CA2390387A1 - Method of diagnosing rheumatoid arthritis - Google Patents
Method of diagnosing rheumatoid arthritis Download PDFInfo
- Publication number
- CA2390387A1 CA2390387A1 CA002390387A CA2390387A CA2390387A1 CA 2390387 A1 CA2390387 A1 CA 2390387A1 CA 002390387 A CA002390387 A CA 002390387A CA 2390387 A CA2390387 A CA 2390387A CA 2390387 A1 CA2390387 A1 CA 2390387A1
- Authority
- CA
- Canada
- Prior art keywords
- peripheral blood
- seq
- blood mononuclear
- mononuclear cells
- rheumatoid arthritis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4713—Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Rehabilitation Therapy (AREA)
- Medicinal Chemistry (AREA)
- Rheumatology (AREA)
- Pathology (AREA)
- Diabetes (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention provides a method for diagnosing rheumatoid arthritis which comprises digesting human genomic DNA with a restriction enzyme EcoRI and detecting an about 7 kb DNA fragment which hybridizes with a probe having the base sequence of the position 159-424 in SEQ ID NO: 1, or which comprises digesting human genomic DNA with a restriction enzyme Dral and detecting an about 1.5 kb DNA fragment which hybrizes with a probe having the base sequence of the position 159-424 in SEQ ID NO: 1. The invention also provides a method for diagnosing rheumatoid arthritis which comprises stimulating the peripheral blood mononuclear cells in a subject with phorbol 12-myristate 13-acetate (PMA) and/or phytohemagglutinin (PHA), and comparing the amount of expression product in the peripheral blood mononuclear cells with the amount of the same product in the peripheral blood mononuclear cells in a healthy person stimulated by PMA and/or PHA, wherein the expression product is expressed from the base sequence of at the least 689-760 position in SEQ ID NO: 1.
Description
. . r , , "T' ~' I-,: .. _.-..:... _ .._~_ ::::~ . _.:, '.:- _-' '=' ,.,- :a_. ;.~_- -. ~ 1.
D'!Ol'~
~athod to: Dia~osia; Rheumatoid Art~itis Toclaoieal FYald The invrntion oft the pres~lt application relates to a zneihod for diagzlosing disease gme ix~ human rheumatoid arthritis.
to Baclc~ound Art The condition of arthriti~ and joint destruraon that are the cause of 1 S rheurnatnid axthritia, particularly their pathological process, has gradua,Ily betel elucidated through divrrsc studits. Many autaiaamune diaea~c9 to which the rheumatoid arthritss txloags are fcrst developed into a dis~~ and became worst thretrgh overlappitlg m8iay causal factors. Ixx this situation, in order to make correct investigation of the diseases and an appropriate therapy therefor, the true 20 form of naulti-factorial ~tezectinn per x ties to be elucadated_ 'rl~ough the incidezioc~ rata of rheumatoid arr~itis (RA) ie 1% or less worldwide (N. Engl_ ,1. Mod. 322: 1277-1289, I990), the ratio of the risk for sibling of patients is approximately $% or more (Cell, 85_ 311-3I8, 1996), and accordingly '?5 some genetic factors haws been assumed as causative factors. The molecular gersetic techniques or generic engineering rechrriqucs usually used in idendtc:auon of the genetic fadora of the diseases. however, do riot i~.tncrtion effectively Far autoimmune diseases. The mason is that the incident mechanism of at1t01~lune dI~E~'3CS 19 quite different from a biologically couple iriechaniam in 34 cancers in which abnormal pz~oliferation is caused by a single gc~e mooeoion. Ori the' other hand, the so far classical genetic tochr~iques investigating the hereditary base of diseases have eluGidat~d that the autoiu7murle diseases are caused by a multiple factorial inheritance, buL it has not be possible to follow after the inner part or the tnzc form. Thus, lm fact, with respect to the genes predispoaixzg Go rheumatoid arthrida, not only their entities but also their gene loci an the chromosome has not yet beers elucidated.
In thi9 situation, tha inventors of the present application conducted a linkage analysis using a microsatelite marloes on a patient with rheumatoid i0 arthritis and his blood relatives and identified the 3 genetic loci at which the disuse genes of the rheumatoid arthritis are located. (Internatinrral Immunology 10(12): 1891-1895, 1998; JQUrnal of Clinical Rheumatology 4(3): 156-158, 1998).
The following disease genies have been filed as a Patent Application PC'i /JP98/01665.
is ( 1 ) DiBeaeC gerxe of rheumatoid arthritiar in tha human chromoson~le 1 which is loeatcd wirhin ti ccnti ru,organ (cM) from the DNA sequence to which a microaatelite marker D 15214 gnd/or D 15253 hybridize.
(2) L7isease ~e of rheumatoid arthritis in the human e3tromosome 8 which ~O is loea,TCd withirn * 1 cM 5~osa the DNA scdueacx to which a rniao~at~lite marker D8S556 hybridize.
D'!Ol'~
~athod to: Dia~osia; Rheumatoid Art~itis Toclaoieal FYald The invrntion oft the pres~lt application relates to a zneihod for diagzlosing disease gme ix~ human rheumatoid arthritis.
to Baclc~ound Art The condition of arthriti~ and joint destruraon that are the cause of 1 S rheurnatnid axthritia, particularly their pathological process, has gradua,Ily betel elucidated through divrrsc studits. Many autaiaamune diaea~c9 to which the rheumatoid arthritss txloags are fcrst developed into a dis~~ and became worst thretrgh overlappitlg m8iay causal factors. Ixx this situation, in order to make correct investigation of the diseases and an appropriate therapy therefor, the true 20 form of naulti-factorial ~tezectinn per x ties to be elucadated_ 'rl~ough the incidezioc~ rata of rheumatoid arr~itis (RA) ie 1% or less worldwide (N. Engl_ ,1. Mod. 322: 1277-1289, I990), the ratio of the risk for sibling of patients is approximately $% or more (Cell, 85_ 311-3I8, 1996), and accordingly '?5 some genetic factors haws been assumed as causative factors. The molecular gersetic techniques or generic engineering rechrriqucs usually used in idendtc:auon of the genetic fadora of the diseases. however, do riot i~.tncrtion effectively Far autoimmune diseases. The mason is that the incident mechanism of at1t01~lune dI~E~'3CS 19 quite different from a biologically couple iriechaniam in 34 cancers in which abnormal pz~oliferation is caused by a single gc~e mooeoion. Ori the' other hand, the so far classical genetic tochr~iques investigating the hereditary base of diseases have eluGidat~d that the autoiu7murle diseases are caused by a multiple factorial inheritance, buL it has not be possible to follow after the inner part or the tnzc form. Thus, lm fact, with respect to the genes predispoaixzg Go rheumatoid arthrida, not only their entities but also their gene loci an the chromosome has not yet beers elucidated.
In thi9 situation, tha inventors of the present application conducted a linkage analysis using a microsatelite marloes on a patient with rheumatoid i0 arthritis and his blood relatives and identified the 3 genetic loci at which the disuse genes of the rheumatoid arthritis are located. (Internatinrral Immunology 10(12): 1891-1895, 1998; JQUrnal of Clinical Rheumatology 4(3): 156-158, 1998).
The following disease genies have been filed as a Patent Application PC'i /JP98/01665.
is ( 1 ) DiBeaeC gerxe of rheumatoid arthritiar in tha human chromoson~le 1 which is loeatcd wirhin ti ccnti ru,organ (cM) from the DNA sequence to which a microaatelite marker D 15214 gnd/or D 15253 hybridize.
