CA2415253A1 - Bio-probes and use thereof - Google Patents
Bio-probes and use thereof Download PDFInfo
- Publication number
- CA2415253A1 CA2415253A1 CA002415253A CA2415253A CA2415253A1 CA 2415253 A1 CA2415253 A1 CA 2415253A1 CA 002415253 A CA002415253 A CA 002415253A CA 2415253 A CA2415253 A CA 2415253A CA 2415253 A1 CA2415253 A1 CA 2415253A1
- Authority
- CA
- Canada
- Prior art keywords
- bioprobe
- biological material
- species
- specifically
- binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/416—Systems
- G01N27/447—Systems using electrophoresis
- G01N27/44704—Details; Accessories
- G01N27/44717—Arrangements for investigating the separated zones, e.g. localising zones
- G01N27/44721—Arrangements for investigating the separated zones, e.g. localising zones by optical means
- G01N27/44726—Arrangements for investigating the separated zones, e.g. localising zones by optical means using specific dyes, markers or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B03—SEPARATION OF SOLID MATERIALS USING LIQUIDS OR USING PNEUMATIC TABLES OR JIGS; MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C—MAGNETIC OR ELECTROSTATIC SEPARATION OF SOLID MATERIALS FROM SOLID MATERIALS OR FLUIDS; SEPARATION BY HIGH-VOLTAGE ELECTRIC FIELDS
- B03C5/00—Separating dispersed particles from liquids by electrostatic effect
- B03C5/005—Dielectrophoresis, i.e. dielectric particles migrating towards the region of highest field strength
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Electrochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to the application of bio-probes which bind specifical ly to biological material and thus permit the detection and/or separation of th e material so marked from an environment of similar biological material, by means of electrophoresis or dielectrophoresis. Said bio-probes are characterised in that they alter the electrical and/or dielectric properties of the biological material.
Description
r Description Bioprobes and use thereof The invention relates to bioprobes which alter by specific binding to biological material the electric and/or dielectric properties thereof and thereby make possible detection and/or purification of the material modified in this way by means of electrophoresis and/or dielectrophoresis.
Removing one or more biological species selectively from a pool of biological material or from a background comprising very similar biological species is a frequent task in biotechnology, bioanalysis and diagnostics. The biological material here may be, for example, tissue, cells, viruses, cell organelles, proteins, protein complexes, carbohydrates, lipids or other organic compounds or a mixture of the groups listed. Accordingly, the different species originate from at least one of said groups. The differences in the properties of the various biological species, on which the separation or detection principle is based, may be very small so that separation and/or detection is often achieved only with great difficulties, if at all.
There are a multiplicity of solution strategies for detecting and separating biological material (Lottspeich and Zorbas (1998) Bioanalytik. Spektrum Akademischer Verlag, Heidelberg). In principle, it is possible to distinguish methods which utilize for separation and detection the differences in the properties of the species to be fractionated from those in which detection and separation of said species can be achieved only by selective modification of the biological material provided.
Removing one or more biological species selectively from a pool of biological material or from a background comprising very similar biological species is a frequent task in biotechnology, bioanalysis and diagnostics. The biological material here may be, for example, tissue, cells, viruses, cell organelles, proteins, protein complexes, carbohydrates, lipids or other organic compounds or a mixture of the groups listed. Accordingly, the different species originate from at least one of said groups. The differences in the properties of the various biological species, on which the separation or detection principle is based, may be very small so that separation and/or detection is often achieved only with great difficulties, if at all.
There are a multiplicity of solution strategies for detecting and separating biological material (Lottspeich and Zorbas (1998) Bioanalytik. Spektrum Akademischer Verlag, Heidelberg). In principle, it is possible to distinguish methods which utilize for separation and detection the differences in the properties of the species to be fractionated from those in which detection and separation of said species can be achieved only by selective modification of the biological material provided.
- The properties characteristic for the biological material, which are used for detecting and/or separating various species, are, inter alia, polarity, hydrophobicity, charge, size, weight and density.
Examples of methods utilizing said properties are electrophoresis, gel filtration, affinity chromato-graphy and centrifugation.
Methods in which the biological material is selectively labeled in a specific manner and in which separation or detection of the various species is made possible only due to the label or due to the properties altered by said label are all methods which are based on an antibody-antigen interaction. Examples of these are EZISA (enzyme-linked immunosorbent assay) methods and particular variants of FACS (fluorescence-activated cell sorting) and MACS (magnetic activated .cell sorting). In these cases, an enzyme, a fluorescent dye or a magnetic bead is selectively bound to particular species of the biological material by using specifically binding antibodies, in order to make possible detection or purification of the species labeled in this way.
An example which may be mentioned of a method in which it is very difficult to fractionate biological material is free-flow electrophoresis (FFE) (Bauer J. (1999) J.
Chrom. B 722: 55). In this method, a laminar liquid stream is passed between two glass plates close to one another. Applying an electric field perpendicular to the direction of flow makes it possible to fractionate the various species of the biological material provided, due to their different charge. If, for example, FFE is used for fractionating cells, said cells are electrically attracted by the cathode due to their negative charge. The lateral migration velocity of the cells in this case depends on the surface charge density of the cells. Cells with different surface charge densities have different lateral migration velocities and thus can be separated from one another.
The decisive disadvantage of FFE is the fact that biological material very often has very similar charge properties. All cells, for example, have a negative and, in addition, very often nearly identical surface charge density and thus can be separated from one another by means of FFE only with great difficulty. In FFE an adequate resolution can often be achieved only if the surface charge density of the cells has been modified sufficiently by a pathogenic change. For this reason, the use of FFE has decreased sharply today and the method has been displaced by other often more expensive and technically more complicated methods.
In the relatively new method of dielectrophoresis (Fiedler et al. (1998) Anal. Chem. 70: 1909; Betts et al. (1999) J. Appl. Microbiol. Symp. Suppl. 85: 201), too, problems have to be dealt with, which are similar to those arising in electrophoretic methods such as the above-described FFE. Dielectrophoresis (DEP) is a method in which the dielectric properties of biological material are utilized in order to separate said material from one another. Dielectrophoresis takes place when biological material is subjected to inhomogeneous alternating electric fields. The biological material moves in the inhomogeneous electric field due to its dielectric properties (permanent or inducible electric dipole), making a fractionation possible as a result.
For example, cells contain various regions which can be polarized and thus be utilized for dielectrophoresis.
