CA2384355A1 - Methods and means for modification of plant flowering characteristics - Google Patents
Methods and means for modification of plant flowering characteristics Download PDFInfo
- Publication number
- CA2384355A1 CA2384355A1 CA002384355A CA2384355A CA2384355A1 CA 2384355 A1 CA2384355 A1 CA 2384355A1 CA 002384355 A CA002384355 A CA 002384355A CA 2384355 A CA2384355 A CA 2384355A CA 2384355 A1 CA2384355 A1 CA 2384355A1
- Authority
- CA
- Canada
- Prior art keywords
- nucleic acid
- plant
- vrn1
- polypeptide
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8214—Plastid transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Physiology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Fertilizers (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Nitrogen Condensed Heterocyclic Rings (AREA)
- Peptides Or Proteins (AREA)
Abstract
Provided are isolated nucleic acid molecules which comprises VRN1 nucleotide sequences, which encode a polypeptide which is capable of specifically altering the vernalisation response of a plant into which the nucleic acid is introduced and expressed. Examples include cDNA and gDNA sequences (see e.g.
Annex I). Also provided are variant molecules which may be derivatives or homologues (e.g. alleles, or paralogues such as RTV1), plus also complementary molecules. Corresponding polypeptides form a further part of the invention.
The invention also provides methods and materials for preparing and using these molecules e.g. in the production of plants having modified vernalisation characteristics. Also methods for influencing and assessing the vernalisation phenotype of a plant.
Annex I). Also provided are variant molecules which may be derivatives or homologues (e.g. alleles, or paralogues such as RTV1), plus also complementary molecules. Corresponding polypeptides form a further part of the invention.
The invention also provides methods and materials for preparing and using these molecules e.g. in the production of plants having modified vernalisation characteristics. Also methods for influencing and assessing the vernalisation phenotype of a plant.
Claims (21)
1 An isolated nucleic acid molecule which comprises a VRN1 nucleotide sequence encoding a polypeptide which is capable of specifically altering the vernalisation response of a plant into which the nucleic acid is introduced and expressed.
2 A nucleic acid as claimed in claim 1 wherein the VRN1 nucleotide sequence:
(i) encodes the VRN1 polypeptide of Fig 7, or (ii) encodes a variant polypeptide which is a homologous variant of the polypeptide shown in Fig7 and which shares at least 50%, 60%, 70%, 80% or 90% identity therewith,
(i) encodes the VRN1 polypeptide of Fig 7, or (ii) encodes a variant polypeptide which is a homologous variant of the polypeptide shown in Fig7 and which shares at least 50%, 60%, 70%, 80% or 90% identity therewith,
3 A nucleic acid as claimed in claim 1 or claim 2 wherein the VRN1 nucleotide sequence is that shown in Fig 7 from nucleotides 269-1295 inclusive, or a sequence which is degeneratively equivalent thereto.
4 A nucleic acid as claimed in claim 1 or claim 2 wherein the VRN1 nucleotide sequence is shown in Annex I.
A nucleic acid as claimed in claim 1 or claim 2 wherein the VRN1 nucleotide sequence encodes a derivative of the polypeptide shown in Fig 7 by way of addition, insertion, deletion or substitution of one or more amino acids.
6 A nucleic acid as claimed in claim 1 or claim 2 wherein the VRN1 nucleotide sequence consists of an allelic or other homologous variant of the nucleotide sequence of claim 3.
7 A nucleic acid as claimed in claim 6 wherein the VRN1 nucleotide sequence is the VRN1 paralogue RTV1 of Figure 9.
8 An isolated nucleic acid which comprises a nucleotide sequence which is the complement of the VRN1 nucleotide sequence of any one of the preceding claims.
9 An isolated nucleic acid for use as a probe or primer, said nucleic acid having a distinctive sequence of at least 16-24 nucleotides in length, which sequence is present in Annex I or a sequence which is degeneratively equivalent thereto, or the complement of either.