(2) L7isease ~e of rheumatoid arthritis in the human e3tromosome 8 which ~O is loea,TCd withirn * 1 cM 5~osa the DNA scdueacx to which a rniao~at~lite marker D8S556 hybridize.
(3) Disease game of rheuzaatosd grthritis iza the human chromosome X which is located within t 1 .M from the DNA xquence to which microaatelit~e markers DXS 100 I , DXS 1047, DXS 125, DXS 1227' and J or DXS 1232 hybridize-The present inventors continued to investigate the resgeczive genes of the diseases in the above-described earli~cr patent application. A9 results, they found that the physical pc~sitlans of the markers D15214 and D1S253 on the GH4 Radiation hybrid map relating to the above disease genes are mapped on 30 2I.14cR3000 arid 23.56cR3000. resPcCtiveJ;y, and that the death receptor gene a "_w ::-~ _ _ _',~_ :'.~'. _.r-, DR,3 is located at the s~eighbor 22.14cR3000 (Nature 384; 3?2-3?5, 199b; Proc.
Natl. Acad. Sci. USA 94: 4615--4619, 1997; Ges~cmics 49; 385-393, 199$).
The pr~esazt application is intended to provide a method for highly precisely diagnosing a sign of rhtuuiaLoid e~rthritis aia~nng at the DR3 gcnc based on the above Ersdings made by the p~st~rst invCntors.
Disclosnse of Iatne~t3on The pre9e~ot application, as the invention for solvir~g the above-described preblems, provide3~ a method for dia$noging rheumatoid arthritxa which a~mpri~
digesting human gcrlomic DNA with a restriction ensyme F.c»RI and detecting 3n about ? kb DNA fragznrnt which hybridixcs with a probe hawing the base sequence of the position 159-42~ in SEQ ID NC7: 1.
Further, the pras~t application provides a method for diagnosing rheumatoid arthritis which comprises dig~e9tizig human genornio DNA mlch a restriction azzyaze Dral and detecting an about 1.5 kb DNA fragment which 2(5 ls.ybridia~ with s probe having rhc base aeqWeace of the position 159-X24 us SEQ
m rro: 1 _ P~lrthermor~, the application provides a method for dis~nosing rheumatoid arthritis. which comprit3es stimulating the peripheral blood mflnorruclear cells in a subject with phorbol 1,2-rayristate 13-acetate (PMA}
and/or phytoh~nna~jutindla (PHA), and comparing the amount of mRNA in the peripheral blood mononudcar cello with the amount of the same mRNA in tho peripheral blood mononuclear cells in a healthy person stirnulaced by PMA arxd/or Pl-lA.
wherein the mRNA is e.Ypressed from the bye sequence of at the least 689-760 3Q position in SEQ IL7 1~C): 1 rlwthGrz~ore, the application provides a method for diagnosing rheumatoid arthritis which compniscs stimulating the peripheral blood manonudear cells in a subject with phorbol 1~-rnyristatc 13-acetate (PMAj and/or phytohemagglutinirs (PHA!, and comparing the amount of a polypepride expressed in the peiigheral blood mononuclear ceps with the amount of the same polypeptide expressed in the peripheral blood manaouclear cells in a healthy person stimulated by PMA audJar PHA, wherein the polypeptide has the amisia acid sequence of at the least 20I-224 position in SEQ 1Z? NO: 1.
Iti the above diagnostic atethods, flit diagnosis is made accardiag to a criterion that the mRNA or pvlypeptide expressed irz the RA patients ~a greater in quantity than that e.~cpressed iti hralthy persons (concretely, 2 times or mosey.
ZS
Hrlef DescrtpttoYS of Dnavi~g Fig. 1 shows the results of the Southtrri anakysis fox F.co~ fragturnta from the reslxctivc gertomic pNA$ of RA patients and healthy persanr~.
~o Flg. 2 shows the results of the Sauttxe~ arxalysis for DrvI li'a~Crr'ts from the respective genoW it DNAa of RA paaerrts and hea~Ithy persons.
F'ig. 3 shouts the results ef quantitatively deterniined mRNAs amount for ~5 the call transmt~abrane region amd dtath domei,ri region of the DR3 ger~.e of RA
patients arid healthy persons.
Best Mode to: Carryiag Out the >investdon .... __. .___ ,. --',. _ '.:=~-- -_:..... .,._: =,. -_. _:__. ~- --,_ : - ,_ The following exaraples serve to explain the best mode for carryirxg out the invcntiors specifically and in dtt~ but sre not intended to limit the invcntiorz.
l~ple 1 RF'L~' A~rl~rais of BcoRI fraponeab Genomic DNAs were prepared from the peripheral blood of healthy persona and RA patient9 according to the guanidine thiocyanate method (Nippon to Yuketsu Gakkai Zasshi (Journal of the Japan Society of Hlood Transfusion), 40(2):
4I3, 1994). Briefly, 20 ml of cell meanbrarse lyais solutiorx (solution I:
0.32M
sutzwse, 1%v/v 'l~itori X-100, SmM MgG"1z, IZmM T'ris-1-iCl pH 7.6) was added to l U mI of peripheral blood containing EDTA. The m'uch~ was agitated under upsettiang arid c.~nrrifuged at 3000 rpm for 10 minute3 to recover tht nuclei.
Five l 5 mI of nuclear zoembrane lysis solution (solution IIv 4M guat~idsne thyacyaaate, l2mM EDTA, 375amM NaCI. 0.S'~o N-lauroyl sorcoainntc, O.1M a-mercaptoethanol, l2mM Ths-HCl pH 7.6) was added try the rrov~ered nucti. The mixture was incubated at SS°C for 10 minutes arid precipitated v~rith ethanol to give the genomic DNA.
Seventy-five unit of EcoRI (Takara 9huzo) and 20 ~.s1 of lOxi-i buffer (Takara Shuzo) was added to 14 ~g of the genozoic DNA and the whole was made up to 200 ~1 with ste-ilc W stet. The resulting solution was sncubattd at 37°C for 18 hours to digest the gcnomic DNA to give EcoRI fragpnents. Then, I00 lrl of phcwol end 10(y girl of chl4roform worn added to the reaction mitture, and centrifuged at 12000 rpm for 10 miriute9 to recover the superltatasit, from which wa,s recovered frag7~crited DI~IAs by means of a converitiozxal ethanol psccipitaxion.
The resulting DNA fz~agments were electrophoresed on o.7% Agarose L (Nippon Gene) along with a molecular wcig~t maker a/HindIII (Nippors Gesse) in a 'TAE
3o buffer at 50v for about 2 hours. The gel was immersed in a denaturatian .... _ . _ ... , , , . . . . . , _ , _.
solution (0.5M NaOH, I.SM NaCl) for 25 raunutes and then in a ~.euti-al~ation sol~den (0.5M Tris-HCl pH 7. S, 1. SM NaCI) for 30 minutes. 'I"he DNA in the g~I
cragl transfernd to a nylox~ membrana (Mybosid-N+, Ataerahsxn phea~aa~
v~rctrsight by means of a cvaventianal caps~ry tsc~hnique and immobilized oa the membrane with a W cross-linker (Japan Genetic). As a capillary bu~'er, IQxSSC
was used.
Hybridization and detection of the DNA frag:uents were conducted uaimg a Gene Iu~ages~ Labeling dee~ection system (Amersham PharnnaQa) as follows. The z 0 membrane fated DNA was iuuwersed in a hybridization bu$er ~5xS5C, 0.1°Yow jv SDS, 5%w/v de~ctran sulfate (mol.wt. 500,O00; Si~ena), 5%v/v blocking reagent (attached to the lat)J and shaken at 60°C for 30 minutes far pre-hybtidi~,atiori.