These regions include the electric charge bilayer surrounding a cell, the cell membranes marking the boundaries of the cell or cell organelles, and also the polar cytoplasm in the cell interior.
Dielectrophoresis may be used, for example, for fractionating cells, bacteria and other microorganisms.
However, it is conceivable to use dielectrophoresis also for fractionating other biological material such as, for example, nucleic acids, proteins, lipids or other organic compounds.
Examples of possible applications of dielectrophoresis are the testing of drinking water, food and biological fluids with regard to pathogenic microorganisms and the concentration of stem cells from bone marrow or peripheral blood.
Dielectrophoresis has the disadvantage that the dielectric properties of biological material, too, are often very similar, thus making a fractionation of different species more difficult.
It is therefore the object of the present invention to increase the resolution of electrophoretic and/or dielectrophoretic methods and thus to make available an improved detection and/or purification method.
The object is achieved by specific binding of bioprobes to a particular species or to a group of particular - species from a pool of biological material containing at least one species, as a result of which the electric and/or dielectric properties of the species labeled in this way are altered selectively and specifically, thus making it possible to purify and/or detect the species labeled in this way or the complex of bioprobe and biological species, which has formed due to binding of said bioprobe.
According to the invention, the biological material here comprises in particular at least one species of at least one group selected from the group consisting of tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds, and the species may also be modified.
The essential advantage of the invention described here compared with the usual methods is the possibility of simple and rapid separation and/or detection of the _ 5 _ complex of biological species and bioprobe, which has formed due to binding of said bioprobe to said biological species, and this advantage can be used on the one hand to enable detection or purification of the species selectively labeled in this way but, conversely, may also be used for selectively removing one or more bioprobes from a pool of bioprobes with different binding specificities. In the latter case it is possible, prior to carrying out the separation method, to contact the biological material in particular with a library of inventive bioprobes of different binding specificity so that selectively binding bioprobes can be identified and isolated from said library.
The decisive advantage of the method of the invention compared with methods such as FRCS and MACS is that the bioprobe need not be modified in a complicated manner by a fluorescent dye or a magnetic bead in order to enable detection and/or purification of the labeled biological material, and that likewise the complex apparatus unavoidable in methods such as FACS or MACS
is not needed.
The inventive method for detecting or purifying biological material may in particular comprise the following steps:
a) Providing biological material which contains different species.
b) Adding a bioprobe containing a part A which binds specifically to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by specific binding of said bioprobe so that detection and/or purification of said labeled species by electrophoresis and/or dielectrophoresis is made possible or improved.
c) Constructing an electric field for detecting or purifying said complex or complexes of one or more iological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
For the purpose of identifying and isolating bioprobes specifically binding to biological material provided, the method of the invention may in particular comprise the following steps:
a) Providing biological material which contains at least one species.
b) Adding a bioprobe or various bioprobes comprising in each case a part A which can specifically bind to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by binding of a bioprobe so that detection and/or purification of a complex forming in this way of one or more biological species and biological material become possible, with the various bioprobes having different binding specificities and at least one of the bioprobes added binding to said biological material.
c) Constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
The various bioprobes according to (b) in this case may be in particular a library of bioprobes of different substrate specificity, which comprises more than 109, in particular more than 1012, different bioprobes.
The bioprobes of the invention comprise a part A which mediates the specific interaction between the probe and the biological material and a part B which alters the properties of said biological material in the desired way, i.e. alters the charge with regard to electrophoresis and the dielectricity constant or specific conductivity or polarizability with regard to dielectrophoresis. There is no need here for the parts A and B to be structurally separated from one another.
Part A of the bioprobe is or comprises, for example, a peptide binding specifically to biological material. In this case, a specific interaction between the peptide and a peptide receptor present on [sic] the biological material is formed. An example of such an interaction is that of the Saccharomyces cerevisiae a-factor receptor Ste2p with the corresponding a-factor peptide ligand. Further examples are the TSH receptor (Schuppert et al. (1996) Thyroid 6: 575), the FSH
receptor (Tilly et al. (1992) Endocrinology 131: 799), the EGF receptor (Christensen et al. (1998) Dan. Med.
Bull. 45: 121), the TNF receptor (Murphy et al. (1994) Thymus 23: 177), the transferrin receptor (Ponka and Lok (1999) Int. J. Biochem. Cell Biol. 31: 1111), the insulin receptor (Milazzo et al. (1992) Cancer Res. 52:
3924), the FGF receptor (Kiefer et al. (1991) Growth Factors 5: 115), the TGF(3 receptor (Derynck et al.
(1994) Princess Takamatsu Symp. 24: 264), the IGF
receptor (Peyrat and Bonneterre (1992) Breast Cancer Res. Treat. 22: 59), the angiotensin II receptor (Smith and Timmermans (1994) Curr. Opin. Nephrol. Hypertens.
3: 112) and the somatostatin receptor (Schonbrunn (1999) Ann. Oncol. 10 Suppl. 2: 17) and the interactions with their particular ligands. Similarly, all peptides capable of binding specifically to the desired biological material can be used.
The specifically binding part A may also be an antibody, in particular for example an antibody recognizing marker structures on cell surfaces. An example of such a marker structure is the transferrin receptor. Furthermore, part A may also comprise a low molecular weight structure which binds specifically to biological material. An example of such a low molecular weight structure is acetylcholine which is specifically bound by the acetylcholine receptor. However, part A of the bioprobe may also be, for example, a carbohydrate, a lipid, an inorganic compound, a nucleic acid or any other ligand binding specifically to biological material or may comprise one of these groups.
Part B of the bioprobe, which is linked to part A is or comprises a structure which, when binding to the biological material, alters the electric and/or dielectric properties thereof such that the behavior of the biological material modified in this way changes in an electric and/or dielectric field. This may take place, for example, by introducing an electric charge, by altering the dielectricity constants and/or by altering the specific conductivity of said biological material. Examples of carriers of electric charge are in this context acidic and basic amino acids (asparate, glutamate, lysine, arginine), nucleic acids (single-stranded and double-stranded DNA and RNA, DNA/RNA
heteroduplex), organic acids and bases (tartrate, citrate, amines), polyquaternary amines and inorganic charge carriers. Structures which alter the dielectric behavior of the biological material are, in addition to the structures mentioned above, also hydrophobic, electrically neutral structures such as lipids, fatty acids, waxes, oils and sterols, for example.
In a preferred embodiment, part B of the bioprobe is or comprises a nucleic acid which is covalently linked to part A of the bioprobe directly or via an intermediate link. The nucleic acid in this case comprises preferably at least 5 or 10, particularly preferably at least 15 or 20, nucleotides.
In a particularly embodiment of the bioprobe, part B of said bioprobe comprises a nucleic acid which comprises the genetic information for part A of the bioprobe, with part A of the bioprobe comprising a protein or _ g _ - polypeptide and part B of the bioprobe comprising a single- or double-stranded RNA or DNA or an RNA/DNA
heteroduplex which is covalently linked to part A of the bioprobe. Here, too, part A of the bioprobe particularly preferably comprises a ligand for the Ste2p receptor, the TSH receptor, the FSH receptor, the EGF receptor, the TNF receptor, the transferrin receptor, the insulin receptor, the FGF receptor, the TGF~i receptor, the IGF receptor, the angiotensin II
receptor or the somatostatin receptor and part B of the bioprobe in each case a nucleic acid which comprises the sequences coding for said ligands. In this preferred embodiment, part A and part B of the bioprobe are preferably linked covalently to one another via a unit which is capable of taking over the growing peptide chain in a ribosomally catalyzed translation reaction with formation of a covalent bond. Said unit in this context comprises, for example, a puromycin molecule or puromycin analog and/or an amino acid or an amino acid analog. In this connection, see also for example Roberts et al. (1997) Proc. Natl. Acad. Sci.
USA 94: 12297, WO 98/16636 and Krayevsky et al. (1979) Progress in Nucleic Acids Research and Molecular Biology 23:1.
In addition to selective labeling of particular species from the biological material provided with a specifically binding bioprobe, it is also possible to label said species with a fluorescent dye, a dye (such as, for example, propidium iodide, Calcofluor), an appropriately labeled specifically binding antibody (e.g., FITC), a radiolabeled (e.g. 35S-methionine) or another compound which enables simple detection of the biological material.
The biological materials labeled by means of the bioprobe may be detected and/or fractionated either electrophoretically using a constant electric field, for example by free-flow electrophoresis, or by dielectrophoresis using an inhomogeneous alternating field. Using the bioprobes, in particular in DEP, can significantly improve the resolution.
The inventive method of labeling biological species with bioprobes and subsequent fractionation of the biological material by electrophoresis or dielectrophoresis may be applied particularly preferably in the use of biochips. Preference should be given here to applying biochips as described by Cheng et al. (Cheng et al. (1998) Anal. Chem. 70:2321).
Biochips allow carrying out the separation and/or detection in a miniaturized form. Miniaturization can additionally reduce the experimental complexity, for example in comparison with FACS.
The dielectric fractionation of cells on a chip has already been described (Cheng et al. (1998) Anal. Chem.
70:2321) in this specific case, the differences in the dielectric properties of the species to be fractionated were large enough to make a fractionation possible. The use of the bioprobes of the invention allows a fractionation of biological species even if the differences in the dielectric properties of said biological species themselves are not large enough to make fractionation via dielectrophoresis possible.
Examples Example l:
Preparation of a bioprobe The bioprobe is prepared starting from a DNA sequence via an in vitro transcription and translation.
According to Roberts and Szostak (1997; Proc. Natl.
Acad. Sci. USA 94: 12297), the peptide forming during translation is covalently linked to its mRNA via a puromycin molecule. Thus the peptide portion is the specific binder whereas the mRNA portion, due to its strong negative charge in the neutral pH region, alters the physical properties of the biological material such that selection or detection is made possible. In the exemplary embodiment, the bioligical material is a population of yeast cells of the species Saccharomyces cerevisiae of mating type MATa, which express the a-factor receptor (STE2) (Davis and Davey (1997) Biochem. Soc. Trans. 25: 1015). The detailed procedure is described in the following: starting from a DNA
sequence (Seq 1) which can be prepared via standard methods (oligonucleotide synthesis) or which is commercially available (e. g. INTERACTIVA The Virtual Laboratory, Ulm), a double-stranded DNA molecule (Seq 2) is generated via a polymerase chain reaction (PCR). The DNA molecule contains the following sequence regions: a T7 promoter sequence, a TMV translation initiation sequence, a coding region containing a 5'-encoded E tag, an a-factor sequence and a 3'-encoded Strep tag. The PCR is carried out according to the art as follows:
The following ingredients are added to a PCR reaction vessel:
1 u1 of DNA (from oligonucleotide synthesis, corresponds to 1 nmol, Seq 1) 10 u1 of Taq polymerase buffer, lOx (Promega, Mannheim) 10 p1 of 25 mM MgCl2 (Promega, Mannheim) 10 u1 of 2.5 mM dNTP mix (Promega, Mannheim) 10 u1 of 10 pM primer 1 (Seq 3) 10 ~1 of 10 uM primer 2 (Seq 4) 2 u1 of 5 U/ul Taq polymerase (Promega, Mannheim) The PCR program is characterized as follows:
10 cycles of 1 min at 95°C, 2 min at 55°C, 2 min at ?2°C
The DNA is quantified and approximately 1 nmol of the double-stranded DNA is used as template for in vitro transcription. The transcription is carried out using a commercially available system from Ambion (Austin, USA). The standard mixture is as follows:
50 u1 of DNA template (1 nmol) 20 p1 of reaction buffer (Ambion, Austin) 20 u1 of 75 mM ATP (Ambion, Austin) _ 20 u1 of 75 mM CTP (Ambion, Austin) 20 p1 of 75 mM GTP (Ambion, Austin) 20 ~zl of 75 mM UTP (Ambion, Austin) 20 u1 of enzyme mix (Ambion, Austin) 30 u1 of H20 The mixture is incubated at 37°C for one hour. The RNA
is worked up via phenol-chloroform extraction (Davis et al. 1994) and then quantified.
In order to prepare the bioprode, the mRNA must be modified at its 3' end such that a short DNA sequence is present on the mRNA and a puromycin molecule is present on the 3' end of said short DNA sequence. This technique is described by Roberts and Szostak (1997;
see above). In the exemplary embodiment, the modification is carried out as follows:
2 nmol of mRNA
2 nmol of linker (Seq 5; INTERACTIVA, Ulm) 2 nmol of splint (Seq 6; INTERACTIVA, Ulm) H20 to 125 u1 The mixture is heated at 70°C for 3 min and cooled at room temperature for 15 min. Then 15 u1 of lOx ligase buffer (Promega, Mannheim) and 10 u1 of 20 U/ul T4 DNA
ligase (Promega, Mannheim) are added. The puromycin carrying linker is ligated to the mRNA by incubating at room temperature for 4 h.
The total mixture is admixed with 10 nmol of antisplint (Seq 7) and heated at 80°C for 5 min. The ligation mixture is then cooled on ice and the ligated mRNA is quantified.
The bioprobe is prepared by adding 10 u1 of s5S-methionine (APbiotech, Freiburg), 15 u1 of amino acid mastermix without methionine (Ambion, Austin) and 200 u1 of Retic Lysate IVT (Ambion, Austin) to 200 pmol of ligated mRNA and translating said mRNA. H20 is added to 300 u1. The mixture is incubated at 30°C for 30 min.
Then 100 p1 of 2.5 M KCl and 70 u1 of 1 M MgCl2 are added and the mixture is stored at -20°C overnight.
The bioprobes are worked up by adding 10 ml of binding buffer (100 mM Tris/HC1 pH 8.0; 10 mM EDTA pH 8.0; 1 M
i NaCl; 0.250 Triton X-100) to the translation mixture and adding to that 10 mg of oligo-dT cellulose (Apbiotech, Freiburg). The mixture is incubated at 4°C
for one hour. The cellulose with the bound bioprobes is removed by filtration and washed with 8 ml of binding buffer. The bioprobes are eluted with 4 times 100 u1 of H20. The bioprobes are quantified by determining the 35S
decays in a scintillation counter and can then be used for binding to the biological material.
Sequences Seq 1 GGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGC
AACTAAAACCTGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAA
Seq 2 .
TAATACGACTCACTATAGGGACAATTACTATTTACAATTACAATGGGTGCGCCG
GTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGCAACTAAAACC
TGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAAGCAGGTGCATCCG
CT
Seq 3 TAA TAC GAC TCA CTA TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG GGT
GCG CCG GTG CCG TAT
Seq 4 AGC GGA TGC TTT CTC AAA CTG
Seq 5 CC-Puromycin Seq 6 GCGCGCTTTTTTn?NAGCGGATGC
i ' SEQUENCE LISTING
<110> Xzillion GmbH & Co. KG
<120> Bioprobes and use thereof <130> 200at15 <140>
<141>
<150> 10033194.7 <151> 2000-07-07 <160> 6 <170> PatentIn Ver. 2.1 <210> 1 <211> 102 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: alpha factor <900> 1 ggtgcgccgg tgccgtatcc ggatccgctg gaaccgcqtt ggcattggtt gcaactaaaa 60 cctggccaac caatgtactg gagccacccg cagtttgaga as 102 <210> 2 <211> 162 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PRE fusagene <400> 2 taatacgact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60 tatccggatc cgctggaacc gcgttggcat tggttgcaac taaaacctgg ccaaccaatg 120 tactggagcc acccgcagtt tgagaaagca ggtgcatccg ct 162 <210> 3 <211> 63 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PCR primer ..
_ WO 02/04656 PCT/EPOl/07259 <400> 3 taataegact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60 tat 63 <210> 9 <211> 21 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PCR primer <900> 4 agcggatgct ttctcaaact g 21 <210> 5 <211> 29 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: linker with puromycin on 3' end <400> 5 aaaaaaaaaa aaaaaaaaaa aaaaaaacc 29 <210> 6 <211> 25 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: splint <400> 6 gcgcgctttt tttttnagcg gatgc 25
Examples of methods utilizing said properties are electrophoresis, gel filtration, affinity chromato-graphy and centrifugation.
Methods in which the biological material is selectively labeled in a specific manner and in which separation or detection of the various species is made possible only due to the label or due to the properties altered by said label are all methods which are based on an antibody-antigen interaction. Examples of these are EZISA (enzyme-linked immunosorbent assay) methods and particular variants of FACS (fluorescence-activated cell sorting) and MACS (magnetic activated .cell sorting). In these cases, an enzyme, a fluorescent dye or a magnetic bead is selectively bound to particular species of the biological material by using specifically binding antibodies, in order to make possible detection or purification of the species labeled in this way.
An example which may be mentioned of a method in which it is very difficult to fractionate biological material is free-flow electrophoresis (FFE) (Bauer J. (1999) J.
Chrom. B 722: 55). In this method, a laminar liquid stream is passed between two glass plates close to one another. Applying an electric field perpendicular to the direction of flow makes it possible to fractionate the various species of the biological material provided, due to their different charge. If, for example, FFE is used for fractionating cells, said cells are electrically attracted by the cathode due to their negative charge. The lateral migration velocity of the cells in this case depends on the surface charge density of the cells. Cells with different surface charge densities have different lateral migration velocities and thus can be separated from one another.
The decisive disadvantage of FFE is the fact that biological material very often has very similar charge properties. All cells, for example, have a negative and, in addition, very often nearly identical surface charge density and thus can be separated from one another by means of FFE only with great difficulty. In FFE an adequate resolution can often be achieved only if the surface charge density of the cells has been modified sufficiently by a pathogenic change. For this reason, the use of FFE has decreased sharply today and the method has been displaced by other often more expensive and technically more complicated methods.
In the relatively new method of dielectrophoresis (Fiedler et al. (1998) Anal. Chem. 70: 1909; Betts et al. (1999) J. Appl. Microbiol. Symp. Suppl. 85: 201), too, problems have to be dealt with, which are similar to those arising in electrophoretic methods such as the above-described FFE. Dielectrophoresis (DEP) is a method in which the dielectric properties of biological material are utilized in order to separate said material from one another. Dielectrophoresis takes place when biological material is subjected to inhomogeneous alternating electric fields. The biological material moves in the inhomogeneous electric field due to its dielectric properties (permanent or inducible electric dipole), making a fractionation possible as a result.
For example, cells contain various regions which can be polarized and thus be utilized for dielectrophoresis.
These regions include the electric charge bilayer surrounding a cell, the cell membranes marking the boundaries of the cell or cell organelles, and also the polar cytoplasm in the cell interior.
Dielectrophoresis may be used, for example, for fractionating cells, bacteria and other microorganisms.
However, it is conceivable to use dielectrophoresis also for fractionating other biological material such as, for example, nucleic acids, proteins, lipids or other organic compounds.
Examples of possible applications of dielectrophoresis are the testing of drinking water, food and biological fluids with regard to pathogenic microorganisms and the concentration of stem cells from bone marrow or peripheral blood.
Dielectrophoresis has the disadvantage that the dielectric properties of biological material, too, are often very similar, thus making a fractionation of different species more difficult.
It is therefore the object of the present invention to increase the resolution of electrophoretic and/or dielectrophoretic methods and thus to make available an improved detection and/or purification method.
The object is achieved by specific binding of bioprobes to a particular species or to a group of particular - species from a pool of biological material containing at least one species, as a result of which the electric and/or dielectric properties of the species labeled in this way are altered selectively and specifically, thus making it possible to purify and/or detect the species labeled in this way or the complex of bioprobe and biological species, which has formed due to binding of said bioprobe.
According to the invention, the biological material here comprises in particular at least one species of at least one group selected from the group consisting of tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds, and the species may also be modified.
The essential advantage of the invention described here compared with the usual methods is the possibility of simple and rapid separation and/or detection of the _ 5 _ complex of biological species and bioprobe, which has formed due to binding of said bioprobe to said biological species, and this advantage can be used on the one hand to enable detection or purification of the species selectively labeled in this way but, conversely, may also be used for selectively removing one or more bioprobes from a pool of bioprobes with different binding specificities. In the latter case it is possible, prior to carrying out the separation method, to contact the biological material in particular with a library of inventive bioprobes of different binding specificity so that selectively binding bioprobes can be identified and isolated from said library.
The decisive advantage of the method of the invention compared with methods such as FRCS and MACS is that the bioprobe need not be modified in a complicated manner by a fluorescent dye or a magnetic bead in order to enable detection and/or purification of the labeled biological material, and that likewise the complex apparatus unavoidable in methods such as FACS or MACS
is not needed.
The inventive method for detecting or purifying biological material may in particular comprise the following steps:
a) Providing biological material which contains different species.
b) Adding a bioprobe containing a part A which binds specifically to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by specific binding of said bioprobe so that detection and/or purification of said labeled species by electrophoresis and/or dielectrophoresis is made possible or improved.
c) Constructing an electric field for detecting or purifying said complex or complexes of one or more iological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
For the purpose of identifying and isolating bioprobes specifically binding to biological material provided, the method of the invention may in particular comprise the following steps:
a) Providing biological material which contains at least one species.
b) Adding a bioprobe or various bioprobes comprising in each case a part A which can specifically bind to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by binding of a bioprobe so that detection and/or purification of a complex forming in this way of one or more biological species and biological material become possible, with the various bioprobes having different binding specificities and at least one of the bioprobes added binding to said biological material.
c) Constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
The various bioprobes according to (b) in this case may be in particular a library of bioprobes of different substrate specificity, which comprises more than 109, in particular more than 1012, different bioprobes.
The bioprobes of the invention comprise a part A which mediates the specific interaction between the probe and the biological material and a part B which alters the properties of said biological material in the desired way, i.e. alters the charge with regard to electrophoresis and the dielectricity constant or specific conductivity or polarizability with regard to dielectrophoresis. There is no need here for the parts A and B to be structurally separated from one another.
Part A of the bioprobe is or comprises, for example, a peptide binding specifically to biological material. In this case, a specific interaction between the peptide and a peptide receptor present on [sic] the biological material is formed. An example of such an interaction is that of the Saccharomyces cerevisiae a-factor receptor Ste2p with the corresponding a-factor peptide ligand. Further examples are the TSH receptor (Schuppert et al. (1996) Thyroid 6: 575), the FSH
receptor (Tilly et al. (1992) Endocrinology 131: 799), the EGF receptor (Christensen et al. (1998) Dan. Med.
Bull. 45: 121), the TNF receptor (Murphy et al. (1994) Thymus 23: 177), the transferrin receptor (Ponka and Lok (1999) Int. J. Biochem. Cell Biol. 31: 1111), the insulin receptor (Milazzo et al. (1992) Cancer Res. 52:
3924), the FGF receptor (Kiefer et al. (1991) Growth Factors 5: 115), the TGF(3 receptor (Derynck et al.
(1994) Princess Takamatsu Symp. 24: 264), the IGF
receptor (Peyrat and Bonneterre (1992) Breast Cancer Res. Treat. 22: 59), the angiotensin II receptor (Smith and Timmermans (1994) Curr. Opin. Nephrol. Hypertens.
3: 112) and the somatostatin receptor (Schonbrunn (1999) Ann. Oncol. 10 Suppl. 2: 17) and the interactions with their particular ligands. Similarly, all peptides capable of binding specifically to the desired biological material can be used.
The specifically binding part A may also be an antibody, in particular for example an antibody recognizing marker structures on cell surfaces. An example of such a marker structure is the transferrin receptor. Furthermore, part A may also comprise a low molecular weight structure which binds specifically to biological material. An example of such a low molecular weight structure is acetylcholine which is specifically bound by the acetylcholine receptor. However, part A of the bioprobe may also be, for example, a carbohydrate, a lipid, an inorganic compound, a nucleic acid or any other ligand binding specifically to biological material or may comprise one of these groups.
Part B of the bioprobe, which is linked to part A is or comprises a structure which, when binding to the biological material, alters the electric and/or dielectric properties thereof such that the behavior of the biological material modified in this way changes in an electric and/or dielectric field. This may take place, for example, by introducing an electric charge, by altering the dielectricity constants and/or by altering the specific conductivity of said biological material. Examples of carriers of electric charge are in this context acidic and basic amino acids (asparate, glutamate, lysine, arginine), nucleic acids (single-stranded and double-stranded DNA and RNA, DNA/RNA
heteroduplex), organic acids and bases (tartrate, citrate, amines), polyquaternary amines and inorganic charge carriers. Structures which alter the dielectric behavior of the biological material are, in addition to the structures mentioned above, also hydrophobic, electrically neutral structures such as lipids, fatty acids, waxes, oils and sterols, for example.
In a preferred embodiment, part B of the bioprobe is or comprises a nucleic acid which is covalently linked to part A of the bioprobe directly or via an intermediate link. The nucleic acid in this case comprises preferably at least 5 or 10, particularly preferably at least 15 or 20, nucleotides.
In a particularly embodiment of the bioprobe, part B of said bioprobe comprises a nucleic acid which comprises the genetic information for part A of the bioprobe, with part A of the bioprobe comprising a protein or _ g _ - polypeptide and part B of the bioprobe comprising a single- or double-stranded RNA or DNA or an RNA/DNA
heteroduplex which is covalently linked to part A of the bioprobe. Here, too, part A of the bioprobe particularly preferably comprises a ligand for the Ste2p receptor, the TSH receptor, the FSH receptor, the EGF receptor, the TNF receptor, the transferrin receptor, the insulin receptor, the FGF receptor, the TGF~i receptor, the IGF receptor, the angiotensin II
receptor or the somatostatin receptor and part B of the bioprobe in each case a nucleic acid which comprises the sequences coding for said ligands. In this preferred embodiment, part A and part B of the bioprobe are preferably linked covalently to one another via a unit which is capable of taking over the growing peptide chain in a ribosomally catalyzed translation reaction with formation of a covalent bond. Said unit in this context comprises, for example, a puromycin molecule or puromycin analog and/or an amino acid or an amino acid analog. In this connection, see also for example Roberts et al. (1997) Proc. Natl. Acad. Sci.
USA 94: 12297, WO 98/16636 and Krayevsky et al. (1979) Progress in Nucleic Acids Research and Molecular Biology 23:1.
In addition to selective labeling of particular species from the biological material provided with a specifically binding bioprobe, it is also possible to label said species with a fluorescent dye, a dye (such as, for example, propidium iodide, Calcofluor), an appropriately labeled specifically binding antibody (e.g., FITC), a radiolabeled (e.g. 35S-methionine) or another compound which enables simple detection of the biological material.
The biological materials labeled by means of the bioprobe may be detected and/or fractionated either electrophoretically using a constant electric field, for example by free-flow electrophoresis, or by dielectrophoresis using an inhomogeneous alternating field. Using the bioprobes, in particular in DEP, can significantly improve the resolution.
The inventive method of labeling biological species with bioprobes and subsequent fractionation of the biological material by electrophoresis or dielectrophoresis may be applied particularly preferably in the use of biochips. Preference should be given here to applying biochips as described by Cheng et al. (Cheng et al. (1998) Anal. Chem. 70:2321).
Biochips allow carrying out the separation and/or detection in a miniaturized form. Miniaturization can additionally reduce the experimental complexity, for example in comparison with FACS.
The dielectric fractionation of cells on a chip has already been described (Cheng et al. (1998) Anal. Chem.
70:2321) in this specific case, the differences in the dielectric properties of the species to be fractionated were large enough to make a fractionation possible. The use of the bioprobes of the invention allows a fractionation of biological species even if the differences in the dielectric properties of said biological species themselves are not large enough to make fractionation via dielectrophoresis possible.
Examples Example l:
Preparation of a bioprobe The bioprobe is prepared starting from a DNA sequence via an in vitro transcription and translation.
According to Roberts and Szostak (1997; Proc. Natl.
Acad. Sci. USA 94: 12297), the peptide forming during translation is covalently linked to its mRNA via a puromycin molecule. Thus the peptide portion is the specific binder whereas the mRNA portion, due to its strong negative charge in the neutral pH region, alters the physical properties of the biological material such that selection or detection is made possible. In the exemplary embodiment, the bioligical material is a population of yeast cells of the species Saccharomyces cerevisiae of mating type MATa, which express the a-factor receptor (STE2) (Davis and Davey (1997) Biochem. Soc. Trans. 25: 1015). The detailed procedure is described in the following: starting from a DNA
sequence (Seq 1) which can be prepared via standard methods (oligonucleotide synthesis) or which is commercially available (e. g. INTERACTIVA The Virtual Laboratory, Ulm), a double-stranded DNA molecule (Seq 2) is generated via a polymerase chain reaction (PCR). The DNA molecule contains the following sequence regions: a T7 promoter sequence, a TMV translation initiation sequence, a coding region containing a 5'-encoded E tag, an a-factor sequence and a 3'-encoded Strep tag. The PCR is carried out according to the art as follows:
The following ingredients are added to a PCR reaction vessel:
1 u1 of DNA (from oligonucleotide synthesis, corresponds to 1 nmol, Seq 1) 10 u1 of Taq polymerase buffer, lOx (Promega, Mannheim) 10 p1 of 25 mM MgCl2 (Promega, Mannheim) 10 u1 of 2.5 mM dNTP mix (Promega, Mannheim) 10 u1 of 10 pM primer 1 (Seq 3) 10 ~1 of 10 uM primer 2 (Seq 4) 2 u1 of 5 U/ul Taq polymerase (Promega, Mannheim) The PCR program is characterized as follows:
10 cycles of 1 min at 95°C, 2 min at 55°C, 2 min at ?2°C
The DNA is quantified and approximately 1 nmol of the double-stranded DNA is used as template for in vitro transcription. The transcription is carried out using a commercially available system from Ambion (Austin, USA). The standard mixture is as follows:
50 u1 of DNA template (1 nmol) 20 p1 of reaction buffer (Ambion, Austin) 20 u1 of 75 mM ATP (Ambion, Austin) _ 20 u1 of 75 mM CTP (Ambion, Austin) 20 p1 of 75 mM GTP (Ambion, Austin) 20 ~zl of 75 mM UTP (Ambion, Austin) 20 u1 of enzyme mix (Ambion, Austin) 30 u1 of H20 The mixture is incubated at 37°C for one hour. The RNA
is worked up via phenol-chloroform extraction (Davis et al. 1994) and then quantified.
In order to prepare the bioprode, the mRNA must be modified at its 3' end such that a short DNA sequence is present on the mRNA and a puromycin molecule is present on the 3' end of said short DNA sequence. This technique is described by Roberts and Szostak (1997;
see above). In the exemplary embodiment, the modification is carried out as follows:
2 nmol of mRNA
2 nmol of linker (Seq 5; INTERACTIVA, Ulm) 2 nmol of splint (Seq 6; INTERACTIVA, Ulm) H20 to 125 u1 The mixture is heated at 70°C for 3 min and cooled at room temperature for 15 min. Then 15 u1 of lOx ligase buffer (Promega, Mannheim) and 10 u1 of 20 U/ul T4 DNA
ligase (Promega, Mannheim) are added. The puromycin carrying linker is ligated to the mRNA by incubating at room temperature for 4 h.
The total mixture is admixed with 10 nmol of antisplint (Seq 7) and heated at 80°C for 5 min. The ligation mixture is then cooled on ice and the ligated mRNA is quantified.
The bioprobe is prepared by adding 10 u1 of s5S-methionine (APbiotech, Freiburg), 15 u1 of amino acid mastermix without methionine (Ambion, Austin) and 200 u1 of Retic Lysate IVT (Ambion, Austin) to 200 pmol of ligated mRNA and translating said mRNA. H20 is added to 300 u1. The mixture is incubated at 30°C for 30 min.
Then 100 p1 of 2.5 M KCl and 70 u1 of 1 M MgCl2 are added and the mixture is stored at -20°C overnight.
The bioprobes are worked up by adding 10 ml of binding buffer (100 mM Tris/HC1 pH 8.0; 10 mM EDTA pH 8.0; 1 M
i NaCl; 0.250 Triton X-100) to the translation mixture and adding to that 10 mg of oligo-dT cellulose (Apbiotech, Freiburg). The mixture is incubated at 4°C
for one hour. The cellulose with the bound bioprobes is removed by filtration and washed with 8 ml of binding buffer. The bioprobes are eluted with 4 times 100 u1 of H20. The bioprobes are quantified by determining the 35S
decays in a scintillation counter and can then be used for binding to the biological material.
Sequences Seq 1 GGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGC
AACTAAAACCTGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAA
Seq 2 .
TAATACGACTCACTATAGGGACAATTACTATTTACAATTACAATGGGTGCGCCG
GTGCCGTATCCGGATCCGCTGGAACCGCGTTGGCATTGGTTGCAACTAAAACC
TGGCCAACCAATGTACTGGAGCCACCCGCAGTTTGAGAAAGCAGGTGCATCCG
CT
Seq 3 TAA TAC GAC TCA CTA TAG GGA CAA TTA CTA TTT ACA ATT ACA ATG GGT
GCG CCG GTG CCG TAT
Seq 4 AGC GGA TGC TTT CTC AAA CTG
Seq 5 CC-Puromycin Seq 6 GCGCGCTTTTTTn?NAGCGGATGC
i ' SEQUENCE LISTING
<110> Xzillion GmbH & Co. KG
<120> Bioprobes and use thereof <130> 200at15 <140>
<141>
<150> 10033194.7 <151> 2000-07-07 <160> 6 <170> PatentIn Ver. 2.1 <210> 1 <211> 102 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: alpha factor <900> 1 ggtgcgccgg tgccgtatcc ggatccgctg gaaccgcqtt ggcattggtt gcaactaaaa 60 cctggccaac caatgtactg gagccacccg cagtttgaga as 102 <210> 2 <211> 162 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PRE fusagene <400> 2 taatacgact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60 tatccggatc cgctggaacc gcgttggcat tggttgcaac taaaacctgg ccaaccaatg 120 tactggagcc acccgcagtt tgagaaagca ggtgcatccg ct 162 <210> 3 <211> 63 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PCR primer ..
_ WO 02/04656 PCT/EPOl/07259 <400> 3 taataegact cactataggg acaattacta tttacaatta caatgggtgc gccggtgccg 60 tat 63 <210> 9 <211> 21 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: PCR primer <900> 4 agcggatgct ttctcaaact g 21 <210> 5 <211> 29 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: linker with puromycin on 3' end <400> 5 aaaaaaaaaa aaaaaaaaaa aaaaaaacc 29 <210> 6 <211> 25 <212> DNA
<213> Artificial sequence <220>
<223> Description of artificial sequence: splint <400> 6 gcgcgctttt tttttnagcg gatgc 25
Claims (20)
1. A method for detecting or purifying biological material by electrophoresis or dielectrophoresis, comprising [lacuna] following steps:
a) providing biological material which contains different species;
b) adding a bioprobe containing a part A which binds specifically to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by specific binding of said bioprobe so that detection and/or purification of said labeled species by electrophoresis and/or dielectrophoresis is made possible or improved;
c) constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
a) providing biological material which contains different species;
b) adding a bioprobe containing a part A which binds specifically to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by specific binding of said bioprobe so that detection and/or purification of said labeled species by electrophoresis and/or dielectrophoresis is made possible or improved;
c) constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
2. A method for detecting or purifying bioprobes which bind specifically to biological material by electrophoresis or dielectrophoresis, comprising the following steps:
a) providing biological material which contains at least one species;
b) adding a bioprobe or various bioprobes comprising in each case a part A which can specifically bind to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by binding of a bioprobe so that detection and/or purification of a complex forming in this way of one or more biological species and biological material become possible, with the various bioprobes having different binding specificities and at least one of the bioprobes added binding to said biological material;
c) constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
a) providing biological material which contains at least one species;
b) adding a bioprobe or various bioprobes comprising in each case a part A which can specifically bind to at least one of said species and a part B which alters the electric and/or dielectric properties of the one or more species labeled by binding of a bioprobe so that detection and/or purification of a complex forming in this way of one or more biological species and biological material become possible, with the various bioprobes having different binding specificities and at least one of the bioprobes added binding to said biological material;
c) constructing an electric field for detecting or purifying said complex or complexes of one or more biological species and specifically bound bioprobe by electrophoresis or dielectrophoresis.
3. The method as claimed in claim 1 or 2, wherein part A of the bioprobe is a protein, preferably an antibody or peptide, an inorganic compound, a carbohydrate, a nucleic acid, a lipid or another organic compound binding specifically to biological material or comprises at least one of said groups.
4. The method as claimed in claim 3, wherein part B
of the bioprobe is a nucleic acid, an electrically charged peptide, a polyquaternary amine, an organic acid, an organic base, an inorganic substance, a lipid, a fatty acid or a compound from the family consisting of waxes, oils and sterols or comprises at least one of said groups.
of the bioprobe is a nucleic acid, an electrically charged peptide, a polyquaternary amine, an organic acid, an organic base, an inorganic substance, a lipid, a fatty acid or a compound from the family consisting of waxes, oils and sterols or comprises at least one of said groups.
5. The method as claimed in claim 1 or 2, wherein part A of the bioprobe is a peptide or protein and part B of the bioprobe is a nucleic acid which codes for said peptide or protein and is bound covalently to said peptide or protein, with said peptide or protein binding covalently to said nucleic acid preferably via a puromycin molecule.
6. The method as claimed in any of claims 3 to 5, wherein the nucleic acid is a single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA or a DNA/RNA heteroduplex.
7. The method as claimed in any of claims 3 to 6, wherein the specifically binding peptide which is part A of the bioprobe or is included in said part is a ligand binding to a receptor from the group consisting of the following receptors: Ste2p receptor from Saccharomyces cerevisiae, TSH, FSH, EGF, TNF, transferrin, insulin, FGF, TGF.beta., IGF, angiotensin II and somatostatin receptors.
8. The method as claimed in any of claims 1 to 7, wherein the biological material is tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds or comprises at least one of said groups.
9. The method as claimed in any of claims 1 to 8, wherein the electrophoretic method is free flow electrophoresis.
10. The method as claimed in claim 1 or 2, wherein the electrophoretic or dielectrophoretic method is carried out using biochips.
11. The method as claimed in any of claims 1 to 10, wherein the material specifically labeled with the aid of the bioprobes is additionally labeled specifically in a different manner.
12. The method as claimed in claim 11, wherein the additional label is a color label, a fluorescent label or a radiolabel.
13. A molecule, denoted bioprobe hereinbelow, which contains a protein moiety which binds specifically to a receptor and is linked covalently to a nucleic acid either directly or via an intermediate link, with the nucleic acid preferably comprising more than 5 nucleotides, wherein said protein moiety of the molecule comprises a ligand for a receptor from the group consisting of the following receptors: Ste2p receptor from Saccharomyces cerevisiae, TSH, FSH, EGF, TNF, transferrin, insulin, FGF, TGF.beta., IGF, angiotensin II and somatostatin receptors.
14. The bioprobe as claimed in claim 13, wherein the nucleic acid comprises the genetic information for the protein moiety.
15. The bioprobe as claimed in claim 13 or 14, wherein the nucleic acid is single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA or a DNA/RNA heteroduplex.
16. A molecule, denoted bioprobe hereinbelow, which comprises a protein moiety which binds specifically to biological material and is covalently linked to a lipid molecule either directly or via an intermediate link, wherein the biological material is tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds or comprises at least one of said groups.
17. A molecule, denoted bioprobe hereinbelow, which comprises a protein moiety which binds specifically to biological material and is covalently linked to a polyquaternary ammonium compound either directly or via an intermediate link, wherein the biological material is tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds or comprises at least one of said groups.
18. The bioprobe as claimed in claim 16 or 17, wherein the protein moiety is a molecule comprising a ligand for a receptor from the group consisting of the following receptors: Ste2p receptor from Saccharomyces cerevisiae, TSH, FSH, EGF, TNF, transferrin, insulin, FGF, TGF.beta., IGF, angiotensin II and somatostatin receptors.
19. The bioprobe as claimed in any of claims 13 to 18, wherein the intermediate link comprises a puromycin molecule.
20. A complex of biological material and a bioprobe specifically bound to said material as claimed in claims 13 to 19, wherein the biological material is tissue, cells, cell organelles, viruses, proteins, peptides, nucleic acids, carbohydrates, lipids or other organic compounds or comprises at least one of said groups.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10033194A DE10033194C2 (en) | 2000-07-07 | 2000-07-07 | Bio probes and their use |
| DE10033194.7 | 2000-07-07 | ||
| PCT/EP2001/007259 WO2002004656A2 (en) | 2000-07-07 | 2001-06-26 | Bio-probes and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2415253A1 true CA2415253A1 (en) | 2002-01-17 |
Family
ID=7648218
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002415253A Abandoned CA2415253A1 (en) | 2000-07-07 | 2001-06-26 | Bio-probes and use thereof |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1305626A2 (en) |
| JP (1) | JP2004502462A (en) |
| AU (1) | AU2001277519A1 (en) |
| CA (1) | CA2415253A1 (en) |
| DE (1) | DE10033194C2 (en) |
| WO (1) | WO2002004656A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE332368T1 (en) * | 1997-01-21 | 2006-07-15 | Gen Hospital Corp | SELECTION OF PROTEINS USING RNA-PROTEIN FUSIONS |
| CA2323638A1 (en) * | 1998-04-03 | 1999-10-14 | Phylos, Inc. | Addressable protein arrays |
-
2000
- 2000-07-07 DE DE10033194A patent/DE10033194C2/en not_active Expired - Fee Related
-
2001
- 2001-06-26 EP EP01955323A patent/EP1305626A2/en not_active Withdrawn
- 2001-06-26 WO PCT/EP2001/007259 patent/WO2002004656A2/en not_active Application Discontinuation
- 2001-06-26 JP JP2002509509A patent/JP2004502462A/en active Pending
- 2001-06-26 AU AU2001277519A patent/AU2001277519A1/en not_active Abandoned
- 2001-06-26 CA CA002415253A patent/CA2415253A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| DE10033194C2 (en) | 2002-07-18 |
| AU2001277519A1 (en) | 2002-01-21 |
| WO2002004656A3 (en) | 2002-09-19 |
| DE10033194A1 (en) | 2002-01-24 |
| WO2002004656A2 (en) | 2002-01-17 |
| JP2004502462A (en) | 2004-01-29 |
| EP1305626A2 (en) | 2003-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6874017B2 (en) | Mutant pore | |
| AU761985B2 (en) | In vitro selection and optional identification of polypeptides using solid support carriers | |
| EP1530592B8 (en) | Chimeric mhc protein and oligomer thereof | |
| US20030032049A1 (en) | Sensitive, multiplexed diagnostic assays for protein analysis | |
| LU86238A1 (en) | METHOD FOR THE IDENTIFICATION OF NUCLEIC ACIDS | |
| EP3380607B1 (en) | Purification of polymerase complexes | |
| CA2369083A1 (en) | Biochemical purification devices with immobilized capture probes and their uses | |
| US20170356902A1 (en) | Method for separating biotinylated nucleic acid | |
| JP2002511583A (en) | Methods and apparatus for electroelution of biological samples | |
| EP1201753B1 (en) | Methods for the analysis of non-proteinaceous components using a protease from a bacillus strain | |
| JP2002541818A (en) | Highly sensitive phage display biomolecule detection | |
| CA2415253A1 (en) | Bio-probes and use thereof | |
| AU758744B2 (en) | Methods for the analysis of non-proteinaceous components using a protease from a bacillus strain | |
| WO2002070749A2 (en) | Methods and compositions for analyzing nucleic acids | |
| Cui et al. | Sepharose-supported DNA as template for RNA synthesis | |
| JP6781883B2 (en) | Aptamer selection method | |
| JP2006527993A (en) | Clean up beads | |
| CN107083388B (en) | Aptamer wh3 specifically binding to annexin A2 and application thereof | |
| WO2004056995A1 (en) | Process for producing an in vitro peptide expression library | |
| Lew et al. | [37] Affinity selection of polymerase chain reaction products by DNA-binding proteins | |
| JP2019106938A (en) | Nucleic acid recovery method and nucleic acid recovery kit | |
| JP2006246732A (en) | Nucleic acid purification supporter and method for purifying the same | |
| JP2004502462A5 (en) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |