280 ctttgacaaa gagcctgatt cggactccac caaacactca actccatcga atagctccaa 5340 CCCCagCggC CCaCCgagCC CCaaCtCCCC CC3CaggagC CagCt CCCCC tcgaaggcct 5400 ggagcagccg gcctgtgaca cctgaagccg ccagctcgcc acaggggcca gggagctgga 5460 gatggcctcc agcgtcagtg ccaagactga gcgggccctc cagtgttgtc caaggaaatg 5520 tagaatcact ttgtagatat ggagatgaag aagacaaatc tttattataa tattgatcag 5580 ttttatgccg cattgttcgt ggcagtagac cacatctgtt cgtctgcaca gctgtgaggc 5640 gatgctgttc catctgcaca tgaaggaccc ccatacagcc tgtctcccac ccctgacaac 5700 ccgagagggc atatggggcc ctgccaacac cacttcctca gcagaaaccc gtcatgacgc 5760 ggctgcttcg gaagcagaca tctggggaca cagcctcagt acccagtctt ttccctagtt 5820 cctgaaactt tcctaggacc ttaagagaat agtaggaggt cctatagcat tcccagtgtc 5880 actagaattt tgaagacagg aaagtggagg ttagtctgtg gccttttttt catttagcca 5940 ttgcacagtc agctgcagaa gtcctgctga ccacctagtc atggacaaag gcccaggacc 6000 agtgacaccc tgcgtccctg tgtgcgttaa gttcattctg ggtcgcagcc atgaagtgtc 6060 accagtatct actactgtga agtcagctgt gctgttttcc attcgcttcc acggcttctg 6120 cctcctgcca taaaaccagc gagtgtcgtg gtgcaggcag gccctgtggc ctgctgggct 6180 gagggaagtc agagccccag ggcgccacga agcagccact gggatacccc accccgcccc 6240 gccnnccccc ccccccccnc cagtcnagnc ccgaaatgga gcccccgtga ttagtagccc 6300 gtatgatcac gtagacccac ccaacacact cctgcacact ggccccggcc cacggcacag 6360 caatcccctg cgcgtggatt tcacctcacc ctttgtacca gatgttgagt gaccagctct 6420 gtggccctgt gtcgtcagag gcttgtgatt aactgtggcg gcagacacag cttgtccaca 6480 gcttgggcca ggcttcccct gtcctcccac cggtcggctg cttggcaagg ctgttcagga 6540 cgtgcacttc cccaagtcgg cactgagtgg cccagcacca cctagccctg ccaccccact 6600 gccctcctgg gccttctgct ggatgggcac ctggggggtt ctggtttttt acttttttaa 6660 tgtaagtctc agtctttgta attaattatt gaattgtgag aacatttttg aacaatttac 6720 ctgtcaataa agcagaagac ggcagtttta aagttaaaaa aaaaaaaaaa aaaaaaaaaa 6780 <210> 10 <211> 1711 <212> PRT
<213> Homo Sapiens <400> 10 Met Ser Ala Lys Val Arg Leu Lys Lys Leu Glu Gln Leu Leu Leu Asp G1y Pro Trp Arg Asn Glu Ser Ala Leu Ser Val Glu Thr Leu Leu Asp Val Leu Val Cys Leu Tyr Thr Glu Cys Ser His Ser Ala Leu Arg Arg Asp Lys Tyr Val Ala G1u Phe Leu Glu Trp Ala Lys Pro Phe Thr Gln Leu Val Lys Glu Met Gln Leu His Arg Glu Asp Phe Glu Ile Ile Lys Val Ile Gly Arg Gly Ala Phe Gly Glu Val Ala Val Val Lys Met Lys Asn Thr Glu Arg Ile Tyr Ala Met Lys Ile Leu Asn Lys Trp Glu Met Leu Lys Arg Ala Glu Thr Ala Cys Phe Arg Glu Glu Arg Asp Val Leu Val Asn Gly Asp Cys Gln Trp Ile Thr Ala Leu His Tyr Ala Phe Gln Asp Glu Asn His Leu Tyr Leu Val Met Asp Tyr Tyr Val Gly Gly Asp Leu Leu Thr Leu Leu Ser Lys Phe Glu Asp Lys Leu Pro Glu Asp Met Ala Arg Phe Tyr Ile Gly Glu Met Va1 Leu Ala Ile Asp Ser I1e His Gln Leu His Tyr Val His Arg Asp Ile Lys Pro Asp Asn Val Leu Leu Asp Val Asn Gly His Ile Arg Leu Ala Asp Phe Gly Ser Cys Leu Lys Met Asn Asp Asp Gly Thr Val Gln Ser Ser Val Ala Val Gly Thr Pro Asp Tyr Ile Ser Pro Glu Ile Leu Gln Ala Met Glu Asp Gly Met Gly Lys Tyr Gly Pro Glu Cys Asp Trp Trp Ser Leu Gly Val Cys Met Tyr 1~
Glu Met Leu Tyr Gly G1u Thr Pro. Phe Tyr Ala Glu Ser Leu Val Glu Thr Tyr Gly Lys Ile Met Asn His Glu Glu Arg Phe Gln Phe Pro Ser His Val Thr Asp Val Ser Glu Glu A1a Lys Asp Leu Ile Gln Arg Leu Ile Cys Ser Arg Glu Arg Arg Leu Gly Gln Asn Gly Ile Glu Asp Phe Lys Lys His Ala Phe Phe Glu Gly Leu Asn Trp Glu Asn I1e Arg Asn Leu Glu Ala Pro Tyr Ile Pro Asp Val Ser Ser Pro Ser Asp Thr Ser Asn Phe Asp Val Asp Asp Asp Val Leu Arg Asn Thr Glu Ile Leu Pro Pro Gly Ser His Thr Gly Phe Ser Gly Leu His Leu Pro Phe Ile Gly Phe Thr Phe Thr Thr Glu Ser Cys Phe Ser Asp Arg Gly Ser Leu Lys Ser Ile Met Gln Ser Ann Thr Leu Thr Lys Asp Glu Asp Val Gln Arg Asp Leu Glu His 5er Leu Gln Met Glu Ala Tyr Glu Arg Arg Ile Arg Arg Leu Glu Gln Glu Lys Leu Glu Leu Ser Arg Lys Leu Gln Glu Ser Thr Gln Thr Val Gln Ser Leu His Gly Ser Ser Arg Ala Leu Ser Asn Ser Asn Arg Asp Lys Glu Ile Lys Lys Leu Asn Glu Glu Ile G1u Arg Leu Lys Asn Lys Ile Ala Asp Ser Asn Arg Leu Glu Arg Gln Leu Glu Asp Thr Val Ala Leu Arg Gln Glu Arg Glu Asp Ser Thr Gln Arg Leu Arg Gly Leu Glu Lys Gln His Arg Val Val Arg Gln Glu Lys Glu Glu Leu His Lys G1n Leu Val Glu Ala Ser Glu Arg Leu Lys Ser Gln Ala Lys Glu Leu Lys Asp Ala His Gln Gln Arg Lys Leu Ala Leu Gln Glu Phe Ser Glu Leu Asn Glu Arg Met Ala Glu Leu Arg Ala Gln Lys Gln Lys Val Ser Arg Gln Leu Arg Asp Lys Glu Glu Glu Met Glu Val Ala Thr Gln Lys Val Asp Ala Met Arg Gln Glu Met Arg Arg Ala Glu Lys Leu Arg Lys Glu Leu Glu Ala Gln Leu Asp Asp Ala Val Ala Glu Ala Ser Lys Glu Arg Lys Leu Arg G1u His Ser Glu Asn Phe Cys Lys Gln Met Glu Ser Glu Leu Glu Ala Leu Lys Val Lys Gln Gly Gly Arg Gly Ala Gly A1a Thr Leu Glu His Gln Gln Glu Ile Ser Lys Ile Lys Ser Glu Leu Glu Lys Lys Val Leu Phe Tyr Glu Glu Glu Leu Val Arg Arg Glu Ala Ser His Val Leu Glu Val Lys Asn Va1 Lys Lys Glu Val His Asp Ser Glu Ser His Gln Leu Ala Leu Gln Lys Glu Ile Leu Met Leu Lys Asp Lys Leu Glu Lys Ser Lys Arg Glu Arg His Asn Glu Met Glu Glu Ala Val Gly Thr Ile Lys Asp Lys Tyr Glu Arg Glu Arg Ala Met Leu Phe Asp Glu Asn Lys Lys Leu Thr Ala Glu Asn Glu Lys Leu Cys Ser Phe Val Asp Lys Leu Thr Ala Gln Asn Arg Gln Leu Glu Asp Glu Leu Gln Asp Leu Ala A1a Lys Lys Glu Ser Val Ala His Trp Glu Ala Gln Ile Ala Glu Ile Ile Gln Trp Val Ser Asp Glu Lys Asp Ala Arg Gly Tyr Leu Gln Ala Leu Ala Ser Lys Met Thr Glu Glu Leu Glu Ala Leu Arg Ser Ser Ser Leu Gly Ser Arg Thr Leu Asp Pro Leu Trp Lys Val Arg Arg Ser Gln Lys T~eu Asp Met Ser Ala Arg Leu Glu Leu Gln Ser Ala Leu Glu A1a Glu Ile Arg Ala Lys Gln Leu Val Gln Glu Glu Leu Arg Lys Val Lys Asp Ala Asn Leu Thr Leu Glu Ser Lys Leu Lys Asp Ser Glu Ala Lys Asn Arg Glu Leu Leu Glu Glu Met Glu Ile Leu Lys Lys Lys Met Glu Glu Lys Phe Arg Ala Asp Thr Gly Leu Lys Leu Pro Asp Phe Gln Asp Ser Ile Phe Glu Tyr Phe Asn Thr Ala Pro Leu Ala His Asp Leu Thr Phe Arg Thr Ser Ser Ala Ser Glu Gln Glu Thr Gln Ala Pro Lys Pro Glu Ala Ser Pro Ser Met Ser Val Ala Ala Ser Glu Gln Gln Glu Asp Met Ala Arg Pro Pro Gln Arg Pro Ser Ala Val gg5 1000 1005 Pro Leu Pro Thr Thr Gln Ala Leu Val Leu Ala Gly Pro Lys Pro Lys Ala His Gln Phe Ser Ile Lys Ser Phe Ser Ser Pro Thr Gln Cys Ser His Cys Thr Ser Leu Met Val Gly Leu Ile Arg Gln Gly Tyr Ala Cys Glu Val Cys Ser Phe Ala Cys His Val Ser Cys Lys Asp Gly Ala Pro Gln Val Cys Pro Ile Pro Pro Glu Gln Ser Lys Arg Pro Leu Gly Val Asp Val Gln Arg Gly Ile Gly Thr Ala Tyr Lys Gly His Val Lys Val Pro Lys Pro Thr Gly Val Lys Lys Gly Trp Gln Arg Ala Tyr Ala Val Val Cys Glu Cys Lys Leu Phe Leu Tyr Asp Leu Pro Glu Gly Lys Ser Thr Gln Pro Gly Val Ile Ala Ser Gln Val Leu Asp Leu Arg Asp Asp Glu Phe Ser Val Ser Ser Val Leu Ala Ser Asp Val Ile His Ala Thr Arg Arg Asp Ile Pro Cys Ile Phe Arg Val Thr Ala Ser Leu Leu Gly Ala Pro Ser Lys Thr Ser Ser Leu Leu Ile Leu Thr Glu Asn Glu Asn Glu Lys Arg Lys Trp Val G1y Ile Leu Glu Gly Leu Gln Ser Ile Leu His Lys Asn Arg Leu Arg Asn Gln Val Val His Val Pro Leu Glu Ala Tyr Asp Ser Ser Leu Pro Leu Ile Lys Ala I1e Leu Thr Ala A1a Ile Val Asp Ala Asp Arg Ile Ala Val Gly Leu Glu Glu Gly Leu Tyr Val Ile Glu Val Thr Arg Asp Val Ile Val Arg Ala Ala Asp Cys Lys Lys Val His Gln Ile Glu Leu Ala Pro Arg Glu Lys Ile Val 1280 1285 ' 1290 Ile Leu Leu Cys Gly Arg Asn His His Val His Leu Tyr Pro Trp Ser Ser Leu Asp Gly Ala Glu Gly Ser Phe Asp Ile Lys Leu Pro Glu Thr Lys Gly Cys Gln Leu Met A1a Thr Ala Thr Leu Lys Arg Asn Ser Gly Thr Cys Leu Phe Val Ala Val Lys Arg Leu Ile Leu Cys Tyr Glu Ile Gln Arg Thr Lys Pro Phe His Arg Lys Phe Asn Glu Ile Val Ala Pro Gly Ser Val Gln Cys Leu Ala Val Leu Arg Asp Arg Leu Cys Val Gly Tyr Pro Ser Gly Phe Cys Leu Leu Ser Ile Gln Gly Asp Gly Gln Pro Leu Asn Leu Val Asn Pro Asn Asp Pro Ser Leu Ala Phe Leu Ser Gln Gln Ser Phe Asp Ala Leu Cys Ala Val Glu Leu Glu Ser Glu Glu Tyr Leu Leu Cys Phe Ser His Met Gly Leu Tyr Val Asp Pro Gln Gly Arg Arg Ala Arg Ala Gln Glu Leu Met Trp Pro Ala Ala Pro Val Ala Cys Ser Cys Ser Pro Thr His Val Thr Val Tyr Ser G1u Tyr Gly Val Asp Val Phe Asp Val Arg Thr Met Glu Trp Val Gln Thr Ile Gly Leu Arg Arg Ile Arg Pro Leu Asn Ser Glu Gly Thr Leu Asn Leu Leu Asn Cys Glu Pro Pro Arg Leu Ile Tyr Phe Lys Ser Lys Phe Ser Gly Ala Val Leu Asn Val Pro Asp Thr Ser Asp Asn Ser Lys Lys Gln Met Leu Arg Thr Arg Ser Lys Arg Arg Phe Val Phe Lys Val Pro Glu G1u Glu Arg Leu Gln Gln Arg Arg Glu Met Leu Arg Asp Pro Glu Leu Arg Ser Lys Met Ile Ser Asn Pro Thr Asn Phe Asn His Val Ala His Met Gly Pro Gly Asp Gly Met Gln Val Leu Met Asp Leu Pro Leu Ser Ala Val Pro Pro Ser Gln Glu Glu Arg Pro Gly Pro Ala Pro Thr Asn Leu Ala Arg G1n Pro Pro Ser Arg Asn Lys Pro Tyr Ile Ser Trp Pro Ser Ser Gly Gly Ser Glu Pro Ser Val Thr Val Pro Leu Arg Ser Met Ser Asp Pro Asp Gln Asp Phe Asp Lys Glu Pro Asp Ser Asp Ser Thr Lys His Ser Thr Pro Ser Asn Ser Ser Asn Pro Ser Gly Pro Pro Ser Pro Asn Ser Pro His Arg Ser Gln Leu Pro Leu Glu Gly Leu G1u Gln Pro Ala Cys Asp Thr <210> 11 <211> 2287 <212> DNA
<213> Homo sapiens <400>
ggctgaggcagtggctccttgcacagcagctgcacgcgccgtggctccggatcttcttcg 60 tctttgcagcgtagcccgagtcggtcagcgccagaggacctcagcagccatgtcgaagcc 120 ccatagtgaagccgggactgccttcattcagacccagcagctgcacgcagccatggctga 180 cacattcctggagcacatgtgccgcctggacattgattcaccacccatcacagcccggaa 240 cactggcatcatctgtaccattggcccagcttcccgatcagtggagacgttgaaggagat 300 gattaagtctggaatgaatgtggctcgtctgaacttctctcatggaactcatgagtacca 360 tgcggagaccatcaagaatgtgcgcacagccacggaaagctttgcttctgaccccatcct 420 ctaccggcccgttgctgtggctctagacactaaaggacctgagatccgaactgggctcat480 caagggcagcggcactgcagaggtggagctgaagaagggagccactctcaaaatcacgct540 ggataacgcctacatggaaaagtgtgacgagaacatcctgtggctggactacaagaacat600 ctgcaaggtggtggaagtgggcagcaagatctacgtggatgatgggcttatttctctcca660 ggtgaagcagaaaggtgccgacttcctggtgacggaggtggaaaatggtggctccttggg720 cagcaagaagggtgtgaaccttcctggggctgctgtggacttgcctgctgtgtcggagaa780 ggacatccaggatctgaagtttggggtcgagcaggatgttgatatggtgtttgcgtcatt840 catccgcaaggcatctgatgtccatgaagttaggaaggtcctgggagagaagggaaagaa900 catcaagattatcagcaaaatcgagaatcatgagggggttcggaggtttgatgaaatcct960 ggaggccagtgatgggatcatggtggctcgtggtgatctaggcattgagattcctgcaga1020 gaaggtcttccttgctcagaagatgatgattggacggtgcaaccgagctgggaagcctgt1080 catctgtgctactcagatgctggagagcatgatcaagaagccccgccccactcgggctga1140 aggcagtgatgtggccaatgcagtcctggatggagccgactgcatcatgctgtctggaga1200 aacagccaaaggggactatcctctggaggctgtgcgcatgcagaacctgattgcccgtga1260 ggcagaggctgccatctaccacttgcaattatttgaggaactccgccgcctggcgcccat1320 taccagcgaccccacagaagccaccgccgtgggtgccgtggaggcctccttcaagtgctg1380 cagtggggccataatcgtcctcaccaagtctggcaggtctgctcaccaggtggccagata1440 ccgcccacgtgcccccatcattgctgtgacccggaatccccagacagctcgtcaggccca1500 cctgtaccgtggcatcttccctgtgctgtgcaaggacccagtccaggaggcctgggctga1560 ggacgtggacctccgggtgaactttgccatgaatgttggcaaggcccgaggcttcttcaa1620 gaagggagatgtggtcattgtgctgaccggatggcgccctggctccggcttcaccaacac1680 catgcgtgttgttcctgtgccgtgatggaccccagagcccctcctccagcccctgtccca1740 cccccttcccccagcccatccattaggccagcaacgcttgtagaactcactctgggctgt1800 aacgtggcactggtaggttgggacaccagggaagaagatcaacgcctcactgaaacatgg1860 ctgtgtttgcagcctgctctagtgggacagcccagagcctggctgccccatcatgtggcc1920 ccacccaatcaagggaagaaggaggaatgctggactggaggcccctggagccagatggca1980 agagggtgacagcttcctttcctgtgtgtactctgtccagttcctttagaaaaaatggat2040 gcccagaggactcccaaccctggcttggggtcaagaaacagccagcaagagttaggggcc2100 ttagggcactgggctgttgttccattgaagccgactctggccctggcccttacttgcttc2160 tctagctctctaggcctctccagtttgcacctgtccccaccctccactcagctgtcctgc2220 agcaaacactccaccctccaccttccattttcccccactactgcagcacctccaggcctg2280 ttgccgc 2287 <210> 12 <211> 531 <212> PRT
<213> HomoSapiens <400> 12 Met Ser ProHis SerGluAla GlyThrAla PheIleGln ThrGln Lys G1n Leu AlaAla MetAlaAsp ThrPheLeu GluHisMet CysArg His Leu Asp AspSer ProProIle ThrAlaArg AsnThrGly IleIle Ile Cys Thr GlyPro AlaSerArg SerValGlu ThrLeuLys GluMet Ile Ile Lys GlyMet AsnValAla ArgLeuAsn PheSerHis GlyThr Ser His Glu HisAla GluThrIle LysAsnVal ArgThrAla ThrGlu Tyr Ser Phe Ala Ser Asp Pro Ile Leu Tyr Arg Pro Val A1a Val Ala Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr Gly Leu Ile Lys Gly Ser Gly Thr Ala Glu Val Glu Leu Lys Lys Gly Ala Thr Leu Lys Ile Thr Leu Asp Asn Ala Tyr Met Glu Lys Cys Asp Glu Asn Ile Leu Trp Leu Asp Tyr Lys Asn Ile Cys Lys Val Val Glu Val Gly Ser Lys Ile Tyr Val Asp Asp Gly Leu Ile Ser Leu Gln Val Lys Gln Lys Gly Ala Asp Phe Leu Va1 Thr Glu Val Glu Asn Gly Gly Ser Leu Gly Ser Lys Lys Gly Val Asn Leu Pro Gly Ala Ala Val Asp Leu Pro Ala Val Ser Glu Lys Asp Ile Gln Asp Leu Lys Phe Gly Val Glu Gln Asp Val Asp Met Val Phe Ala Ser Phe Ile Arg Lys Ala Ser Asp Val His Glu Val Arg Lys Val Leu Gly Glu Lys Gly Lys Asn Ile Lys Ile Ile Ser Lys Ile Glu Asn His Glu Gly Val Arg Arg Phe Asp Glu Ile Leu Glu Ala Ser Asp Gly Ile Met Val Ala Arg Gly Asp Leu Gly Ile Glu Ile Pro Ala Glu Lys Val Phe Leu Ala Gln Lys Met Met Ile Gly Arg Cys Asn Arg Ala Gly Lys Pro Val Ile Cys Ala Thr Gln Met Leu Glu Ser Met Ile Lys Lys Pro Arg Pro Thr Arg Ala Glu Gly Ser Asp Val Ala Asn Ala Val Leu Asp Gly Ala Asp Cys Ile Met Leu Ser Gly Glu Thr Ala Lys Gly Asp Tyr Pro Leu Glu Ala Val Arg Met G1n Asn Leu Ile Ala Arg Glu Ala Glu Ala A1a Ile Tyr His Leu Gln Leu Phe Glu Glu Leu Arg Arg Leu Ala Pro Ile Thr Ser Asp Pro Thr Glu Ala Thr Ala Val Gly Ala 1~
Val Glu Ala Ser Phe Lys Cys Cys Ser Gly Ala Ile Ile Val Leu Thr Lys Ser Gly Arg Ser Ala His Gln Val Ala Arg Tyr Arg Pro Arg Ala Pro Ile Ile Ala Val Thr Arg Asn Pro Gln Thr Ala Arg Gln Ala His Leu Tyr Arg Gly Ile Phe Pro Val Leu Cys Lys Asp Pro Val Gln Glu Ala Trp Ala Glu Asp Val Asp Leu Arg Val Asn Phe Ala Met Asn Val Gly Lys Ala Arg Gly Phe Phe Lys Lys Gly Asp Val Val I1e Val Leu Thr Gly Trp Arg Pro Gly Ser Gly Phe Thr Asn Thr Met Arg Val Val 5l5 520 525 Pro Val Pro <210> 13 <211> 4364 <212> DNA
<213> Homo Sapiens <400>