DR3 oi?NA was amplified by RT-PCR $'om the tot$1 RNA obtained from the peripheral blood mononuclear cells of healthy lxr~u-~ns_ An oLig~nuc3,eotide having thr base scqutacc of the 159-424 position of 8EQ ID NO: 1 was prepared fiom this cDNA, and this was labeled arith fiuorescein to give a probe. This protae was heat danatured under heating at 95°C for 5 a~autes, than added to a pre-hybridization solution at a conc~rrrtration of 10 ng/ml and the membrane was ~O shalce~ at 60°C overnight for hybridiza~osa. This was washed arith a buffer ( ixSSC, O. i°~ow/v SDS) pre-heated at 60°C for 15 m~inutea, and fiuthcr a~rashed with another bv~er (0. lxSSC, O.lof°w/v SDS) for IS rninut~s. The m~brane was rinsed roughly with Buffer A ( 100mM Tris-HC pH 9.5, 300mM NaCI) and blocked with a hloclang agent (attached to the ldt) diluted 10 times with Buffer A zr room 2S tcmpershxr~e for 1 hour. The mdmbrane was rinsed roughly with Buffer A, thezx aucmcrsed in an antibody-diluted soiutiors [alkaline phosphatase-labeled anti-fluox'esctin antibody (attached to the lot) diiutcd 5,000 times with Buffer A
containing 0,59'ow/v 19SA] and incubated at roou~ tempe=store for 1 hour. 1~e membrane was washed 3 tunes with Hu~'er A cnntsinung 0.3%v Jv Tvveen 20 at 30 room temperature with shalang for 10 zstznute5. 'lhe membrane was zinged '__. ~...:__~ .. .:~-~~ ____ -.:~ . ::.:. _'- ~_.._= :;'. ''~_ _, .... ..__. ~ - . - ~ - '' ~,._ . ' - _ roughly with Buffer A" then irarnerscd in a detection rcagcr~t (attached to the lot) and e~rposed to an X-ray elm (Fuji Fllm).
The rcsu,lt is as shown in Ihg. 1. In the healthy persons, only a band indicating the presence of about 9 kb DNA rent was dtxe~ctcd. On the other harad, in the RA patients, a bard isidic.atirig tk~e presence of about 7 kb DNA
fragment in addition to the about 9 kb DNA ~enc was detected {polytypic banda)_ From the above results, it was confirmed that the RA patient can be diagno$ed by fragmexitxng the gertosnic DNA with EcoRI end eoslfirming the presence of the about 7 kb DNA garment hybridfzing with said probe.
1 S ample 2 » A~ya;s of Dr,a~ frag~enta The aszalysis wan conducted in the same mariner as in l~rsmple l e~oept that the re~trictiaa enzyme Drat ( I'ak~ura ShuZO) sad lOxM bu$tr (Takar'a Shuzo) 2,D wire u~d.
Tha result ie as shown in Fig. 2. In the healthy pcrsoas, bands of about 10 kb or more DrtA frag~ts were detected_ On the other hand, in the RA
patients, a polytypic band indicating the presence of about 1.5 kb DNA ~agment 2v ire addition to the about 10 kb or more DNA fragments wa.s detected.
Frouz the above results, it was, confirmed that the RA patient can be diagnosed by fragmenting the grnomic DNA with Drat sad con5rming the presence of the about 1.5 kb DNA fra,gflaemt hybridizing with said probe.
Natl. Acad. Sci. USA 94: 4615--4619, 1997; Ges~cmics 49; 385-393, 199$).
The pr~esazt application is intended to provide a method for highly precisely diagnosing a sign of rhtuuiaLoid e~rthritis aia~nng at the DR3 gcnc based on the above Ersdings made by the p~st~rst invCntors.
Disclosnse of Iatne~t3on The pre9e~ot application, as the invention for solvir~g the above-described preblems, provide3~ a method for dia$noging rheumatoid arthritxa which a~mpri~
digesting human gcrlomic DNA with a restriction ensyme F.c»RI and detecting 3n about ? kb DNA fragznrnt which hybridixcs with a probe hawing the base sequence of the position 159-42~ in SEQ ID NC7: 1.
Further, the pras~t application provides a method for diagnosing rheumatoid arthritis which comprises dig~e9tizig human genornio DNA mlch a restriction azzyaze Dral and detecting an about 1.5 kb DNA fragment which 2(5 ls.ybridia~ with s probe having rhc base aeqWeace of the position 159-X24 us SEQ
m rro: 1 _ P~lrthermor~, the application provides a method for dis~nosing rheumatoid arthritis. which comprit3es stimulating the peripheral blood mflnorruclear cells in a subject with phorbol 1,2-rayristate 13-acetate (PMA}
and/or phytoh~nna~jutindla (PHA), and comparing the amount of mRNA in the peripheral blood mononudcar cello with the amount of the same mRNA in tho peripheral blood mononuclear cells in a healthy person stirnulaced by PMA arxd/or Pl-lA.
wherein the mRNA is e.Ypressed from the bye sequence of at the least 689-760 3Q position in SEQ IL7 1~C): 1 rlwthGrz~ore, the application provides a method for diagnosing rheumatoid arthritis which compniscs stimulating the peripheral blood manonudear cells in a subject with phorbol 1~-rnyristatc 13-acetate (PMAj and/or phytohemagglutinirs (PHA!, and comparing the amount of a polypepride expressed in the peiigheral blood mononuclear ceps with the amount of the same polypeptide expressed in the peripheral blood manaouclear cells in a healthy person stimulated by PMA audJar PHA, wherein the polypeptide has the amisia acid sequence of at the least 20I-224 position in SEQ 1Z? NO: 1.
Iti the above diagnostic atethods, flit diagnosis is made accardiag to a criterion that the mRNA or pvlypeptide expressed irz the RA patients ~a greater in quantity than that e.~cpressed iti hralthy persons (concretely, 2 times or mosey.
ZS
Hrlef DescrtpttoYS of Dnavi~g Fig. 1 shows the results of the Southtrri anakysis fox F.co~ fragturnta from the reslxctivc gertomic pNA$ of RA patients and healthy persanr~.
~o Flg. 2 shows the results of the Sauttxe~ arxalysis for DrvI li'a~Crr'ts from the respective genoW it DNAa of RA paaerrts and hea~Ithy persons.
F'ig. 3 shouts the results ef quantitatively deterniined mRNAs amount for ~5 the call transmt~abrane region amd dtath domei,ri region of the DR3 ger~.e of RA
patients arid healthy persons.
Best Mode to: Carryiag Out the >investdon .... __. .___ ,. --',. _ '.:=~-- -_:..... .,._: =,. -_. _:__. ~- --,_ : - ,_ The following exaraples serve to explain the best mode for carryirxg out the invcntiors specifically and in dtt~ but sre not intended to limit the invcntiorz.
l~ple 1 RF'L~' A~rl~rais of BcoRI fraponeab Genomic DNAs were prepared from the peripheral blood of healthy persona and RA patient9 according to the guanidine thiocyanate method (Nippon to Yuketsu Gakkai Zasshi (Journal of the Japan Society of Hlood Transfusion), 40(2):
4I3, 1994). Briefly, 20 ml of cell meanbrarse lyais solutiorx (solution I:
0.32M
sutzwse, 1%v/v 'l~itori X-100, SmM MgG"1z, IZmM T'ris-1-iCl pH 7.6) was added to l U mI of peripheral blood containing EDTA. The m'uch~ was agitated under upsettiang arid c.~nrrifuged at 3000 rpm for 10 minute3 to recover tht nuclei.
