KR102099684B1 - Novel Biomarkers for Predicting Susceptibility to Anti-Cancer Drug and Uses Thereof - Google Patents

Abstract

The present invention relates to a biomarker for predicting susceptibility to an anticancer agent, and more specifically, to predict susceptibility to an anticancer agent including a mutant of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10) Biomarker composition, a composition for predicting susceptibility to an anticancer agent comprising an agent for detecting a mutation of the MAP3K10 gene, kit for predicting susceptibility to an anticancer agent comprising the composition; And an information providing method for predicting susceptibility to anticancer drugs. According to the present invention, since the prediction and predictive effects of anti-cancer agents are excellent, the present invention can be usefully used to treat cancer.

Description

Biomarkers for Predicting Susceptibility to Anti-Cancer Drug and Uses Thereof

The present invention relates to biomarkers for predicting susceptibility to anticancer agents and uses thereof.

Stomach cancer is the number one incidence in Korea, and mortality is second only to lung cancer, but it is the lowest in the United States and Europe. Today, endoscopic mucosal resection with endoscopic resection of gastric cancer, laparoscopic laparoscopic gastrectomy using laparoscopic techniques, chemotherapy, and immunotherapy have been developed to increase the survival rate of patients by reducing the recurrence of gastric cancer.

However, since surgery is often applicable only to early stage cancer, most cancer patients are treated with chemotherapy, which helps to extend their survival and improve their quality of life.

Anti-cancer chemotherapy is divided into prior chemotherapy (if performed before surgery) and adjuvant chemotherapy (prevention of recurrence after surgery) .If this chemotherapy is used for a long period of time, it is possible to develop anti-cancer drug resistance. It is being reported. The process of obtaining resistance to anticancer drugs is divided into two. First, the anticancer drugs fail to reach cancer cells. In other words, it is the case that abnormality occurs in absorption, re-occurrence, and drug migration of anticancer drugs in the patient's body. The second is the genetic or epigenetic change of the cancer cell itself, which is the overgrowth of the drug-resistant cancer cell and the rapid acquisition of resistance.

At first, chemotherapy was effective, but due to long-term use of anticancer drugs, gene mutations gradually occurred, resulting in cell proliferation through other anomalous pathways, anti-cancer drug absorption and proliferation inside cells, recovery of damaged cancer cell DNA, and apoptosis. It is difficult to treat patients due to the occurrence of resistance, etc. At the same time, cancer cells are metastasized to other organs, and anti-cancer chemotherapy fails, which poses a risk to patients' lives. As an example, it was confirmed that patients with bladder cancer treated with Cisplatin did not respond to Cisplatin any more, resulting in gene mutations that activated p-AKT related to cell proliferation and apoptosis, resulting in increased cell proliferation but decreased apoptosis. It has been reported that the survival rate is reduced compared to those who did not undergo mutation. Studies on the genetic variation of cancer cells due to such anticancer drug resistance are ongoing, but have not been well established. Therefore, solving this problem is currently a major problem facing cancer treatment.

That is, in the anti-cancer therapy, in general, the reactivity of the living body when the anti-cancer agent is administered is largely dependent on the sensitivity of the target cancer cell to the drug. The sensitivity of these cancer cells to drugs is significantly different for each cancer cell. This difference in sensitivity is due to a quantitative or qualitative difference in the target molecule of the drug or its related factors, or the acquisition of drug resistance. Based on this background, if the genetic changes of cancer cells that are specific when the target cancer cells show sensitivity to the drug can be confirmed, the effect of the drug can be determined early, the establishment of a treatment method, the selection of a new treatment method, etc. It becomes possible and is very advantageous.

In addition, in cancer tissues obtained by a biological tissue piece or the like prior to treatment, cancer cells are separated according to a conventional method, and then drug treatment is performed. It is clinically useful because it can predict in advance whether a treatment is valid.

As described above, since the anticancer agent has a large individual difference in resistance and toxicity, and there is a problem in that it exhibits resistance in more than half of the same patients, screening using a suitable therapeutic response marker may lead to a breakthrough in the treatment of anticancer agents. Accordingly, research on the therapeutic reactivity of individual anticancer agents according to specific genes has been actively developed in recent years.

However, due to the complex action of bioreaction-related factors for specific drugs, the variety of therapeutic and administration methods, and the difficulty of obtaining a large amount of samples, remarkable results are still weak.

Under these circumstances, the present inventors made great efforts to develop a biomarker capable of predicting sensitivity to a specific anticancer agent. As a result, the mutation of MAP3K10 was analyzed as a biomarker predicting susceptibility in a group of patients with recurrence of gastric cancer. , The present invention was completed.

Accordingly, an object of the present invention is to provide a biomarker composition for predicting susceptibility to an anticancer agent, a composition for predicting susceptibility to an anticancer agent, a kit, and a method for providing information for predicting susceptibility to an anticancer agent.

Hereinafter, the present invention will be described in more detail.

According to an aspect of the present invention, the present invention provides a biomarker composition for predicting susceptibility to an anti-cancer agent including a mutant of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10).

The biggest feature of the present invention is the anti-cancer agent by confirming the presence of the biomarker in the obtained sample using a mutation of the MAP3K10 gene (GenBank numb. NM_002446.3) or protein (GenBank numb. NP_002437.2) as a biomarker. Is to predict susceptibility to.

As used herein, the term 'biomarker' may be defined as an 'indicator capable of objectively measuring and evaluating a drug's responsiveness to a normal biological process, disease progression, and treatment method'. With the recent development of genetic analysis technology, as research on the relationship between mutations of specific genes and specific diseases has increased, biomarkers are molecular and biological that encompass both genetic and genetic mutations, and the differences in RNA, protein, and metabolite expression. It is being redefined as an indicator.

The biomarker of the present invention can be an indicator of sensitivity to anticancer agents, and can be used for the treatment of the development, development and / or metastasis of cancer because of its excellent accuracy and reliability as a susceptibility marker for anticancer agents.

As used herein, the term "sensitivity" refers to whether a particular drug has an effect on the cancer of an individual patient.

For example, the specific drug is mainly an anti-cancer agent, and these anti-cancer agents may or may not exhibit effects depending on the type of cancer. In addition, it is known that even if the cancer is of a type that is recognized as being effective, there are cases where the effect is exhibited and the effect is not exhibited depending on the individual patient. Whether or not an anticancer agent has an effect on cancer of an individual patient like this is called anticancer drug sensitivity. Therefore, according to the present invention, if it is possible to predict a patient (responder) who can expect an effect and a patient (non-responder) who cannot expect an effect before starting treatment, chemotherapy with high efficacy and safety can be realized.

In the present invention, in relation to the above sensitivity, when there is no effect on a drug (for example, an anti-cancer agent), it can be expressed as resistance or resistance.

The term "prediction" as used herein is used herein to refer to the likelihood that a subject patient will respond favorably or adversely to a drug or set of drugs. In one embodiment, the prediction relates to the extent of this response. For example, the prediction relates to whether and / or the likelihood that a patient will survive without cancer recurrence after treatment, for example after treatment of a particular therapeutic agent and / or surgical removal of the primary tumor and / or chemotherapy for a certain period of time. .

The predictions of the present invention can be used clinically to determine treatment by selecting the most appropriate treatment modality for cancer, especially gastric cancer patients. Prediction of the present invention is whether the patient will respond favorably to a treatment treatment, such as a given therapeutic treatment, for example administration of a given therapeutic agent or combination, surgical intervention, chemotherapy, etc., or whether long-term survival of the patient is possible after therapeutic treatment. It is a useful tool in predicting whether or not.