A nucleic acid as claimed in claim 9 which is selected from the oligonucleotides (shown below in the 5' to 3' orientation):
8H8DIAG1 ACCTGCTTCTGCCAACCGCTC)
8H8DIAG1 ACCTGCTTCTGCCAACCGCTC)
11 A process for producing a nucleic acid as claimed in claim 5 comprising the step of modifying a nucleic acid as claimed in claim 3 or claim 4.
12 A method for identifying or cloning a nucleic acid as claimed in claim 6 or claim 7, which method employs a nucleic acid as claimed in claim 9 or claim 10.
13 A method as claimed in claim 12, which method comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a nucleic acid molecule which is a nucleic acid as claimed in claim 9 or claim 10, (c) contacting nucleic acid in said preparation with said nucleic acid molecule under conditions for hybridisation, and, (d) identifying nucleic acid in said preparation which hybridises with said nucleic acid molecule.
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a nucleic acid molecule which is a nucleic acid as claimed in claim 9 or claim 10, (c) contacting nucleic acid in said preparation with said nucleic acid molecule under conditions for hybridisation, and, (d) identifying nucleic acid in said preparation which hybridises with said nucleic acid molecule.
14 A method as claimed in claim 12, which method comprises the steps of:
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a pair of nucleic acid molecule primers suitable for PCR, at least one of said primers being a nucleic acid as claimed in claim 9 or claim 10, (c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR, (d) performing PCR and determining the presence or absence of an amplified PCR product.
(a) providing a preparation of nucleic acid from a plant cell;
(b) providing a pair of nucleic acid molecule primers suitable for PCR, at least one of said primers being a nucleic acid as claimed in claim 9 or claim 10, (c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR, (d) performing PCR and determining the presence or absence of an amplified PCR product.
15 A method as claimed in claim 14 wherein the preparation of nucleic acid is obtained from a Brassicaceae plant.
16 A recombinant vector which comprises the nucleic acid of any one of claims 1 to 8.
17 A vector as claimed in claim 16 wherein the nucleic acid is operably linked to a promoter for transcription in a host cell, wherein the promoter is optionally an inducible promoter.
18 A vector as claimed in claim 16 or claim 17 which is a plant vector.
19 A method for transforming a host cell, which comprises the step of introducing the vector of any one of claims 16 to 18 into a host cell, and optionally causing or allowing recombination between the vector and the host cell genome such as to transform the host cell.
20 A host cell containing or transformed with a heterologous vector of any one of claims 16 to 18.
21 A method for producing a transgenic plant, which method comprises the steps of:
(a) performing a method as claimed in claim 19 wherein the host cell is a plant cell, (b) regenerating a plant from the transformed plant cell.
22 A transgenic plant which is obtainable by the method of
21 A method for producing a transgenic plant, which method comprises the steps of:
(a) performing a method as claimed in claim 19 wherein the host cell is a plant cell, (b) regenerating a plant from the transformed plant cell.
22 A transgenic plant which is obtainable by the method of
claim 21, or which is a clone, or selfed or hybrid progeny or other descendant of said transgenic plant, which in each case includes a heterologous nucleic acid of any one of claims 1 to 8.
23 A plant as claimed in claim 22 which is selected from the list consisting of: rice; maize; wheat: barley; oats;
rye; oil seed rape; sugar beet; maize; sunflower; soybean;
sorghum; lettuce; endive: cabbage; broccoli; cauliflower;
carnations; geraniums.
24 A part of propagule from a plant as claimed in claim 22 or claim 23, which in either case includes a heterologous nucleic acid of any one of claims 1 to 8.
25 An isolated polypeptide which is encoded by the VRN1 nucleotide sequence of any one of claims 1 to 7.
26 A polypeptide as claimed in claim 25 which is the VRN1 polypeptide shown in Fig 4.
27 A method of making the polypeptide of claim 25 or claim 26, which method comprises the step of causing or allowing expression from a nucleic acid of any one of claims 1 to 7 in a suitable host cell.
28 A polypeptide which comprises the antigen-binding site of an antibody having specific binding affinity for the polypeptide of claim 26.
29 A method for assessing the vernalisation phenotype of a plant, the method comprising the step of determining the presence and/or identity of a VRN1 allele therein comprising the use of a nucleic acid as claimed in claim 9 or claim 10.