Five l 5 mI of nuclear zoembrane lysis solution (solution IIv 4M guat~idsne thyacyaaate, l2mM EDTA, 375amM NaCI. 0.S'~o N-lauroyl sorcoainntc, O.1M a-mercaptoethanol, l2mM Ths-HCl pH 7.6) was added try the rrov~ered nucti. The mixture was incubated at SS°C for 10 minutes arid precipitated v~rith ethanol to give the genomic DNA.
Seventy-five unit of EcoRI (Takara 9huzo) and 20 ~.s1 of lOxi-i buffer (Takara Shuzo) was added to 14 ~g of the genozoic DNA and the whole was made up to 200 ~1 with ste-ilc W stet. The resulting solution was sncubattd at 37°C for 18 hours to digest the gcnomic DNA to give EcoRI fragpnents. Then, I00 lrl of phcwol end 10(y girl of chl4roform worn added to the reaction mitture, and centrifuged at 12000 rpm for 10 miriute9 to recover the superltatasit, from which wa,s recovered frag7~crited DI~IAs by means of a converitiozxal ethanol psccipitaxion.
The resulting DNA fz~agments were electrophoresed on o.7% Agarose L (Nippon Gene) along with a molecular wcig~t maker a/HindIII (Nippors Gesse) in a 'TAE
3o buffer at 50v for about 2 hours. The gel was immersed in a denaturatian .... _ . _ ... , , , . . . . . , _ , _.
solution (0.5M NaOH, I.SM NaCl) for 25 raunutes and then in a ~.euti-al~ation sol~den (0.5M Tris-HCl pH 7. S, 1. SM NaCI) for 30 minutes. 'I"he DNA in the g~I
cragl transfernd to a nylox~ membrana (Mybosid-N+, Ataerahsxn phea~aa~
v~rctrsight by means of a cvaventianal caps~ry tsc~hnique and immobilized oa the membrane with a W cross-linker (Japan Genetic). As a capillary bu~'er, IQxSSC
was used.
Hybridization and detection of the DNA frag:uents were conducted uaimg a Gene Iu~ages~ Labeling dee~ection system (Amersham PharnnaQa) as follows. The z 0 membrane fated DNA was iuuwersed in a hybridization bu$er ~5xS5C, 0.1°Yow jv SDS, 5%w/v de~ctran sulfate (mol.wt. 500,O00; Si~ena), 5%v/v blocking reagent (attached to the lat)J and shaken at 60°C for 30 minutes far pre-hybtidi~,atiori.
DR3 oi?NA was amplified by RT-PCR $'om the tot$1 RNA obtained from the peripheral blood mononuclear cells of healthy lxr~u-~ns_ An oLig~nuc3,eotide having thr base scqutacc of the 159-424 position of 8EQ ID NO: 1 was prepared fiom this cDNA, and this was labeled arith fiuorescein to give a probe. This protae was heat danatured under heating at 95°C for 5 a~autes, than added to a pre-hybridization solution at a conc~rrrtration of 10 ng/ml and the membrane was ~O shalce~ at 60°C overnight for hybridiza~osa. This was washed arith a buffer ( ixSSC, O. i°~ow/v SDS) pre-heated at 60°C for 15 m~inutea, and fiuthcr a~rashed with another bv~er (0. lxSSC, O.lof°w/v SDS) for IS rninut~s. The m~brane was rinsed roughly with Buffer A ( 100mM Tris-HC pH 9.5, 300mM NaCI) and blocked with a hloclang agent (attached to the ldt) diluted 10 times with Buffer A zr room 2S tcmpershxr~e for 1 hour. The mdmbrane was rinsed roughly with Buffer A, thezx aucmcrsed in an antibody-diluted soiutiors [alkaline phosphatase-labeled anti-fluox'esctin antibody (attached to the lot) diiutcd 5,000 times with Buffer A
containing 0,59'ow/v 19SA] and incubated at roou~ tempe=store for 1 hour. 1~e membrane was washed 3 tunes with Hu~'er A cnntsinung 0.3%v Jv Tvveen 20 at 30 room temperature with shalang for 10 zstznute5. 'lhe membrane was zinged '__. ~...:__~ .. .:~-~~ ____ -.:~ . ::.:. _'- ~_.._= :;'. ''~_ _, .... ..__. ~ - . - ~ - '' ~,._ . ' - _ roughly with Buffer A" then irarnerscd in a detection rcagcr~t (attached to the lot) and e~rposed to an X-ray elm (Fuji Fllm).
The rcsu,lt is as shown in Ihg. 1. In the healthy persons, only a band indicating the presence of about 9 kb DNA rent was dtxe~ctcd. On the other harad, in the RA patients, a bard isidic.atirig tk~e presence of about 7 kb DNA
fragment in addition to the about 9 kb DNA ~enc was detected {polytypic banda)_ From the above results, it was confirmed that the RA patient can be diagno$ed by fragmexitxng the gertosnic DNA with EcoRI end eoslfirming the presence of the about 7 kb DNA garment hybridfzing with said probe.
1 S ample 2 » A~ya;s of Dr,a~ frag~enta The aszalysis wan conducted in the same mariner as in l~rsmple l e~oept that the re~trictiaa enzyme Drat ( I'ak~ura ShuZO) sad lOxM bu$tr (Takar'a Shuzo) 2,D wire u~d.
Tha result ie as shown in Fig. 2. In the healthy pcrsoas, bands of about 10 kb or more DrtA frag~ts were detected_ On the other hand, in the RA
patients, a polytypic band indicating the presence of about 1.5 kb DNA ~agment 2v ire addition to the about 10 kb or more DNA fragments wa.s detected.
Frouz the above results, it was, confirmed that the RA patient can be diagnosed by fragmenting the grnomic DNA with Drat sad con5rming the presence of the about 1.5 kb DNA fra,gflaemt hybridizing with said probe.
. ... . , . - . 1,1 i-I
'~uplo 3 Quanti9cwt3oa of DR3 a~RffA
. Hepatirlizcd peripheral blood ( 10 ml each) celletted &nm 6 healthy p~ssersia sad 7 RA patients was mixrrd with gn equal volume of a phosphate buSer (PaS) am.d lay~er~d on 20 ml of Lymphoprer (Daiiehi Pure Chemicals). The mbcturc was cenflcifuged at 1,500 rpm for 30 minutes to collect the peripheral blood mononuclear cells, which were then washed with PBS and suspended in a mrdiuna (1?PMI 1640 J I4% FCS) _ The cell suspmaiorr (5 x 105 cells/tnl: 10 tall was disuibuGed on a 1O cm dish, and incubated ux~der stimulation with 20 ng/aal of PMA (Sigma) and 1 ~sg/mI of PHA (Difco Laboratories) in a edition of 5°~° CUz, 37°C, for 48 hours. The calls were recovered, washed with PBS, and treated witlu isogea (Nippoa Crane) to prepare the total RNAs.
The Lotal RNAs were subj~ed to a qe~antitative RT-PCR using s lest (TaqMar? Cold RT-PCR Re~gents)(P~ewldn Elmer (PE)). Using reagents attached tc~
the let, 10(1 ng of the total RNA was rever~ae-trans~azbed with a pmgrsua of 75°C/ 10 soirtutes. 48°C/30 minutes, and 95°C/S minutes.