As used herein, the term “mutant” includes those in which the nucleotide and amino acid sequences of the gene are base substituted, deleted, inserted, amplified and rearranged. Nucleotide variation refers to a change in nucleotide sequence relative to a reference sequence (eg, a wild-type sequence) (eg, insertion, deletion, inversion or substitution of one or more nucleotides, such as single nucleotide polymorphism (SNP)). The term also includes corresponding changes in the complement of the nucleotide sequence, unless indicated otherwise. Nucleotide mutations can be somatic mutations or germline polymorphism.

In addition, amino acid variation is a change in the amino acid sequence relative to a reference sequence (e.g., a wild-type sequence) (e.g., insertion, substitution or deletion of one or more amino acids, such as an internal deletion or an N- or C-terminal truncation) (truncation)).

The mutation of the present invention is a point mutation in which one nucleotide in the polynucleotide of SEQ ID NO: 1 is substituted, deleted, or inserted, and is preferably a point mutation in which one nucleotide in the polynucleotide of SEQ ID NO: 1 is substituted.

According to a preferred embodiment of the present invention, the mutation is substituted by thymine, which is the 910 th base Cytosine of the normal MAP3K10 gene set forth in SEQ ID NO: 1; Adenine, the 632th base, is substituted with Guanine; And 89th base, Cytosine, which is substituted with adenine.

In addition, the mutation of the present invention is a substitution, deletion or insertion of amino acids in the polypeptide of SEQ ID NO: 2.

According to a preferred embodiment, the mutation is wild type MAP3K10 304 amino acid arginine (arginine) MAP3K10 ^Arg304Cys, 211 amino acid of histidine (histidine) is substituted by a cysteine (cysteine) of the protein shown in SEQ ID NO: 2 is arginine It is one or more cases selected from the group consisting of MAP3K10 ^His211Arg substituted with (arginine) and MAP3K10 ^Ala30Glu substituted with 30th amino acid alanine (glutamic acid).

According to a preferred embodiment of the present invention, the anti-cancer agent of the present invention is 5-fluorouracil (5-Fluorouracil, 5-FU); Cisplatin; Abarelix; Aldesleukin; Azacitidine; Bevacuzimab; Cetuximab; Gefitinib; Gemcitabine; Paclitaxel; And tamoxifen, and most preferably 5-fluorouracil [5-Fluorouracil, 5-FU (Adrucil)] or cisplatin (cisplatin (Platinol)).

In the present invention, the anticancer agent is gastric cancer, breast cancer, colon cancer, lung cancer, liver cancer, blood cancer, bone cancer , Pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer (rectal cancer), anal cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, small intestine cancer, endocrine cancer, Thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchogenic cancer and bone marrow cancer (bone marrow tumor) is a treatment for one or more cancers selected from the group consisting of, most Preferably it is stomach cancer.

In addition, the term cancer is used interchangeably with "tumor" or "malignant" and generally refers to or describes the physiological condition of a mammal with characteristics of unregulated cell growth.

In the present invention, the cancer is selected from the group consisting of progression, recurrence and metastasis, most preferably recurrent cancer.

According to another aspect of the present invention, the present invention provides a composition for predicting susceptibility to anticancer agents, including an agent for detecting mutants of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10).

Unless otherwise specified in this specification, the expression "detection of a mutant of MAP3K10" as used herein means detecting a mutation as a target to be detected in a corresponding sample. In the present invention, the target to be detected is DNA (or mRNA) and / or protein of a mutation of the gene in the sample.

That is, it is possible to check whether the gene is expressed by detecting DNA, which is a product of gene mutation, or protein, which is a gene product.

The detection can be usually performed by extracting DNA or protein from a sample and detecting a specific portion of DNA or protein in the extract. The detection of such DNA or protein can be measured by an immunoassay method, a hybridization reaction, and an amplification reaction, but is not limited thereto and can be easily performed using various techniques known in the art.

According to a preferred embodiment of the present invention, the agent for detecting the mutant includes an antisense oligonucleotide, primer pair, probe, antibody, peptide or nucleotide that specifically binds to the mutant site.

The detection agent is selected from the group consisting of antisense oligonucleotides specific for the mutant gene, primer pairs, probes and combinations thereof. That is, the detection of nucleic acids can be performed by an amplification reaction using one or more oligonucleotide primers that hybridize to a nucleic acid molecule encoding a gene or a complement of the nucleic acid molecule.

For example, detection of a nucleic acid using a primer may be performed by amplifying a gene sequence using an amplification method such as PCR, and then confirming whether the gene is amplified by a method known in the art.

According to a preferred embodiment of the present invention, the primer pair comprises a pair consisting of a forward primer represented by SEQ ID NO: 9 and a reverse primer represented by SEQ ID NO: 10; A pair consisting of a forward primer represented by SEQ ID NO: 11 and a reverse primer represented by SEQ ID NO: 12; And a pair consisting of a forward primer represented by SEQ ID NO: 13 and a reverse primer represented by SEQ ID NO: 14; is selected from the group consisting of.

Further, the detection agent may be an antibody that specifically binds to the amino acid site of the mutation, and includes both polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof.

Such antibodies are polyclonal antibodies, monoclonal antibodies, recombinant antibodies and complete forms with two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules, such as Fab, F (ab ' ), F (ab ') 2, and Fv. Antibody production can be easily produced using techniques well known in the field to which the present invention pertains, and antibodies produced and commercially available can be used.

The composition of the present invention is not only an agent for measuring the presence or expression of the above-described mutation, but also a label that enables quantitative or qualitatively measuring the formation of the antigen-antibody complex, a conventional tool used for immunological analysis, reagents, etc. It may further include.

Labels that enable qualitative or quantitative measurement of the formation of antigen-antibody complexes include, but are not limited to, enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioactive isotopes. . Enzymes that can be used as detection labels include β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, peroxidase, alkaline phosphatase, acetylcholinesterase, and glucoseoxy Multidose, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphenol pyruvate decarboxylase, β- Ratamaze, and the like, but is not limited thereto. Fluorescent materials include, but are not limited to, fluorescein, isothiocyanate, rhodamine, picoerytherin, phycocyanin, allopicocyanine, o-phthalaldehyde, fluorescamine, and the like. Ligands include, but are not limited to, biotin derivatives. The luminescent material includes acridinium ester, luciferin, luciferase, and the like, but is not limited thereto. The microparticles include, but are not limited to, colloidal gold, colored latex, and the like. The redox molecule includes ferrocene, ruthenium complex, viologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone, K ₄ W (CN) ⁸ , [Os (bpy) ₃ ] ²⁺ , [RU (bpy) ₃ ] ²⁺ , [MO (CN) ₈ ] ^4- and the like. Radioisotopes include, but are not limited to, ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³ 1I, ¹⁸⁶ Re.

Examples of the tools or reagents include, but are not limited to, suitable carriers, solubilizers, detergents, buffers, stabilizers, and the like. When the labeling substance is an enzyme, a substrate capable of measuring enzyme activity and a reaction stopper may be included. The carrier is a soluble carrier, an insoluble carrier, an example of a soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS, and an example of the insoluble carrier is polystyrene, polyethylene, polypropylene, polyester, poly Acrylonitrile, fluorine resin, crosslinked dextran, polysaccharide, other paper, glass, metal, agarose and combinations thereof.

Since the composition of the present invention contains a mutation as the biomarker described above, the duplicated description is omitted to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides a kit for predicting susceptibility to an anti-cancer agent comprising the composition.

The kit may include an agent for measuring the expression level of the gene, as well as tools, reagents, and the like commonly used in the art used for immunological analysis.

Examples of such tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, chromophores, solubilizers, detergents, buffers, stabilizers, and the like. When the labeling substance is an enzyme, a substrate capable of measuring enzyme activity and a reaction stopper may be included. The carrier includes a soluble carrier, an insoluble carrier, and examples of the soluble carrier include physiologically acceptable buffers known in the art, for example, PBS, and examples of the insoluble carrier include polystyrene, polyethylene, polypropylene, polyester, poly Polymers such as acrylonitrile, fluorine resin, crosslinked dextran, polysaccharide, magnetic fine particles plated with metal in latex, other paper, glass, metal, agarose, and combinations thereof.

Since the kit of the present invention includes a mutation as a biomarker as described above, the duplicated content is omitted to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention comprises the steps of (a) detecting a mutation (Mutant) of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10) in a biological sample obtained from a subject; And (b) predicting susceptibility to the anticancer agent of the subject based on the detection result in the step (a); provides an information providing method for predicting susceptibility to the anticancer agent.

According to a preferred embodiment of the present invention, when the presence (or expression) of the mutation in step (a) is confirmed (or detected), the subject is determined to have susceptibility (tolerance) to the anti-cancer agent.

In the predictive method of the present invention, a biological sample is obtained from a patient with recurrence of a target cancer, and after detecting one or a plurality of entities selected from the group consisting of the mutation of the above-described gene or protein in the sample, the expression ( If present) is confirmed, it comprises the step of determining that the sample is susceptible (resistant) to the anticancer agent.

That is, the prediction method of the present invention is characterized in that the presence or absence of a specific mutation in the sample is used as an indicator of sensitivity of cancer cells to anticancer agents.

In the present invention, the presence and expression of the mutation may affect sensitivity to anticancer agents as described above.

Detection of the mutation can be performed by target molecular cloning and sequencing using techniques well known in the art. For example, DNA sequencing; Primer extensions, including allele-specific nucleotide incorporation assays and allele-specific primer extension assays (e.g., allele-specific PCR, allele-specific ligation chain reaction (LCR) and gap-LCR) black; Allele-specific oligonucleotide hybridization assay (eg, oligonucleotide ligation assay); A cleavage protection assay that detects mismatched bases in a nucleic acid double helix using protection from a cleavage agent; MutS protein binding assay; Electrophoretic analysis comparing the mobility of variant and wild-type nucleic acid molecules; Denaturation-gradient gel electrophoresis (as in DGGE, eg, Myers et al. (1985) Nature 313: 495); Analysis of RNase cleavage in mismatched base pairs; Analysis of chemical or enzymatic cleavage of hetero double helix DNA; Mass spectrometry (eg, MALDITOF); Genetic bit analysis (GBA); 5 'nuclease assays (eg, TaqMan); and assays using molecular beacons.

As used herein, the term "biological sample" means any sample obtained from an individual whose expression of the biomarker of the present invention can be detected.

The biological sample is any one selected from the group consisting of saliva, biopsy, blood, skin tissue, liquid culture, feces, and urine, and is not particularly limited thereto, and is commonly used in the technical field of the present invention. It can be prepared by processing in a manner that can be.

Since the method of the present invention is determined to be susceptible using the above-described biomarker mutation, the duplicated description is omitted to avoid excessive complexity of the present specification.

When a mutation is used as a biomarker for predicting susceptibility to an anticancer agent of the present invention, the susceptibility of each patient can be reliably determined before starting treatment, and selection of an anticancer agent with a high therapeutic effect becomes possible. In addition, unnecessary side effects can be avoided because it is possible to avoid using an anticancer agent for which no effect is obtained.

1 shows the MAP3K10 plasmid vector map.
2 shows WES (Whole Exome Sequencing) results.
FIG. 3 shows that MAP3K10 ^Arg304Cys is a cytokine (C, Cytosine) of the codon 304 region of wild-type MAP3K10 substituted with thymine (T, Thymine).
4 shows that MAP3K10 ^His211Arg is adenine (A, Adenine) at the codon 211 region of wild-type MAP3K10 is substituted with guanine (G, Guanine).
FIG. 5 shows that MAP3K10 ^Ala30Glu is substituted with adenine (C, Cytosine) at the codon 30 region of wild-type MAP3K10.
FIG. 6 shows wild-type MAP3K10 and MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg ) in gastric cancer cell lines (MKN-28, MKN-45, SNU-484, AGS). And MAP3K10 ^Ala30Glu ), the results of measuring the resistance to 5-FU (500 μM).
7 is a wild type MAP3K10 and MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg ) in gastric cancer cell lines (MKN-28, MKN-45, SNU-484, AGS) And MAP3K10 ^Ala30Glu ), the results of measuring resistance to cisplatin (50 μM).
8 shows the degree of apoptosis for 5-FU (1000 μM) of wild-type MAP3K10 and MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) in gastric cancer cell lines (MKN-28, MKN-45, SNU-484, AGS). Shows the results of the measurement.
Figure 9 measures the degree of cell death for cisplatin (100 μM) of wild-type MAP3K10 and MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) in gastric cancer cell lines (MKN-28, MKN-45, SNU-484, AGS). Shows one result.
10 shows antibiotic treatment of wild-type MAP3K10 and MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) in gastric cancer cell lines (MKN-28, MKN-45, SNU-484, AGS) (5-FU; 500 μM, Cisplatin; After 50 μM), Western blotting results are shown. (Lane 1; Empty vector, lane 2; MAP3K10 ^WT , lane 3; MAP3K10 ^Arg304Cys , lane 4; MAP3K10 ^His211Arg , lane 5; MAP3K10 ^Ala30Glu )

Hereinafter, the examples are only intended to describe the present invention in more detail, and according to the gist of the present invention, the scope of the present invention is not limited by these examples. Those skilled in the art to which the present invention pertains It will be obvious to you.

Experimental method and conditions

One. WES  (Whole Exome  Sequencing)

After chemotherapy, gastric cancer tissues of patients who have not recurred gastric cancer and those who have recurred gastric cancer are obtained with the consent of the patient and conducted WES (Whole Exome Sequencing) to identify Mutation genes using Life Technology's Ion Proton ^TM System. Did.

2. Mutagenic Plasmid  Vector production

2.1. Plasmid  Buy Vector

An expression plasmid vector, pCMV6-Entry (Origene, RC218669), was purchased to express the mutant MAP3K10 gene as a protein in human gastric cancer cells.

2.2. Point Mutation part included primer  Design and PCR  Amplification process

For the production of a mutated plasmid vector, the method of the Quickchange II XL Site-Directed Mutagenesis Kit (Aglient, # 200522) was used to make a mutant primer (Table 1). Using, MAP3K10 plasmid vector DNA as a template, PCR (Polymerase Chain Reaction) (composition; Table 2, and conditions; Table 3) was carried out.

gene Amino Acid Change primer Sequence (5'-3 ') MAP3K10 p.Arg304Cys F GAGGTCCCCTAC T GTGAGATCGACGCC (SEQ ID NO: 3) R GGCGTCGATCTCAC A GTAGGGGACCTC (SEQ ID NO: 4) p.His211Arg F CGGGGCATGAACTACCTAC G CAATGATGCCCCTGTGCCC (SEQ ID NO: 5) R GGGCACAGGGGCATCATTG C GTAGGTAGTTCATGCCCCG (SEQ ID NO: 6) p.Ala30Glu F GTGTTCGACTACGAGGCGG A GGGCGACGAGGAGCTGACC (SEQ ID NO: 7) R GGTCAGCTCCTCGTCGCCC T CCGCCTCGTAGTCGAACAC (SEQ ID NO: 8)

The underlined base is a substituted base.

PCR composition 5 μl 10X reaction buffer 10 ng dsDNA template (MAP3K10 plasmid vector DNA) 125 ng Oligonucleotide Forward Primer 125 ng Oligonucleotide Reverse Primer 1 μl dNTP Mix 3 μl QuikSolution 50 µl total volume with ddH2O Add 1 μl pfuUltra HF DNA Polymerase (2.5 U / μl)

Segment cycle Temperature time One One 95 ℃ 1 minute 2 18 95 ℃ 50 seconds 60 ℃ 50 seconds 68 ℃ 1 min / kb plasmid length 3 One 68 ℃ 7 minutes

2.3. Digestion and transformation

To remove parental supercoiled dsDNA, 1 μl of Dpn I Restriction enzyme (10 U / μl) (Aglient, # 20522) was added to the PCR-amplified reaction and incubated for 1 hour at 37 ° C. Then, the mutagenic supercoiled dsDNA (2 μl) obtained through the Digestion reaction and XL10-Gold Ultracompetent Cells (45 μl) (Aglient Technologies, # 20522) were well mixed by pipeting and incubated on ice for 30 minutes. After this, Heat shock (30 sec) was added on a 42 ° C. water bath, followed by incubation on ice for 2 minutes. Then, LB liquid medium (500 µl) without antibiotics was added, followed by incubation for 1 hour in a shaking incubator (230 rpm, 37 ° C). Thereafter, X-gal was plated for blue-white screening in LB solid medium containing Kanamycin (25 µg / ml) preheated to 37 ° C. Thereafter, the mixture was carefully spread on a solid medium to prevent contamination and cultured overnight in a 37 ° C incubator. Thereafter, only white colonies were taken and used in the following examples.

2.4. Liquid Culture

Put 10 ml of LB liquid medium and Kanamycin (25 µg / ml) in a 50 ml tube, take only one white colony one by one using a flame-sterilized white tip, place it in the tube, and shake it overnight in a shaker (230 rpm, 37 ° C). The incubation allowed E. coli to grow sufficiently.

2.5. Plasmid DNA extraction (Mini Prep)

In order to obtain the cloned plasmid DNA from the sufficiently grown E. coli, a mini prep was performed.

This process was performed according to a known method using a LaboPass ^TM plasmid mini kit (Cosmogenetech, Cat No. CMP0112).

2.6. Sequencing

To confirm whether the plasmid DNA obtained through the Mini prep was produced with the target Mutagenic Plasmid Vector, a sequence analysis was performed, and a sequencing primer (Table 4) was prepared to analyze it.

Mutagenic gene primer SEQ ID NO: 5'-3 ' MAP3K10 ^Arg304Cys F CTCCCTCTTCTCCAAAAGCA (SEQ ID NO: 9) R AAGCCGCTTCAAGATGCTAC (SEQ ID NO: 10) MAP3K10 ^His211Arg F CCCCACACCTCTGCCTAGT (SEQ ID NO: 11) R GTCTGCGAGGTTGTGGTTCT (SEQ ID NO: 12) MAP3K10 ^Ala30Glu F GACCGCGGTGTTCGACTA (SEQ ID NO: 13) R ACGTAGTTGCTGGGGAAGAC (SEQ ID NO: 14)

3. On In Vitro Mutated  gene( Mutagenic  Gene) to verify the effect of anticancer drug susceptibility

3.1. Cell culture and materials

RPMI-1640 (Gibco by Life technology, Cat No.) with FBS (Fetal Bonvine Serum, Gibco by Life technology, Cat No. 10099-141) and penicillin / streptomycin (Gibco by Life technology, Cat No. 15140-122) 11875-093). Transfection reagent is Lipofectamine ^TM 3000 (Invitrogen, Cat No. L3000150) was used.

Human gastric cancer cell line (MKN-28 (KCLB, No. 80102)), MKN-45 (KCLB, No. 80103), SNU-484 (KCLB, No. 00484), used in this example AGS (KCLB, No. 21739) cell lines are cultured in an incubator at 37 ° C, 5% CO ₂ in RPMI-1640 medium with 10% FBS and 1% penicillin / streptomycin inactivated and passaged once every 2-3 days. Did.

In addition, in order to confirm the relationship between the mutagenic gene (Mutagenic gene) and anticancer drug susceptibility on In Vitro, the anticancer agent is 5-FU (5-fluorouracil) (SIGMA, Cat No.F6627), cisplatin, Cis- platium (II) diamine dichloride) (Cisplatin, SIGMA, Cat No. P4394) was purchased and used.

3.2. Cell viability measurement

First, the human gastric cancer cell line was maintained in RPMI-1640 medium containing 10% FBS and 1% penicillin / streptomycin, and then added to a 2.5x10 ⁴ cell / well in a 24-well multi dish (Thermo Scientific, Cat No. 142475). , Attached in a 5% CO ₂ incubator (37 ° C.) for 24 hours. After removing the supernatant from the attached human gastric cancer cell line, 300 μl of OPTI-MEM (Gibco by Life Technology, Cat No. 31985-070) was added to each well. The amount of DNA entering each well was 3 µg, and OPTI-MEM was added so that the total volume was 100 µl. Transfection is Lipofectamine ^TM Incubation was performed for 48 hours using 3000 (5% CO ₂ , 37 ° C.) according to a known method. After that, the supernatant was removed, and anti-cancer agents (5-FU, Cisplatin) diluted to a constant concentration were added and incubated in a CO ₂ incubator (37 ° C.) for 24 hours, and the number of grown cells was measured by the MTT method.

In addition, the cell viability was calculated as follows (%) of the cell viability compared to the growth of the human gastric cancer cell line of the control group without anticancer agents.

Cell Viability (%) = (sample ₅₇₀ / control ₅₇₀ ) x 100

3.3. Apoptosis ( Apoptosis )

Human gastric cancer cell lines MKN-28, MKN-45, SNU-484, and AGS were placed in a 6-well multidish so as to be 1.5x10 ⁵ cells / well, and attached in a 5% CO ₂ incubator (37 ° C) for 24 hours.

After removing the supernatant from the attached human gastric cancer cell line, 800 μl of OPTI-MEM was added per well. The amount of DNA entering each well was 3 μg, and OPTI-MEM was added to a total volume of 200 μl. Transfection is Lipofectamine ^TM Incubation was performed for 48 hours using 3000 (5% CO ₂ , 37 ° C.) according to a known method. After that, the supernatant was removed and incubated for 24 hours in a CO ₂ incubator (37 ℃) by adding anticancer drugs (5FU, Cisplatin) diluted to a constant concentration, and then washed once with DPBS (Gibco, Cat No. 14190-144) to make Annexin The experiment was conducted according to a known method using V Apoptosis Detection Kit FITC (Affymetrix eBioscience, Cat No. 88-8005-74).

3.4. Western Blotting (Western Blotting)

In order to confirm whether the cell viability (%) is increased compared to the wild-type MAP3K10 ^WT in the human gastric cancer cell line into which the mutagenic plasmid vector prepared in the present invention is introduced, the human gastric cancer cell lines MKN-28, MKN-45, SNU -484, AGS was placed in a 6-well multidish (Thermo Scientific, Cat No. 140675) to be 1.5x10 ⁵ cells / well and attached in a 5% CO ₂ incubator (37 ° C.) for 24 hours. After removing the supernatant from the attached human gastric cancer cell line, 800 μl of OPTI-MEM was added to each well. The amount of DNA entering each well was 3 μg, and OPTI-MEM was added to a total volume of 200 μl. Transfection was performed for 48 hours (5% CO ₂ , 37 ° C) according to a known method using Lipofectamine ^TM 3000. After that, the supernatant was removed, and anti-cancer agents (5FU, Cisplatin) diluted to a certain concentration were added, followed by incubation for 24 hours in a CO ₂ incubator (37 ° C.) to collect cells. The cell pellet was lysed with 1X lysis buffer (Cell Signaling, # 9803) containing 1 mM PMSF, and then centrifuged (4 ° C 15,000 rpm, 15 min) to take only the supernatant, and the protein was quantified by BCA assay. Running was performed at 100 V with a running buffer (Tris base 25 mM, Glycine 192 mM, 0.1% SDS), and transfer was performed at 100 V for 90 minutes with Trans buffer (Tris base 25 mM, Glycine 192 mM, 20% Methanol). After dissolving 5% skim milk (BD, Cat No. 232100) in 1X TTBS buffer (10% Triton X-100), it was blocked at room temperature for 1 hour. As primary antibody, MAP3K10 (Abcam, Cat No. ab172873), p-MEK1 / 2 (phospho-MEK1 / 2, Cell Signaling, # 9121), p-p38 (phospho-p38 MAP Kinase, Cell Signaling, # 9211), Gapdh (Glyceraldehyde-3-phosphate Dehydrogenase, Millipore, Cat No. MAB374) was used by diluting at a ratio of 1: 1000, and reacted at 4 ° C overnight or at room temperature for 5 hours. Goat anti-mouse IgA + igG + IgM (KPL, Cat No. 074-1807), goat anti-rabbit IgG (H + L) (Thermo Fisher Scientific, Cat No. 31460) ) Was used as a secondary antibody, diluted in a ratio of 1: 5000 in 1X TTBS buffer in which 5% skim milk was dissolved, and reacted at room temperature for 1 hour. After washing three times for 15 minutes with 1X TTBS buffer, it was detected after reacting with ECL (Advansta, Cat No. K-12045-D50).

Example  One. WES (Whole Exome  Bio using Sequencing) Marker  Selection

In the present invention, the purpose of this study was to investigate the presence or absence of genetic mutation and characteristics of the discovered mutation in patients with recurrence of gastric cancer after anticancer adjuvant therapy.

Therefore, WES (Whole Exome Sequencing) was performed on frozen fresh tissues (normal, tumor tissue) of 14 patients who received anticancer adjuvant therapy.

As a result, as shown in FIG. 2A, in the case of other genes (TP53, MUC16, MUC6, ADGB, etc.), mutations occurred in both patients who did not relapse and patients who relapsed.

On the other hand, in the case of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10), mutations were not found in patients who did not recur gastric cancer after anticancer adjuvant treatment, but it was confirmed that mutations occurred only in patients who recurred gastric cancer.

As shown in Figure 2b and Figure 2c, the mutation is a total of three species, (1) p.Arg304Cys is present in the Tyrosine Kinase Domain and this site is substituted with thymine (T, Thymine) in cytosine (C, Cytosine). that; (2) p.His211Arg is present in the Tyrosine Kinase Domain, and this site is substituted with adenine (A, Adenine) to guanine (G, Guanine); And (3) p.Ala30Glu was present in the SH3 Domain and was confirmed to be substituted with adenine (A, Adenine) in cytosine (C, Cytosine).

Example  2. Mutagenic Plasmid  Vector production

In order to verify whether the MAP3K10 mutation of the gastric cancer cell line shows sensitivity (resistance or resistance) to the anticancer agent, the inventors confirmed that the base of the desired site was changed by constructing the MAP3K10 plasmid vector DNA.

As a result, as shown in FIG. 3, MAP3K10 ^Arg304Cys confirmed that cytosine (C, Cytosine), the 910 th nucleotide corresponding to codon 304 of wild type MAP3K10, was substituted with thymine (T, Thymine).

In addition, as shown in Figure 4, MAP3K10 ^His211Arg was confirmed that in the 632nd nucleotide in the codon 211 of the wild-type MAP3K10 adenine (A, Adenine) substituted with guanine (G, Guanine).

In addition, as shown in Figure 5, MAP3K10 ^Ala30Glu confirmed that the 89th nucleotide corresponding to codon 30 of wild-type MAP3K10, Cytosine (C, Cytosine), was substituted with adenine (A, Adenine).

That is, the mutation of the present invention is that the cytosine of 910 th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1 is substituted with thymine, which is the 304th amino acid of the normal MAP3K10 protein set forth in SEQ ID NO: 2. Phosphorus arginine is MAP3K10 ^Arg304Cys substituted with cysteine; Adenine, which is the 632th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1, is substituted with guanine, and histidine, the 211th amino acid of the normal MAP3K10 protein shown in SEQ ID NO: 2, is arginine. Substituted with MAP3K10 ^His211Arg ; Cytosine, the 89th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1, is substituted with adenine, which means that alanine, the 30th amino acid of the normal MAP3K10 protein set forth in SEQ ID NO: 2, is glutamic acid ) Substituted MAP3K10 ^Ala30Glu .

Example  3. In gastric cancer cell line MAP3K10  Mutation ( MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg  And MAP3K10 ^Ala30Glu ) Reactivity check

3-1. In gastric cancer cell line MAP3K10  Mutation ( MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg  And MAP3K10 ^Ala30Glu ) For anticancer drugs Immunity effect

The present inventors transformed MAP3K10 mutant Plasmid Vector DNA into gastric cancer cell lines, and then used 5-fluorouracil [5-Fluorouracil, 5-FU (Adrucil)] and cisplatin (cisplatin (Platinol)) as anticancer agents, respectively. Treatment to confirm anticancer drug resistance by MTT method.

As a result, as shown in FIGS. 6 and 7, in the cell viability of each gastric cancer cell line, there was a significant difference between the MAP3K10 wild type and MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg and MAP3K10 ^Ala30Glu ) that were not treated with each anticancer agent. On the other hand, MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) treated with each anticancer agent were found to have increased cell proliferation from a minimum of 5% to a maximum of 20% compared to the MAP3K10 wild type.

Therefore, it was confirmed that the MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg, and MAP3K10 ^Ala30Glu ) have a resistance to anticancer agents (5-Fluorouracil, Cisplatin) compared to the MAP3K10 wild type.

3-2. MAP3K10  Mutation ( MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg  And MAP3K10 ^Ala30Glu Apoptosis against anticancer drugs in gastric cancer cell lines of Apoptosis ) effect

Known anticancer agents 5-FU and cisplatin cause apoptosis in cancer cells. Thus, the present inventors have MAP3K10 wild-type and mutant MAP3K10 as anticancer agents in cancer cells of the above (MAP3K10 ^Arg304Cys, MAP3K10 ^His211Arg and MAP3K10 ^Ala30Glu) 5-fluorouracil [5-Fluorouracil, 5-FU (Adrucil)] and cisplatin [cisplatin (Platinol )] To measure apoptosis.

As a result, as shown in FIGS. 8 and 9, there was no difference in apoptosis between the MAP3K10 wild type and the MAP3K10 mutant (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) without ^{treatment with the} anti-cancer agent (5-fluorouracil, Cisplatin).

However, the cell death of MAP3K10 mutants treated with anticancer drugs (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) was reduced from at least 5% to up to 10% compared to the MAP3K10 wild type.

Therefore, it was confirmed that the MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) were more resistant to anticancer agents than the MAP3K10 wild type.

3-3. MAP3K10  Mutation ( MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) Signaling path check

The present inventors compared the MAP3K10 wild type treated with the anticancer agent in Example 3-2 to the MAP3K10 mutation (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) observed an increase in cell viability (%) and a decrease in apoptosis.

Accordingly, in order to determine which pathways the MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , and MAP3K10 ^Ala30Glu ) influence cell proliferation and death, changes in protein expression of MEK1 / 2 and p38 MAPK present downstream were confirmed.

As a result, as shown in FIG. 10, the anti-cancer agent (5-fluorouracil, Cisplatin) -treated MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) are related to cell growth and differentiation compared to MAP3K10 wild type. The expression of 2 was confirmed to be increased, and it was also observed that p-38MAPK related to metastasis of cancer cells was also increased.

Therefore, these mutations are thought to exhibit resistance to anticancer agents through the p-MEK1 / 2 and p-p38MAPK signaling pathways.

In summary, MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10) mutations were not found in patients who did not relapse with gastric cancer after anticancer adjuvant therapy, but in patients with recurrence of gastric cancer.

Thus, the effect of treatment with anticancer agents on gastric cancer cell lines in which MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) occurred was examined.

As a result, it was confirmed that MAP3K10 mutants (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) treated with the anticancer agent (5-Fluorouracil, Cisplatin) had reduced cell proliferation and decreased apoptosis than the MAP3K10 wild type.

In addition, as a result of confirming the expression of the protein through which pathway the anticancer drug resistance occurs, the MAP3K10 mutant (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) treated with the anticancer drug, MAP3K10 ^treated with the anticancer agent (5-Fluorouracil, Cisplatin) Compared to the wild type, it was confirmed that the activation of p-MEK1 / 2 and p-p38MAPK related to cell growth and metastasis downstream of MAP3Ks was increased.

In conclusion, MAP3K10 mutations (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) occurred due to the resistance of anticancer drugs in samples of patients with recurrence of gastric cancer after anticancer adjuvant therapy and anticancer drugs (5-Fluorouracil, Cisplatin) When treated with), it was confirmed that the activity of p-MEK1 / 2 and p-p38MAPK present downstream is increased, resulting in increased resistance.

Therefore, the MAP3K10 mutation (MAP3K10 ^Arg304Cys , MAP3K10 ^His211Arg , MAP3K10 ^Ala30Glu ) is one of the causes of resistance to anticancer agents in gastric cancer cells and is expected to play a very important role in ultimately enhancing the therapeutic effect of cancer.

That is, when the MAP3K10 mutation is present in the cancer cells, it shows that the resistance to anticancer agents is high.

Therefore, it can be confirmed that the MAP3K10 mutation is available as a biomarker for predicting susceptibility to a specific anticancer agent.

<110> Pusan National University Industry-University Cooperation Foundation          PUSAN NATIONAL UNIVERSITY HOSPITAL <120> Novel Biomarkers for Predicting Susceptibility to Anti-Cancer          Drug and Uses Thereof <130> PNU1-326p <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 2865 <212> DNA <213> Homo sapiens <400> 1 atggaggagg aggagggggc ggtggccaag gagtggggca cgacccccgc ggggcccgtc 60 tggaccgcgg tgttcgacta cgaggcggcg ggcgacgagg agctgaccct gcggaggggc 120 gatcgcgtcc aggtgctttc ccaagactgt gcggtgtccg gcgacgaggg ctggtggacc 180 gggcagctcc ccagcggccg cgtgggcgtc ttccccagca actacgtggc ccccggcgcc 240 cccgctgcac ccgcgggcct ccagctgccc caggagatcc ccttccacga gctgcagcta 300 gaggagatca tcggtgtggg gggctttggc aaggtctatc gggccctgtg gcgtggcgag 360 gaggtggcag tcaaggccgc ccggctggac cctgagaagg acccggcagt gacagcggag 420 caggtgtgcc aggaagcccg gctctttgga gccctgcagc accccaacat aattgccctt 480 aggggcgcct gcctcaaccc cccacacctc tgcctagtga tggagtatgc ccggggtggt 540 gcactgagca gggtgctggc aggtcgccgg gtgccacctc acgtgctggt caactgggct 600 gtgcaggtgg cccggggcat gaactaccta cacaatgatg cccctgtgcc catcatccac 660 cgggacctca agtccatcaa catcctgatc ctggaggcca tcgagaacca caacctcgca 720 gacacggtgc tcaagatcac ggacttcggc ctcgcccgcg agtggcacaa gaccaccaag 780 atgagcgctg cggggaccta cgcctggatg gcgccggagg ttatccgtct ctccctcttc 840 tccaaaagca gtgatgtctg gagcttcggg gtgctgctgt gggagctgct gacgggggag 900 gtcccctacc gtgagatcga cgccttggcc gtggcgtatg gcgtggctat gaataagctg 960 acgctgccca ttccctccac gtgccccgag ccctttgccc gcctcctgga ggaatgctgg 1020 gacccagacc cccacgggcg gccagatttc ggtagcatct tgaagcggct tgaagtcatc 1080 gaacagtcag ccctgttcca gatgccactg gagtccttcc actcgctgca ggaagactgg 1140 aagctggaga ttcagcacat gtttgatgac cttcggacca aggagaagga gcttcggagc 1200 cgtgaggagg agctgctgcg ggcggcacag gagcagcgct tccaggagga gcagctgcgg 1260 cggcgggagc aggagctggc agaacgtgag atggacatcg tggaacggga gctgcacctg 1320 ctcatgtgcc agctgagcca ggagaagccc cgggtccgca agcgcaaggg caacttcaag 1380 cgcagccgcc tgctcaagct gcgggaaggc ggcagccaca tcagcctgcc ctctggcttt 1440 gagcataaga tcacagtcca ggcctctcca actctggata agcggaaagg atccgatggg 1500 gccagccccc ctgcaagccc cagcatcatc ccccggctga gggccattcg cctgactccc 1560 gtggactgtg gtggcagcag cagtggcagc agcagtggag gaagtgggac atggagccgc 1620 ggtgggcccc caaagaagga agaactggtc gggggcaaga agaagggacg aacgtggggg 1680 cccagctcca ccctgcagaa ggagcgggtg ggaggagagg agaggctgaa ggggctgggg 1740 gaaggaagca aacagtggtc atcaagtgcc cccaacctgg gcaagtcccc caaacacaca 1800 cccatcgccc ctggctttgc cagcctcaat gagatggagg agttcgcgga ggcagaggat 1860 ggaggcagca gcgtgccccc ttccccctac tcgaccccgt cctacctctc agtgccactg 1920 cctgccgagc cctccccggg ggcgcgggcg ccgtgggagc cgacgccgtc cgcgcccccc 1980 gctcggtggg gacacggcgc ccggcggcgc tgcgacctgg cgctgctagg ctgcgccacg 2040 ctgctggggg ctgtgggcct gggcgccgac gtggccgagg cgcgcgcggc cgacggtgag 2100 gagcagcggc gctggctcga cggcctcttc tttccccgcg ccggccgctt cccgcggggc 2160 ctcagcccac ccgcgcgtcc ccacggccgc cgcgaagacg tgggccccgg cctgggcctg 2220 gcgccctcgg ccaccctcgt gtcgctgtcg tccgtgtccg actgcaactc cacgcgttca 2280 ctgctgcgct ctgacagtga cgaggccgca ccggccgcgc cctccccacc accctccccg 2340 cccgcgccca cacccacgcc ctcgcccagc accaaccccc tggtggacct ggagctggag 2400 agcttcaaga aggacccccg ccagtcgctc acgcccaccc acgtcacggc tgcatgcgct 2460 gtgagccgcg ggcaccggcg gacgccatcg gacggggcgc tggggcagcg ggggccgccc 2520 gagcccgcgg gccatggccc tggccctcgt gaccttctgg acttcccccg cctgcccgac 2580 ccccaggccc tgttcccagc ccgccgccgg ccccctgagt tcccaggccg ccccaccacc 2640 ctgacctttg ccccgagacc tcggccggct gccagtcgcc cccgcttgga cccctggaaa 2700 ctggtctcct tcggccggac actcaccatc tcgcctccca gcaggccaga cactccggag 2760 agccctgggc cccccagcgt gcagcccaca ctgctggaca tggacatgga ggggcagaac 2820 caagacagca cagtgcccct gtgcggggcc cacggctccc actaa 2865 <210> 2 <211> 954 <212> PRT <213> Homo sapiens <400> 2 Met Glu Glu Glu Glu Gly Ala Val Ala Lys Glu Trp Gly Thr Thr Pro   1 5 10 15 Ala Gly Pro Val Trp Thr Ala Val Phe Asp Tyr Glu Ala Ala Gly Asp              20 25 30 Glu Glu Leu Thr Leu Arg Arg Gly Asp Arg Val Gln Val Leu Ser Gln          35 40 45 Asp Cys Ala Val Ser Gly Asp Glu Gly Trp Trp Thr Gly Gln Leu Pro      50 55 60 Ser Gly Arg Val Gly Val Phe Pro Ser Asn Tyr Val Ala Pro Gly Ala  65 70 75 80 Pro Ala Ala Pro Ala Gly Leu Gln Leu Pro Gln Glu Ile Pro Phe His                  85 90 95 Glu Leu Gln Leu Glu Glu Ile Ile Gly Val Gly Gly Phe Gly Lys Val             100 105 110 Tyr Arg Ala Leu Trp Arg Gly Glu Glu Val Ala Val Lys Ala Ala Arg         115 120 125 Leu Asp Pro Glu Lys Asp Pro Ala Val Thr Ala Glu Gln Val Cys Gln     130 135 140 Glu Ala Arg Leu Phe Gly Ala Leu Gln His Pro Asn Ile Ile Ala Leu 145 150 155 160 Arg Gly Ala Cys Leu Asn Pro Pro His Leu Cys Leu Val Met Glu Tyr                 165 170 175 Ala Arg Gly Gly Ala Leu Ser Arg Val Leu Ala Gly Arg Arg Val Pro             180 185 190 Pro His Val Leu Val Asn Trp Ala Val Gln Val Ala Arg Gly Met Asn         195 200 205 Tyr Leu His Asn Asp Ala Pro Val Pro Ile Ile His Arg Asp Leu Lys     210 215 220 Ser Ile Asn Ile Leu Ile Leu Glu Ala Ile Glu Asn His Asn Leu Ala 225 230 235 240 Asp Thr Val Leu Lys Ile Thr Asp Phe Gly Leu Ala Arg Glu Trp His                 245 250 255 Lys Thr Thr Lys Met Ser Ala Ala Gly Thr Tyr Ala Trp Met Ala Pro             260 265 270 Glu Val Ile Arg Leu Ser Leu Phe Ser Lys Ser Ser Asp Val Trp Ser         275 280 285 Phe Gly Val Leu Leu Trp Glu Leu Leu Thr Gly Glu Val Pro Tyr Arg     290 295 300 Glu Ile Asp Ala Leu Ala Val Ala Tyr Gly Val Ala Met Asn Lys Leu 305 310 315 320 Thr Leu Pro Ile Pro Ser Thr Cys Pro Glu Pro Phe Ala Arg Leu Leu                 325 330 335 Glu Glu Cys Trp Asp Pro Asp Pro His Gly Arg Pro Asp Phe Gly Ser             340 345 350 Ile Leu Lys Arg Leu Glu Val Ile Glu Gln Ser Ala Leu Phe Gln Met         355 360 365 Pro Leu Glu Ser Phe His Ser Leu Gln Glu Asp Trp Lys Leu Glu Ile     370 375 380 Gln His Met Phe Asp Asp Leu Arg Thr Lys Glu Lys Glu Leu Arg Ser 385 390 395 400 Arg Glu Glu Glu Leu Leu Arg Ala Ala Gln Glu Gln Arg Phe Gln Glu                 405 410 415 Glu Gln Leu Arg Arg Arg Glu Gln Glu Leu Ala Glu Arg Glu Met Asp             420 425 430 Ile Val Glu Arg Glu Leu His Leu Leu Met Cys Gln Leu Ser Gln Glu         435 440 445 Lys Pro Arg Val Arg Lys Arg Lys Gly Asn Phe Lys Arg Ser Arg Leu     450 455 460 Leu Lys Leu Arg Glu Gly Gly Ser His Ile Ser Leu Pro Ser Gly Phe 465 470 475 480 Glu His Lys Ile Thr Val Gln Ala Ser Pro Thr Leu Asp Lys Arg Lys                 485 490 495 Gly Ser Asp Gly Ala Ser Pro Pro Ala Ser Pro Ser Ile Ile Pro Arg             500 505 510 Leu Arg Ala Ile Arg Leu Thr Pro Val Asp Cys Gly Gly Ser Ser Ser         515 520 525 Gly Ser Ser Ser Gly Gly Ser Gly Thr Trp Ser Arg Gly Gly Pro Pro     530 535 540 Lys Lys Glu Glu Leu Val Gly Gly Lys Lys Lys Gly Arg Thr Trp Gly 545 550 555 560 Pro Ser Ser Thr Leu Gln Lys Glu Arg Val Gly Gly Glu Glu Arg Leu                 565 570 575 Lys Gly Leu Gly Glu Gly Ser Lys Gln Trp Ser Ser Ser Ala Pro Asn             580 585 590 Leu Gly Lys Ser Pro Lys His Thr Pro Ile Ala Pro Gly Phe Ala Ser         595 600 605 Leu Asn Glu Met Glu Glu Phe Ala Glu Ala Glu Asp Gly Gly Ser Ser     610 615 620 Val Pro Pro Ser Pro Tyr Ser Thr Pro Ser Tyr Leu Ser Val Pro Leu 625 630 635 640 Pro Ala Glu Pro Ser Pro Gly Ala Arg Ala Pro Trp Glu Pro Thr Pro                 645 650 655 Ser Ala Pro Pro Ala Arg Trp Gly His Gly Ala Arg Arg Arg Cys Asp             660 665 670 Leu Ala Leu Leu Gly Cys Ala Thr Leu Leu Gly Ala Val Gly Leu Gly         675 680 685 Ala Asp Val Ala Glu Ala Arg Ala Ala Asp Gly Glu Glu Gln Arg Arg     690 695 700 Trp Leu Asp Gly Leu Phe Phe Pro Arg Ala Gly Arg Phe Pro Arg Gly 705 710 715 720 Leu Ser Pro Pro Ala Arg Pro His Gly Arg Arg Glu Asp Val Gly Pro                 725 730 735 Gly Leu Gly Leu Ala Pro Ser Ala Thr Leu Val Ser Leu Ser Ser Val             740 745 750 Ser Asp Cys Asn Ser Thr Arg Ser Leu Leu Arg Ser Asp Ser Asp Glu         755 760 765 Ala Ala Pro Ala Ala Pro Ser Pro Pro Pro Ser Pro Pro Ala Pro Thr     770 775 780 Pro Thr Pro Ser Pro Ser Thr Asn Pro Leu Val Asp Leu Glu Leu Glu 785 790 795 800 Ser Phe Lys Lys Asp Pro Arg Gln Ser Leu Thr Pro Thr His Val Thr                 805 810 815 Ala Ala Cys Ala Val Ser Arg Gly His Arg Arg Thr Pro Ser Asp Gly             820 825 830 Ala Leu Gly Gln Arg Gly Pro Pro Glu Pro Ala Gly His Gly Pro Gly         835 840 845 Pro Arg Asp Leu Leu Asp Phe Pro Arg Leu Pro Asp Pro Gln Ala Leu     850 855 860 Phe Pro Ala Arg Arg Arg Pro Pro Glu Phe Pro Gly Arg Pro Thr Thr 865 870 875 880 Leu Thr Phe Ala Pro Arg Pro Arg Pro Ala Ala Ser Arg Pro Arg Leu                 885 890 895 Asp Pro Trp Lys Leu Val Ser Phe Gly Arg Thr Leu Thr Ile Ser Pro             900 905 910 Pro Ser Arg Pro Asp Thr Pro Glu Ser Pro Gly Pro Pro Ser Val Gln         915 920 925 Pro Thr Leu Leu Asp Met Asp Met Glu Gly Gln Asn Gln Asp Ser Thr     930 935 940 Val Pro Leu Cys Gly Ala His Gly Ser His 945 950 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 3 gaggtcccct actgtgagat cgacgcc 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 4 ggcgtcgatc tcacagtagg ggacctc 27 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 5 cggggcatga actacctacg caatgatgcc cctgtgccc 39 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 6 gggcacaggg gcatcattgc gtaggtagtt catgccccg 39 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 7 gtgttcgact acgaggcgga gggcgacgag gagctgacc 39 <210> 8 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 8 ggtcagctcc tcgtcgccct ccgcctcgta gtcgaacac 39 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 9 ctccctcttc tccaaaagca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 10 aagccgcttc aagatgctac 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 11 ccccacacct ctgcctagt 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 12 gtctgcgagg ttgtggttct 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 13 gaccgcggtg ttcgacta 18 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 14 acgtagttgc tggggaagac 20

Claims (16)

A biomarker composition for predicting susceptibility of anticancer agents against gastric cancer, including a mutant of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10),
In the mutation, arginine, the 304th amino acid of the normal MAP3K10 protein set forth in SEQ ID NO: 2, is substituted with cysteine, histidine, the 211th amino acid, is substituted with arginine, and the 30th amino acid alanine ( alanine) is one or more cases selected from the group consisting of the case where it is substituted with glutamic acid;
The anticancer agent is 5-fluorouracil (5-Fluorouracil, 5-FU) or cisplatin (cisplatin), characterized in that the composition.
According to claim 1,
In the mutation, Cytosine, the 910th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1, is substituted with Thymine, substitution of the 632th base, Adenine with Guanine, and the 89th base. A composition, characterized in that the phosphorus cytosine (Cytosine) is at least one selected from the group consisting of adenine (Adenine) substitution.
delete delete delete The composition of claim 1, wherein the gastric cancer is selected from the group consisting of progression, recurrence and metastasis.
A composition for predicting the susceptibility of an anticancer agent to gastric cancer, comprising an agent that detects a mutant of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10),
In the mutation, arginine, the 304th amino acid of the normal MAP3K10 protein set forth in SEQ ID NO: 2, is substituted with cysteine, histidine, the 211th amino acid, is substituted with arginine, and the 30th amino acid alanine ( alanine) is one or more cases selected from the group consisting of the case where it is substituted with glutamic acid;
The anticancer agent is 5-fluorouracil (5-Fluorouracil, 5-FU) or cisplatin (cisplatin), characterized in that the composition.
The method of claim 7,
The agent for detecting the mutation is characterized in that it comprises an antisense oligonucleotide, primer pair, probe, antibody, peptide or nucleotide that specifically binds to the mutation.
The method of claim 8,
The primer pair is a pair consisting of a forward primer represented by SEQ ID NO: 9 and a reverse primer represented by SEQ ID NO: 10; A pair consisting of a forward primer represented by SEQ ID NO: 11 and a reverse primer represented by SEQ ID NO: 12; And a pair consisting of a forward primer represented by SEQ ID NO: 13 and a reverse primer represented by SEQ ID NO: 14; characterized in that it is selected from the group consisting of.
The method of claim 7,
In the mutation, Cytosine, the 910th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1, is substituted with Thymine, substitution of the 632th base, Adenine with Guanine, and the 89th base. A composition, characterized in that the phosphorus cytosine (Cytosine) is at least one selected from the group consisting of adenine (Adenine) substitution.
delete A kit for predicting the sensitivity of an anticancer agent to gastric cancer, comprising the composition of claim 7.
Method of providing information for predicting susceptibility of anticancer drugs to gastric cancer, including the following steps:
(A) detecting a mutation (Mutant) of MAP3K10 (Mitogen-Activated Protein Kinase Kinase Kinase 10) in a biological sample obtained from a patient with gastric cancer,
In the mutation, arginine, the 304th amino acid of the normal MAP3K10 protein set forth in SEQ ID NO: 2, is substituted with cysteine, histidine, the 211th amino acid, is substituted with arginine, and the 30th amino acid alanine ( alanine) is one or more cases selected from the group consisting of the case where it is substituted with glutamic acid; And
(b) predicting susceptibility to the anticancer agent of the gastric cancer patient based on the detection result in the step (a),
The anticancer agent is 5-fluorouracil (5-Fluorouracil, 5-FU) or cisplatin (cisplatin) characterized in that the method.
The method of claim 13,
When the mutation of step (a) is detected, the gastric cancer patient is predicted to be susceptible to anticancer agents.
The method of claim 13,
In the mutation, Cytosine, the 910th base of the normal MAP3K10 gene set forth in SEQ ID NO: 1, is substituted with Thymine, substitution of the 632th base, Adenine with Guanine, and the 89th base. A method, characterized in that the cytosine (Cytosine) is at least one selected from the group consisting of adenine (Adenine) substitution.
delete

Images