30 A method for influencing or affecting the vernalisation phenotype of a plant, which method comprises the step of causing or allowing expression of a heterologous nucleic acid as claimed in any one of claims 1 to 8 within the cells of the plant, following an earlier step of introducing the nucleic acid into a cell of the plant or an ancestor thereof.
31 A method as claimed in claim 30 for modifying the kinetics and/or optimal temperature of the vernalization response such as to alter the phenotype of the plant with respect to any one or more of: geographic range; length of a vernalization period; length of a vegetative growth phase.
32 A method as claimed in claim 30 or claim 31 for reducing the vernalisation requirement of a plant, wherein the heterologous nucleic acid is that claimed in any one of claims 1 to 7.
33 A method as claimed in claim 30 or claim 31 for increasing the vernalisation requirement of a plant, which method comprises any of the following steps of:
(i) causing or allowing transcription from a nucleic acid as claimed in claim 8 in the plant such as to reduce VRN1 expression by an antisense mechanism;
(ii) causing or allowing transcription from a nucleic acid as claimed in any one of claims 1 to 7 or a part thereof such as to reduce VRN1 expression by co-suppression;
(iii) use of nucleic acid encoding a ribozyme specific-for a nucleic acid as claimed in any one of claims 1 to 7.
34 An isolated nucleic acid molecule encoding the promoter of the VRN1 gene, or a homologous variant thereof which has promoter activity.
23 A plant as claimed in claim 22 which is selected from the list consisting of: rice; maize; wheat: barley; oats;
rye; oil seed rape; sugar beet; maize; sunflower; soybean;
sorghum; lettuce; endive: cabbage; broccoli; cauliflower;
carnations; geraniums.
24 A part of propagule from a plant as claimed in claim 22 or claim 23, which in either case includes a heterologous nucleic acid of any one of claims 1 to 8.
25 An isolated polypeptide which is encoded by the VRN1 nucleotide sequence of any one of claims 1 to 7.
26 A polypeptide as claimed in claim 25 which is the VRN1 polypeptide shown in Fig 4.
27 A method of making the polypeptide of claim 25 or claim 26, which method comprises the step of causing or allowing expression from a nucleic acid of any one of claims 1 to 7 in a suitable host cell.
28 A polypeptide which comprises the antigen-binding site of an antibody having specific binding affinity for the polypeptide of claim 26.
29 A method for assessing the vernalisation phenotype of a plant, the method comprising the step of determining the presence and/or identity of a VRN1 allele therein comprising the use of a nucleic acid as claimed in claim 9 or claim 10.
30 A method for influencing or affecting the vernalisation phenotype of a plant, which method comprises the step of causing or allowing expression of a heterologous nucleic acid as claimed in any one of claims 1 to 8 within the cells of the plant, following an earlier step of introducing the nucleic acid into a cell of the plant or an ancestor thereof.
31 A method as claimed in claim 30 for modifying the kinetics and/or optimal temperature of the vernalization response such as to alter the phenotype of the plant with respect to any one or more of: geographic range; length of a vernalization period; length of a vegetative growth phase.
32 A method as claimed in claim 30 or claim 31 for reducing the vernalisation requirement of a plant, wherein the heterologous nucleic acid is that claimed in any one of claims 1 to 7.
33 A method as claimed in claim 30 or claim 31 for increasing the vernalisation requirement of a plant, which method comprises any of the following steps of:
(i) causing or allowing transcription from a nucleic acid as claimed in claim 8 in the plant such as to reduce VRN1 expression by an antisense mechanism;
(ii) causing or allowing transcription from a nucleic acid as claimed in any one of claims 1 to 7 or a part thereof such as to reduce VRN1 expression by co-suppression;
(iii) use of nucleic acid encoding a ribozyme specific-for a nucleic acid as claimed in any one of claims 1 to 7.
34 An isolated nucleic acid molecule encoding the promoter of the VRN1 gene, or a homologous variant thereof which has promoter activity.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB9922071.7A GB9922071D0 (en) | 1999-09-17 | 1999-09-17 | Methods and means for modification of plant characteristics |
| GB9922071.7 | 1999-09-17 | ||
| PCT/GB2000/003525 WO2001021822A1 (en) | 1999-09-17 | 2000-09-13 | Methods and means for modification of plant flowering characteristics |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2384355A1 true CA2384355A1 (en) | 2001-03-29 |
| CA2384355C CA2384355C (en) | 2010-11-23 |
Family
ID=10861149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA2384355A Expired - Fee Related CA2384355C (en) | 1999-09-17 | 2000-09-13 | Methods and means for modification of plant flowering characteristics |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US7045682B1 (en) |
| EP (1) | EP1214433B1 (en) |
| AT (1) | ATE397082T1 (en) |
| AU (1) | AU782427B2 (en) |
| CA (1) | CA2384355C (en) |
| DE (1) | DE60039055D1 (en) |
| DK (1) | DK1214433T3 (en) |
| ES (1) | ES2307532T3 (en) |
| GB (1) | GB9922071D0 (en) |
| WO (1) | WO2001021822A1 (en) |
Families Citing this family (48)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7462706B2 (en) | 2003-04-11 | 2008-12-09 | The Regents Of The University Of California | Genes responsible for vernalization regulation in temperate grasses and uses thereof |
| CN1295333C (en) * | 2004-01-15 | 2007-01-17 | 中国科学院植物研究所 | Wheat VER2 gene promotor |
| CA2575388C (en) * | 2004-07-29 | 2013-04-30 | Pioneer Hi-Bred International, Inc. | Methods and compositions for modulating flowering and maturity in plants |
| US7964774B2 (en) | 2008-05-14 | 2011-06-21 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV384196 |
| EP2440663A1 (en) | 2009-06-09 | 2012-04-18 | Pioneer Hi-Bred International Inc. | Early endosperm promoter and methods of use |
| US9175301B2 (en) * | 2009-07-24 | 2015-11-03 | Pioneer Hi Bred International Inc | Use of dimerization domain component stacks to modulate plant architecture |
| US8440891B2 (en) | 2009-09-22 | 2013-05-14 | Board of Trustees of the University of Akransas, N.A. | Rice cultivar CL 142-AR |
| US8440892B2 (en) | 2009-10-15 | 2013-05-14 | Board Of Trustees Of The University Of Arkansas, N.A. | Rice cultivar CL 181-AR |
| CN102597244B (en) | 2009-10-26 | 2014-07-23 | 先锋国际良种公司 | Somatic ovule specific promoter and methods of use |
| WO2013096818A1 (en) | 2011-12-21 | 2013-06-27 | The Curators Of The University Of Missouri | Soybean variety s05-11268 |
| US9204603B2 (en) | 2011-12-21 | 2015-12-08 | The Curators Of The University Of Missouri | Soybean variety S05-11482 |
| US20130180008A1 (en) | 2012-01-06 | 2013-07-11 | Pioneer Hi Bred International Inc | Ovule Specific Promoter and Methods of Use |
| WO2013103365A1 (en) | 2012-01-06 | 2013-07-11 | Pioneer Hi-Bred International, Inc. | Pollen preferred promoters and methods of use |
| US8878009B2 (en) | 2012-04-26 | 2014-11-04 | Monsanto Technology, LLP | Plants and seeds of spring canola variety SCV318181 |
| US8835720B2 (en) | 2012-04-26 | 2014-09-16 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV967592 |
| US8859857B2 (en) | 2012-04-26 | 2014-10-14 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV259778 |
| WO2014059155A1 (en) | 2012-10-11 | 2014-04-17 | Pioneer Hi-Bred International, Inc. | Guard cell promoters and uses thereof |
| US9713332B2 (en) | 2013-03-13 | 2017-07-25 | Pioneer Hi-Bred International, Inc. | Glyphosate application for weed control in Brassica |
| MX369750B (en) | 2013-03-14 | 2019-11-20 | Pioneer Hi Bred Int | Compositions and methods to control insect pests. |
| EP2971000A4 (en) | 2013-03-15 | 2016-11-23 | Pioneer Hi Bred Int | Phi-4 polypeptides and methods for their use |
| US10006045B2 (en) | 2013-08-16 | 2018-06-26 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| CA3175967A1 (en) | 2013-09-13 | 2015-03-19 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| CA2939156A1 (en) | 2014-02-07 | 2015-08-13 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| CA2955828A1 (en) | 2014-08-08 | 2016-02-11 | Pioneer Hi-Bred International, Inc. | Ubiquitin promoters and introns and methods of use |
| WO2016044092A1 (en) | 2014-09-17 | 2016-03-24 | Pioneer Hi Bred International Inc | Compositions and methods to control insect pests |
| CN113372421A (en) | 2014-10-16 | 2021-09-10 | 先锋国际良种公司 | Insecticidal proteins and methods of use thereof |
| US20170359965A1 (en) | 2014-12-19 | 2017-12-21 | E I Du Pont De Nemours And Company | Polylactic acid compositions with accelerated degradation rate and increased heat stability |
| CN116333064A (en) | 2015-05-19 | 2023-06-27 | 先锋国际良种公司 | Insecticidal proteins and methods of use thereof |
| US10647995B2 (en) | 2015-06-16 | 2020-05-12 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| CN104928284A (en) * | 2015-06-30 | 2015-09-23 | 华南农业大学 | Soybean vernalization gene GmVRN1 and colonizing method and application thereof |
| US11198709B2 (en) | 2015-08-06 | 2021-12-14 | E. I. Du Pont De Nemours And Company | Plant derived insecticidal proteins and methods for their use |
| CA2992488A1 (en) | 2015-08-28 | 2017-03-09 | Pioneer Hi-Bred International, Inc. | Ochrobactrum-mediated transformation of plants |
| CN105154451A (en) * | 2015-09-24 | 2015-12-16 | 中国热带农业科学院南亚热带作物研究所 | LcVRN2 gene for shifting flower formation to earlier date and application thereof |
| EP3390431A1 (en) | 2015-12-18 | 2018-10-24 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| EP4257694A3 (en) | 2015-12-22 | 2023-12-06 | Pioneer Hi-Bred International, Inc. | Tissue-preferred promoters and methods of use |
| MX2018013249A (en) | 2016-05-04 | 2019-02-13 | Pioneer Hi Bred Int | Insecticidal proteins and methods for their use. |
| US20190185867A1 (en) | 2016-06-16 | 2019-06-20 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| CN116334123A (en) | 2016-06-24 | 2023-06-27 | 先锋国际良种公司 | Plant regulating element and method of use thereof |
| US11155829B2 (en) | 2016-07-01 | 2021-10-26 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins from plants and methods for their use |
| WO2018013333A1 (en) | 2016-07-12 | 2018-01-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| US11021716B2 (en) | 2016-11-01 | 2021-06-01 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| BR112020006045A2 (en) | 2017-09-25 | 2020-10-06 | Pioneer Hi-Bred International, Inc. | nucleic acid molecule, expression cassette, vector, plant cell, plant, plant seed, method for producing a transgenic plant, transgenic plant, transgenic plant seed, method for improving somatic embryo maturation efficiency and method for producing a transgenic dicot plant or a transgenic gymnosperm plant |
| BR112020023800A2 (en) | 2018-05-22 | 2021-02-23 | Pioneer Hi-Bred International, Inc. | plant regulatory elements and methods of using them |
| WO2020005933A1 (en) | 2018-06-28 | 2020-01-02 | Pioneer Hi-Bred International, Inc. | Methods for selecting transformed plants |
| AU2019369415A1 (en) | 2018-10-31 | 2021-03-25 | Pioneer Hi-Bred International, Inc. | Compositions and methods for Ochrobactrum-mediated plant transformation |
| CN109666757B (en) * | 2019-01-31 | 2022-04-19 | 宁夏农林科学院农作物研究所（宁夏回族自治区农作物育种中心） | Kit for identifying wheat vernalization gene VRN-D4 and special complete set of primer pair thereof |
| US20230235352A1 (en) | 2020-07-14 | 2023-07-27 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| CN113988376B (en) * | 2021-09-29 | 2023-08-29 | 南京物链云农业科技有限公司 | Rice growth period prediction method, system and device |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9901927D0 (en) | 1999-01-28 | 1999-03-17 | John Innes Foundation | Methods and means for modification of plant characteristics |
| GB9902660D0 (en) | 1999-02-05 | 1999-03-31 | Plant Bioscience Ltd | Plant gene |
-
1999
- 1999-09-17 GB GBGB9922071.7A patent/GB9922071D0/en not_active Ceased
-
2000
- 2000-09-13 ES ES00962656T patent/ES2307532T3/en not_active Expired - Lifetime
- 2000-09-13 WO PCT/GB2000/003525 patent/WO2001021822A1/en active IP Right Grant
- 2000-09-13 AU AU74307/00A patent/AU782427B2/en not_active Ceased
- 2000-09-13 AT AT00962656T patent/ATE397082T1/en not_active IP Right Cessation
- 2000-09-13 EP EP00962656A patent/EP1214433B1/en not_active Expired - Lifetime
- 2000-09-13 CA CA2384355A patent/CA2384355C/en not_active Expired - Fee Related
- 2000-09-13 DE DE60039055T patent/DE60039055D1/en not_active Expired - Lifetime
- 2000-09-13 US US10/088,187 patent/US7045682B1/en not_active Expired - Lifetime
- 2000-09-13 DK DK00962656T patent/DK1214433T3/en active
Also Published As
| Publication number | Publication date |
|---|---|
| GB9922071D0 (en) | 1999-11-17 |
| US7045682B1 (en) | 2006-05-16 |
| AU782427B2 (en) | 2005-07-28 |
| AU7430700A (en) | 2001-04-24 |
| ES2307532T3 (en) | 2008-12-01 |
| EP1214433B1 (en) | 2008-05-28 |
| DK1214433T3 (en) | 2008-10-06 |
| DE60039055D1 (en) | 2008-07-10 |
| CA2384355C (en) | 2010-11-23 |
| WO2001021822A1 (en) | 2001-03-29 |
| ATE397082T1 (en) | 2008-06-15 |
| EP1214433A1 (en) | 2002-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2384355A1 (en) | Methods and means for modification of plant flowering characteristics | |
| US7220587B2 (en) | Ethylene insensitive plants | |
| CA2360053A1 (en) | Plant gene | |
| CN102131934B (en) | Plants having enhanced yield-related traits and method for making same | |
| CA2299699A1 (en) | Genetic control of plant growth and development | |
| CA2359231A1 (en) | Methods and means for modification of plant characteristics using the vernalization gene vrn2 | |
| DE112008001277T5 (en) | Transgenic plants with increased stress tolerance and increased yield | |
| US8319018B2 (en) | Genetic system for controlling the floral development of a dicotyledon plant, and implementation in detection and selection processes | |
| EP1948683B1 (en) | Emp4 gene | |
| AU2011273569B2 (en) | Gene involved in the development of the seed | |
| CA2008698C (en) | Male flower specific gene sequences | |
| US6501007B1 (en) | Method of dwarfing plants | |
| CN108341857B (en) | Rice yield related protein and coding gene and application thereof | |
| CA2392435A1 (en) | An isolated plant gene encoding a .beta.-amyrin synthase | |
| CA2575388A1 (en) | Methods and compositions for modulating flowering and maturity in plants | |
| Kitashiba et al. | Isolation of genes similar to DREB1/CBF from sweet cherry (Prunus avium L.) | |
| US7199282B2 (en) | Floral induction gene | |
| CA2395453C (en) | Plant lesion formation suppressing gene, spl7 and use thereof | |
| CA2394792A1 (en) | Promoter and intron from maize actin depolymerizing factor | |
| US20040098758A1 (en) | Method for modifying a plant phenotype | |
| KR20050091149A (en) | Polypeptide having a function controling early flowering, polynucleotide coding the polypeptide and their use | |
| JP2001333784A5 (en) | ||
| JPH05199885A (en) | Yeast ste11 homologous protein phosphorylation enzyme gene of solanaceae plant | |
| JPH08275779A (en) | S saccharide protein gene and s receptor kinase gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKLA | Lapsed |
Effective date: 20150914 |