A variety of primors.
probv~ and resgeutm atta~.lxed to the kit wta'~ edd~cd ire ~ defisaite ut~t to 1 J l OO
of this soluriorn as a template, and the mixture was subjected w PCR The amount mRNA was determined by an ABI PRISM 7700 (PE). PCR was conducted in a condition; 1 cycle. 50°C/2 minutes; 1 cycle. 95°C/ IO
minutes: and then 40 cycles, 9S°C J IS sscnmds for ihrrmal deaaturatiotl arid 60°C/ 1 minute for aruaealing and extcansicrn reaction. Quasidfication of DR3 was conducted aiming at mRNA rxpreaaed from tile DR3 gene cDNA tot~tainizig the cell traaszneatbrame region (the base sequence of the 689-760 position of SEQ 1D NO: l) and mRNA
e.~cprassed from the DR3 gene cDNA containing the death doxnaun region (the base sequence of the 1091-1330 position of SEQ 1D N4:11. The probes and the PCR
primers were as follow: s.
'~uplo 3 Quanti9cwt3oa of DR3 a~RffA
. Hepatirlizcd peripheral blood ( 10 ml each) celletted &nm 6 healthy p~ssersia sad 7 RA patients was mixrrd with gn equal volume of a phosphate buSer (PaS) am.d lay~er~d on 20 ml of Lymphoprer (Daiiehi Pure Chemicals). The mbcturc was cenflcifuged at 1,500 rpm for 30 minutes to collect the peripheral blood mononuclear cells, which were then washed with PBS and suspended in a mrdiuna (1?PMI 1640 J I4% FCS) _ The cell suspmaiorr (5 x 105 cells/tnl: 10 tall was disuibuGed on a 1O cm dish, and incubated ux~der stimulation with 20 ng/aal of PMA (Sigma) and 1 ~sg/mI of PHA (Difco Laboratories) in a edition of 5°~° CUz, 37°C, for 48 hours. The calls were recovered, washed with PBS, and treated witlu isogea (Nippoa Crane) to prepare the total RNAs.
The Lotal RNAs were subj~ed to a qe~antitative RT-PCR using s lest (TaqMar? Cold RT-PCR Re~gents)(P~ewldn Elmer (PE)). Using reagents attached tc~
the let, 10(1 ng of the total RNA was rever~ae-trans~azbed with a pmgrsua of 75°C/ 10 soirtutes. 48°C/30 minutes, and 95°C/S minutes.
A variety of primors.
probv~ and resgeutm atta~.lxed to the kit wta'~ edd~cd ire ~ defisaite ut~t to 1 J l OO
of this soluriorn as a template, and the mixture was subjected w PCR The amount mRNA was determined by an ABI PRISM 7700 (PE). PCR was conducted in a condition; 1 cycle. 50°C/2 minutes; 1 cycle. 95°C/ IO
minutes: and then 40 cycles, 9S°C J IS sscnmds for ihrrmal deaaturatiotl arid 60°C/ 1 minute for aruaealing and extcansicrn reaction. Quasidfication of DR3 was conducted aiming at mRNA rxpreaaed from tile DR3 gene cDNA tot~tainizig the cell traaszneatbrame region (the base sequence of the 689-760 position of SEQ 1D NO: l) and mRNA
e.~cprassed from the DR3 gene cDNA containing the death doxnaun region (the base sequence of the 1091-1330 position of SEQ 1D N4:11. The probes and the PCR
primers were as follow: s.
Cell transrnembrane region Probe: Oligonudeotidc comprising the base sequence of the 691-71Q
position in SEQ ID NO:1 (6-aarboxy-fluer~scein attached at 5'-end arid 6-carboxy-tetrazuethyl-rhodamine attached at 3'-exsd).
Sense primer: Oligonucle,otide corresponding to the base sedu~re of the a68-485 posiuori iu SEQ 1'I~ NO: 1.
Aatisensc primer: 03igonucieotida corxrsponding tv the base sequence of the 743-762 position in SEQ ID NO- 1.
Death da~msim ragan Probe 013gcanudeotidc comprising the base xoluence of the 1154-11?3 position in SEQ ID N0:1 (6..csrboxy-fluoro9ctin attached at 5'-end and fi-r.~cboxy-tearamethyl-rhodamirse attsrhtd at 3'-tnd).
Sense primer: Oligonudeotide corresponding to the base sequence of the 912-932 position irt SJ:Q ID Ptp: 1.
Anti~t3e primer: Oligonudeotide carresgonding to the base sequence of the 1209-1232 position in SEQ I» NO: 1.
2b in this operation, rRNA was qusatified as an internal standard at the see time and used for correction. The probe need in the ~xantific~tiosi ef rRNA
is an aligon~.lCleotsdt comprising the base xquence of SEQ 1D N0:2 (2.?-dimethoacy-4,S.dichloro-6-carb~oxy-tluoresc~ein attached at 5'-end and 6-carboxy-tetra-mcthyi-rhodamine attached at 3'-end). The PCR primers used in the quan~cati,on of rRNA are oligonucleotide5 comprising the base sequences of SE(p B~ N0:3 (acme primer) and SEQ TD N0~4 (anasetzse priux~rl, respe~rly.
The calibration aan~es uxd for detertainauon of DR3 arid rRNA were prepared ~sirlg plasmids as tertlplatcs oi~tainod by cloning cDNAs of I,7R3 and 3U rR.'YA, nespcctwely. In teach case, the sa~,~e sat~nple was measured 3 times- 'Else _. , ~ _ , .. _ _ . . . . _ . . . _ _ _ -. _. . _ . .. . . . . ~ _'~ » __ _, :
_ .~_' ~ ~ '_' , . . :: 1_ amount of DR3 ~»RNA was indic~tcd by the coaecti~ value desivcd by dividing by the value of rRNA measured sinaultaneous~ly.
The resuats are as shown in Fig. 3. In the death domain region, the S amount of DR3 zrsRNA was 0.90 t 0.26 (mean ~ SE) for thz RA patients and 0.92 t 0.43 for the healthy persons, and no sig~cant difference was observed between their amaunte. To the contrary, irr the welt t~ra~ns~membrane rrgion, the amount was I.84 t 0.27 for the RA patients and 0.82 ~ 0.25 for the healthy persons, and there was observed a si~cant ir~.a~c~.sc of DR3 m~RNA expression in Lhe RA
patients.
From the above results, it was contira~ed that the RA pauenis can bG
diagnosed by stimulating the peripheral blood mononuclear cells with PMA acid P~iA, deteraiming the amount of mRNA from the base s~equerm of the 689-760 z 5 position of sEQ ID I~IQ-1 or the amrnint of a polypeptade (h.avix~g tlxe amino add sequence of the 201-224 position of 9EQ ID NO:1) tran~bed from said mRNA, and judgirig whether the ~xprc~ed eimotlnt is at least 2 or more of that of healthy persona.
Iadns~ial Applicobi~ity As described above in detat~, according to the invention of the prtstnt application. it is possible to dia~roae rheumatoid arthritis convcairntly and 2S e~a~ctly. Such diagnveea are useful its development of a novti therapy or thcrapcucics for ttse rheumatoid arthritis.
zo SEQUENCE LISTING
<110~ Shiozawa, shunnich <120~ A Method for Diagnosing Rheumatoid Arthritis <130> NP99453-YS
<140>
<141>
<150> JP11-310805 <151> 1999-11-01 <160> 4 <170> Patent I n Ver. 2. 0 <210> 1 <211> 1634 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (89) . . (1342) <400>. 1 cgggccctgc gggcgcgggg ctgaaggcgg aaccacgacg ggcagagagc acggagccgg 60 gaagcccctg ggcgcccgtc ggagggct atg gag cag cgg ccg cgg ggc tgc 112 Met Glu Gln Arg Pro Arg Gly Cys gcg gcg gtg gcg gcg gcg ctc ctc ctg gtg ctg ctg ggg gcc cgg gcc 160 Ala Ala Val Ala Ala Ala Leu Leu Leu Val Leu Leu Gly Ala Arg Ala cag ggc ggc act cgt agc ccc agg tgt gac tgt gcc ggt gac ttc cac 208 Gln Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly Asp Phe His 10 aag aagattggtctgttttgttgcagaggc tgcccagcggggcactac 256 Lys LysIleGlyLeuPheCysCysArgGly CysProAlaGlyHisTyr ctg aaggccccttgcacggagccctgcggc aactccacctgccttgtg 304 Leu LysAlaProCysThrGluProCysGly AsnSerThrCysLeuVal tgt ccccaagacaccttcttggcctgggag aaccaccataattctgaa 352 Cys ProGlnAspThrPheLeuAlaTrpGlu AsnHisHisAsnSerGlu tgt gcccgctgccaggcctgtgatgagcag gcctcccaggtggcgctg 400 Cys AlaArgCysGlnAlaCysAspGluGln AlaSerGlnValAlaLeu gag aac tgt tca gca gtg gcc gac acc cgc tgt ggc tgt aag cca ggc 448 Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly tgg ttt gtg gag tgc cag gtc agc caa tgt gtc agc agt tca ccc ttc 496 Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe _ 125 130 135 tac tgc caa cca tgc cta gac tgc ggg gcc ctg cac cgc cac aca cgg 544 Tyr CysGlnProCysLeuAspCysGlyAla LeuHisArgHisThrArg cta ctctgttcccgcagagatactgactgt gggacctgcctgcctggc 592 Leu LeuCysSerArgArgAspThrAspCys GlyThrCysLeuProGly ttc tatgaacatggcgatggctgcgtgtcc tgccccacgagcaccctg 640 Phe TyrGluHisGlyAspGlyCysValSer CysProThrSerThrLeu ggg agctgtccagagcgctgtgccgetgtc tgtggctggaggcagatg 688 Gly SerCysProGluArgCysAlaAlaVal CysGlyTrpArgGlnMet ttc tgggtccaggtgctcctggetggcctt gtggtccccctcctgctt 736 Phe TrpValGlnValLeuLeuAlaGlyLeu ValValProLeuLeuLeu ggg gccaccctgacctacacataccgccac tgctggcctcacaagccc 784 Gly AlaThrLeuThrTyrThrTyrArgHis CysTrpProHisLysPro ctg gttactgcagatgaagetgggatggag getctgaccccaccaccg 832 Leu ValThrAlaAspGluAlaGlyMetGlu AlaLeuThrProProPro gcc acccatctgtcacccttggacagcgcc cacacccttctagcacct 880 Ala ThrHisLeuSerProLeuAspSerAla HisThrLeuLeuAlaPro cct gacagcagtgagaagatctgcaccgtc cagttggtgggtaacagc 928 Pro AspSerSerGluLysIleCysThrVal GlnLeuValGlyAsnSer tgg acccctggctaccccgagacccaggag gcgctctgcccgcaggtg 976 Trp ThrProGlyTyrProGluThrGlnGlu AlaLeuCysProGlnVal aca tggtcctgggaccagttgcccagcagagetctt ggccccgetget 1024 Thr TrpSerTrpAspGlnLeuProSerArgAlaLeu GlyProAlaAla gcg cccacactctcgccagagtccccagccggctcg ccagccatgatg 1072 Ala ProThrLeuSerProGluSerProAlaGlySer ProAlaMetMet ctg cagccgggcccgcagctctacgacgtgatggac gcggtcccagcg 1120 Leu GlnProGlyProGlnLeuTyrAspValMetAsp AlaVaiProAla cgg cgctggaaggagttcgtgcgcacgctggggctg cgcgaggcagag 1168 Arg ArgTrpLysGluPheValArgThrLeuGlyLeu ArgGluAlaGlu atc gaagccgtggaggtggagatcggccgcttccga gaccagcagtac 1216 Ile GluAlaValGluValGluIleGlyArgPheArg AspGlnGlnTyr gag atgctcaagcgctggcgccagcagcagcccgcg ggcctcggagcc 1264 Glu MetLeuLysArgTrpArgGlnGinGlnProAla GlyLeuGlyAla gtt tacgcggccctggagcgcatggggctggacggc tgcgtggaagac 1312 Val TyrAlaAlaLeuGluArgMetGlyLeuAspGly CysValGluAsp ttg cgcagccgcctgcagcgcggcccgtgacacggcgcccacttgcca cc 1362 Leu ArgSerArgLeuGlnArgGlyPro taggcgctct ggtggccctt gcagaagccc taagtacggt tacttatgcg tgtagacatt 1422 ttatgtcact tattaagccg ctggcacggc cctgcgtagc agcaccagcc ggccccaccc 1482 ctgctcgccc ctatcgctcc agccaaggcg aagaagcacg aacgaatgtc gagagggggt 1542 gaagacattt ctcaacttct cggccggagt ttggctgaga tcgcggtatt aaatctgtga 1602 aagaaaacaa aaaaaaaaaa aaaaaaaaaa as 1634 <210> 2 <211> 22 <212> DNA
<213~ Artificial sequence <220>
<223> synthesized oligonucleotide <400> 2 tgctggcacc agacttgccc tc 22 <210> 3 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> synthesized oligonucleotide <400> 3 cggctaccac atccaaggaa 20 <210> 4 <211> 20 <212> DNA
<213> Artificial sequence <220> 18 <223~ synthesized oligonucleotide <400> 4 gctggaatta ccgcggct 18
position in SEQ ID NO:1 (6-aarboxy-fluer~scein attached at 5'-end arid 6-carboxy-tetrazuethyl-rhodamine attached at 3'-exsd).
Sense primer: Oligonucle,otide corresponding to the base sedu~re of the a68-485 posiuori iu SEQ 1'I~ NO: 1.
Aatisensc primer: 03igonucieotida corxrsponding tv the base sequence of the 743-762 position in SEQ ID NO- 1.
Death da~msim ragan Probe 013gcanudeotidc comprising the base xoluence of the 1154-11?3 position in SEQ ID N0:1 (6..csrboxy-fluoro9ctin attached at 5'-end and fi-r.~cboxy-tearamethyl-rhodamirse attsrhtd at 3'-tnd).
Sense primer: Oligonudeotide corresponding to the base sequence of the 912-932 position irt SJ:Q ID Ptp: 1.
Anti~t3e primer: Oligonudeotide carresgonding to the base sequence of the 1209-1232 position in SEQ I» NO: 1.
2b in this operation, rRNA was qusatified as an internal standard at the see time and used for correction. The probe need in the ~xantific~tiosi ef rRNA
is an aligon~.lCleotsdt comprising the base xquence of SEQ 1D N0:2 (2.?-dimethoacy-4,S.dichloro-6-carb~oxy-tluoresc~ein attached at 5'-end and 6-carboxy-tetra-mcthyi-rhodamine attached at 3'-end). The PCR primers used in the quan~cati,on of rRNA are oligonucleotide5 comprising the base sequences of SE(p B~ N0:3 (acme primer) and SEQ TD N0~4 (anasetzse priux~rl, respe~rly.
The calibration aan~es uxd for detertainauon of DR3 arid rRNA were prepared ~sirlg plasmids as tertlplatcs oi~tainod by cloning cDNAs of I,7R3 and 3U rR.'YA, nespcctwely. In teach case, the sa~,~e sat~nple was measured 3 times- 'Else _. , ~ _ , .. _ _ . . . . _ . . . _ _ _ -. _. . _ . .. . . . . ~ _'~ » __ _, :
_ .~_' ~ ~ '_' , . . :: 1_ amount of DR3 ~»RNA was indic~tcd by the coaecti~ value desivcd by dividing by the value of rRNA measured sinaultaneous~ly.
The resuats are as shown in Fig. 3. In the death domain region, the S amount of DR3 zrsRNA was 0.90 t 0.26 (mean ~ SE) for thz RA patients and 0.92 t 0.43 for the healthy persons, and no sig~cant difference was observed between their amaunte. To the contrary, irr the welt t~ra~ns~membrane rrgion, the amount was I.84 t 0.27 for the RA patients and 0.82 ~ 0.25 for the healthy persons, and there was observed a si~cant ir~.a~c~.sc of DR3 m~RNA expression in Lhe RA
patients.
From the above results, it was contira~ed that the RA pauenis can bG
diagnosed by stimulating the peripheral blood mononuclear cells with PMA acid P~iA, deteraiming the amount of mRNA from the base s~equerm of the 689-760 z 5 position of sEQ ID I~IQ-1 or the amrnint of a polypeptade (h.avix~g tlxe amino add sequence of the 201-224 position of 9EQ ID NO:1) tran~bed from said mRNA, and judgirig whether the ~xprc~ed eimotlnt is at least 2 or more of that of healthy persona.
Iadns~ial Applicobi~ity As described above in detat~, according to the invention of the prtstnt application. it is possible to dia~roae rheumatoid arthritis convcairntly and 2S e~a~ctly. Such diagnveea are useful its development of a novti therapy or thcrapcucics for ttse rheumatoid arthritis.
zo SEQUENCE LISTING
<110~ Shiozawa, shunnich <120~ A Method for Diagnosing Rheumatoid Arthritis <130> NP99453-YS
<140>
<141>
<150> JP11-310805 <151> 1999-11-01 <160> 4 <170> Patent I n Ver. 2. 0 <210> 1 <211> 1634 <212> DNA
<213> Homo sapiens <220>
<221> CDS
<222> (89) . . (1342) <400>. 1 cgggccctgc gggcgcgggg ctgaaggcgg aaccacgacg ggcagagagc acggagccgg 60 gaagcccctg ggcgcccgtc ggagggct atg gag cag cgg ccg cgg ggc tgc 112 Met Glu Gln Arg Pro Arg Gly Cys gcg gcg gtg gcg gcg gcg ctc ctc ctg gtg ctg ctg ggg gcc cgg gcc 160 Ala Ala Val Ala Ala Ala Leu Leu Leu Val Leu Leu Gly Ala Arg Ala cag ggc ggc act cgt agc ccc agg tgt gac tgt gcc ggt gac ttc cac 208 Gln Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly Asp Phe His 10 aag aagattggtctgttttgttgcagaggc tgcccagcggggcactac 256 Lys LysIleGlyLeuPheCysCysArgGly CysProAlaGlyHisTyr ctg aaggccccttgcacggagccctgcggc aactccacctgccttgtg 304 Leu LysAlaProCysThrGluProCysGly AsnSerThrCysLeuVal tgt ccccaagacaccttcttggcctgggag aaccaccataattctgaa 352 Cys ProGlnAspThrPheLeuAlaTrpGlu AsnHisHisAsnSerGlu tgt gcccgctgccaggcctgtgatgagcag gcctcccaggtggcgctg 400 Cys AlaArgCysGlnAlaCysAspGluGln AlaSerGlnValAlaLeu gag aac tgt tca gca gtg gcc gac acc cgc tgt ggc tgt aag cca ggc 448 Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys Lys Pro Gly tgg ttt gtg gag tgc cag gtc agc caa tgt gtc agc agt tca ccc ttc 496 Trp Phe Val Glu Cys Gln Val Ser Gln Cys Val Ser Ser Ser Pro Phe _ 125 130 135 tac tgc caa cca tgc cta gac tgc ggg gcc ctg cac cgc cac aca cgg 544 Tyr CysGlnProCysLeuAspCysGlyAla LeuHisArgHisThrArg cta ctctgttcccgcagagatactgactgt gggacctgcctgcctggc 592 Leu LeuCysSerArgArgAspThrAspCys GlyThrCysLeuProGly ttc tatgaacatggcgatggctgcgtgtcc tgccccacgagcaccctg 640 Phe TyrGluHisGlyAspGlyCysValSer CysProThrSerThrLeu ggg agctgtccagagcgctgtgccgetgtc tgtggctggaggcagatg 688 Gly SerCysProGluArgCysAlaAlaVal CysGlyTrpArgGlnMet ttc tgggtccaggtgctcctggetggcctt gtggtccccctcctgctt 736 Phe TrpValGlnValLeuLeuAlaGlyLeu ValValProLeuLeuLeu ggg gccaccctgacctacacataccgccac tgctggcctcacaagccc 784 Gly AlaThrLeuThrTyrThrTyrArgHis CysTrpProHisLysPro ctg gttactgcagatgaagetgggatggag getctgaccccaccaccg 832 Leu ValThrAlaAspGluAlaGlyMetGlu AlaLeuThrProProPro gcc acccatctgtcacccttggacagcgcc cacacccttctagcacct 880 Ala ThrHisLeuSerProLeuAspSerAla HisThrLeuLeuAlaPro cct gacagcagtgagaagatctgcaccgtc cagttggtgggtaacagc 928 Pro AspSerSerGluLysIleCysThrVal GlnLeuValGlyAsnSer tgg acccctggctaccccgagacccaggag gcgctctgcccgcaggtg 976 Trp ThrProGlyTyrProGluThrGlnGlu AlaLeuCysProGlnVal aca tggtcctgggaccagttgcccagcagagetctt ggccccgetget 1024 Thr TrpSerTrpAspGlnLeuProSerArgAlaLeu GlyProAlaAla gcg cccacactctcgccagagtccccagccggctcg ccagccatgatg 1072 Ala ProThrLeuSerProGluSerProAlaGlySer ProAlaMetMet ctg cagccgggcccgcagctctacgacgtgatggac gcggtcccagcg 1120 Leu GlnProGlyProGlnLeuTyrAspValMetAsp AlaVaiProAla cgg cgctggaaggagttcgtgcgcacgctggggctg cgcgaggcagag 1168 Arg ArgTrpLysGluPheValArgThrLeuGlyLeu ArgGluAlaGlu atc gaagccgtggaggtggagatcggccgcttccga gaccagcagtac 1216 Ile GluAlaValGluValGluIleGlyArgPheArg AspGlnGlnTyr gag atgctcaagcgctggcgccagcagcagcccgcg ggcctcggagcc 1264 Glu MetLeuLysArgTrpArgGlnGinGlnProAla GlyLeuGlyAla gtt tacgcggccctggagcgcatggggctggacggc tgcgtggaagac 1312 Val TyrAlaAlaLeuGluArgMetGlyLeuAspGly CysValGluAsp ttg cgcagccgcctgcagcgcggcccgtgacacggcgcccacttgcca cc 1362 Leu ArgSerArgLeuGlnArgGlyPro taggcgctct ggtggccctt gcagaagccc taagtacggt tacttatgcg tgtagacatt 1422 ttatgtcact tattaagccg ctggcacggc cctgcgtagc agcaccagcc ggccccaccc 1482 ctgctcgccc ctatcgctcc agccaaggcg aagaagcacg aacgaatgtc gagagggggt 1542 gaagacattt ctcaacttct cggccggagt ttggctgaga tcgcggtatt aaatctgtga 1602 aagaaaacaa aaaaaaaaaa aaaaaaaaaa as 1634 <210> 2 <211> 22 <212> DNA
<213~ Artificial sequence <220>
<223> synthesized oligonucleotide <400> 2 tgctggcacc agacttgccc tc 22 <210> 3 <211> 20 <212> DNA
<213> Artificial sequence <220>
<223> synthesized oligonucleotide <400> 3 cggctaccac atccaaggaa 20 <210> 4 <211> 20 <212> DNA
<213> Artificial sequence <220> 18 <223~ synthesized oligonucleotide <400> 4 gctggaatta ccgcggct 18
Claims (4)
1. A method for diagnosing rheumatoid arthritis which comprises digesting human genomic DNA with a restriction enzyme EcoRI and detecting an about 7 kb DNA fragment which hybridizes with a probe having the base sequence of the position 159-424 in SEQ ID NO: 1.
2. A method for diagnosing rheumatoid arthritis which comprises digesting human genomic DNA with a restriction enzyme Dral and detecting an about 1.5 kb DNA fragment which hybridizes with a probe having the base sequence of the position 159-424 in SEQ ID NO: 1.
3. A method for diagnosing rheumatoid arthritis which comprises stimulating the peripheral blood mononuclear cells in a subject with phorbol 12-myristate 13-acetate (PMA) and/or phytohemagglutinin (PHA), and comparing the amount of mRNA in the peripheral blood mononuclear cells with the amount of the same mRNA in the peripheral blood mononuclear cells in a healthy person stimulated by PMA and/or PHA, wherein the mRNA is expressed from the base sequence of at the least 689-760 position in SEQ ID NO: 1.
4. A method for diagnosing rheumatoid arthritis which comprises stimulating the peripheral blood mononuclear cells in a subject with phorbol 12-myristate 13-acetate (PMA) and/or phytohemagglutinin (PHA), and comparing the amount of a polypeptide in the peripheral blood mononuclear cells with the amount of the same poly peptide expressed in the peripheral blood mononuclear cells in a healthy person stimulated by PMA and/or PHA, wherein the polypeptide has the amino acid sequence of at the least 201-224 position in SEQ ID NO: 1.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP31080599 | 1999-11-01 | ||
| JP11/310805 | 1999-11-01 | ||
| PCT/JP2000/007690 WO2001032921A2 (en) | 1999-11-01 | 2000-11-01 | Method of diagnosing rheumatoid arthritis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2390387A1 true CA2390387A1 (en) | 2001-05-10 |
Family
ID=18009651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002390387A Abandoned CA2390387A1 (en) | 1999-11-01 | 2000-11-01 | Method of diagnosing rheumatoid arthritis |
Country Status (4)
| Country | Link |
|---|---|
| KR (1) | KR100762444B1 (en) |
| AU (1) | AU785071B2 (en) |
| CA (1) | CA2390387A1 (en) |
| WO (1) | WO2001032921A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7306908B2 (en) | 2000-10-24 | 2007-12-11 | Shunichi Shiozawa | Nucleic acids associated with rheumatoid arthritis, and methods and kits for the diagnosis thereof |
| JP3710809B1 (en) | 2004-02-26 | 2005-10-26 | 俊一 塩澤 | Polynucleotides involved in the development of rheumatoid arthritis and uses thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5110920A (en) * | 1982-01-22 | 1992-05-05 | Cetus Corporation | HLA typing method and DNA probes used therein |
| US6194561B1 (en) * | 1986-03-13 | 2001-02-27 | Roche Molecular Systems, Inc. | Characterization and detection of sequences associated with autoimmune diseases |
-
2000
- 2000-11-01 CA CA002390387A patent/CA2390387A1/en not_active Abandoned
- 2000-11-01 AU AU10530/01A patent/AU785071B2/en not_active Expired
- 2000-11-01 WO PCT/JP2000/007690 patent/WO2001032921A2/en active IP Right Grant
- 2000-11-01 KR KR1020027005592A patent/KR100762444B1/en active IP Right Grant
Also Published As
| Publication number | Publication date |
|---|---|
| KR20020065498A (en) | 2002-08-13 |
| WO2001032921A2 (en) | 2001-05-10 |
| KR100762444B1 (en) | 2007-10-04 |
| AU1053001A (en) | 2001-05-14 |
| AU785071B2 (en) | 2006-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jin et al. | A novel X–linked gene, DDP, shows mutations in families with deafness (DFN–1), dystonia, mental deficiency and blindness | |
| Lee et al. | The gene for paroxysmal non-kinesigenic dyskinesia encodes an enzyme in a stress response pathway | |
| Yamagata et al. | Mutations in the hepatocyte nuclear factor-1α gene in maturity-onset diabetes of the young (MODY3) | |
| Xu et al. | Mutations and alternative splicing of the BRCA1 gene in UK breast/ovarian cancer families | |
| EP1126034A2 (en) | Coding sequences of the human BRCA1 gene | |
| US20030190639A1 (en) | Genes involved in intestinal inflamatory diseases and use thereof | |
| Huopaniemi et al. | Three widespread founder mutations contribute to high incidence of X-linked juvenile retinoschisis in Finland | |
| US9556488B2 (en) | Spinocerebellar ataxia type 8 and methods of detection | |
| US20080199856A1 (en) | Probe for Diagnosis of Marfan Syndrome and a Method for Screening Using the Probe | |
| US20160215347A1 (en) | LaFORA'S DISEASE GENE | |
| Bijlsma et al. | Misleading linkage results in an NF2 presymptomatic test owing to mosaicism. | |
| CA2390387A1 (en) | Method of diagnosing rheumatoid arthritis | |
| Scott et al. | Characterization of a novel gene, C21orf2, on human chromosome 21q22. 3 and its exclusion as the APECED gene by mutation analysis | |
| US20100003673A1 (en) | Gene and methods for diagnosing neuropsychiatric disorders and treating such disorders | |
| EP2061809B1 (en) | Diagnosis of hereditary spastic paraplegias (hsp) by detection of a mutation in the kiaa1840 gene or protein | |
| Bardien-Kruger et al. | Refinement of the RP17 locus for autosomal dominant retinitis pigmentosa, construction of a YAC contig and investigation of the candidate gene retinal fascin | |
| Afzal et al. | Novel mutations in the 3'region of the polycystic kidney disease 1 (PKD1) gene | |
| Gámez‐Pozo et al. | Pathogenic validation of unique germline intronic variants of RB1 in retinoblastoma patients using minigenes | |
| JP2000316577A (en) | Diagnosis of citrullinemia type ii onset in adult | |
| KR100431285B1 (en) | Polymorphic VNTRs of human telomerase gene and methods for DNA typing and detecting telomerase-related diseases using the same | |
| WO1999009169A1 (en) | The pyrin gene and mutants thereof, which cause familial mediterranean fever | |
| WO1999009164A9 (en) | Coding sequence haplotypes of the human brca2 gene | |
| Magovcevic et al. | Detection of cone alpha transducin mRNA in human fetal cochlea: negative mutation analysis in Usher syndrome | |
| Torban et al. | F329L polymorphism in the human PAX8 gene | |
| Sohocki | Identification and evaluation of candidate genes for inherited retinal-degenerative diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Dead |