cattagatctttacatgaaagtaaaatttataagatttctagaaagtcaaaagatgataa60 ctatttcttaggatactaaaagcactcacattatagaaaaaaaatcagttaactatactc120 cacaaacattaaaggctccctataaaaaaacatttttaataggcaagccacagaaagggc180 aaatattaatagtttgcaatacatatgtatgaaaaggaattgaatctagaatatttaaca240 aagctttacaactcaaaaaatacaaagaaaatatttttcttccaattggcaaattactta300 aacagaaccttcacaaaagaagataagaatgtttaataaacatttgaagccataataatg360 acatcattagccatgatggaaatgcaaatttaagtaccacttcacatccacaagaaaaag420 ataaaaataaaaggactgagctcaccaaacattggtgaggatgtggtaatactgaaattc480 ttgtaccgtgctcctgagggtataacatattacaggatttttttgaaaactagtggttcc540 ttataaacttaatgccctggcaacctcacacctatttacttaagaatgaaagggccccgc600 cctcctccctcctcgctcgcgggccgggcccggcatggtgcggcgtcgccgccgatggcg660 ctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcgg720 ctcgggctgctgctggcggagtccgccgccgcaggtctgaagctcatgggagccccggtg780 aagctgacagtgtctcaggggcagccggtgaagctcaactgcagtgtggaggggatggag840 gagcctgacatccagtgggtgaaggatggggctgtggtccagaacttggaccagttgtac900 atcccagtcagcgagcagcactggatcggcttcctcagcctgaagtcagtggagcgctct960 gacgccggccggtactggtgccaggtggaggatgggggtgaaaccgagatctcccagcca1020 gtgtggctcacggtagaaggtgtgccatttttcacagtggagccaaaagatctggcagtg1080 ccacccaatgcccctttccaactgtcttgtgaggctgtgggtccccctgaacctgttacc1140 attgtctggtggagaggaactacgaagatcgggggacccgctccctctccatctgtttta1200 aatgtaacaggggtgacccagagcaccatgttttcctgtgaagctcacaacctaaaaggc1260 ctggcctcttctcgcacagccactgttcaccttcaagcactgcctgcagcccccttcaac1320 atcaccgtgacaaagctttccagcagcaacgctagtgtggcctggatgccaggtgctgat1380 ggccgagctctgctacagtcctgtacagttcaggtgacacaggccccaggaggctgggaa1440 gtcctggctgttgtggtccctgtgcccccctttacctgcctgctccgggacctggtgcct1500 gccaccaactacagcctcagggtgcgctgtgccaatgccttggggccctctccctatgct1560 gactgggtgccctttcagaccaagggtctagccccagccagcgctccccaaaacctccat1620 gccatccgcacagattcaggcctcatcttggagtgggaagaagtgatccccgaggcccct1680 ttggaaggccccctgggaccctacaaactgtcctgggttcaagacaatggaacccaggat1740 gacag tggaggggaccagggccaatttgacaggctgggatccccaaaaggacctg1800 gagct . tgtgcgtctccaatgcagttggctgtggaccctggagtcagccactggtg1860 atcgtacgtg gtctcttctcatgaccgtgcaggccagcagggccctcctcacagccgcacatcctgggta1920 cctgtggtccttggtgtgctaacggccctggtgacggctgctgccctggccctcatcctg1980 cttcgaaagagacggaaagagacgcggtttgggcaagcctttgacagtgtcatggcccgg2040 ggagagccagccgttcacttccgggcagcccggtccttcaatcgagaaaggcccgagcgc2100 atcgaggccacattggacagcttgggcatcagcgatgaactaaaggaaaaactggaggat2160 gtgctcatcccagagcagcagttcaccctgggccggatgttgggcaaaggagagtttggt2220 tcagtgcgggaggcccagctgaagcaagaggatggctcctttgtgaaagtggctgtgaag2280 atgctgaaagctgacatcattgcctcaagcgacattgaagagttcctcagggaagcagct2340 tgcatgaaggagtttgaccatccacacgtggccaaacttgttggggtaagcctccggagc2400 agggctaaaggccgtctccccatccccatggtcatcttgcccttcatgaagcatggggac2460 ctgcatgccttcctgctcgcctcccggattggggagaacccctttaacctacccctccag2520 accctgatccggttcatggtggacattgcctgcggcatggagtacctgagctctcggaac2580 ttcatccaccgagacctggctgctcggaattgcatgctggcagaggacatgacagtgtgt2640 gtggctgacttcggactctcccggaagatctacagtggggactactatcgtcaaggctgt2700 gcctccaaactgcctgtcaagtggctggccctggagagcctggccgacaacctgtatact2760 gtgcagagtgacgtgtgggcgttcggggtgaccatgtgggagatcatgacacgtgggcag2820 acgccatatgctggcatcgaaaacgctgagatttacaactacctcattggcgggaaccgc2880 ctgaaacagcctccggagtgtatggaggacgtgtatgatctcatgtaccagtgctggagt2940 gctgaccccaagcagcgcccgagctttacttgtctgcgaatggaactggagaacatcttg3000 ggccagctgtctgtgctatctgccagccaggaccccttatacatcaacatcgagagagct3060 gaggagcccactgtgggaggcagcctggagctacctggcagggatcagccctacagtggg3120 gctggggatggcagtggcatgggggcagtgggtggcactcccagtgactgtcggtacata3180 ctcacccccggagggctggctgagcagccagggcaggcagagcaccagccagagagtccc3240 ctcaatgagacacagaggcttttgctgctgcagcaagggctactgccacacagtagctgt3300 tagcccacaggcagagggcatcggggccatttggccggctctggtggccactgagctggc3360 tgactaagccccgtctgaccccagcccagacagcaaggtgtggaggctcctgtggtagtc3420 ctcccaagctgtgctgggaagcccggactgaccaaatcacccaatcccagttcttcctgc3480 aaccactctgtggccagcctggcatcagtttaggccttggcttgatggaagtgggccagt3540 cctggttgtctgaacccaggcagctggcaggagtggggtggttatgtttccatggttacc3600 atgggtgtggatggcagtgtggggagggcaggtccagctctgtgggccctaccctcctgc3660 tgagctgcccctgctgcttaagtgcatgcattgagctgcctccagcctggtggcccagct3720 attaccacacttggggtttaaatatccaggtgtgcccctccaagtcagaaagagatgtcc3780 ttgtaatattcccttttaggtgagggttggtaaggggttggtatctcaggtctgaatctt3840 caccatctttctgattccgcaccctgcctacgccaggagaagttgaggggagcatgcttc3900 cctgcagctgaccgggtcacacaaaggcatgctggagtacccagcctatcaggtgcccct3960 cttccaaaggcagcgtgccgagccagcaagaggaaggggtgctgtgaggcttgcccagga4020 gcaagtgaggccggagaggagttcaggaacccttctccatacccacaatctgagcacgct4080 accaaatctcaaaatatcctaagactaacaaaggcagctgtgtctgagcccaacccttct4140 aaacggtgacctttagtgccaacttcccctctaactggacagcctcttctgtcccaagtc4200 tccagagagaaatcaggcctgatgagggggaattcctggaacctggaccccagccttggt4260 gggggagcctctggaatgcatggggcgggtcctagctgttagggacatttccaagctgtt4320 agttgctgtttaaaatagaaataaaattgaagactaaagaccta 4364 <210> 14 <211> 882 <212> PRT
<213> Homo Sapiens <400> 14 Met A1a Leu Arg Arg Ser Met Gly Arg Pro Gly Leu Pro Pro Leu Pro Leu Pro Pro Pro Pro Arg Leu Gly Leu Leu Leu Ala Glu Ser Ala Ala Ala Gly Leu Lys Leu Met Gly Ala Pro Val Lys Leu Thr Val Ser Gln Gly Gln Pro Val Lys Leu Asn Cys Ser Val Glu Gly Met Glu Glu Pro Asp Ile Gln Trp Val Lys Asp Gly Ala Val Val Gln Asn Leu Asp Gln Leu Tyr Ile Pro Val Ser Glu Gln His Trp Ile Gly Phe Leu Ser Leu Lys Ser Val Glu Arg Ser Asp Ala Gly Arg Tyr Trp Cys Gln Val Glu Asp Gly Gly Glu Thr Glu Ile Ser Gln Pro Val Trp Leu Thr Val Glu G1y Val Pro Phe Phe Thr Val Glu Pro Lys Asp Leu Ala Val Pro Pro Asn Ala Pro Phe Gln Leu Ser Cys Glu Ala Val Gly Pro Pro Glu Pro Val Thr Ile Val Trp Trp Arg Gly Thr Thr Lys Ile Gly Gly Pro Ala Pro Ser Pro Ser Val Leu Asn Val Thr Gly Val Thr Gln Ser Thr Met Phe Ser Cys Glu Ala His Asn Leu Lys Gly Leu Ala Ser Ser Arg Thr Ala Thr Val His Leu Gln Ala Leu Pro Ala Ala Pro Phe Asn Ile Thr Val Thr Lys Leu Sex Ser Ser Asn Ala Ser Val Ala Trp Met Pro Gly Ala Asp Gly Arg Ala Leu Leu Gln Ser Cys Thr Val Gln Val Thr Gln Ala Pro Gly G1y Trp Glu Val Leu Ala Val Val Val Pro Val Pro Pro Phe Thr Cys Leu Leu Arg Asp Leu Val Pro Ala Thr Asn Tyr Ser Leu Arg Val Arg Cys Ala Asn Ala Leu Gly Pro Ser Pro Tyr Ala Asp Trp Val Pro Phe Gln Thr Lys Gly Leu Ala Pro Ala Ser Ala Pro Gln Asn Leu His Ala Ile Arg Thr Asp Ser Gly Leu I1e Leu Glu Trp Glu Glu Val Ile Pro Glu Ala Pro Leu Glu Gly Pro Leu Gly Pro Tyr Lys Leu Ser Trp Val Gln Asp Asn Gly Thr Gln Asp Glu Leu Thr Val Glu Gly Thr Arg Ala Asn Leu Thr Gly Txp Asp Pro Gln Lys Asp Leu Ile Val Arg Val Cys Val Ser Asn Ala Val Gly Cys Gly Pro Trp Ser Gln Pro Leu Val Val Ser Ser His Asp Arg Ala Gly Gln Gln Gly Pro Pro His Ser Arg Thr Ser Trp Val Pro Val Val Leu Gly Val Leu Thr Ala Leu Val Thr Ala Ala Ala Leu Ala Leu I1e Leu Leu Arg Lys Arg Arg Lys Glu Thr Arg Phe Gly Gln Ala Phe Asp Ser Val Met Ala Arg Gly Glu Pro Ala Val His Phe Arg Ala Ala Arg Ser Phe Asn Arg Glu Arg Pro Glu Arg Ile Glu Ala Thr Leu Asp Ser Leu Gly Ile Ser Asp Glu Leu Lys Glu Lys Leu Glu Asp Val Leu Ile Pro Glu Gln Gln Phe Thr Leu Gly Arg Met Leu Gly Lys Gly Glu Phe Gly Ser Va1 Arg Glu Ala Gln Leu Lys Gln Glu Asp Gly Ser Phe Val Lys Val Ala Val Lys Met Leu Lys Ala Asp Ile Ile Ala Ser Ser Asp Ile Glu Glu Phe Leu Arg Glu Ala Ala Cys Met Lys Glu Phe Asp His Pro His Val Ala Lys Leu Val Gly Val Ser Leu Arg Ser Arg Ala Lys G1y Arg Leu Pro Ile Pro Met Va1 Ile Leu Pro Phe Met Lys His Gly Asp Leu His Ala Phe Leu Leu Ala Ser Arg Ile Gly Glu Asn Pro Phe Asn Leu Pro Leu Gln Thr Leu Ile Arg Phe Met Val Asp Ile Ala Cys Gly Met Glu Tyr Leu Ser Ser Arg Asn Phe Ile His Arg Asp Leu Ala Ala Arg Asn Cys Met Leu Ala Glu Asp Met Thr Val Cys Val Ala Asp Phe Gly Leu Ser Arg Lys Ile Tyr Ser Gly Asp Tyr Tyr Arg Gln Gly Cys Ala Ser Lys Leu Pro Val Lys Trp Leu Ala Leu Glu Ser Leu Ala Asp Asn Leu Tyr Thr Val Gln Ser Asp Val Trp Ala Phe Gly Val Thr Met Trp Glu Ile Met Thr Arg Gly Gln Thr Pro Tyr Ala Gly 21e Glu Asn Ala Glu Ile Tyr Asn Tyr Leu Ile Gly Gly Asn Arg Leu Lys Gln Pro Pro Glu Cys Met Glu Asp Val Tyr Asp Leu Met Tyr Gln Cys Trp Ser Ala Asp Pro Lys Gln Arg Pro Ser Phe Thr Cys Leu Arg Met Glu Leu Glu Asn Ile Leu Gly G1n Leu Ser Val Leu Ser Ala Ser Gln Asp Pro Leu Tyr Ile Asn 21e Glu Arg Ala Glu Glu Pro Thr Val Gly Gly Ser Leu Glu Leu Pro Gly Arg Asp Gln Pro Tyr Ser Gly Ala Gly Asp Gly Ser Gly Met Gly Ala Val Gly Gly Thr Pro Ser Asp Cys Arg Tyr Ile Leu Thr Pro Gly Gly Leu Ala Glu Gln Pro Gly Gln Ala G1u His Gln Pro Glu Ser Pro Leu Asn Glu Thr Gln Arg Leu Leu Leu Leu Gln Gln Gly Leu Leu Pro His Ser Ser Cys <210>
<211>
<212>
DNA
<213> sapiens Homo <400>
ggccgcttcgggtttccggaggggccggagggcgggcgagggcgtcacgtgcgcgccgcc 60 cgcgggccggttggtccccgggcgggggaggggccgtgcgcagcctgggtcggggtcggg 120 ccggggtcggcacctgggacatccctgagggaagggccgggagcgggagcgccccagcgg 180 ccggcgggcgggcgggcgagcggacgagcggcgcggagccggcccgaggcgcgcgccgag 240 ggagccccgtccccggtcgtgggggcaccgcccgcaggctctgcggggtgggcagctccc 300 gggcctgccatgagctctccgccgcccgcccgcagtggcttttaccgccaggaggtgacc 360 aagacggcctgggaggtgcgcgccgtgtaccgggacctgcagcccgtgggctcgggcgcc 420 tacggcgcggtgtgctcggccgtggacggccgcaccggcgctaaggtggccatcaagaag 480 ctgtatcggcccttccagtccgagctgttcgccaagcgcgcctaccgcgagctgcgcctg 540 ctcaagcacatgcgccacgagaacgtgatcgggctgctggacgtattcactcctgatgag 600 accctggatgacttcacggacttttacctggtgatgccgttcatgggcaccgacctgggc660 aagctcatgaaacatgagaagctaggcgaggaccggatccagttcctcgtgtaccagatg720 ctgaaggggctgaggtatatccacgctgccggcatcatccacagagacctgaagcccggc780 aacctggctgtgaacgaagactgtgagctgaagatcctggacttcggcctggccaggcag840 gcagacagtgagatgactgggtacgtggtgacccggtggtaccgggctcccgaggtcatc900 ttgaattggatgcgctacacgcagacggtggacatctggtccgtgggctgcatcatggcg960 gagatgatcacaggcaagacgctgttcaagggcagcgaccacctggaccagctgaaggag1020 atcatgaaggtgacggggacgcctccggctgagtttgtgcagcggctgcagagcgatgag1080 gccaagaacaacatgaagggcctccccgaattggagaagaaggattttgcctctatcctg1140 accaatgcaagccctctggctgtgaacctcctggagaagatgctggtgctggacgcggag1200 cagcgggtgacggcaggcgaggcgctggcccatccctacttcgagtccctgcacgacacg2260 gaagatgagccccaggtccagaagtatgatgactcctttgacgacgttgaccgcacactg1320 gatgaatggaagcgtgttacttacaaagaggtgctcagcttcaagcctccccggcagctg1380 ggggccagggtctccaaggagacgcctctgtgaagatctctgggctccggggtggcagtg1440 aggaccaccttcacctt 1457 <210> 16 <211> 367 <212> PRT
<213> Homo sapiens <400> 16 Met Ser Ser Pro Pro Pro Ala Arg Ser Gly Phe Tyr Arg Gln Glu Val Thr Lys Thr Ala Trp Glu Val Arg Ala Val Tyr Arg Asp Leu Gln Pro Val Gly Ser Gly Ala Tyr Gly Ala Val Cys Ser Ala Val Asp Gly Arg Thr Gly Ala Lys Val Ala Ile Lys Lys Leu Tyr Arg Pro Phe Gln Ser Glu Leu Phe Ala Lys Arg Ala Tyr Arg Glu Leu Arg Leu Leu Lys His Met Arg His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Asp Glu Thr Leu Asp Asp Phe Thr Asp Phe Tyr Leu Val Met Pro Phe Met Gly Thr Asp Leu Gly Lys Leu Met Lys His Glu Lys Leu Gly Glu Asp Arg Ile Gln Phe Leu Val Tyr Gln Met Leu Lys Gly Leu Arg Tyr Ile His Ala Ala Gly Ile Ile His Arg Asp Leu Lys Pro Gly Asn Leu Ala Va1 Asn Glu Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg Gln Ala Asp Ser Glu Met Thr Gly Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Val Ile Leu Asn Trp Met Arg Tyr Thr Gln Thr Val Asp Ile Trp Ser Val Gly Cys Ile Met Ala Glu Met Ile Thr Gly Lys Thr Leu Phe Lys Gly Ser Asp His Leu Asp Gln Leu Lys Glu Ile Met Lys Val Thr Gly Thr Pro Pro Ala G1u Phe Val Gln Arg Leu Gln Ser Asp Glu Ala Lys Asn Asn Met Lys Gly Leu Pro Glu Leu G1u Lys Lys Asp Phe Ala Ser Ile Leu Thr Asn A1a Ser Pro Leu Ala Val Asn Leu Leu Glu Lys Met Leu Val Leu Asp Ala Glu Gln Arg Val Thr Ala Gly Glu Ala Leu Ala His Pro Tyr Phe Glu Ser Leu His Asp Thr Glu Asp Glu Pro Gln Val Gln Lys Tyr Asp Asp Ser Phe Asp Asp Val Asp Arg Thr Leu Asp Glu Trp Lys Arg Va1 Thr Tyr Lys Glu Val Leu Ser Phe Lys Pro Pro Arg Gln Leu G1y Ala Arg Val Ser Lys Glu Thr Pro Leu <210> 17 <211> 5243 <212> DNA
<213> Homo Sapiens <400>
cttttcttgcaggacatgttctctggatgtcagctgagtcattaaagtaactctgcatgt60 cagtagacagaccttggtagaaccacaaggctcccagagacacccatctctcctcatttt120 tttggtgtgtgtgtcttcaccgaacattcaaaactgtttctccaaagcgttttgcaaaaa180 ctcagactgttttccaaagcagaagcactggagtccccagcagaagcgatgggcagtgtg240 cgaaccaaccgctacagcatcgtctcttcagaagaagacggtatgaagttggccaccatg300 gcagttgcaaatggctttgggaacgggaagagtaaagtccacacccgacaacagtgcagg360 agccgctttgtgaagaaagatggccactgtaatgttcagttcatcaatgtgggtgagaag420 gggcaacggtacctcgcagacatcttcaccacgtgtgtggacattcgctggcggtggatg480 ctggttatcttctgcctggctttcgtcctgtcatggctgttttttggctgtgtgttttgg540 ttgatagctctgctccatggggacctggatgcatccaaagagggcaaagcttgtgtgtcc600 gaggtcaacagcttcacggctgccttcctcttctccattgagacccagacaaccataggc660 tatggtttcagatgtgtcacggatgaatgcccaattgctgttttcatggtggtgttccag720 tcaatcgtgggctgcatcatcgatgctttcatcattggcgcagtcatggccaagatggca780 aagccaaagaagagaaacgagactcttgtcttcagtcacaatgccgtgattgccatgaga840 gacggcaagctgtgtttgatgtggcgagtgggcaatcttcggaaaagccacttggtggaa900 gctcatgttcgagcacagctcctcaaatccagaattacttctgaaggggagtatatccct960 ctggatcaaatagacatcaatgttgggtttgacagtggaatcgatcgtatatttctggtg1020 tccccaatcactatagtccatgaaatagatgaagacagtcctttatatgatttgagtaaa1080 caggacattgacaacgcagactttgaaatcgtggtcatactggaaggcatggtggaagcc1140 actgccatgacgacacagtgccgtagctcttatctagcaaatgaaatcctgtggggccac1200 cgctatgagc ctgtgctctt tgaagagaag cactactaca aagtggacta ttccaggttc 1260 cacaaaactt acgaagtccc caacactccc ctttgtagtg ccagagactt agcagaaaag 1320 aaatatatcc tctcaaatgc aaattcattt tgctatgaaa atgaagttgc cctcacaagc 1380 aaagaggaag acgacagtga aaatggagtt ccagaaagca ctagtacgga cacgccccct 1440 gacatagacc ttcacaacca ggcaagtgta cctctagagc ccaggccctt acggcgagag 1500 tcggagatat gactgactga ttccttctct ggaatagtta ctttacaaca cggtctgttg 1560 gtcagaggcc caaaacagtt atacagatga cggtactggt caagatgggt caagcaagcg 1620 gccacaaggg actgaggcaa gcacaatggt ttcaaagaaa gactgtaagc tccatgatta 1680 gcataaagca ctaaccatgt ctccatgtga cccgatggca catagatgtt gtagaataag 1740 ttatgggttt ttatgttttg ttttgtgttt ttccaaaact tgaacttgca ggcaagcctt 1800 ggttgggtat ttgatttatc cagaatgctt ctctttaggg aacaaggatg tttttaatgg 1860 cataacaaag gcaagactct gccttaattt ttgaaaagct gctaactaca tgaacacaaa 1920 tgtgtatttt tgttgcagtg tagttttcct tttgtgtaat tttaaagtca gtgttgaatt 1980 ttattgaaag ctcatgatgc gcttcaaagt ggcaagtatt tggctattaa ctgccaaaac 2040 aagagcctga ttttttgagg ccagtaattc gtttgctaga attgattttt tttctctctc 2100 tctttgttac ataagggcat tatgtaacac tagccgaatg gtagcctctg ggttgttgtt 2160 tttttctttt cctccatgat gttaatgggt tatctcaaat tttaagttaa actacctaaa 2220 ataaatacca aagataatgc atatttttgc acagtggagc ttacacttaa aagaaaacaa 2280 agccccatgg gctgccttga aatcaagaga caataacttt gaacctcagc aagaccttga 2340 accgccggtt cattttgcac cttattcaga aaatagagca tcatactcac cgagtctagt 2400 cagtgtagtg cttttaaaaa ttttgtcctt tcatgtaact tttttatttt aagaggaaga 2460 agaagaaagg ggcacacaca cacaataccg acgtctatcc tttcctgcta ggcagtgctg 2520 gccaggctca tgtgtagtgt gcgagatggt gatgtactct tatatttttc tgggcttttc 2580 cttttgcaca ttccaaaatt catttcataa gacaagatct tcataggacc tccttggcat 2640 cctggcattc tcaaaactga gccatccagc atgaaagata aatgggttta aacccttgct 2700 gctgaattta ttgcctggac tgtcaggaca tcaccagccc accttcacct tagggaagat 2760 gccacacctg gcctccacac ttgctcttct gatcagtctg tctggattga gtcctacagt 2820 gtcagatagg gcggcaaatg ccaaagcagg gaaacaggga ggtgtggaca agccagtttg 2880 atgcagcact tcagatcaag tgcttaggaa ggagaggaaa cttgcctttt ttatggcaga 2940 ggatagtaat gaaaatgtct cagtatttta gggtcaatga gagccataaa aatataacat 3000 aatcacaagt aaaggagata atggtctaaa acagctattt cccttttctg tgtgcatact 3060 tatgactgaa tgtgagctaa gcattttctc ctgtggagcc ctagagcagg ttactaagga 3120 aggacacatt gttttccaga agcctcccct gcctggctga ctgccttgct agaaacataa 3180 tttttttttt ctcactgaag ctcaataatg gaactctttt tttttttttt tttaatttaa 3240 agttccctat ttgtgaattc tgggattact gacttttctt tttaattgga gtctcaaaat 3300 caactctctt atggtattat atctctgtat gccattaaaa aacagcttgt tctagaatca 3360 tgtattttgt aaactgatgt ttgtgatggt ctctggttct tgaacagcca tatctgaatg 3420 ccgtgcctgc aaaactatga caatttttgc tgttttcagc cttcagattt gatggcttgg 3480 gaaactgagg tgttattttc aatgaaacaa agaaagagat gttaagcaag tggttgtttt 3540 agatccaaat gtaaaggcag gtttgggaag gtgtttaaag agttggagga attggggatt 3600 gagttgtaaa gaaaacttac agaagaggca acaatttggt tcttgacagt gagaggatat 3660 tgagggcttc agctgctgct attatgatgt tttgcaaagg aaaataatca aaccaaagag 3720 tattcagtga tatgtaaatt aaatgaagat acagtggaga atgggggtga ccacaaaaga 3780 ggctccccct aaacacacag tgctgccact taaaaagact tgagaaattt gaaagggggt 3840 gggtatgggg ggggcaagaa agagggaggg aaatctttca acttatttct gaaaaagaga 3900 aaaaaatata aaatttctgg tgcacaggtt tgttttttca agaaaatttt gcagaagcta 3960 tgtttttaaa gtgtacattt tataaagttt atcagatatt ttcatattta aagccaaatg 4020 taaatagagg tctgtaaaga aaaataattg ccatagaaag tataatttca gtgcagtaat 4080 ttctgagagc tagtacctat atgctaccgg ttagcatggt tttagcaaat atataccagc 4140 cttataaggt tcgtattgct atgttcttct gttatttatt tcagcatgga ctgttcattt 4200 gaaacctttt tctagttatt agcgttttaa cagttacaag ctttaaatgg caattttttt 4260 tttttttttt tttttttttt tttttttgtc aagagccaag acacaggtaa tgcacgacat 4320 tgattgctgc attttacctt caaaatattt gtccttattg actgggtctc cttaattaat 4380 gtacacatgt cattagaatg cagacggagg ggactcacca tgaatatctg gggttgattc 4440 ccagatgtgt gttgcttctc tattgcaagc agattccctg ttggatttac ttcggattta 4500 ttccctttta aagaattttt gcccatatct ggaagggcac tatatttttg ggaggagcca 4560 tagattcctg gttatcctat ttttaaacaa aatgtagaca aagtgaactc tattttgatt 4620 attgagaaag gagtagtttt ctatccctct aagagtatac ttgaatcaga cattttaagg 4680 atgtcactat ggcactgttg tcatttccaa attcctagaa aagtttgttt tactttgttt 4740 ttattctgttaatgcattctttcttctctttacttcctttcttaccagtacactcctatc4800 tcaactctgtttatttgatgagttctgtcccgtaaatcatatttcccttacaattaataa4860 atgtcacttcatattttataataaaccactcagtaaaagcaaaagcttgtcctgagaagt4920 agagtgagttctttttcactctgtgtctaataatgttaaggtgggaaaaaaaaaagtgtg4980 gcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttctggtaatttt5040 gggtttccgctctgggctctggcaagttgaacaatcctagccattgacaatcgtgatagt5100 tattattttcccatttgctgtctttttgtatctaaagtcttcctattgtactgcacaaac5160 catggattgtacatatttttatatattatgtcttattttattatttctaaataaaaaaat5220 taaaaattgaaaacaaattcttg 5243 <210> 18 <211> 427 <212> PRT
<213> Homo Sapiens <400> 18 Met Gly Ser Val Arg Thr Asn Arg Tyr Ser Ile Val Ser Ser Glu Glu Asp Gly Met Lys Leu Ala Thr Met Ala Val Ala Asn Gly Phe Gly Asn Gly Lys Ser Lys Val His Thr Arg Gln Gln Cys Arg Ser Arg Phe Val Lys Lys Asp Gly His Cys Asn Val Gln Phe Ile Asn Val Gly Glu Lys Gly Gln Arg Tyr Leu Ala Asp Ile Phe Thr Thr Cys Val Asp Ile Arg Trp Arg Trp Met Leu Val I1e Phe Cys Leu Ala Phe Val Leu Ser Trp Leu Phe Phe Gly Cys Val Phe Trp Leu Ile Ala Leu Leu His Gly Asp Leu Asp Ala Ser Lys Glu Gly Lys Ala Cys Val Ser Glu Val Asn Ser Phe Thr Ala Ala Phe Leu Phe Ser Ile Glu Thr Gln Thr Thr Ile Gly Tyr Gly Phe Arg Cys Val Thr Asp Glu Cys Pro Ile Ala Val Phe Met Val Val Phe Gln Ser Ile Val Gly Cys Ile Ile Asp Ala Phe Ile Ile Gly Ala Val Met Ala Lys Met Ala Lys Pro Lys Lys Arg Asn Glu Thr Leu Val Phe Ser His Asn Ala Val Ile Ala Met Arg Asp Gly Lys Leu Cys Leu Met Trp Arg Val Gly Asn Leu Arg Lys Ser His Leu Val Glu Ala His Val Arg Ala Gln Leu Leu Lys Ser Arg Ile Thr Ser Glu Gly Glu Tyr Ile Pro Leu Asp Gln Ile Asp Ile Asn Val Gly Phe Asp Ser Gly Ile Asp Arg Ile Phe Leu Val Ser Pro Ile Thr Ile Val His Glu Ile Asp Glu Asp Ser Pro Leu Tyr Asp Leu Ser Lys Gln Asp Ile Asp Asn Ala Asp Phe Glu Ile Val Val Ile Leu Glu Gly Met Val Glu Ala Thr Ala Met Thr Thr Gln Cys Arg Ser Ser Tyr Leu Ala Asn Glu Ile Leu Trp Gly His Arg Tyr Glu Pro Val Leu Phe Glu Glu Lys His Tyr Tyr Lys Val Asp Tyr Ser Arg Phe His Lys Thr Tyr Glu Val Pro Asn Thr Pro Leu Cys Ser Ala Arg Asp Leu Ala Glu Lys Lys Tyr Ile Leu Ser Asn Ala Asn Ser Phe Cys Tyr Glu Asn Glu Val Ala Leu Thr Ser Lys Glu Glu Asp Asp Ser Glu Asn Gly Val Pro Glu Ser Thr Ser Thr Asp Thr Pro Pro Asp Ile Asp Leu His Asn Gln Ala Ser Val Pro Leu Glu Pro Arg Pro Leu Arg Arg Glu Ser Glu Ile <210> 19 <211> 1050 <212> DNA
<213> Homo Sapiens <400>
tttatattttttcagtgtccatatttcaaaaatttatttatctcaaactgtgcataatgg60 agtaaaaacttaagttgaaaatgtacctgttataaggatgatattagttcaaatatatac120 atggattctcggcagactgattcaaataatacagagccgaatcttttaaaatacaactac180 ggaaaataaaggggggaaaaccttaaaatatcacaataaatttacagaaatattacaaac240 cataagaaaatatttcaaacacagtaatttcatggttttttttatctgaacaaaatggaa300 agttgggatcgaacaaaagctattataaattaccaacggtgtcaacctgcatggccattt360 ttgcttttaacagtaagttataaaatttagtacagtctaaaacttttgccctttttaaac420 aagaccacagagatggttcgccagtacttattctaattttttccttttgtacaattttta480 aacaattaaaatgtccaaatttgaataattttcttcttttcacgtttgcaactgtcctaa540 atttcagctgcagaatcaaaattcagcaagaagcctctccttgaaaaatattggcaaatt600 ctcagcttataaacaatggacattttgattgccatgtttatctcgataaatactgtacaa660 aagttgcttgcaaatattaaaacatttttttcgtcgcttggagactagctctaaatatta720 ttggtaaagacttttgcaaacttcctgcaaagctcctaccgtaccactagaacttttaaa780 aagtttttcgtagctttctttcctccagatctatacaaggtccattcccccgccctcccc840 accctcccca ggttttctct gtacaaaaat agtcccccaa aaagaagtcc aggatctctc 900 tcataaaagt tttcttgtcg gcatcgcggt ttttgcgtga gtgtggatgg gattggtgtt 960 ctcttttgca gctgtcattt gctgtgggtg atgggatttt tttttttcct ttttcttttt 1020 gagcgtaccg ggttttctcc atgctgtttc 1050 <210> 20 <211> 88 <212> PRT
<213> Homo Sapiens <400> 20 Met Glu Lys Thr Arg Tyr Ala Gln Lys Glu Lys Gly Lys Lys Lys Ile Pro Ser Pro Thr Ala Asn Asp Ser Cys Lys Arg Glu His Gln Ser His Pro His Ser Arg Lys Asn Arg Asp Ala Asp Lys Lys Thr Phe Met Arg Glu Ile Leu Asp Phe Phe Leu Gly Asp Tyr Phe Cys Thr Glu Lys Thr Trp Gly Gly Trp Gly Gly Arg Gly Asn Gly Pro Cys Ile Asp Leu Glu Glu Arg Lys Leu Arg Lys Thr Phe <210> 21 <211> 881 <212> DNA
<213> Homo Sapiens <400>
ttttttttttttgtcaagagccaagacacaggtaatgcacgacattgattgctgcatttt 60 accttcaaaatatttgtccttattgactgggtctccttaattaatgtacacatgtcatta 120 gaatgcagacggaggggactcaccatgaatattctgggttgattcccagatgtgtgttgc 180 ttctctattgcaagcagattccctgttggatttacttcggatttattcccttttaaagaa 240 tttttgcccatatctggaagggcactatatttttgggaggagccatagattcctggttat 300 cctatttttaaacaaaatgtagacaaagtgaactctattttgattattgagaaaggagta 360 gttttctatccctctaagagtatacttgaatcagacattttaaggatgtcactatggcac 420 tgttgtcatttccaaattcctagaaaagtttgttttactttgtttttattctgttaatgc 480 attctttcttctctttacttcctttcttaccagtacactcctatctcaactctgtttatt 540 tgatgagttctgtcccgtaaatcatatttcccttacaattaataaatgtcacttcatatt 600 ttataataaaccactcagtaaaagcaaaagcttgtcctgagaagtactctgtgtctaata 660 atgttaagggcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttct 720 ggtaattttgggtttccgctctgggotctggcaagttgaacaatcctagccattgacaat 780 cgtgatagttattattttcccatttgctgtctttttgtatctaaagtcttcctattgtac 840 tgcacaaaccatggattgtacatatttttatatattatgtc 881
<212>
DNA
<213> sapiens Homo <400>
ggccgcttcgggtttccggaggggccggagggcgggcgagggcgtcacgtgcgcgccgcc 60 cgcgggccggttggtccccgggcgggggaggggccgtgcgcagcctgggtcggggtcggg 120 ccggggtcggcacctgggacatccctgagggaagggccgggagcgggagcgccccagcgg 180 ccggcgggcgggcgggcgagcggacgagcggcgcggagccggcccgaggcgcgcgccgag 240 ggagccccgtccccggtcgtgggggcaccgcccgcaggctctgcggggtgggcagctccc 300 gggcctgccatgagctctccgccgcccgcccgcagtggcttttaccgccaggaggtgacc 360 aagacggcctgggaggtgcgcgccgtgtaccgggacctgcagcccgtgggctcgggcgcc 420 tacggcgcggtgtgctcggccgtggacggccgcaccggcgctaaggtggccatcaagaag 480 ctgtatcggcccttccagtccgagctgttcgccaagcgcgcctaccgcgagctgcgcctg 540 ctcaagcacatgcgccacgagaacgtgatcgggctgctggacgtattcactcctgatgag 600 accctggatgacttcacggacttttacctggtgatgccgttcatgggcaccgacctgggc660 aagctcatgaaacatgagaagctaggcgaggaccggatccagttcctcgtgtaccagatg720 ctgaaggggctgaggtatatccacgctgccggcatcatccacagagacctgaagcccggc780 aacctggctgtgaacgaagactgtgagctgaagatcctggacttcggcctggccaggcag840 gcagacagtgagatgactgggtacgtggtgacccggtggtaccgggctcccgaggtcatc900 ttgaattggatgcgctacacgcagacggtggacatctggtccgtgggctgcatcatggcg960 gagatgatcacaggcaagacgctgttcaagggcagcgaccacctggaccagctgaaggag1020 atcatgaaggtgacggggacgcctccggctgagtttgtgcagcggctgcagagcgatgag1080 gccaagaacaacatgaagggcctccccgaattggagaagaaggattttgcctctatcctg1140 accaatgcaagccctctggctgtgaacctcctggagaagatgctggtgctggacgcggag1200 cagcgggtgacggcaggcgaggcgctggcccatccctacttcgagtccctgcacgacacg2260 gaagatgagccccaggtccagaagtatgatgactcctttgacgacgttgaccgcacactg1320 gatgaatggaagcgtgttacttacaaagaggtgctcagcttcaagcctccccggcagctg1380 ggggccagggtctccaaggagacgcctctgtgaagatctctgggctccggggtggcagtg1440 aggaccaccttcacctt 1457 <210> 16 <211> 367 <212> PRT
<213> Homo sapiens <400> 16 Met Ser Ser Pro Pro Pro Ala Arg Ser Gly Phe Tyr Arg Gln Glu Val Thr Lys Thr Ala Trp Glu Val Arg Ala Val Tyr Arg Asp Leu Gln Pro Val Gly Ser Gly Ala Tyr Gly Ala Val Cys Ser Ala Val Asp Gly Arg Thr Gly Ala Lys Val Ala Ile Lys Lys Leu Tyr Arg Pro Phe Gln Ser Glu Leu Phe Ala Lys Arg Ala Tyr Arg Glu Leu Arg Leu Leu Lys His Met Arg His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Asp Glu Thr Leu Asp Asp Phe Thr Asp Phe Tyr Leu Val Met Pro Phe Met Gly Thr Asp Leu Gly Lys Leu Met Lys His Glu Lys Leu Gly Glu Asp Arg Ile Gln Phe Leu Val Tyr Gln Met Leu Lys Gly Leu Arg Tyr Ile His Ala Ala Gly Ile Ile His Arg Asp Leu Lys Pro Gly Asn Leu Ala Va1 Asn Glu Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg Gln Ala Asp Ser Glu Met Thr Gly Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Val Ile Leu Asn Trp Met Arg Tyr Thr Gln Thr Val Asp Ile Trp Ser Val Gly Cys Ile Met Ala Glu Met Ile Thr Gly Lys Thr Leu Phe Lys Gly Ser Asp His Leu Asp Gln Leu Lys Glu Ile Met Lys Val Thr Gly Thr Pro Pro Ala G1u Phe Val Gln Arg Leu Gln Ser Asp Glu Ala Lys Asn Asn Met Lys Gly Leu Pro Glu Leu G1u Lys Lys Asp Phe Ala Ser Ile Leu Thr Asn A1a Ser Pro Leu Ala Val Asn Leu Leu Glu Lys Met Leu Val Leu Asp Ala Glu Gln Arg Val Thr Ala Gly Glu Ala Leu Ala His Pro Tyr Phe Glu Ser Leu His Asp Thr Glu Asp Glu Pro Gln Val Gln Lys Tyr Asp Asp Ser Phe Asp Asp Val Asp Arg Thr Leu Asp Glu Trp Lys Arg Va1 Thr Tyr Lys Glu Val Leu Ser Phe Lys Pro Pro Arg Gln Leu G1y Ala Arg Val Ser Lys Glu Thr Pro Leu <210> 17 <211> 5243 <212> DNA
<213> Homo Sapiens <400>
cttttcttgcaggacatgttctctggatgtcagctgagtcattaaagtaactctgcatgt60 cagtagacagaccttggtagaaccacaaggctcccagagacacccatctctcctcatttt120 tttggtgtgtgtgtcttcaccgaacattcaaaactgtttctccaaagcgttttgcaaaaa180 ctcagactgttttccaaagcagaagcactggagtccccagcagaagcgatgggcagtgtg240 cgaaccaaccgctacagcatcgtctcttcagaagaagacggtatgaagttggccaccatg300 gcagttgcaaatggctttgggaacgggaagagtaaagtccacacccgacaacagtgcagg360 agccgctttgtgaagaaagatggccactgtaatgttcagttcatcaatgtgggtgagaag420 gggcaacggtacctcgcagacatcttcaccacgtgtgtggacattcgctggcggtggatg480 ctggttatcttctgcctggctttcgtcctgtcatggctgttttttggctgtgtgttttgg540 ttgatagctctgctccatggggacctggatgcatccaaagagggcaaagcttgtgtgtcc600 gaggtcaacagcttcacggctgccttcctcttctccattgagacccagacaaccataggc660 tatggtttcagatgtgtcacggatgaatgcccaattgctgttttcatggtggtgttccag720 tcaatcgtgggctgcatcatcgatgctttcatcattggcgcagtcatggccaagatggca780 aagccaaagaagagaaacgagactcttgtcttcagtcacaatgccgtgattgccatgaga840 gacggcaagctgtgtttgatgtggcgagtgggcaatcttcggaaaagccacttggtggaa900 gctcatgttcgagcacagctcctcaaatccagaattacttctgaaggggagtatatccct960 ctggatcaaatagacatcaatgttgggtttgacagtggaatcgatcgtatatttctggtg1020 tccccaatcactatagtccatgaaatagatgaagacagtcctttatatgatttgagtaaa1080 caggacattgacaacgcagactttgaaatcgtggtcatactggaaggcatggtggaagcc1140 actgccatgacgacacagtgccgtagctcttatctagcaaatgaaatcctgtggggccac1200 cgctatgagc ctgtgctctt tgaagagaag cactactaca aagtggacta ttccaggttc 1260 cacaaaactt acgaagtccc caacactccc ctttgtagtg ccagagactt agcagaaaag 1320 aaatatatcc tctcaaatgc aaattcattt tgctatgaaa atgaagttgc cctcacaagc 1380 aaagaggaag acgacagtga aaatggagtt ccagaaagca ctagtacgga cacgccccct 1440 gacatagacc ttcacaacca ggcaagtgta cctctagagc ccaggccctt acggcgagag 1500 tcggagatat gactgactga ttccttctct ggaatagtta ctttacaaca cggtctgttg 1560 gtcagaggcc caaaacagtt atacagatga cggtactggt caagatgggt caagcaagcg 1620 gccacaaggg actgaggcaa gcacaatggt ttcaaagaaa gactgtaagc tccatgatta 1680 gcataaagca ctaaccatgt ctccatgtga cccgatggca catagatgtt gtagaataag 1740 ttatgggttt ttatgttttg ttttgtgttt ttccaaaact tgaacttgca ggcaagcctt 1800 ggttgggtat ttgatttatc cagaatgctt ctctttaggg aacaaggatg tttttaatgg 1860 cataacaaag gcaagactct gccttaattt ttgaaaagct gctaactaca tgaacacaaa 1920 tgtgtatttt tgttgcagtg tagttttcct tttgtgtaat tttaaagtca gtgttgaatt 1980 ttattgaaag ctcatgatgc gcttcaaagt ggcaagtatt tggctattaa ctgccaaaac 2040 aagagcctga ttttttgagg ccagtaattc gtttgctaga attgattttt tttctctctc 2100 tctttgttac ataagggcat tatgtaacac tagccgaatg gtagcctctg ggttgttgtt 2160 tttttctttt cctccatgat gttaatgggt tatctcaaat tttaagttaa actacctaaa 2220 ataaatacca aagataatgc atatttttgc acagtggagc ttacacttaa aagaaaacaa 2280 agccccatgg gctgccttga aatcaagaga caataacttt gaacctcagc aagaccttga 2340 accgccggtt cattttgcac cttattcaga aaatagagca tcatactcac cgagtctagt 2400 cagtgtagtg cttttaaaaa ttttgtcctt tcatgtaact tttttatttt aagaggaaga 2460 agaagaaagg ggcacacaca cacaataccg acgtctatcc tttcctgcta ggcagtgctg 2520 gccaggctca tgtgtagtgt gcgagatggt gatgtactct tatatttttc tgggcttttc 2580 cttttgcaca ttccaaaatt catttcataa gacaagatct tcataggacc tccttggcat 2640 cctggcattc tcaaaactga gccatccagc atgaaagata aatgggttta aacccttgct 2700 gctgaattta ttgcctggac tgtcaggaca tcaccagccc accttcacct tagggaagat 2760 gccacacctg gcctccacac ttgctcttct gatcagtctg tctggattga gtcctacagt 2820 gtcagatagg gcggcaaatg ccaaagcagg gaaacaggga ggtgtggaca agccagtttg 2880 atgcagcact tcagatcaag tgcttaggaa ggagaggaaa cttgcctttt ttatggcaga 2940 ggatagtaat gaaaatgtct cagtatttta gggtcaatga gagccataaa aatataacat 3000 aatcacaagt aaaggagata atggtctaaa acagctattt cccttttctg tgtgcatact 3060 tatgactgaa tgtgagctaa gcattttctc ctgtggagcc ctagagcagg ttactaagga 3120 aggacacatt gttttccaga agcctcccct gcctggctga ctgccttgct agaaacataa 3180 tttttttttt ctcactgaag ctcaataatg gaactctttt tttttttttt tttaatttaa 3240 agttccctat ttgtgaattc tgggattact gacttttctt tttaattgga gtctcaaaat 3300 caactctctt atggtattat atctctgtat gccattaaaa aacagcttgt tctagaatca 3360 tgtattttgt aaactgatgt ttgtgatggt ctctggttct tgaacagcca tatctgaatg 3420 ccgtgcctgc aaaactatga caatttttgc tgttttcagc cttcagattt gatggcttgg 3480 gaaactgagg tgttattttc aatgaaacaa agaaagagat gttaagcaag tggttgtttt 3540 agatccaaat gtaaaggcag gtttgggaag gtgtttaaag agttggagga attggggatt 3600 gagttgtaaa gaaaacttac agaagaggca acaatttggt tcttgacagt gagaggatat 3660 tgagggcttc agctgctgct attatgatgt tttgcaaagg aaaataatca aaccaaagag 3720 tattcagtga tatgtaaatt aaatgaagat acagtggaga atgggggtga ccacaaaaga 3780 ggctccccct aaacacacag tgctgccact taaaaagact tgagaaattt gaaagggggt 3840 gggtatgggg ggggcaagaa agagggaggg aaatctttca acttatttct gaaaaagaga 3900 aaaaaatata aaatttctgg tgcacaggtt tgttttttca agaaaatttt gcagaagcta 3960 tgtttttaaa gtgtacattt tataaagttt atcagatatt ttcatattta aagccaaatg 4020 taaatagagg tctgtaaaga aaaataattg ccatagaaag tataatttca gtgcagtaat 4080 ttctgagagc tagtacctat atgctaccgg ttagcatggt tttagcaaat atataccagc 4140 cttataaggt tcgtattgct atgttcttct gttatttatt tcagcatgga ctgttcattt 4200 gaaacctttt tctagttatt agcgttttaa cagttacaag ctttaaatgg caattttttt 4260 tttttttttt tttttttttt tttttttgtc aagagccaag acacaggtaa tgcacgacat 4320 tgattgctgc attttacctt caaaatattt gtccttattg actgggtctc cttaattaat 4380 gtacacatgt cattagaatg cagacggagg ggactcacca tgaatatctg gggttgattc 4440 ccagatgtgt gttgcttctc tattgcaagc agattccctg ttggatttac ttcggattta 4500 ttccctttta aagaattttt gcccatatct ggaagggcac tatatttttg ggaggagcca 4560 tagattcctg gttatcctat ttttaaacaa aatgtagaca aagtgaactc tattttgatt 4620 attgagaaag gagtagtttt ctatccctct aagagtatac ttgaatcaga cattttaagg 4680 atgtcactat ggcactgttg tcatttccaa attcctagaa aagtttgttt tactttgttt 4740 ttattctgttaatgcattctttcttctctttacttcctttcttaccagtacactcctatc4800 tcaactctgtttatttgatgagttctgtcccgtaaatcatatttcccttacaattaataa4860 atgtcacttcatattttataataaaccactcagtaaaagcaaaagcttgtcctgagaagt4920 agagtgagttctttttcactctgtgtctaataatgttaaggtgggaaaaaaaaaagtgtg4980 gcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttctggtaatttt5040 gggtttccgctctgggctctggcaagttgaacaatcctagccattgacaatcgtgatagt5100 tattattttcccatttgctgtctttttgtatctaaagtcttcctattgtactgcacaaac5160 catggattgtacatatttttatatattatgtcttattttattatttctaaataaaaaaat5220 taaaaattgaaaacaaattcttg 5243 <210> 18 <211> 427 <212> PRT
<213> Homo Sapiens <400> 18 Met Gly Ser Val Arg Thr Asn Arg Tyr Ser Ile Val Ser Ser Glu Glu Asp Gly Met Lys Leu Ala Thr Met Ala Val Ala Asn Gly Phe Gly Asn Gly Lys Ser Lys Val His Thr Arg Gln Gln Cys Arg Ser Arg Phe Val Lys Lys Asp Gly His Cys Asn Val Gln Phe Ile Asn Val Gly Glu Lys Gly Gln Arg Tyr Leu Ala Asp Ile Phe Thr Thr Cys Val Asp Ile Arg Trp Arg Trp Met Leu Val I1e Phe Cys Leu Ala Phe Val Leu Ser Trp Leu Phe Phe Gly Cys Val Phe Trp Leu Ile Ala Leu Leu His Gly Asp Leu Asp Ala Ser Lys Glu Gly Lys Ala Cys Val Ser Glu Val Asn Ser Phe Thr Ala Ala Phe Leu Phe Ser Ile Glu Thr Gln Thr Thr Ile Gly Tyr Gly Phe Arg Cys Val Thr Asp Glu Cys Pro Ile Ala Val Phe Met Val Val Phe Gln Ser Ile Val Gly Cys Ile Ile Asp Ala Phe Ile Ile Gly Ala Val Met Ala Lys Met Ala Lys Pro Lys Lys Arg Asn Glu Thr Leu Val Phe Ser His Asn Ala Val Ile Ala Met Arg Asp Gly Lys Leu Cys Leu Met Trp Arg Val Gly Asn Leu Arg Lys Ser His Leu Val Glu Ala His Val Arg Ala Gln Leu Leu Lys Ser Arg Ile Thr Ser Glu Gly Glu Tyr Ile Pro Leu Asp Gln Ile Asp Ile Asn Val Gly Phe Asp Ser Gly Ile Asp Arg Ile Phe Leu Val Ser Pro Ile Thr Ile Val His Glu Ile Asp Glu Asp Ser Pro Leu Tyr Asp Leu Ser Lys Gln Asp Ile Asp Asn Ala Asp Phe Glu Ile Val Val Ile Leu Glu Gly Met Val Glu Ala Thr Ala Met Thr Thr Gln Cys Arg Ser Ser Tyr Leu Ala Asn Glu Ile Leu Trp Gly His Arg Tyr Glu Pro Val Leu Phe Glu Glu Lys His Tyr Tyr Lys Val Asp Tyr Ser Arg Phe His Lys Thr Tyr Glu Val Pro Asn Thr Pro Leu Cys Ser Ala Arg Asp Leu Ala Glu Lys Lys Tyr Ile Leu Ser Asn Ala Asn Ser Phe Cys Tyr Glu Asn Glu Val Ala Leu Thr Ser Lys Glu Glu Asp Asp Ser Glu Asn Gly Val Pro Glu Ser Thr Ser Thr Asp Thr Pro Pro Asp Ile Asp Leu His Asn Gln Ala Ser Val Pro Leu Glu Pro Arg Pro Leu Arg Arg Glu Ser Glu Ile <210> 19 <211> 1050 <212> DNA
<213> Homo Sapiens <400>
tttatattttttcagtgtccatatttcaaaaatttatttatctcaaactgtgcataatgg60 agtaaaaacttaagttgaaaatgtacctgttataaggatgatattagttcaaatatatac120 atggattctcggcagactgattcaaataatacagagccgaatcttttaaaatacaactac180 ggaaaataaaggggggaaaaccttaaaatatcacaataaatttacagaaatattacaaac240 cataagaaaatatttcaaacacagtaatttcatggttttttttatctgaacaaaatggaa300 agttgggatcgaacaaaagctattataaattaccaacggtgtcaacctgcatggccattt360 ttgcttttaacagtaagttataaaatttagtacagtctaaaacttttgccctttttaaac420 aagaccacagagatggttcgccagtacttattctaattttttccttttgtacaattttta480 aacaattaaaatgtccaaatttgaataattttcttcttttcacgtttgcaactgtcctaa540 atttcagctgcagaatcaaaattcagcaagaagcctctccttgaaaaatattggcaaatt600 ctcagcttataaacaatggacattttgattgccatgtttatctcgataaatactgtacaa660 aagttgcttgcaaatattaaaacatttttttcgtcgcttggagactagctctaaatatta720 ttggtaaagacttttgcaaacttcctgcaaagctcctaccgtaccactagaacttttaaa780 aagtttttcgtagctttctttcctccagatctatacaaggtccattcccccgccctcccc840 accctcccca ggttttctct gtacaaaaat agtcccccaa aaagaagtcc aggatctctc 900 tcataaaagt tttcttgtcg gcatcgcggt ttttgcgtga gtgtggatgg gattggtgtt 960 ctcttttgca gctgtcattt gctgtgggtg atgggatttt tttttttcct ttttcttttt 1020 gagcgtaccg ggttttctcc atgctgtttc 1050 <210> 20 <211> 88 <212> PRT
<213> Homo Sapiens <400> 20 Met Glu Lys Thr Arg Tyr Ala Gln Lys Glu Lys Gly Lys Lys Lys Ile Pro Ser Pro Thr Ala Asn Asp Ser Cys Lys Arg Glu His Gln Ser His Pro His Ser Arg Lys Asn Arg Asp Ala Asp Lys Lys Thr Phe Met Arg Glu Ile Leu Asp Phe Phe Leu Gly Asp Tyr Phe Cys Thr Glu Lys Thr Trp Gly Gly Trp Gly Gly Arg Gly Asn Gly Pro Cys Ile Asp Leu Glu Glu Arg Lys Leu Arg Lys Thr Phe <210> 21 <211> 881 <212> DNA
<213> Homo Sapiens <400>
ttttttttttttgtcaagagccaagacacaggtaatgcacgacattgattgctgcatttt 60 accttcaaaatatttgtccttattgactgggtctccttaattaatgtacacatgtcatta 120 gaatgcagacggaggggactcaccatgaatattctgggttgattcccagatgtgtgttgc 180 ttctctattgcaagcagattccctgttggatttacttcggatttattcccttttaaagaa 240 tttttgcccatatctggaagggcactatatttttgggaggagccatagattcctggttat 300 cctatttttaaacaaaatgtagacaaagtgaactctattttgattattgagaaaggagta 360 gttttctatccctctaagagtatacttgaatcagacattttaaggatgtcactatggcac 420 tgttgtcatttccaaattcctagaaaagtttgttttactttgtttttattctgttaatgc 480 attctttcttctctttacttcctttcttaccagtacactcctatctcaactctgtttatt 540 tgatgagttctgtcccgtaaatcatatttcccttacaattaataaatgtcacttcatatt 600 ttataataaaccactcagtaaaagcaaaagcttgtcctgagaagtactctgtgtctaata 660 atgttaagggcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttct 720 ggtaattttgggtttccgctctgggotctggcaagttgaacaatcctagccattgacaat 780 cgtgatagttattattttcccatttgctgtctttttgtatctaaagtcttcctattgtac 840 tgcacaaaccatggattgtacatatttttatatattatgtc 881
Claims (32)
1. A process for identifying an agent that modulates the activity of a cancer-related gene comprising:
(a) contacting a compound with a cell containing a gene that corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and under conditions promoting the expression of said gene; and (b) detecting a difference in expression of said gene relative to when said compound is not present thereby identifying an agent that modulates the activity of a cancer-related gene.
(a) contacting a compound with a cell containing a gene that corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and under conditions promoting the expression of said gene; and (b) detecting a difference in expression of said gene relative to when said compound is not present thereby identifying an agent that modulates the activity of a cancer-related gene.
2. The process of claim 1 wherein said gene has a sequence selected from the group consisting of SEQ ID NO: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
3. The process of claim 1 wherein the cell is a cancer cell and the difference in expression is a decrease in expression.
4. The process of claim 2 wherein the cell is a cancer cell and the difference in expression is a decrease in expression.
5. A process for identifying an anti-neoplastic agent comprising contacting a cell exhibiting neoplastic activity with a compound first identified as a cancer related gene modulator using a process of one of claims 1 - 4 and detecting a decrease in said neoplastic activity after said contacting compared to when said contacting does not occur.
6. The process of claim 5 wherein said neoplastic activity is accelerated cellular replication.
7. The process of claim 5 wherein said decrease in neoplastic activity results from the death of the cell.
8. A process for identifying an anti-neoplastic agent comprising administering to an animal exhibiting a cancer condition an effective amount of an agent first identified according to a process of one of claims 1-7 and detecting a decrease in said cancerous condition.
9. A process for determining the cancerous status of a cell, comprising determining an increase in the level of expression in said cell of at least one gene that corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 wherein an elevated expression relative to a known non-cancerous cell indicates a cancerous state or potentially cancerous state.
10. An antibody that reacts with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
11. The antibody of claim 10 wherein said antibody is a monoclonal antibody.
12. The antibody of claim 10 wherein said antibody is a recombinant antibody.
13. The antibody of claim 10 wherein said antibody is a synthetic antibody.
14. The antibody of claim 10 wherein said antibody further comprises a cytotoxic agent.
15. The antibody of claim 14 wherein said cytotoxic agent is an apoptotic agent.
16. A process for treating cancer comprising contacting a cancerous cell with an agent having activity against an expression product encoded by a gene sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
17. The process of claim 16 wherein said cancerous cell is contacted in vivo.
18. The process of claim 16 wherein said agent has affinity for said expression product.
19. The process of claim 18 wherein said agent is an antibody of claim -15.
20. An immunogenic composition comprising a polypeptide comprising an amino acid sequence with at least 90% identity to a sequence selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 and wherein and amino acid difference results only from conservative amino acid substitutions.
21. The immunogenic composition of claim 20 wherein said percent identity is at least 95%.
22. The immunogenic composition of claim 20 wherein said percent identity is at least 98%.
23. The immunogenic composition of claim 20 wherein said polypeptide has the sequence of a member selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
24. A process for treating cancer in an animal afflicted therewith comprising administering to said animal an amount of an immunogenic composition of claim 20-23 sufficient to elicit the production of cytotoxic T
lymphocytes specific for said immunogenic composition.
lymphocytes specific for said immunogenic composition.
25. The process of claim 24 wherein said animal is a human being.
26. A process for treating a cancerous condition in an animal afflicted therewith comprising administering to said animal a therapeutically effective amount of an agent first identified as having anti-neoplastic activity using the process of claim 8.
27. A process for protecting an animal against cancer comprising administering to an animal at risk of developing cancer a therapeutically effective amount of an agent first identified as having anti-neoplastic activity using the process of claim 8.
28. A method for producing a product comprising identifying an agent according to the process of claim 1 - 8 wherein said product is the data collected with respect to said agent as a result of said process and wherein said data is sufficient to convey the chemical structure and/or properties of said agent.
29. An isolated polynucleotide comprising a polynucleotide having at least 95% sequence identity to a member selected from the group consisting of SEQ ID NO: 3 or the complement thereof.
30. The isolated polynucleotide of claim 29 wherein said polynucleotide comprises the sequence of SEQ ID NO: 3.
31. An isolated polynucleotide comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide encoding the amino acid sequence of SEQ ID NO:
4, and (b) the complement of (a).
(a) a polynucleotide encoding the amino acid sequence of SEQ ID NO:
4, and (b) the complement of (a).
32. An isolated polynucleotide comprising an amino acid sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 4 and wherein any difference in sequence identity results only from conservative amino acid substitutions.
Applications Claiming Priority (21)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US23929400P | 2000-10-11 | 2000-10-11 | |
| US23960500P | 2000-10-11 | 2000-10-11 | |
| US23929700P | 2000-10-11 | 2000-10-11 | |
| US60/239,605 | 2000-10-11 | ||
| US60/239,297 | 2000-10-11 | ||
| US60/239,294 | 2000-10-11 | ||
| US23980500P | 2000-10-12 | 2000-10-12 | |
| US23980200P | 2000-10-12 | 2000-10-12 | |
| US23980600P | 2000-10-12 | 2000-10-12 | |
| US60/239,806 | 2000-10-12 | ||
| US60/239,802 | 2000-10-12 | ||
| US60/239,805 | 2000-10-12 | ||
| US24062200P | 2000-10-16 | 2000-10-16 | |
| US60/240,622 | 2000-10-16 | ||
| US24168200P | 2000-10-19 | 2000-10-19 | |
| US24172300P | 2000-10-19 | 2000-10-19 | |
| US60/241,723 | 2000-10-19 | ||
| US60/241,682 | 2000-10-19 | ||
| US24493200P | 2000-10-31 | 2000-10-31 | |
| US60/244,932 | 2000-10-31 | ||
| PCT/US2001/031607 WO2002031198A2 (en) | 2000-10-11 | 2001-10-11 | Cancer-linked genes as targets for chemotherapy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2425643A1 true CA2425643A1 (en) | 2002-04-18 |
Family
ID=27581180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2425643 Abandoned CA2425643A1 (en) | 2000-10-11 | 2001-10-11 | Cancer-linked genes as targets for chemotherapy |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1399584A2 (en) |
| JP (1) | JP2004533206A (en) |
| AU (1) | AU2002213084A1 (en) |
| CA (1) | CA2425643A1 (en) |
| WO (1) | WO2002031198A2 (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030215445A1 (en) | 1997-05-23 | 2003-11-20 | Ginette Serrero | Methods and compositions for inhibiting the growth of hematopoietic malignant cells |
| US7411045B2 (en) | 2002-11-19 | 2008-08-12 | A&G Pharmaceutical, Inc. | Autocrine growth factor receptor antibodies and methods |
| JP4488903B2 (en) | 2003-02-26 | 2010-06-23 | エイアンドジー ファーマスーティカル インコーポレイテッド | Method for increasing B cell proliferation |
| EP1660010B1 (en) | 2003-08-01 | 2013-07-24 | A & G Pharmaceutical, Inc. | Compositions and methods for restoring sensitivity to treatment with her2 antagonists |
| GB0328928D0 (en) * | 2003-12-12 | 2004-01-14 | Cancer Rec Tech Ltd | Materials and methods relating to cell cycle control |
| US20050186577A1 (en) | 2004-02-20 | 2005-08-25 | Yixin Wang | Breast cancer prognostics |
| US8673268B2 (en) | 2004-10-15 | 2014-03-18 | Galapagos N.V. | Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases |
| US7485468B2 (en) | 2004-10-15 | 2009-02-03 | Galapagos Bv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases |
| JP2010511382A (en) * | 2006-12-01 | 2010-04-15 | エージェンシー フォー サイエンス,テクノロジー アンド リサーチ | Cancer-related protein kinase |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5668267A (en) * | 1995-05-31 | 1997-09-16 | Washington University | Polynucleotides encoding mammaglobin, a mammary-specific breast cancer protein |
| AU2115197A (en) * | 1996-01-30 | 1997-08-22 | Melcorp Diagnostics, Inc. | Compositions and methods useful in the detection and/or treatment of cancerous conditions |
| US6007991A (en) * | 1997-03-28 | 1999-12-28 | The Research Foundation Of Suny | Antisense oligonucleotides for mitogen-activated protein kinases as therapy for cancer |
| JP2002519000A (en) * | 1998-01-28 | 2002-07-02 | カイロン コーポレイション | Human genes and gene expression products II |
| WO2001042467A2 (en) * | 1999-12-08 | 2001-06-14 | Millennium Pharmaceuticals, Inc. | Genes, compositions, kits, and methods for identification, assessment, prevention, and therapy of cervical cancer |
| WO2001060860A2 (en) * | 2000-02-17 | 2001-08-23 | Millennium Predictive Medicine, Inc. | Genes differentially expressed in human prostate cancer and their use |
-
2001
- 2001-10-11 JP JP2002534562A patent/JP2004533206A/en active Pending
- 2001-10-11 CA CA 2425643 patent/CA2425643A1/en not_active Abandoned
- 2001-10-11 AU AU2002213084A patent/AU2002213084A1/en not_active Abandoned
- 2001-10-11 EP EP20010981443 patent/EP1399584A2/en not_active Withdrawn
- 2001-10-11 WO PCT/US2001/031607 patent/WO2002031198A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| EP1399584A2 (en) | 2004-03-24 |
| JP2004533206A (en) | 2004-11-04 |
| WO2002031198A3 (en) | 2003-12-31 |
| WO2002031198A2 (en) | 2002-04-18 |
| AU2002213084A1 (en) | 2002-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20030235820A1 (en) | Novel methods of diagnosis of metastatic colorectal cancer, compositions and methods of screening for modulators of metastatic colorectal cancer | |
| JP2002533056A (en) | Compounds and methods for treatment and diagnosis of lung cancer | |
| JPH11505322A (en) | Diagnosis and treatment of cancer based on mutations in TGF-beta receptor | |
| JP2009519002A (en) | Novel therapeutic targets in cancer | |
| JP2006507794A (en) | Novel compositions and methods for cancer | |
| JP2014525586A (en) | Methods and compositions for the treatment and diagnosis of colorectal cancer | |
| JP2003111595A (en) | Tumor antigen | |
| KR100566839B1 (en) | Oncology compositions and methods | |
| CA2425643A1 (en) | Cancer-linked genes as targets for chemotherapy | |
| CN100564524C (en) | Novel transfer factor and use thereof | |
| US20040110712A1 (en) | Methods for treating patients and identifying therapeutics | |
| CN101768214A (en) | Human tumor marker-Tim17 polypeptide and application thereof | |
| JP2009225807A (en) | New composition and method in cancer associated with altered expression of prlr | |
| AU2008296927C1 (en) | Methods for diagnosing and treating cancers | |
| WO2004009836A2 (en) | Pr/set-domain containing nucleic acids, polypeptides, antibodies and methods of use | |
| KR20030090655A (en) | Polynucleotide Useful for Modulating Cancer Cell Proliferation | |
| US20040072192A1 (en) | Cancer-linked genes as targets for chemotherapy | |
| US7883896B2 (en) | Marker molecules associated with lung tumors | |
| KR102099684B1 (en) | Novel Biomarkers for Predicting Susceptibility to Anti-Cancer Drug and Uses Thereof | |
| KR101683961B1 (en) | Recurrence Marker for Diagnosis of Bladder Cancer | |
| JP2009195244A (en) | Novel composition and method in cancer associated with altered expression of mcm3ap | |
| KR100552496B1 (en) | NDRK2 gene expressing dendritic cells specifically and a method for detecting dendritic cells using the same | |
| JP2005527190A (en) | Nuclear protein "SHOCA"-a component of the WNT signaling pathway | |
| JP2005520561A (en) | Novel compositions and methods in cancer associated with altered expression of PRDM11 | |
| JP2003532417A (en) | F-box containing protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued |