CA2366217A1 - Inducible comtii promoter, chimera gene containing same and transformed plants - Google Patents

Abstract

The invention concerns a novel regulating COMTII promoter sequence inducible in response to a mechanical or chemical injury, or in response to aggression by a pathogenic agent, in particular bacterial, fungal or viral, or by an insect or a threadworm. The invention also concerns a chimera gene (or expression cassette) comprising the inventive regulating promoter sequence controlling the expression of a heterologous coding sequence and host organism comprising said chimera gene, the transformed plants containing it and the seeds of said transformed plants.

Description

COMTII inducible promoter, chimeric gene comprising it and plants transformed The present invention relates to a new promoter regulatory sequence inducible in response to an injury, mechanical or chemical, or in response to a aggression by a pathogenic agent, in particular bacterial, fungal or viral, or by a insect or nematode.
The present invention also relates to a chimeric gene (or cassette expression) comprising the promoter regulatory sequence according to invention which controls the expression of a heterologous, heterologous coding sequence meaning here a coding sequence different from the native coding sequence.
The present invention also relates to a host organism comprising said chimeric gene, transformed plants comprising it and seeds said transformed plants.
It is known from the state of the art that certain genes, silent in the absence of aggression, are only activated by both mechanical and chemical aggression and / or in response to an attack by a pathogen, an insect or a nematode. Of such genes and their activation factors are described in particular in the US patent 5,670,349.
These different modes of defense are generally linked to a regulation of the expression of certain genes involved in the defense mechanisms of plants by induction of their promoter regulatory sequences. We know several sequences regulators such as phenylalanine ammonia lyase promoters (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, inhibitors of proteinase (PI), genes of the PR1 family, nopaline synthase (nos) or of the gene vspB, all these promoters being recalled with the references of the publications corresponding by Table 3 of US Patent 5,670,349. We also know the HMG2 promoter described in this same US Pat. No. 5,670,349, as the promoter of the apple beta-galactosidase (ABG1) or the amino cyclopropane promoter apple carboxylate syntase (ACC synthase) described in the patent application WO
98/45445.
The present invention relates to a new nucleic acid fragment, in particular isolated, comprising a plant promoter (or sequence of regulation promoter) inducible, said inducible promoter being constituted by the promoter of a WO 00/56897

2 PCT / FR00 / 00714 plant O-methyltransferase class II gene (hereinafter COMT II).
Class II O-methyltransferase genes; whose gene for caffeic acid-O-Class II methyltransferase, plants are silent (inactive) in the absence of any aggression since the non-aggressed plants do not express it, or for the less at levels undetectable by usual analysis methods. So the messenger of the COMT II is undetectable by the technique of "Northern blot" in different fabrics a healthy untreated plant, such as tobacco (Pellegrini & al., 1993).
This COMTII and its promoter are activated (or induced) by injuries, infections viral, assaults with UV rays, or chemical assaults by different products like benzothiazole (BTH), methyl jasmonate or elicitors of plant origin such as pectin.
Advantageously, the isolated nucleic acid fragment according to the invention East consisting of a COMTII plant promoter.
By COMTII of plant is understood according to the invention any OMT of plant which is not not expressed in healthy untreated plants, but is expressed as a result of a mechanical, chemical attack by a pathogen, an insect or a nematode.
By COMTII plant of origin, we mean according to the invention any organism differentiated multicellular capable of photosynthesis, whether monocot or dicot, such as rice, wheat, barley, sunflower, corn, tobacco, rapeseed, soybeans or Arabidopsis thaliana.
According to a particular embodiment of the invention, the COMT II is a COMT of dicotyledonous plant, preferably tobacco.
By promoter is meant according to the invention the non-coding region of a gene involved in binding with RNA polymerase and other factors that are responsible for initiating and modulating transcription leading to the production of an RNA transcript. It is more particularly about any 5 'sequence of the translation initiation site or codon "start" (ATG) of the sequence coding of COMTII allowing the transcription and expression of said sequence coding.
The promoter according to the invention advantageously comprises one more sequence 600 nucleotides upstream of the COMT II ATG, preferably more than 70.0, from more than 800 or even more than 900 nucleotides upstream of the ATG, more preferably more than 1000 nucleotides upstream of the ATG, even more WO 00/56897

3 PCT / FR00 / 00714 preferably more than 1200 nucleotides upstream of the ATG. The promoters comprising more than 1,500 nucleotides upstream of the COMTII ATG
also part of the present invention.
The promoter includes a transcription initiation site. The site initiation S of transcription is generally located less than 100 nucleotides in upstream of ATG, advantageously about 90 nucleotides upstream.
Advantageously, the 3 ′ end of the COMTII promoter according to the invention is located between the transcription initiation site and the ATG. Of preference, the 3 'end of the COMTII promoter is located between 10 and 50 nucleotides in downstream of the site transcription initiation, more preferably between 20 and 40 nucleotides in downstream, even more preferably between 20 and 30 nucleotides downstream.
The COMTII promoter according to the invention also comprises at least one box TATA and at least one CAT box. The TATA box is generally located at least of 50 nucleotides upstream of the transcription initiation site, about 40 nucleotides upstream. The CAT box is generally located less than 100 nucleotides in upstream transcription initiation site, preferably about 100 nucleotides and / or 80 nucleotides upstream. Advantageously, the promoter comprises two boxes CAT.
The promoter according to the invention also comprises regulatory elements involved in the expression of genes for the metabolism of phenylpropanoids and of defense-associated genes, in particular at least one A and / or minus a box L and / or at least one reverse L box and / or at least one P box and / or at minus one reverse W box. Box A includes the following sequence CCGTCC. She is generally located less than 410 nucleotides from the initiation site of the transcription.
Box L includes the following sequence CTTCAACAACCAACC. She is generally located less than 180 nucleotides from the initiation site of the transcription.
The first reverse L box includes the following sequence GTTAGGTGAAG. She is generally located less than 1000 nucleotides upstream of the site initiation of the transcription. Advantageously, the promoter according to the invention comprises two boxes L
inverted, one about 970 nucleotides upstream of the initiation site of the transcription and the other about 440 nucleotides upstream. The second box L
reverse includes the following sequence TGTTAGGTGTGTGTTT. The P box WO 00/56897

4 PCT / FR00 / 00714 includes the following sequence CACACCAACTCCCA. It is usually located less than 750 nucleotides upstream from the transcription initiation site. The box W
reverse includes the following sequence GGTCAA. It is usually located less than 1200 nucleotides upstream of the transcription initiation site.
Advantageously, the promoter according to the invention comprises two boxes W
reversed, one at around 1110 nucleotides upstream and the other at erz ~ iron 210 nucleotides in upstream.
The promoter according to the invention also comprises at least one E box and / or at least one G box and / or at least one GT box. Box E includes the sequence following TTCCATCAAG. It is generally located less than 110 nucleotides in upstream of the transcription initiation site. Box G includes the next sequence CCACGT. It is generally located less than 600 nucleotides upstream of the site transcription initiation. The GT box includes the following sequence GGTTAA.
It is generally located less than 450 nucleotides upstream from the site initiation of the transcription. Advantageously, the promoter according to the invention comprises two boxes GT, one about 400 nucleotides upstream and the other about 280 nucleotides in upstream.
According to an advantageous embodiment of the invention, the promoter according to the invention consists of the COMTII tobacco promoter defined by the sequence nucleotide upstream of the ATG represented by the sequence identifier 1 (SEQ
ID NO 1). Preferably the COMTII tobacco promoter comprises the sequence between nucleotides 557 and 1795 of SEQ ID NO 1, the sequences capable to selectively hybridize to said sequences and their sequences counterparts.
Preferably the COMTII tobacco promoter comprises the sequence included Between nucleotides 557 and 889 of SEQ ID NO 1, the sequences capable of hybridize selectively to said sequences and their homologous sequences. The promoter COMTII tobacco inducible is activated by injuries, infections viral, the UV attack, or chemical attack by different products as benzothiazole (BTH), methyl jasmonate or original elicitors vegetable like pectin. The promoter's functional study identified the regions involved in the induction of the promoter under different conditions. The fragment comprising the sequence between nucleotides 698 to 1365 is necessary and WO 00/56897

5 PCT / FR00 / 00714 sufficient to impart sensitivity and induction by injury, by the VMT, the megaspermine, pectin and chitin. Preferably the promoter ÇOMTII
of tobacco therefore comprises the sequence between nucleotides 698 and 1365 of the SEQ
ID NO 1, the sequences capable of hybridizing selectively to the said sequences and their homologous sequences. This fragment can be associated with a other promoter to induce expression of a gene by injury, by VMT, the megaspermine, pectin or chitin. This fragment can thus be associated with minimum promoter of CaMV RNA 355. The present invention therefore also has relates to a chimeric promoter comprising the sequence between nucleotides 698 and 1365 of SEQ ID NO 1, the sequences capable of hybridizing to way selective to said sequences and their homologous sequences. Analysis of the reply of the promoter with respect to methyl jasmonate and the UV indicates that the fragment comprising the sequence between nucleotides 815 and 1795 of SEQ ID

is functional. In an advantageous embodiment, the COMTII promoter of tobacco therefore comprises the sequence between nucleotides 815 and 1795 of the SEQ
ID NO 1, the sequences capable of hybridizing selectively to the said sequences and their homologous sequences.
By "sequence capable of hybridizing selectively" is meant according to the invention the sequences which hybridize with the above sequences to a level significantly higher than background noise. Background noise can be linked to the hybridization of other DNA sequences present, in particular other cDNAs present in a cDNA library. The signal level generated by the interaction enter here sequence capable of selectively hybridizing and the sequences defined by The above sequence ID according to the invention is generally 10 times, from preferably 100 times more intense than that of the interaction of other DNA sequences generating the noise of background. The level of interaction can be measured, for example, by marking the probe with radioactive elements, like 32P. Selective hybridization is usually obtained using very harsh environmental conditions (e.g. NaCI
0.03M
and 0.03 M sodium citrate at about 50 ° C-60 ° C). Hybridization can of course be carried out according to the usual methods of the state of the art (in particular Sambrook &
al., 1989, Molecular Cloning: A Labratory Manual).
By homologous sequence is meant according to the invention any sequence comprising WO 00/56897

6 PCT / FR00 / 00714 more than 70% homology, preferably more than 80% homology, again more preferably more than 90% homology, and which retains the elements functional COMTII giving it its properties as an inducible promoter. The methods of measurement and identification of homologies between acid sequences nucleic acids are well known to those skilled in the art. One can use for example the programs PILEUP or BLAST (in particular Altschul & al., 1993, J. Mol. Evol. 36: 290-300;
Altschul & al., 1990, J. Mol. Biol. 215: 403-10).
Isolation, cloning and characterization of COMT II promoters from of COMT II genes are made according to the usual experimental methods of man of profession to isolate, clone and characterize a promoter, abundantly described in the literature.
COMT II gene isolation and cloning is done by bank analysis genomics prepared from the DNA of the plant of interest. Genomic DNA
East cut by one or more suitable restriction enzymes and introduced in one suitable vector for constituting, by methods known to those skilled in the art profession, a library containing all of the plant's genomic DNA (Ausubel et al., 1998;
Sambrook et al., 1989).
The clone (s) containing a COMT II gene is (are) isolated) thanks to a probe nucleotide. The probe sequence is. be deduced from the sequence protein if the enzyme has been purified (by following its activity, for example), or prepared from a cDNA clone from a bank. This cDNA bank is prepared from mRNA extracted from tissues treated to induce expression of the COMT II gene (over there injury, infection or chemical treatment as described in the examples where the Figures 1-5). The cDNA library is then screened by directed antibodies against a COMT II protein (from tobacco for example) or by a deduced nucleotide probe of the COMT II protein of the plant considered or deduced from the conserved sequences at the COUNT of plants. The cDNA thus isolated is characterized by its sequence nucleotide or by the enzymatic activity of the recombinant protein obtained after expression of cDNA in a prokaryotic or eukaryotic organism.
The non-coding sequences of cDNA (3 'and / or 5') are used to to select, by PCR, under very selective conditions, the genomic clone (s) containing the gene COMT II expressed during the processing used to build the cDNA library. The WO 00/5689

7 ~ PCT / FR00 / 00714 promoter sequences are then to be isolated by PCR or any other method suitable well known to those skilled in the art.
Based on the information contained in this patent application for the COMTII tobacco promoter, those skilled in the art will be able to identify other COMTII promoters of other plant species once the COMTII gene has been identified and cloned according to the usual methods, in particular those described above.
The present invention also relates to a chimeric gene (or cassette expression) functional in plant cells and plants including in the sense of transcription a 5 'regulatory sequence, a sequence coding and a 3 'regulatory sequence, the 5' regulatory sequence comprising a promoter COMT II according to the invention defined above.
By "plant cell" is meant according to the invention any cell originating from a plant and which can constitute undifferentiated tissues such as calluses, tissues differentiated such as embryos, parts of plants, plants or seeds.
IS The term "plant" according to the invention means any multicellular organism differentiated capable of photosynthesis, in particular monocots or dicots, more particularly crop plants intended or not intended for food animal or human, such as corn, wheat, rapeseed, soy, rice, cane sugar, beet, tobacco, cotton, etc.
As a 5 ′ regulatory sequence, the COMTII promoter can be used according to the invention alone or associated with at least part of a promoter of a gene speaking naturally in plants especially a promoter expressing itself especially in plant leaves, such as so-called promoters original bacterial, viral or plant or so-called light promoters addicted like that of a gene for the small ribulose subunit-biscarboxylase / oxygenase (RuBisCO) plant or any known suitable promoter that can be used.
Among promoters of plant origin include histone promoters such as described in EP 0 507 698, or the rice actin promoter (US 5,641,876). Among the promoters of a plant virus gene, that of the mosaic of cauliflower (CAMV 19S or 35S), or the promoter of the circovirus (AU 689 311).
The COMTII promoter according to the invention can also be used in combination with at least part of a region or tissue specific promoter individuals WO 00/56897 g PCT / FR00 / 00714 plants, and more specifically seed promoters ([22] Datla, R. & al., Biotechnology Ann. Rev. (1997) 3, 269-296), in particular the promoters of the napine (EP 255 378), phaseoline, glutenin, heliantinine (WO
92/17580), albumin (WO 98/45460) or oelosin (WO 98/45461).
According to the invention, it is also possible to use, in combination with the promoter COMTII according to the invention, other regulatory sequences, which are located between the promoter and coding sequence, such as transcription activators ("enhancer"), such as the translational activator of the mosaic of tobacco (VMT) described in application WO 87/07644, or the etch tobacco virus (VET) described by Carrington & Freed.
As terminating or polyadenylation regulatory sequence, use any corresponding sequence of bacterial origin, such as example the terminator nos of Agrobacterium tumefaciens, or of plant origin, like example a histone terminator as described in application EP 0 633 317.
The coding sequence of the chimeric gene according to the invention comprises a sequence coding for a reporter gene, such as the coding sequence GUS, or a sequence coding for a protein of interest. Regarding the induction mode of promoter according to invention, injury, viral infection or response to elicitors, the protein of interest is advantageously a protein conferring on plants properties of resistance to diseases or insects.
Among the proteins or peptides of interest conferring new properties of resistance to diseases include chitinases, glucanases, oxalate oxidase, all of these proteins and their coding sequences being largely described in literature, or even antibacterial and / or antifungal peptides, in especially the peptides of less than 100 amino acids rich in cysteines such as thionines or plant defensins, and more particularly the lytic peptides of all origins comprising one or more disulfide bridges between cysteines and regions comprising basic amino acids, in particular lytic peptides following androctonine (WO 97/30082 and PCT / FR98 / 01814, filed on August 18, 1998) or drosomicin (PCT / FR98 / 01462, filed July 8, 1998).
According to a preferred embodiment of the invention, the protein or peptide of interest is chosen from fungal eliciting peptides, in particular elicitins (Kamoun & al., 1993; Panabières & al., 1995). Preferably, the peptide fungal elicitor is megaspermine. Megaspermine and its coding sequence East represented by sequence identifier No. 13 (SEQ ID 13). Of way more preferential, the chimeric gene according to the invention comprising, in the sense of the transcription of a 5 'regulatory sequence comprising a COMT II promoter and a coding sequence for megaspermine includes the DNA sequence represented by sequence identifier No. 14 (SEQ ID 14).
Among the proteins of interest conferring new resistance properties to the insects, more particularly the Bt proteins widely described in the literature and well known to those skilled in the art. We will also mention the proteins extracted bacteria such as Photorabdus (WO 97/17432 & WO 98/08932).
The present invention also relates to a chimeric gene (or cassette expression) functional in plant cells and plants including in the sense of transcription a 5 'regulatory sequence, a sequence coding for a elicitor and a 3 'regulatory sequence, the 5' regulatory sequence including an inducible promoter.
Preferably, the elicitor is an elicitin, more preferably the megaspermine as defined above.
The inducible promoter is advantageously chosen from the promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, of glucanases, proteinase inhibitors (PI), genes of the PR1 family, nopaline synthase (nos) or the vspB gene (US 5,670,349, Table 3), the HMG2 promoter (US 5 670 349), the promoter of apple beta-galactosidase (ABG1) or the promoter of apple amino cyclopropane carboxylate syntase (ACC synthase) (WO
98/45445).
The present invention also relates to a cloning vector and / or of expression for the transformation of plant cells or plants containing at minus one chimeric gene as defined above. This vector also includes uncomfortable above chimera, at least one origin of replication. This vector can be constituted by a plasmid, a cosmid, a bacteriophage or a virus, transformed by the introduction of the chimeric gene according to the invention. Such vectors of transformation are well known to those skilled in the art and widely described in the literature. For the transformation of plant cells or plants, this will include of a virus that WO 00/56897 1 ~ PCT / FR00 / 00714 can be used for the transformation of developed plants and containing in addition its own elements of replication and expression. So preferential, the vector transformation of plant cells or plants according to the invention is a plasmid.
For the transformation of plant cells or plants, the chimeric gene according to the invention can be used in association with a marker gene for selection, either in the same vector, the two genes being convergently associated, divergent or collinear, or in two vectors used simultaneously for the transformation of the host organism. Such marker genes and their use for the transformation of plants are well known to those skilled in the art and widely described in the litterature.
Among the genes coding for selection markers, mention may be made of genes of antibiotic resistance, herbicide tolerance genes (bialaphos, glyphosate or isoxazoles), genes coding for reporter enzymes easily identifiable as the enzyme GUS, genes coding for pigments or enzymes regulating the production of pigments in transformed cells. Of such selection marker genes are described in particular in the applications for EP patent 242 236, EP 242 246, GB 2 197 653, WO 91/02071, WO 95/06128, WO 96/38567 or WO 97/04103.
The invention also relates to a method for transforming cells.
plants by integration into the genome of said plant cells of at least one uncomfortable chimera as defined above, transformation which can be obtained by any means known appropriate, amply described in the specialized literature and in particular the references cited in the present application, more particularly by the vector according to the invention.
A series of methods involves bombarding cells, protoplasts or of tissues with particles to which the DNA sequences are attached. A
other series of methods is to use as a means of transfer into the plant a gene chimera inserted into a Ti plasmid of Agrobacterium tumefaciens or Ri of Agrobacterium rhizogenes. Other methods can be used such that the microphone injection or electroporation, or even direct precipitation by means of PEG.
Those skilled in the art will choose the appropriate method depending on the nature of the host organism, in particular the plant cell or the plant.
The present invention also relates to plant cells or plants transformed and containing a chimeric gene defined above.
The present invention also relates to plants containing cells transformed, especially plants regenerated from cells transformed. The regeneration is obtained by any suitable process which depends on the nature of the species, as for example described in the references above. For the processes of transformation of plant cells and plant regeneration, we will quote including the following patents and patent applications: US 4,459,355, US
4,536,475, US 5,464,763, US 5,177,010, US 5,187,073, EP 267,159, EP 604 662, EP 672 752, US
4,945,050, US 5,036,006, US 5,100,792, US 5,371,014, US 5,478,744, US
5,179,022, US 5,565,346, US 5,484,956, US 5,508,468, US 5,538,877, US 5,554,798, US
5,489,520, US 5,510,318, US 5,204,253, US 5,405,765, EP 442 174, EP 486 233, EP
486,234, EP 539,563, EP 674,725, WO 91/02071 and WO 95/06128.
The present invention also relates to the transformed plants derived from the cultivation and / or crossing of the above regenerated plants, as well as seeds transformed plants.
The transformed plants obtainable according to the invention can be of monocotyledonous type such as for example cereals, sugar cane, rice and corn or dicot such as tobacco, soy, rapeseed, cotton, the sunflower, beet, clover, etc.
The plants transformed according to the invention may contain other genes of interest, giving plants new agronomic properties. Among the genes conferring new agronomic properties on transformed plants, we can quote genes conferring tolerance to certain herbicides, those conferring tolerance to certain insects, those which confer tolerance to certain diseases. Such genes are in particular described in patent applications WO 91/02071 and WO 95/06128. We may also cite the genes modifying the constitution of plants modified, in in particular the content and quality of certain essential fatty acids (EP 666 918) or still the protein content and quality, especially in leaves and / or seeds of said plants. Mention will in particular be made of the genes coding for protein enriched with sulfur amino acids ([1]; WO 98/20133; WO 97/41239; WO
95/31554;

WO 94/2082

8; WO 92/14822). These proteins enriched with sulfur amino acids will have also has the function of trapping and storing cysteine and / or methionine excess, to avoid possible toxicity problems related to a overproduction of these sulfur amino acids by trapping them. We can cite also genes coding for peptides rich in sulfur amino acids and more particularly in cysteines, said peptides also having antibacterial activity and or antifungal. Mention will be made more particularly of the defensins of plants, same as the lytic peptides of any origin, and more particularly peptides following lytics androctonine (WO 97/30082 and PCT / FR98 / 01814, filed on August 18, 1998) or drosomicine (PCT / FR98 / 01462, filed July 8, 1998.
These other genes of interest can be combined with the chimeric gene according to the invention either by conventional crossing of two plants containing each one genes (the first the chimeric gene according to the invention and the second the gene coding for the protein of interest) either by transforming cells vegetable of a plant containing the gene coding for the protein of interest with the gene chimera according to the invention.
The examples below illustrate the invention, without however seek to limit its scope.
All the methods or operations described below in these examples are given as examples and correspond to a choice made from among different methods available to achieve the same result. This choice has no affect the quality of the result and therefore any suitable method can be used by skilled in the art to achieve the same result. Most methods engineering DNA fragments are described in "Current Protocol in Molecular Biology "
Volumes 1 and 2, Ausubel FM et al or in Sambrook et al 1989.
Description of Figure 1: GUS activity kinetics (lA) corresponding to the COMTII promoter construction (-1215 to +24) / GUS and COMTII (1B) during a viral infection (VMT) or during an injury.
EXAMPLE 1 Isolation of the Class II COMT Gene Screening of a tobacco genomic bank allowed the isolation of 6 clones different containing COMT class II genes (COMTII). These first summer characterized by their restriction profiles which revealed some heterogeneity among the different clones.
COMTIIs form a multigene family composed of six to seven genes including only one is transcribed in defense reactions since only one type of cDNA
has been characterized in a bank elaborated from leaves inoculated by the virus Tobacco mosaic (VMT) (Pellegrini & al. 1993). In order to identify the clones containing the gene expressed during defense reactions, PCR reactions have been made using primers derived from the 3 'non-coding region of cDNA. In conditions of high selectivity a single clone is then amplified. The products amplifications have been sequenced. The sequences obtained presented a homology perfect with those of the 3 'non-coding regions of the cDNA.
Example 2 Analysis of the COMT gene promoter sequences of class II
The selected genomic clone was subcloned into a bacterial vector (puc 18) and represents a 14 kb insert of which 9 kb are located upstream of the ATG of the gene COMTII.
The transcription initiation site was determined by the technique extension primer and it is placed at 90 nucleotides from the initiation site of the translation.
The promoter was sequenced over a length of 1771 kilobases. Elements non-specific and common to the eukaryotic genes involved in the initiation of the transcripts such as the TATA box and the CAT box were found in the promoter COMTII (SEQ ID NO 1). Regulation sites have been highlighted by comparison of promoter sequences of the COMTII gene with those of genes intervening in defense mechanisms. The COMTII promoter contains specific elements of the phenylpropanoid metabolism genes involved in the stress response such as the three boxes P, A, L (initially identified in the gene PAL parsley) (SEQ ID NO 1). These three boxes are involved in the response to the elicitors and the P and L boxes are also involved in responding to UV. The box E originally identified in the CCoAOMT gene of parsley and extremely stored in the genes of phenylpropanoid metabolism also plays a role in the answer to the elicitors.
The COMTII promoter also has elements playing an important role in the induction of PR genes by elicitors such as the W box (SEQ ID NO 1 ).

General regulatory elements are found in the promoter of the COMTII such as G, GT boxes and the activator element of the simiens SV40 virus (SEQ ID
NO 1). Box G is an element present in a wide variety of promoters plants. Box G, associated with specific cis elements, is involved in the regulation of many genes responding to different physiological signals and environmental. The promoter region, responsible for the regulation of genes speak methyl jasmonate, consists of a G box associated with sequences rich in nucleotides C. A similar organization is found at the level of the promoter of genes specifically induced during the injury. The L boxes, present in the promoter of COMTII, could intervene in this kind of interaction because they are patterns rich in nucleotides C.
GT boxes, represented several times in promoters, seem to be playing a role in modulating the expression of certain plant genes, namely so much as an activator or as a repressor.
Example 3 Functional Analysis of the Promoter Regions of the COMTII Gene The functional analysis of the COMTII promoter was carried out by transgenesis in stable expression. The transgene was obtained by transcriptional fusion between the promoter and a reporter gene, the GUS ((3-glucuronidase) gene.
constructions corresponding to different deletions of the promoter have been carried out in order to specify the nature of the important promoter sequences responsible for the regulation of uncomfortable.
These constructions correspond to the promoter sequences from -1215 to +24 pairs of bases (bp), from -420 to +24 bp, from -313 to + 24bp and from -121 to +24 bp (compared to the site +1 of transcription), 557 to 1795, 1352 to 1795, 1459 to 1795 and 1651 to 1795 respectively on SEQ ID NO 1 introduced upstream of the GUS gene in the vector pBi101 (Clontech).
The different constructions were introduced via Agrobacterium tumefaciens in the plant genome. A population of ten tobacco plants transformed has been regenerated for each construction. The level of expression of the transgene has been determined by assay of enzyme activity and by tests histochemicals.
At the same time, the expression of the COMTII genes was analyzed by measuring activity of corresponding enzymes.

Results:
GUS activity has been tested in these plants under different conditions induction defense reactions, by a fungal elicitor injected into the leaves (megaspermine), or after exposure to UV. The results obtained are reported in Tables I and 2 below. The GUS activity is expressed in pmol MU / min.
mg.
For Table I, the control (T) consists of the infiltration of water into the leaves of transformed plants. Control plants transformed with an empty vector had an activity of about 10-30 pmoles / min.mg. For Table 2, the control (T) corresponds to basal GUS activity in untreated plants.
Table 1 - Expression of the GUS activity corresponding to the different COMT II / GUS constructions: induction with megaspermine GUS activity COMT II / GUST Mgaspermine construction COMT II -1215 +24 150 1150 COMT II -420 +24 2 6 COMT II -313 +24 0.4 0.8 COMT II -121 +24 0.2 0.8 Table 2 - The expression of the GUS activity corresponding to the different COMT II / GUS constructions: UV induction GUS activity COMT II / GUST UV construction COMT II -1215 +24 90 900 COMT II -420 +24 10 12 COMT II -313 +24 10 11 COMT II -121 +24 1 II 0 IS These results show that the size of the promoter must be greater than 600bp, in the occurrence 1239 bp to allow induction and strong expression of the GUS gene.
The promoter's deletions corresponding to constructions (-420 to +24), from (-313 to +24) and (-121 to +24) cause complete loss of gene expression GUS
under all the conditions tested. The activity of the GUS gene under the control of promoter 1239 bp is 1000 times higher than that observed for the others constructions.

Activation of the COMTII promoter by the injury and methyl jasmonate and by elicitors of various origins and nature.
Transgenic plants with the COMTII (- 1215 to +24) / GUS construction have been treated with different chemicals, reaction regulators defense, with salicylic acid (SA) and methyl-2-6-dichloroisonicotinic (INA), by fungal elicitors like glucans or chitin fragments and a elicitor of plant origin such as pectin. GUS activity was measured in leaves 4 p.m.
after infiltration of these compounds and the results reported in the Table 3 below.
The GUS activity is expressed in pmole MU / min.mg. The witness (T) corresponds to basal GUS activity in untreated transformed plants.
Table 3 - Induction of GUS activity by elicitors GUS Induction Activity SA (1mM) 1200 200 INA (1mM) 1700 200 Chitins (100 ~ g / ml) 1200 200 Glucans (ZOOpg / ml) 1400 200 Pectins (200 ~, g / ml) 3700 600 The strongest increase in GUS activity (of the order of 3) is obtained in plants infiltrated with pectic fragments compared to the control.
The 1239 bp promoter induction was studied at or after injury treatment with methyl jasmonate (molecule playing a role in the signaling of defense responses to injury) and benzothiadiazole (BTH) (inductor SAR chemical). The GUS activity is measured 16 hours after treatment. The results are reported in Table 4 below.
Table 4 - Induction of GUS activity by different compounds and stress Induction of GUS activity WO 00/56897 1 ~ PCT / FR00 / 00714 Injury 600 Methyl jasmonate 1450 The witness fTl corresponds to 1 ~ 'aCtlVtiPi ~ rTJ ~ (IPC n ~ antPC nnn traitPPe TP nrnmntPr is activated by the different treatments.
Induction factors range from 2.5 (BTH) to 14.5 (methyl jasmonate).
Activation of the COMTII promoter during viral infection.
VMV inoculation in tobacco requires the production of micro-wounds at level of leaves allowing the entry of the virus and its multiplication.
The GUS activity and COMTII activity were measured in the injured leaves and in the leaves inoculated by the virus. The results (Figure 1) show that the GUS gene under the COMTII promoter control has an induction kinetics identical to that of uncomfortable COMTII endogenous, followed by the measurement of the catalytic activity of proteins corresponding. The COMTII promoter is induced early by the injury and presents maximum activity at 4 p.m. The same peak of activity is observed at 4 p.m.
at during viral infection and is due to the leaf injury caused by inoculation of the virus. In inoculated leaves, GUS activity is strongly stimulated go from 5th day and progresses to the 7th day. Local and systemic induction of promoter during viral infection was measured 3 and 7 days after inoculation of VMT. The GUS activities expressed in pmol MU / min.mg, are reported in the Table 5 and represent an average of the values obtained in 9 transformants. The control T corresponds to the GUS activity of the untreated plants.

WO 00/56897 1 g PCT / FR00 / 00714 Table 5 - Local and systemic induction (SAR) of GUS activity GUS activity Leaves inoculated after 3 days 3800 Leaves inoculated after 7 days 7100 SAR sheets after 7 days 2700 These results show an 1100% induction of the promoter at 7 days in the inoculated leaves. The GUS activity measured at 7 days in the SAR sheets is weaker but very significant. However, in uninoculated leaves the factors induction calculated from GUS activities are stronger than those obtained at from COMTII activities (Table 6). This is due, on the one hand to the fact that the test GUS activity is more sensitive than that of COMTII and, on the other hand, makes that the GUS protein is extremely stable and the measured GUS activity corresponds to a accumulation of this protein after treatment. The comparison of GUS activities and COMTII is reported in Table 6 below. Uninoculated leaves where is develops acquired systemic resistance are called "SAR leaves".
Table 6 - Induction factors for GUS and COMTII activities 3 and 7 days after inoculation with VMT in infected leaves and SAR leaves Induction Induction of COMTII activities GUS

Inocule Sheets SAR Sheets Inocule Sheets SAR Sheets 3 days 5.8 - S ~ g _ 7 days 11 3.9 15 1.8 Histochemical analysis of GUS activity during and after viral infection injury.
Histochemical analysis of GUS activity in leaves inoculated with VMT, 7 days after virosis, shows that the expression of the GUS gene is localized in the cells surrounding the site of infection. Cross sections of leaves at the level of lesions were performed to determine the cell types involved and, show that the induction of the GUS gene is not specific tissue but concerns all cells around the lesions.
Histochemical analysis of GUS gene expression in leaves injured 2 days after treatment, shows induction of the GUS gene in non-wounded surrounding the sites of puncture injury or using forceps. These results imply that a signal is sent from injured tissue to intact tissue inducing a systemic expression of the GUS gene. Methyl jasmonat ~ synthesized in fabrics injured could induce the GUS gene from a distance, because an exogenous application methyl jasmonate induces GUS activity. The histochemical test performed on leaves from of 35S / GUS transgenic plants is the positive control of the experiment. Of cuts crosses of injured leaves also show that all types cell are injury-induced.
Activity of promoter fragments of variable size and between bases -1215 and - 406.
List of constructs possessing the GUS reporter gene under the control of promoter sequences between -1215 and - 406 (relative to the site + 1 initiation of the transcript) Control constructions GUS reporter gene without promoter GUS reporter gene under the control of the minimum promoter of RNA 35 S of CaMV
(p min).
COMTII / GUS constructions used COMT II - 956 to + 24 COMT II - 937 to + 24 COMT II - 882 to + 24 COMT II - 746 to + 24 COMT II - 676 to + 24 COMT II - 560 to + 24 COMT II - 435 to + 24 COMT II - 1073 to - 406 + minimum promoter of RNA 35 S of CaMV (p min).
These constructions correspond respectively to fragments 815 to 1795, 834 to 1795, 889 to 1795, 1025 to 1795, 1095 to 1795, 1211 to 1795, 1336 to 1795 and 698 to 1365 of SEQ ID NO 1.

The functional analysis of these different constructions was carried out on of transgenic tobacco in stable expression.
The studies were first carried out on a population of around 20 vitroplants allowing the selection of 3 to 7 lines per construction which analyzed at the age of 20 45 days after transfer to the greenhouse.
Table 7: Injury induction, methyl jasmonate, UV and VMT
of GUS activity in tobacco vitroplants transformed by different COMTII / GUS constructions.
Number of plants answering at the signal / number total of plants analyzes Constructions Tmoin BlessureMthyl UV VMT
COMTII / GUS in jasmonate survival COMTII-1215 + 24 4/15 3/7 9/15 10/15 7/15 COMTII-956 + 24 4/20 6/15 9/20 15/20 7/20 COMTII-937 + 24 0/20 5/10 0/20 0/20 8/20 + 24 COMTII -746 + 24 0/20 0/4 0/20 0/20 0/20 COMTII -676 + 24 0/20 0/13 0/20 0/20 0/20 COMTII -560 + 24 0/20 0/8 0/20 0/20 0/20 COMTII -435 + 24 0/20 0/5 0/20 0/20 0/20 pBI101 0/20 0/5 0/20 0/20 0/20 (without promoter) Lmin / GUS 0/20 0/11 0/20 0/20 0/20 To test the response to the injury, leaves of vitroplants (aged 4 at 6 weeks after transplanting) were injured with forceps and activity histochemical GUS was revealed 16 hours after injury.
To test the response to infection, leaves of vitroplants were inoculated with a solution of VMT, and the GUS activity was revealed 7 days after inoculation.
UV and methyl jasmonate treatments as well as non-control induced were carried out on leaves of vitroplants put in survival in some water for 16 hours.

Table 8: Induction of GUS activity by fragments of pectin, chitin or by megaspermine in tobacco plants grown in greenhouses and processed through the different COMTII / GUS constructions Number of plants answering at the signal /
number total of plants analyzes Constructions PectinsChitines Mgaspermine COMTII / GUS

COMTII-1215 + 24 5/6 4/6 4/6 COMTII-956 + 24 4/5 4/5 4/5 COMTII-937 + 24 1/3 1/3 2/3 COMTII -882 + 24 0/5 0/5 0/5 COMTII -746 + 24 0/5 0/5 0/5 COMTII -676 + 24 0/5 0/5 0/5 COMTII -560 + 24 0/5 0/5 0/5 COMTII -435 + 24 0/5 0/5 0/5 pBI101 0/5 0/5 0/5 (without promoter) ~ pmin / GUS IO / 6 I ~ / 6 I0 / 6 The deletions corresponding to the constructions (-882 to + 24), (- 746 to + 24), (-676 to + 24), (- 560 to + 24) and (- 435 to + 24) result in a complete loss of finductibility of the COMTII promoter for all the stresses studied in the Tables 7 and 8. This indicates that the sequences necessary for the activity of the promoter lie between the bases - 1215 and - 882 in relation to the initiation site of the transcription.
In the case of induction of the promoter by the injury, the VMT, the megaspermine, as well as by the fragments of pectin and chitin, only the fragments of promoter (- 956 to + 24), (- 937 to + 24) and (- 1073 to - 406) allow the expression of GUS activity. In addition, the fragment (- 1073 to - 406) allows induction of the gene protractor by the different treatments mentioned above, the proximal part of promoter between -406 and +24 is therefore not essential to the activity of promoter. The fragment -1071 to - 406 bp therefore appears necessary and sufficient for confer sensitivity to the inducers studied.
Analysis of the promoter's response to methyl jasmonate and UV
indicates that only the promoter fragment from - 956 to + 24 bp is functional. In effect, when the fragment (- 1073 to - 406) is analyzed outside the context of the promoter total (-1215 to + 24 bp), no induction is observed. There are therefore several regions necessary for the finductibility of the COMTII promoter by methyl jasmonate and UV
the region between -956 and - 937 bp as well as one or more regions located in the more proximal part of the promoter.
EXAMPLE 4 Anti-Infectious Activity of COMTII / Megaspermine in Tobacco 4.1. Cloning of a cDNA encoding (3 megaspermine.
Cloning of elicitin genes such as those of parasiticin and cryptogeine have shown that these genes code for a preprotein (Kamoun and al., 1993; Panabières et al., 1995). The coding sequence of these elicitins includes a signal peptide of 20 amino acids, allowing their excretion in the medium extra-cell followed by a sequence of 98 amino acids corresponding to the mature protein.
The protein sequence of (3 megaspermine, previously determined (Kauffmann S., unpublished results), shows a strong homology with that of the cryptogeine (Kamoun et al., 1993). We hypothesized that the sequences nucleotides of the corresponding genes could be very close. Of primers derived from the nucleotide sequence of the cryptogen gene have been synthesized so to isolate by PCR a cDNA coding for (3 megaspermine. These primers are place at level of the sequence encoding the signal peptide and contain the codon initiation of the translation. Amplification reactions were carried out on the reverse transcripts of Phytophthora megasperma using a sense primer derived from the nucleotide sequence of cryptogeine and foligodT as an antisense primer. A
amplified fragment of approximately 450 nucleotides was obtained. This fragment was cloned into a bacterial vector to be sequenced.
Analysis of the sequences revealed that the clone thus obtained codes for a preprotein comprising a signal sequence of 20 amino acids and a sequence from 98 amino acids corresponding to (3 megaspermine (SEQ ID NO 12).
nucleotide corresponding to the signal peptide also present 100%
identity with that of cryptogeine.
The native cDNA of (3 megaspermine was firstly merged with the promoter COMT II and on the other hand to the promoter 35S. The 1239 bp COMT II promoter has summer used because it has all the regulatory elements necessary for its induction.
4.2. Obtaining transgenic tobacco WO 00/568

9? 23 PCT / FR00 / 00714 Nicotiana tabacum Samsun NN tobacco plants were transformed with two constructions via Agrobacterium tumefaciens. Six primary transformants for each construction were regenerated and self-fertilized. Plants from the second generation have a normal phenotype except some individuals with the gene (3 megaspermine under the control of the 35S promoter. These plants present a stunted growth and also have an underdeveloped root system.
However no tissue necrosis reminiscent of that developed by infiltration leaf and capable to be linked to the expression of felicitin is only observed in plants transgenic.
4.3. Analysis of the expression of (3 megaspermine in tobacco transgenic.
The expression of (3 megaspermine was analyzed in the leaves of plants transgenics with feline cDNA under the control of the 35S promoter through Western-Blot (Figure 2A) and by Northern-Blot (Figure 2B). In a way surprisingly, the (3 megaspermine is undetectable in all the transformants analyzed (figure 2A). The transcription level of elicitin was therefore examined in these plants by Northern-Blot (Figure 2B). Transcripts could be detected and the level expression varies from transforming to another. It appears that in 2 types of plants (E and F) the size of transcribed is smaller than the size of the complete messenger. In that case, the absence of protein could be explained by the fact that the cDNA is truncated. For the plants A, B, C, D the size of the transcripts corresponds to that of the expressed elicitin speak fungus and the transcribed rate is not negligible, except for the plant B showing a very small proportion of transcripts. Plants A which have the levels of the highest transcripts also show stunting. Over there next, only transformants with complete transcripts of (3 megaspermine have been tested for their resistance.
Similarly, the expression of (3 megaspermine under the control of COMT II promoter was analyzed by Western-Blot in tobacco leaves transgenic (Figure 3). The expression has been studied in healthy plants untreated to determine the baseline level of elicitin expression and after injury for analyze the level of induction obtained. In untreated tissue, the level from the (3 megaspermine is undetectable. On the other hand, elicitin is detected in very small amount in injured tissue. This is due to the activation of the COMT II promoter by the injury.

The accumulation of COMT II was also examined in the same plants transgenic using anti-COMT II antibodies. Surprisingly the COMT
It is detected at a non-negligible level in untreated tissue, so than normally only very low COMT II activity is detected in the healthy plants not transformed or transformed with the chimeric COMT II :: GUS gene (Collendavelloo et al., 1981; Pellegrini et al., 1993). VCOMT II is also produced in greater quantities in injured tissue compared to plants injured controls the same way.
The COMT II promoter allows an induced expression of felicitin in the tobacco transgenic. This was verified for the 6 transformants. However the amount elicitin detected in plants after induction is very low. The presence of COMT II in untreated plants suggests that a very low amount elicitin (not detected by the method used) is produced in the plant healthy and that this synthesis is sufficient to induce the endogenous COMT II gene. Moreover, he seems to be an induced expression of felicity during injury also allows stronger induction of the endogenous COMT II gene.
Furthermore, the analysis of (3 megaspermine on denaturing gel shows a electrophoretic migration lower than that of (3 megaspermine mature purified (figure 3). This difference in migration was evaluated at 3 kD which corresponds to the size of the signal peptide. This result seems to indicate that the signal peptide was not cleaved. However it is possible that the mature protein is produced in addition small quantity by plant cells and that quantity is below from the threshold of detection on this Western-Blot.
Study of the expression of (3 megaspermine in transgenic tobacco seems to indicate that a constituent expression of elicitin is not tolerated by the plants and therefore does not allow its accumulation in cells vegetable.
Only an induced expression allows a synthesis of (3 megaspermine to a level detectable. These results could be linked to the toxic nature of the protein.
4.4. Analysis of the level of resistance of transgenic plants towards of different pathogens.
Antiviral resistance.
a) Resistance to the Tobacco Mosaic Virus (VMT).

Processed tobacco has the resistance gene N and therefore reacts through HR during inoculation by VMT. In these experiments resistance to virus is quantified by measuring the size of the lesions 7 days after infection, when they have reaches their almost final size. The higher the resistance developed by the plant is large, the smaller the size of the lesions, thus illustrating a containment more important pathogen at the site of infection. The promoter of the COMT II gene being strongly induced around lesions during HR at VMT, it should allow a strong expression of (3 megaspermine at the site of infection. To verify this, the plants transgenic a, b, c, d, e and f expressing elicitin under the control of COMT II promoter and transformants A, B, C, D having the cDNA of (3 megaspermine under the control of the 35S promoter were inoculated by VMT. Control plants are plants transgenic for the chimeric gene "COMT II promoter :: GUS".
Seven days after virosis, the lesions developed on plants expressing the (3 megaspermine under the control of the 35S promoter do not seem different of those of control plants. On the other hand, smaller lesions are observed on the transgenic plants expressing (3 megaspermine under the control of promoter COMT II compared to those obtained on the control plants.
A statistical analysis of the size of the lesions was carried out by measuring the diameter of 100 to 150 lesions in control plants and in plants transgenic for the (3 megaspermine. Figure 4 shows the size distribution lesions measured on the control plants and for a line expressing elicitin under Control of the 35S promoter (plants A) and a line expressing elicitin under the control of COMT II promoter (plants b). This distribution follows a Gauss curve this who authorizes statistical analysis of the results. Control plants show a size of lesions with an average of 3.30.5 mm. Average lesion size obtained for plants A is not significantly different from that of the controls (3.10.6 mm) on the other hand that obtained for plants b is much lower than witnesses (1.40.6 mm). The results obtained for each independent line are grouped on Figure 5 and show that all transformants (plants A, B, C and D) possessing the cDNA for (3 megaspermine under the control of the 35S promoter has a cut of lesions not different from that of the controls. However, all plants expressing elicitin under the control of the COMT II promoter have a cut mean lesions significantly lower than that of control plants.
This decrease is more or less important according to the transformants. A strong reduction, about 60%, the size of the lesions is obtained for the transformants COMT II :: meg a, b, and f and the lowest observed is 36% and corresponds to the transformant COMT
II :: meg e.
All the results obtained show that the plants expressing b megaspermine under the control of the 35S promoter exhibit a level of resistance antiviral equivalent to that of control plants. However, resistance increased at VMT is obtained for transgenic tobacco expressing (3 megaspermine under the COMT II promoter control. However, not all transgenic lines present not the same level of resistance. This could be linked to levels expression different from the (3 megaspermine in these different transgenic plants.
b) Resistance to Alfalfa Mosaic Virus (VML).
We tested the resistance of COMT II :: megaspermine transgenic tobacco vis-à-vis another virus, VML, which infects tobacco systemically.
About ten days after viral infection, MLV has spread throughout the plant and level of leaves not inoculated with mosaic symptoms.
Plants expressing (3 megaspermine under the control of the COMT II promoter chosen for this test correspond to line b which has a level of resistance raised to VMT. Plants A having the cDNA for (3 megaspermine under the control of the 35S promoter were also inoculated as well as control plants COMT
II :: GUS. For each transgenic line, 5 plants were inoculated. We we have examined the phenotype of the different plants fifteen days after treatment. AT
this stage mosaic symptoms are well developed on COMT II :: GUS plants.
The A transgenic plants show a mosaic similar to the control plants.
Through against, a reduction of these symptoms is observed in plants transgenic b.
Viral load was examined in systemic leaves of the same level (3 th sheet above the inoculated sheet). This analysis has been performed by Western-Blot using antibodies directed against the protein shell of the virus (figure 6). The amount of virus present in different transgenic plants is assessed by compared to the amount of virus present in the control plants. The results obtained show that plants expressing (3 megaspermine under the control of promoter WO 00/56897 2 ~ PCT / FR00 / 00714 35S have 10 to 15 times less virus than the control plants. This reduction of the amount of virus may seem significant. However, you should know that quantities of viruses produced in wild plants can vary in the same proportions.
On the other hand, the transgenic plants expressing megaspermine under the control of COMT II promoter contains 1,000 to 10,000 times less virus than plants witnesses. This represents a considerable and very significant reduction in load viral.
These results suggest that only plants transformed with ~ 3 megaspermine under the control of the inducible COMT II promoter are less susceptible to a systemic viral infection. This also shows a correlation between reduced symptoms of infection and decreased load viral in these leaves.
Antifungal resistance.
We examined whether elicitin production in planta conferred resistance induced with respect to a soil fungus, Phytophthora parasitica var.nicotianae. This fungus infects tobacco plants through the roots invading the system root then vascular, thus causing sclerosis of the conducting vessels. The symptoms of infection result in black rot in the collar. This mode of infection is difficult to implement because it requires a concentration in adequate zoospores and meets strict temperature conditions and humidity. A
"artificial" mode of inoculation consists in applying after decapitation of tobacco on mycelium of the fungus at the level of the severed stem. After 7 days stems are removed and symptoms of infection are examined inside the stems.
The inoculation was carried out on 7 COMT II :: GUS control plants. For each transgenic line for (3 megaspermine, five plants were inoculated.
Plants A, B, C and D with the "35S-megaspermine promoter" construct have been tested.
For plants with the gene for (3 megaspermine under the control of promoter COMT II, lines a and b with strong increased resistance to VMT have summer chosen as well as the line e exhibiting a lower level of resistance.
The progression of symptoms measured in the stems of control plants achieved an average length of 5.3 cm. Slower symptoms of infection East observed in the stems of transgenic plants expressing (3 megaspermine under the WO 00/56897 2g PCT / FR00 / 00714 35S promoter control. This decrease is variable from genotype to the other (figure 7). The progression of the fungus is greatly slowed down in plants 35S :: meg A
(d = 0.8cm) and weaker in plants 35S :: meg B (d = 3.8cm) compared at control plants (d = 5.3 cm). Plants A correspond to plants which present the higher proportion of transcripts of (3 megaspermine, while plants B have a very low rate of transcripts coding for elicitin. This could suggest a correlation between the levels of elicitin transcripts detected (and without doubt the levels of / 3 megaspermine products even if these remain below the threshold of detection) and the level of antifungal resistance induced.
The progression of the fungus is also greatly slowed down in the stems of transgenic plants expressing (3 megaspermine under the control of promoter COMT II. We have also shown that the COMT II promoter was induced during infection with P. parasitica. The rods of the COMT II transformants :: meg a, b and e are infected respectively over a length of 0.7 cm, 1 cm and 3.5 cm. The plants a and b are the most resistant to infection with P. nicotianae and correspond also to plants with the highest resistance to VMT. Thus, it appears that the same relative resistance levels are detected with the two pathogens tested. We we can assume that the resistance levels induced in these plants are linked to rate expression of elicitin. An analysis of the levels of transcribed by Northern-blot would perhaps confirm this hypothesis, knowing the difficulty of detect the protein by Western-Blot.
These results show that the constitutive or induced expression of (3 megaspermine in transgenic tobacco allows to confer an increased level of resistance opposite of a fungal infection.
Antibacterial resistance We also tested the resistance of transgenic plants expressing the / 3 megaspermine under the control of the COMT II promoter with respect to a bacterium, Erwinia carotovora. This bacterium is a well-known pathogen of apple earth and is able to macerate plant tissue through the synthesis of enzymes pectinolytics. However, it can also infect other plants such as the tobacco.
For this test, a suspension of E carotovora was infiltrated into the leaves of COMT II :: megaspermine transgenic plants as well as in the leaves of plants controls (corresponding to transgenic plants for the chimeric gene COMT
II :: GUS). A population of 7 plants was inoculated for each of the transformants.
Two days after inoculation of the bacteria, 60% of the control plants (4 plants out of 7) show symptoms of severe infection, inoculated leaves are entirely macerated and the infection tends to spread throughout the whole plant. AT
the reverse 85%
transgenic plants expressing the (3 megaspermine under;
promoter COMTII (6 plants out of 7) are resistant to bacterial infection.
These results show that the induced expression of felicitin increases strongly the resistance to E carotovora. We have previously shown that the promoter COMT II was inducible by secondary elicitors among which the fragments pectics. So we can assume that the pectic fragments produced when lysis of plant tissue induces the COMT II promoter and therefore the synthesis of (3 megaspermine. However, the mechanism allowing the establishment of the Antibacterial resistance remains to be determined.
Material and methods Screening of a genomic library and identification of the corresponding clone to the gene expressed during the defense response.
A tobacco genomic DNA bank (Nicotiana tabacum var. Xanthi) built in ~, -EMBL3 (Clontech) was screened with a radioactive probe cDNA
from COMT II (Pellegrini & al., 1993). Six positive genomic clones were isolated after four purification rounds. These purified clones were tested by PCR for identify one who understands the COMT gene expressed during the hypersensitivity response (HR) tobacco leaves at VMT. Primers 5 'and 3' for PCR analysis are represented with oligonucleotides 1 and 2 below (SEQ ID NO 4 and SEQ ID NO 5 respectively) Oligo 1: 5 'CGTTTCGCAA TGTGATTTGA TC 3' Oligo 2: 5 'CTCAAAATGA CATCCTTTCA TAC 3' They are derived from the 3 'untranslated region of the COMT II cDNA.
The analysis PCR is carried out at 62 ° C (theoretical melting temperature) so to promote specific hybridization. A single clone amplifies the fragment expected from 400 base pairs as does the cDNA used as a positive control. The clone WO 00/56897 3 ~ PCT / FR00 / 00714 COMT II genomics was purified on Quiagen tip according to the protocol described speak manufacturing and subcloned into the Sall restriction site of the plasmid vector puc 18.
DNA sequencing.
DNA sequencing was carried out on denatured double-stranded DNA according to the method of Sànger & al. (1977) using the rhodamin dye kit terminator cycle ready "with ampliPaq FS DNA polymerase (Perkin-Elmer, P / N402078) and a Applied Biosystems 373 sequencer (Perkin-Elmer). The sequence has been determined sure both strands with overlaps using primers synthesized at go already determined sequences.
Analysis of primer extension products.
The primer extension reaction was carried out on total RNA according to the method described in Carrent Protocols in Molecular Biology (Trienzenberg, 1992).
Total RNA isolated from VMT-infected tobacco leaves and tobacco no infected (as negative control] was hybridized to the following oligonucleotide (SEQ ID
NO 6), complementary to the COMT II mRNA and labeled at the 5 'end Oligo 3: 5 'CTGAAGATGT CAATAGTTGC ATGGC 3' The extension product was separated on a 6% polyacrylamide gel. The location of the transcription initiation site was determined on the base of the comigration of extension products with the sequence scale of the obtained from of the corresponding region of the gene (Sànger & al., 1977).
Construction of plasmids.
The truncated versions of the COMTII promoter were amplified by PCR in using the primers PAS 1 in 3 'and PS 1, PS2, PS3 and PS4 in 5' shown below (SEQ ID NO 7 to 11 respectively), leading respectively to amplification of nucleotide fragments of following lengths: -1215 / + 24, (new built less than 600 bp) -420 / + 24, -313 / + 24 and -121 / + 24 (numbering relating to site transcription initiation).
PAS1. 5 'GGTCTAGAGG GCCTTTTAGA GTGTTTTTGT TAG 3' PS1. 5 'AAAGTCGACC GTCCACCTGT GCCAACAAT 3' PS2. 5 'TGTTTGGTGT TATGCTTCCG TCCT 3' PS3. 5 'AAAAAGCTTT TTTAGGATGG AGTACAGCC 3' PS4. 5 'TTTAAGCTTA AAGAGAACCA GACAATATT 3' Constructed -1728 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, -882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24, -435 / + 24, were obtained with the primers PAS2 in 3 'and primers PSS, PS6, PS7, PSB, PS9, PS10, PS11, PS12 and PS13 respectively in 5 ' presented below (SEQ ID NO 15 to 24 respectively):
PAS2: 5 'CGCGGATCCC CTTTTAGAGT GTTTTTGTTA GGC 3' PS5. 5 'ACGCGTCGAC GTTAGGGACA ATCTATAGTG TCAC 3' PS6. 5 'ACGCGTCGAC GCTCCGAGGA TTTGGCTGTC GCGG 3' PS7. 5 'ACGCGTCGAC GCTGGTTAGG TGAAGTAAAG CATG 3' PS8. 5 'ACGCGTCGAC GCATGTTATA TGAGGAAAGT ACG 3' PS9. 5 'ACGCGTCGAC GCAGCCAGCA CAAGCAAATT CGC 3' PS10: 5 'ACGCGTCGAC GACTTTAACA CACCAACTCC C 3' PS11: 5 'ACGCGTCGAC CGGATCTAGA ATTTGGGTTC ATTC 3' PS12: 5 'ACGCGTCGAC GTGTATACTC CACGTCTCCG GATAC 3' PS13: 5 'ACGCGTCGAC GTTCAATGTT AGGTGTGTTT GG 3' The sequence -1073 / -406 which has been placed upstream of the minimum 35S promoter has was obtained using the 3 'PAS3 primer and the 5' PS14 primer (SEQ ID NO
25 and 26):
PAS3. 5 'CGCGGATCCG CTTAACACCA AACACACCTA ACATTG 3' PS14. 5 'ACGCGTCGAC CAGTGGTGAG TTTAGCTGTC 3' Amplification was carried out for 30 cycles with an initial step of 4 min at 95 ° C and a final step of 5 min at 72 ° C, using the genomic clone like matrix. Each cycle consists of 1 min at 95 ° C followed by 1 min then hybridization 1.5-2 min at 72 ° C. The hybridization step is carried out at 54 ° C, 59 ° C, 55 ° C, and 50 ° C for amplify, respectively, the fragments -1215 / + 24, -420 / + 24, -313 / + 24 and -121 / + 24.
For all the other fragments of the promoter, the hybridization temperature is of 60 ° C. After subcloning into the plasmid pGEM-T (Promega) and amplification in E.
Coli, the promoter fragment -1215 / + 24 is digested with Sall and Xbal, Site (s corresponding being present in the primers PS1 and PSAI respectively. The promoter fragments of 420, 313 and 121 base pairs are digested with Hindlll and Xbal (the site for Hindlll is present in the primers PS2, PS3 and PS4, and the Xbal site in the primer PASI). The fragments -1768 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, -882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24 and -435 / + 24 are digested with BamHI
present in PAS2 and PAS3 and by Sall present in primers PSS to PS14. All fragments are cloned into the plasmid pBIIOl (Qiagen) so as to create a fusion transcriptional with the reporter gene GUS. All constructs are sequenced for confirm their structure and the junction boundaries.
The construct consisting of the CaMV 35S promoter upstream of the gene for megaspermine was obtained by replacing the Gus gene with the gene for megaspermine (SEQ ID NO 12) in the plasmid pBi121 (Clontech).
Cloning of Phytophthora megasperma cDNA
mg of total Phytophthora megasperma RNA is used as a template for the synthesis of the first strand. Total RNAs are heated 3 min to 65 ° C, cooled on ice, and incubated for 2 h at 42 ° C in 50 ml of transcription buffer reverse (50 mM

10 Tris-HCL pH 8.3 - 15 mM MgCl2 - 75 mM KCL - 1 mM DTT) containing 1 mM of each dNTP, 40 pmol of antisense primer corresponding to oligodT, and 20 U of AMV reverse transcriptase (avian myeloblastosis virus). The mixture is heated at 94 ° C to stop the reaction. After precipitation of the mixture reactionary to ethanol, the pellet is dissolved in sterile distilled water.
The synthesis of the second strand is initiated by Taq DNA polymerase. 1/20 of reverse transcript is used for PCR amplification in 50 ml of buffer (10 mM Tris-HCL pH 8.3 - 50 mM KCL - 1.5 mM MgCl2 - 0.01% BSA), 200 mM dNTP, 0.1 mM sense and antisense primers and 1 unit of Taq. The primer sense (5 ' ATGAACTTCACCGCTCTGCT 3 ') is derived from the nucleotide sequence of the cryptogeine, the antisense primer corresponds to oligodT having the sites of restriction SstI-EcoRI-HindIII at its 5 'end. The reaction mixture is heated for 3 min at 94 ° C, then is subjected to 30 reaction cycles each comprising 3 steps: 1 min at 94 ° C, 1 min at 49 ° C and 1 min at 72 ° C. After the last cycle, the elongation is continued 10 min at 72 ° C. The amplification product obtained is then cloned in the vector pGEM (Promega) in order to be sequenced.
Transformation of plants The different COMTII-GUS promoter constructs previously obtained in the plasmid pBI101 are introduced into a strain of Agrobacterium tumefaciens GV3101 (pPM6000) (Rossi & al., 1993) by electroporation (Nagel & al., 1990).
The tobacco plants (Nicotiana tabacum cv Samsun NN) are transformed by infiltration Agrobacterium on 10-day-old plants (Rossi & al., 1993). Plants are regenerated on Murashige & Skoog (MS) medium (GIBCO BRL) supplemented with of sucrose (30 g / 1 for the formation of stems and 15 g / 1 for the formation of roots), of 6-benzylaminopurine (Serva) (2 mg / ml), and naphthalene acetic acid (Serva) (0.05 mg / ml). Kanamycin (150 mg / ml) is used as a screening agent during the stages of in vitro regeneration and propagation. Plant checks were prepared by transformation with the empty vector pBI101 or the vector p min GUS
(containing the reporter gene GUS under control of the minimum promoter of RNA 35 S
of CaMV). Seven to 20 independent transformants are regenerated for each built.
The primary transformants are self-fertilized and the F 1 seeds are germinated on a MS medium comprising 300 mg / l of kanamycin.
Enzyme assays The histochemical localization of GUS in transgenic plants is performed according to the method described by Jefferson & al. (1987). Histochemical reaction East incubated in the dark at 37 ° C for 12 hours. The fabrics are rinsed, first with 50 mM phosphate buffer to terminate the reaction, then several times with of ethanol from 70% to 90% to remove pigmentation from the tissues. After the reaction histochemical, the tissues are rinsed in 70% ethanol and are included in a fixing historesin (Jung) for cross sections of sheets.
Blocks of historesins are cut with a microtome and photographs are taken has a magnification 10 to 40 times with a binocular microscope.
The COMTII and GUS activities were assayed on 100 mg of tissue. The tissue is homogenized in a 100mM sodium phosphate buffer at pH 7.5 and 10 mM
of DTT after addition of polyclar AT (Serva) and quartz. Raw extracts are clarified by centrifugation and by filtration on glass wool. The measure of GUS and COMTII activities are carried out on the same raw extracts. For the measure of COMTII activity, an aliquot of the protein extract is added to 1 ml of buffer phosphate comprising 100p, M of catechol, SOp.M of S-adenosyl-L-methionine tritiate (1.5 105 cpm / ml) and incubated for 3 hours at 37 ° C. The reaction is stopped by addition 1001 9M sulfuric acid. The radioactive product of the reaction, the acid ferulic, is extracted with 5 ml of an NA scintillation solution (Beckman) and the radioactivity is counted on a Beckman LS 9000 device. The fluorimetric measurement of GUS activity is performed on the same samples according to the procedure of Jefferson & al.
(1987). The protein content is determined by the method of Bradford (1976) in employing the Biorad reagents.
COMTII-meg and 355-meg built The vector pGEM (Promega) without the compatible cloning sites those of pBI101, a subcloning step in the Bluescript vector (pSK) a summer necessary. The BamHI / SstI insert from pSK :: megaspermine has been purified for the cloning into the binary vector pBi101 (Clontech).
The vector pBilO1 :: COMT II GUS previously constructed and corresponding to the promoter -1215 / + 24 fused to the reporter gene GUS was used to obtain the gene chimeric short II meg. The GUS gene is excised by digestion of the plasmid binary by BamHI and SstI. A SnabI site present in the GUS gene makes it possible to cut this one here and prevents it from religionizing with the binary plasmid since no step of purification of vector is performed. Restriction enzymes are inactivated by heat. DNA
digested is extracted with a phenol: chloroform mixture (1: 1), then chloroform: alcohol isoamilic (24: 1) and precipitated with ethanol. Digested DNA is put back in suspension in sterile water and ligated with the insert.
The vector pBi121 (Clontech) carrying the 355-GUS gene was used to get the 355 meg chimeric gene. Cloning is carried out according to the method described previously.
The constructions were then verified by sequencing.
Tobacco plants.
Transgenic tobacco plants (Nicotiana tabacum cv. Samsun NN) are grown in vitro under a 12h (24 ° C) / 12 (20 ° C) light cycle for 5 weeks after germination. They are propagated on an MS medium with the addition of kanamycin (150 mg / 1) as a screening agent. They are then transferred to the greenhouse and grown in soil under a 16h / 8h light cycle at 22 ° + 2 ° C.
Analysis of plant RNA by Northern Extraction of total AR1V
The tissues are finely ground in liquid nitrogen, then in 1 to 2 volumes extraction buffer (0.2 M sodium borate pH 9 - 30 mM EGTA - SDS 1% - 5 mM DTT). The mixture is poured into a tube containing 1 volume of phenol / chloroform (1: 1), vortexed, then centrifuged 10 min at SOOOg. A
second phenol / chloroform extraction (1: 1) is performed, followed by a third chloroform / isoamyl alcohol (24: 1). The RNAs present in the supernatant are specifically precipitated by adding 1 volume of a LiCl solution (4 M) EDTA
(10 mM) overnight at 0 ° C. The whole is centrifuged 30 min at 10000g and the base is washed with a solution of LiCI (2 M), EDTA (5 mM). Total RNAs are taken over in water and again precipitated with 70% ethanol, NaCl (0.2 mM). After centrifugation 30 min at 10,000 g, the pellet is washed twice with 70% ethanol, then taken up in 50 ~, l of water. The ÄRNs are dosed by measuring the absorbance of a solution diluted to 260 (1 unit D0260 = 40 ~ g / ml of RNA), and their integrity is verified by migration on a gel non-denaturing agarose colored with BET.
Electrophoresis The RNAs are separated on denaturing agarose gel prepared in a buffer MOPS xl containing 16% formaldehyde. 1.2% agarose (w / v) gels have summer used. The RNA samples are denatured for 15 min at 65 ° C. in presence of 3 volumes of denaturing solution (MOPS x5 101, formamide 501, formaldehyde 161) by volume of RNA, and quickly cooled in ice. Buffer charge is added (MOPSxI, glycerol 50%, bromophenol blue 0.05%) at a rate of 1/10 of volume. After migration in MOPS xl buffer, the gel can be stained with BET
(0.5 ~ g / ml) 1 to 2 min, then thoroughly washed with sterile water. The NRAs are then viewed under IJV light.
"Northern Blot"
The "Northern-blot" technique makes it possible to detect, among the total RNAs, the messengers homologous to a radioactive DNA probe. This is done at help from Random Priming kit (Amersham) following the protocol provided.
10 ~ g of total stem or leaf RNA are deposited on 1.2% agarose gel (w / v) denaturing as well as an RNA size marker (Promega) deposited in border of gel. After migration, the gel is rinsed with sterile water in order to remove the excess of formaldehyde. The migration band corresponding to the size marker is cut out, BET stained and photographed.
The RNAs are transferred by capillary action for 5 h on a nylon membrane positively charged (Hybond N +, Amersham) with SSC x20 buffer. After transfer the membrane is rinsed in the SSC x2 buffer and the RNAs are fixed in a way covalent on the nylon membrane by exposure to ultraviolet light (1200 J, UV Stratalinker 2400, Stratagene). The membrane is hybridized to a probe radioactive and treated as described in Sambrook et al.
Plant protein analysis by Western Leaf protein extraction Extraction can be done immediately after harvest or on samples frozen. 1 SO g of leaf tissue is ground in a mortar in buffer acetate sodium 0.5 M pH 5.2 containing 2-13-mercaptoethanol (15 mM) and carbon active.
The volume of buffer is adjusted so as to obtain a fine and homogeneous ground material.
The one-it is then filtered through gauze and then centrifuged for 30 min at 15,000 g. The supernatant constituting the raw extract is then analyzed.
Protein determination The protein concentration of the crude extracts is determined by the method of Bradford (1976) in microtiter plates: at 10 ~ l of an extract to test are added 200 ~ 1 of Bradford reagent xl (Biorad). 2 ~ l of crude extract sheet are supplemented to 10 ~ 1 with buffer. Each sample is tested three times.
After 5 to 10 min, the plate is read with a spectrophotometer MR 700 (Dynatech) with the filter 5 (660 nm). The blank consists of 10 ~ l of buffer and the values are compared with a standard range produced with bovine serum albumin (SAB, Sigma).
Separation of proteins on denaturing polyacrylamide gel The gel analysis makes it possible to determine the molecular mass of the proteins in comparing their relative mobility to that of molecular weight proteins known. AT
the protein extract is added 20% (v / v) loading buffer (60 mM Tris-HC1 pH 6.8, 5% (v / v) 2-13-mercaptoethanol, 10% (v / v) glycerol, 0.01% (v / v) blue bromophenol, 1% SDS). The samples are heated at 100 ° C for 1 min before to be dropped off.
The gels (0.75 mm x 7 cm x 9 cm) are poured between a glass plate and a plate alumina. The electrophoresis buffer is composed of 192 mM glycine, 25 mM
Tris and 0.1% SDS. Vertical migration is carried out in an electrophoresis tank Hoeffner to an intensity of 20 mA per gel for a voltage of 100 to 160 V.
Protein transfer and immunodetection on nitrocellulose (Western-Blot) WO 00/56897 3 ~ PCT / FR00 / 00714 After electrophoretic migration on acrylamide gel, the proteins can be transferred, in liquid medium to the transfer buffer (0.16 M Tris -1.20M
glycine), on a nitrocellulose or PVDF nylon membrane (Immobilon, Millipore).
Before the transfer, the gel is balanced in the transfer buffer. The PVDF membrane is activated for 1 min in methanol and then equilibrated in the buffer of transfer. The electrotransfer takes place for 90 min at 150 mA.
Immunodetection was carried out using specific antibodies directed against megaspermine or the VML shell protein. The revelation is carried out through chemiluminescence with the ECL kit (Amersham).
Plant treatment.
Before treatment, the plants are conditioned for a few days in a air-conditioned cubicle at 22 ° C ~ 1 ° C, under a brightness of 5000 lux and a photoperiod J / N from 4 p.m. / 8 a.m. These conditions are maintained during infection, the exception of infection with Erwinia carotovora.
Tobacco Mosaic Virus (VMT) Inoculation The leaves of tobacco plants grown in a greenhouse and 6 weeks old, are rubbed with a cotton pad previously soaked in a suspension of VMT
purified (common strain U1 0.1 to 1 ~ g / ml) containing an abrasive, celite (10 mg / ml).
The tobacco vitroplant leaves, 6 to 7 weeks old after transplanting, are rubbed to using a sintered glass spatula previously immersed in a suspension of Purified VMT (common strain U1 at 4 pg / ml, filtered on 0.45 gym membrane) and a abrasive, celite (10 mg / ml). After a few minutes of contact, the leaves are rinsed with water to remove excess celite and virus particles.
Alfalfa mosaic virus (MLV) inoculation The leaves of tobacco plants, 6 weeks old, are rubbed using of a glass spatula soaked in a buffer solution containing viral RNA (1 to 5 ~ g / ml) and an abrasive, celite (10 mg / ml). Inoculum per leaf (for one plant) correspond to 200 ml of buffer solution: Kpi, pH 7.2, 0.04M, 1 ml RNAsin, DTT 1mM final, Macaloid (0.05%), total yeast RNA 0.25 mg / ml, viral RNA (1 to 5 pg / ml) Inoculation of Phytophthora parasitica var. nicotianae The mycelium of P. p. nicotianae is grown on a petri dish containing a solid medium (oat medium: 100 g of crushed oat seeds are placed in suspension in 1 1 of distilled water. The medium is filtered on gauze. The middle is autoclaved after addition of 15 g of agar).
The inoculation was carried out after decapitation of the tobacco plants. The rod of 10-week-old tobacco plants are sectioned under the apical bud.
Pellet mycelium of P. p. nicotianae is collected at the periphery of a culture of 7 days on oat medium and is deposited on the stem section. The rod put in contact with mycelium tablet is encapsulated in aluminum foil so to avoid a too rapid drying of tissues at the site of inoculation.
Inoculation of Erwinia carotovora The strain of Erwinia carotovora is cultivated overnight in 28 ° C in from the middle LB. After centrifugation, the bacterial pellet is taken up in a solution of MgS04 (IOmM) to obtain an approximate bacterial concentration of 1.10 cfu (colony-forming units) / ml. The leaves of tobacco plants aged 4 to 5 weeks are infiltrated by this bacterial suspension. Only one site is inoculated by leaf in infiltrating using a pipette-man SO ml of the bacterial suspension. The plants are then placed in cubicles in high humidity conditions and at a temperature of 26 ° C
~ 1 ° C during infection.
Treatment by an elicitor: Solutions are infiltrated by a syringe equipped with a fine needle in the leaf mesophyle. The areas infiltrated are delimited with a felt-tip marker. Infiltrated areas are harvested 16 hours after treatment. The leaves are treated with a solution of / 3-megaspermine, a purified protein elicitor of a Phytophthora megasperma culture medium (Kauffmann & al., 1993), or oligosaccharides such as chitin oligomers (100 ~ g / ml), glucan fragments (200 ~ g / ml), and pectin fragments (200 ~ g / ml). Control plants are infiltrated with water.
Injury: Fully developed leaves are injured with a hemostat or pierced with needles. The injured leaves are then harvested 16 or 24 hours after injury for fluorimetric or histochemical analyzes.
UV treatment: The upper part of transgenic plants aged 5 weeks is exposed to UV rays (1 = 254nm) for 10 minutes and then plants are placed in the dark until the tissue collection 16 hours following the treatment.
Chemical treatments: (1) Solutions of SA (1mM) or INA (SOmM) are infiltrated into tobacco leaves using the protocol described for treatment by elicitors. (2) Under identical culture conditions, spray on transgenic plants solutions of SA (IOmM), INA (1mM) or BTH (SOmM). The tissues are collected 16 hours after treatment. Plants treated with water are used as a witness. (3) Seven week old plants or leaves of vitroplants surviving on water are transferred to boxes transparent and airtight and subjected to an atmosphere of 3, SmM from MeJa (Serva). Tissues are taken at different times after treatment. Control plants are placed in the same boxes without MeJa.
References Ausubel, FM, Brent, R., Kingston, RE, Moore, DD, Seidman, JG, Smith, JA, Struhl, K. (1998) Current protocols in molecular biology. John Wiley & Sons.
Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of protein-dye binding, Anal.
Biochem. 72, 248-254.
Collendavelloo J, Legrand M, Geoffroy P, Barthelemy J & Fritig B (1981).
Purification and properties of the three o-diphenol O-methyltransferases of tobacco leaves.
Phytochemistry 20, 611-616.
Jefferson RA, Kavanagh TA & Bevan MW (1987). GUS mergers: b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907.
Kamoun S, Young M, Glascock CB & Tyler BM (1993). A gene encoding a host-specific elicitor protein of Phytophthora: host specificity and induction of resistance to bacterial and fungal pathogens. Mol. Plant Microbe Interact. 6, 15-25.
Kauffmann S., Baillieul F., Genetet L, Kopp M. & Fritig B. (1993). Two proteins secreted by Phytophthora megasperma elicit and defense-related responses in tobacco.
In Mechanisms of plant defense responses, B. Fritig and M. Legrand, Dordrecht Kluwer Academic Publishers, 140-143.

Nagel R., Eliott A., Masel A., Birch RG & Manners JM (1990).
Electroporation of binary Ti plasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes. FEMS Microbiol. Lett. 67, 325-328.
Panabières F, Marais A, Berre JYL, Penot I, Fournier D & Ricci P (1995).
Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hypersensitive-like response in tobacco. Mol. Plant Microbe Interact. 8, 1995.
Pellegrini L., Geoffroy P., Fritig B. & Legrand M. (1993). Molecular cloning and expression of a new clans of ortho-diphenol-O-methyltransferases induced in tobacco (Nicotiana tabacum L.) leaves by infection or elicitor treatment. Plant Physiol. 103, 509-517.
Rossi L., Escudero J., Hohn B. & Tinland B. (1993). Efftcient and sensitive assay for T
DNA dependent transient gene expression. Plant Mol. Biol. Rep. 12, 220-229.
Sambrook, J., Fritsch, EF and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Singer F., Nicklens S. & Coulson AR (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74, 5463-5467.
Trienzenberg SJ (1992). Primer extension. In Current Protocol in Molecular Biology.
J. Wiley & Sons eds. 20.4.8.1 SEQUENCE LIST
(1) GENERAL INFORMATION:
(i) DEPOSITOR:
(A) NAME: RHOBIO
(B) STREET: 14-20 Rue Pierre BAIZET
(C) CITY: LYON
(E) COUNTRY: France (F) POSTAL CODE: 69009 (ii) TITLE OF THE INVENTION: COMTII inducible promoter, chimeric gene including and transformed plants (iii) NUMBER OF SEQUENCES: 26 (iv) COMPUTER-DETACHABLE FORM:
(A) TYPE OF SUPPORT: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS
(D) SOFTWARE: PatentIn Release # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEQ ID N0: l:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1863 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: double (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA (genomics) (ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 667..672 (D) OTHER INFORMATION: / function = "reverse W box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 820..830 (D) OTHER INFORMATION: / function = "reverse L box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: enhancer (B) LOCATION: 845..852 (ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1034..1047 (D) OTHER INFORMATION: / function = "P box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1221..1226 (D) OTHER INFORMATION: / function = "G box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1343..1356 (D) OTHER INFORMATION: / function = "reverse L box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc signal (B) LOCATION: 1369..1374 (D) OTHER INFORMATION: / function = "box A"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1377..1382 (D) OTHER INFORMATION: / function = "GT box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1483..1488 (D) OTHER INFORMATION: / function = "GT box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1562..1567 (D) OTHER INFORMATION: / function = "reverse W box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1600..1614 (D) OTHER INFORMATION: / function = "L box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: CAAT_signal (B) LOCATION: 1675..1679 (ix) CHARACTERISTIC:
(A) NAME / KEY: misc_signal (B) LOCATION: 1681..1690 (D) OTHER INFORMATION: / function = "E box"
(ix) CHARACTERISTIC:
(A) NAME / KEY: CAAT_signal (B) LOCATION: 1695..1699 (ix) CHARACTERISTIC:
(A) NAME / KEY: TATA_signal (B) LOCATION: 1735..1739 (ix) CHARACTERISTIC:
(A) NAME / KEY: original transcription (B) LOCATION: 1772 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 1:

(2) INFORMATION FROM THE SEQ
FOR ID N0:
2:

(i) CHARACTERISTICS
OF THE
SQUENCE:

(A) LENGTH:

pairs of basics (B) TYPE:
nucleotide (C) NUMBER
OF BRINS:
double (D) CONFIGURATION:
linear (ii) TYPE
OF MOLCULE:
DNA (genomic) (ix) CHARACTERISTIC:
(A) NAME / KEY: promoter (B) LOCATION: 1..1860 (ix) CHARACTERISTIC:
(A) NAME / KEY: origin transcription (B) LOCATION: 1772 (ix) CHARACTERISTIC:
(A) NAME / KEY: exon (B) LOCATION: 1861..2281 (ix) CHARACTERISTIC:
(A) NAME / KEY: intron (B) LOCATION: 2282..3633 (ix) CHARACTERISTIC:
(A) NAME / KEY: exon (B) LOCATION: 3634..3944 (ix) CHARACTERISTIC:
(A) NAME / KEY: intron (B) LOCATION: 3945..4726 (ix) CHARACTERISTIC:
(A) NAME / KEY: exon (B) LOCATION: 4727..5089 (ix) CHARACTERISTIC:
(A) NAME / KEY: terminator (B) LOCATION: 5090..5371 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 2:

CGGTCAAACTTTCAAAAGAGAAAGAAATAACTAGACAAACTTCAACAACCy ~ IACCTGCCCA1620 ATCAGGTATT

WO 00/56897 g PCT / FR00 / 00714 WO 00/56897 ~ PCT / FR00 / 00714 (2) INFORMATION FOR SEQ ID N0: 3:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 1095 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 1..1095 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3:

ACC AGC ACA

MetGluSerSer ThrLysSerGln IleProThr GlnSerGlu GluGlu ArgAsnCysThr TyrAlaMetGln LeuLeuSer SerSerVal LeuPro PheValLeuHis SerThrIleGln LeuGluVal PheGluIle LeuAla LysSerAsnAsp ThrLysLeuSer AlaSerGln IleValSer GlnIle ProAsnCysThr LysProGluAla ProThrMet LeuAsnArg MetLeu TyrValLeuAla SerTyrSerLeu PheThrCys SerIleVal GluAsp GluLysAsnAsn GlyGlyGlnLys ArgValTyr GlyLeuSer GlnVal GlyLysPhePhe ValLysAsnGlu AsnGlyAla SerMetGly ProLeu LeuAlaLeuLeu GlnAsnLysVal PheIleAsn SerTrpPhe GluLeu LysAspAlaVal LeuGluGlyGly ValProPhe AspArgVal HisGly ValHisAlaPhe GluTyrProLys SerAspPro LysPheAsn AspVal WO 00/56897 g PCT / FR00 / 00714 PheAsnLys AlaMetIle AsnHis ThrThrValVa1 MetLysLysIle LeuGluAsn TyrLysGly PheGlu AsnLeuLysThr LeuValAspVal GlyGlyGly LeuGlyVal AsnLeu LysMetIleThr SerLysTyrPro ThrIleLys GlyThrAsn PheAsp LeuProHisVal ValGlnHisAla ProSerTyr ProGlyVal GluHis ValGlyGlyAsp MetPheGluSer ValProGlu GlyAspAla IlePhe MetLysTrpIle LeuHisAspTrp SerAspSer HisAsnLeu LysLeu LeuLysAsnCys TyrLysAlaLeu ProAspAsn GlyLysVal IleVal ValGluAlaIle LeuProValLys ProAspIle AspThrAla ValVal GlyValSerGln CysAspLeuIle MetMetAla GlnAsnPro GlyGly LysGluArgSer GluGluGluPhe ArgAlaLeu AlaThrGlu AlaGly PheLysGlyVal AsnLeuIleCys CysValCys AsnPheTrp ValMet GluPheCysLys 355,360 (2) INFORMATION N0: 4:
FOR
THE
SEQ
ID

(i) SQ UENCE FEATURES:
OF
THE

(A) 22 LENGTH: pairs of basics (B) nucleotide of TYPE:

(C) STRANDS:
NUMBER single OF

(D) linear CONFIGURATION:

(ii) TY PE synthetic n MOLCULE:
Oligonuclotide (xi) DESCRIPTION OF SEQ NO: 4:
OF SQUENCE: ID

TC

(2) INFORMATION UR N0: 5:
PO LA
SEQ
ID

(i) SQ UENCE FEATURES:
OF
THE

(A) LENGTH: 23 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide n ° 2 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 5:

(2) INFORMATION FOR SEQ ID N0: 6:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide n ° 3 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 6:

(2) INFORMATION FOR SEQ ID N0: 7:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 33 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PAS1 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 7:

(2) INFORMATION FOR SEQ ID N0: 8:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 29 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS1 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 8:
AAAGTCGACC GTCCACCTGT GCCAACAAT 2g (2) INFORMATION FOR SEQ ID NO: 9:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 24 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS2 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9:

WO 00/56897 1 ~ PCT / FR00 / 00714 (2) INFORMATION FOR SEQ ID N0: 10:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 292 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS3 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 10:

(2) INFORMATION FOR SEQ ID N0: 11:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 29 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS4 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11:

(2) INFORMATION FOR SEQ ID N0: 12:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 354 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 1..60 (D) OTHER INFORMATION: / function = preprotein (ix) CHARACTERISTIC:
(A) NAME / KEY: CDS
(B) LOCATION: 61..60 (D) OTHER INFORMATION: / function = preprotein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12:
atgaacttc accgctctgctc gctgccgtc gccgccgcc ttggtcgga 48 MetAsnPhe ThrAlaLeuLeu AlaAlaVal AlaAlaAla LeuValGly tctgccaac gccaccgcgtgc accgccacc cagcagacc gctgcgtac 96 SerAlaAsn AlaThrAlaCys ThrAlaThr GlnGlnThr AlaAlaTyr aagacactc gtgagcatcctg tcggacgcg tcgttcaac aagtgctct 144 LysThrLeu ValSerIleLeu SerAspAla SerPheAsn LysCysSer acggattcg ggctactccatg ctgacggcc aaggccctc cccaccacg 192 ThrAspSer GlyTyrSerMet LeuThrAla LysAlaLeu ProThrThr

11 gcgcagtac aag ctc atg tgc gcg tcc tgc aac acc atg 240 acg gca atc AlaGlnTyr Lys Leu Met Cys Ala Ser Cys Asn Thr Met Thr Ala Ile aagaagatc gtg acg ctg aac ccg ccc gac ctg acg gtg 288 aac tgc ccc LysLysIle Val Thr Leu Asn Pro Pro Asp Leu Thr Val Asn Cys Pro acgagcggc ctg gtg ctc aac gtg tac gcg aac ggc ttc 336 tcg tac tcg ThrSerGly Leu Val Leu Asn Val Tyr Ala Asn Gly Phe Ser Tyr Ser gacaagtgc tcg tcg ctg 354 AspLysCys Ser Ser Leu (2) INFORMATION
FOR
THE
SEQ
ID
N0:
13:

(i) FEATURES OF THE SQUENCE:

(A) LENGTH: 354 pairs of basics (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE
OF
MOLCULE:
DNA

(ix) FEATURE:

(A) NAME / KEY: CDS

(B) LOCATION: 1..294 (xi) DESCRIPTION OF THE SQUENCE: N0: 13:
SEQ ID

accgcg tgcaccgcc acccag cagacc gctgcg tacaagacactc gtg 48 ThrAla CysThrAla ThrGln GlnThr AlaAla TyrLysThrLeu Val agcatc ctgtcggac gcgtcg ttcaac aagtgc tctacggattcg ggc 96 SerIle LeuSerAsp AlaSer PheAsn LysCys SerThrAspSer Gly tactcc atgctgacg gccaag gccctc cccacc acggcgcagtac aag 144 TyrSer MetLeuThr AlaLys AlaLeu ProThr ThrAlaGlnTyr Lys ctcatg tgcgcgtcc acggca tgcaac accatg atcaagaagatc gtg 192 LeuMet CysAlaSer ThrAla CysAsn ThrMet IleLysLysIle Val acgctg aacccgccc aactgc gacctg acggtg cccacgagcggc ctg 240 ThrLeu AsnProPro AsnCys AspLeu ThrVal ProThrSerGly Leu gtgctc aacgtgtac tcgtac gcgaac ggcttc tcggacaagtgc tcg 288 ValLeu AsnValTyr SerTyr AlaAsn GlyPhe SerAspLysCys Ser tcgctg 294 SerLeu (2) IDN0 INFORMATION: 14:
FOR
THE
SEQ

(i) LASQ UENCE FEATURES:
OF

(A) 1620 pairs of bases LENGTH:

(B) nucleotide of TYPE:

(C) STRANDS: simple NUMBER
OF

WO 00/56897

12 PCT / FR00 / 00714 (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: DNA
(ix) CHARACTERISTIC:
(A) NAME / KEY: COMTII promoter (B) LOCATION: 1..1263 (ix) CHARACTERISTIC:
(A) NAME / KEY: CDS Megaspermine (B) LOCATION: 1264..1630 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13:
cgtccacctg tgccaacaat atagagacaa tttgctcgta tagtcagaaa gagtgtttta 60 ctttttagtt gctttttagt gaatctactc ggtataaagt taaattagtg ggtcaataag 120 tcgggtgaat agttaaagaa aacagtggtg agtttagctg tcaaataatt tcttcttttt 180 cttgttttca cattagaaat caaaataaaa cacaagcttt ttgtatttat tttaacacaa 240 gctaattata tgtttatatg ctggttaggt gaagtaaagc atgttatatg aggaaagtac 300 gaagaaaatg tgccaattgt cgtgtacagc aaagcagcca gcacaagcaa attcgcactt 360 gataagtggc taagtccact ttctagtgga cctagtggtt cactaacttt taccaaaaag 420 gcaataattt gcaattcaaa aagaaaaaag gaaaaaagaa aactagacag actttaacac 480 accaactccc acaggaagca acaatgcaac tcacaaaagg aaaccgagtt tttccgcgac 540 ggatctagaa tttgggttca ttctttacgc tttttcgtat taaactcatt atatttgtat 600 aattatgggt ttatattttt tatttattgt aatttttgta aaattttata tataagtgta 660 tactccacgt ctccggatac tacattagcc tctagggttc ttaatactct tgttaaattg 720 tccaggctcc aaacgcatgt tcgtttcaat tttaacggat gtttccgaac aactccaaat 780 gttcaatgtt aggtgtgttt ggtgttaagc ttccgtccta ggttaataga atagataatt 840 gttgtttctt atatagtttt gaacaatcgt cgccataaac taatttttag gatggaagct 900 aatttttagg atggagtaca gcctaaggtt aaaatataac tataaaaaat atccataaaa 960 ggtgaaattt aattagtaac atgaaaagat aaaactagtg ttatcggtca aactttcaaa 1020 agagaaagaa ataactagac aaacttcaac aaccaacctg cccaacatgc tactgtgcaa 1080 ttgaaaaata aacaaaagag aaccagacaa tatttcaacc aatattccat caagaaaacc 1140 aattatgaca attcttaacc aaagtcacaa ctaacactta taaaaagcac taactcaact 1200 gtacatgatt gtgaagccta acaaaaacac tctaaaaggc ctctagagga tccccggggt 1260 acc atg aac ttc acc gct ctg ctc gct gcc gtc gcc gcc gcc ttg gtc 1308 Met Asn Phe Thr Ala Leu Leu Ala Ala Val Ala Ala Ala Leu Val gga tct gcc aac gcc acc gcg tgc acc gcc acc cag caa acc gct gcg 1356 Gly Ser Ala Asn Ala Thr Ala Cys Thr Ala Thr Gln Gln Thr Ala Ala WO 00/56897

13 PCT / FR00 / 00714 tac aaa aca ctc gtg agc atc ctg tcg gac gcg tcg ttc aac aag tgc 1404 Tyr Lys Thr Leu Val Ser Ile Leu Ser Asp Ala Ser Phe Asn Lys Cys tct acg gat tcg ggc tac tcc atg ctg acg gcc aag gcc ctc ccc acc 1452 Ser Thr Asp Ser Gly Tyr Ser Met Leu Thr Ala Lys Ala Leu Pro Thr acg gcg cag tac aag ctc atg tgc gcg tcc acg gca tgc aac acc atg 1500 Thr Ala Gln Tyr Lys Leu Met Cys Ala Ser Thr Ala Cys Asn Thr Met atc aaa aaa atc gtg acg ctg aac ccg ccc aac tgc aac ctg acg gtg 1548 Ile Lys Lys Ile Val Thr Leu Asn Pro Pro Asn Cys Asn Leu Thr Val ccc acg agc ggc ctg gtg ctc aac gtg tac tcg tac cca aac ggc ttc 1596 Pro Thr Ser Gly Leu Val Leu Asn Val Tyr Ser Tyr Pro Asn Gly Phe tcg gac aag tgc tcg tcg ctg taa 1620 Ser Asp Lys Cys Ser Ser Leu (2) INFORMATION FOR SEQ ID N0: 15:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 33 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PAS2 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15:

(2) INFORMATION FOR SEQ ID NO: 16:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 33 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS5 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 16:

(2) INFORMATION FOR SEQ ID N0: 17:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 34 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS6 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 17:

WO 00/56897

14 PCT / FR00 / 00714 (2) INFORMATION FOR SEQ ID N0: 18:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 34 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS7 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 18:

(2) INFORMATION FOR SEQ ID N0: 19:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 33 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS8 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19:

(2) INFORMATION FOR SEQ ID NO: 20:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 33 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS9 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 20:

(2) INFORMATION FOR SEQ ID NO: 21:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 31 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS10 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 21:

(2) INFORMATION FOR SEQ ID NO: 22:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 34 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS11 WO 00/56897

15 PCT / FR00 / 00714 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 22:

(2) INFORMATION FOR SEQ ID N0: 23:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 35 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear , v (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS12 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 23:

(2) INFORMATION FOR SEQ ID N0: 24:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 32 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS13 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 24:

(2) INFORMATION FOR SEQ ID N0: 25:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 36 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PAS3 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 25:

(2) INFORMATION FOR SEQ ID N0: 26:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 30 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: single (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: Synthetic oligonucleotide PS14 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 26:

Claims (32)

41~
Claims 1. Nucleic acid fragment comprising a plant promoter inducible, characterized in that said inducible promoter consists of the promoter of a plant O-methyltransferase class II (COMT II) gene. 2. Nucleic acid fragment according to claim 1, characterized in that that it consists of a plant COMT II promoter. 3. Nucleic acid fragment according to one of claims 1 or 2, characterized in that the promoter is activated by wounds, viral infections, attacks by UV rays, chemical attacks, or attacks by pathogenic, an insect or a nematode 4. Nucleic acid fragment according to one of claims 1 to 3, characterized in that the plant COMTII is a plant COMT which is not expressed in untreated healthy plants, but which is expressed at the following a mechanical or chemical aggression, or by a pathogen, an insect or a nematode. 5. Nucleic acid fragment according to one of claims 1 to 4, characterized in that the plant is a monocotyledonous or dicotyledonous plant, in particular selected from rice, wheat, barley, sunflower, corn, tobacco, rapeseed, soy or Arabidopsis thaliana. 6. Nucleic acid fragment according to claim 5, characterized in that that the plant is a dicotyledonous plant, preferably tobacco. 7. Nucleic acid fragment according to one of claims 1 to 6, characterized in that the promoter comprises a sequence 5' of the site of initiation of the translation or "start" codon (ATG) of the COMTII coding sequence allowing transcription and expression of said coding sequence. 8. Nucleic acid fragment according to claim 1 to 7, characterized in that that the promoter comprises a sequence of more than 600 nucleotides upstream of the ATG of COMTII, preferably more than 1000 nucleotides upstream of the ATG, more preferably more than 1200 nucleotides upstream of the ATG. 9. Nucleic acid fragment according to one of claims 1 to 8, characterized in that the promoter comprises an initiation site of the transcript located less than 100 nucleotides upstream of the ATG, advantageously about 90 upstream nucleotides. 10. Nucleic acid fragment according to one of claims 1 to 9, characterized in that the 3' end of the promoter is located between the site of initiation of the transcription and the ATG. 11. Nucleic acid fragment according to claim 10, characterized in that the 3' end of the promoter is located between 10 and 50 nucleotides downstream of the site transcription initiation, more preferably between 20 and 40 nucleotides in downstream, even more preferably between 20 and 30 nucleotides downstream. 12. Nucleic acid fragment according to one of claims 1 to 11, characterized in that it consists of the tobacco COMTII promoter defined over there nucleotide sequence upstream of the ATG represented by the identifier of sequence 1 (SEQ ID NO 1), the sequences capable of hybridizing selectively to said sequence and homologous sequences. 13. Nucleic acid fragment according to claim 12, characterized in that that it consists of the sequence between nucleotides 557 and 1796 of sequence identifier #1 14. Chimeric gene (or expression cassette) functional in cells plants and plants comprising in the sense of transcription a sequence of 5' regulation, a coding sequence and a 3' regulation sequence, characterized in that the 5' regulatory sequence comprises the acid moiety nucleic according to one of claims 1 to 13. 15. Chimeric gene according to claim 14, characterized in that the sequence coding sequence comprises a coding sequence for a reporter gene or a sequence coding for a protein of interest. 16. Chimeric gene according to claim 15, characterized in that the protein of interest is a protein which confers resistance properties on plants to diseases or insects. 17. Chimeric gene according to claim 16, characterized in that the protein or peptide of interest is chosen from fungal elicitor peptides, in especially the elictins. 18. Chimeric gene according to claim 17, characterized in that the peptide fungal elicitor is megaspermine. 19. Chimeric gene according to claim 18, characterized in that the megaspermine is represented by sequence identifier No. 13 (SEQ ID
13). 20. Chimeric gene according to claim 19, characterized in that it comprises the DNA sequence represented by sequence identifier No. 14 (SEQ ID
14). 21. Functional chimeric gene in plant cells and plants characterized in that it comprises in the sense of transcription a sequence of 5' regulator comprising an inducible promoter, a coding sequence for a elicitor and a 3' regulatory sequence. 22. Chimeric gene according to claim 21, characterized in that the elicitor is defined in claims 17 to 19. 23. Chimeric gene according to one of claims 21 or 22, characterized in that that the inducible promoter is chosen from phenylalanine promoters ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, inhibitors proteinase (PI), PR1 family genes, nopaline synthase (nos) or gene vspB, HMG2 promoter, apple beta-galactosidase (ABG1) promoter Where the amino cyclopropane carboxylate synthase (ACC synthase) promoter of apple. 24. Cloning and/or expression vector for cell transformation plants or plants, characterized in that it contains at least one gene chimera according to claims 14 to 23. 25. Process for transforming plant cells, characterized in that it consists in integrating into the genome of said plant cells at least one gene chimera according to one of claims 14 to 23.~ 26. Transformed plant cells characterized in that they comprise a chimeric gene according to one of claims 14 to 23. 27. Transformed plants characterized by comprising a gene chimera according to claims 14 to 23. 28. Plants, characterized by containing cells transformed according to claim 26 or obtained by the process according to claim 25. 29. Plants according to claim 28, characterized in that they are regenerated from transformed cells according to claim 19 or obtained by the method according to claim 18. 30. Plants resulting from the cultivation and/or crossing of regenerated plants according to claim 29. 31. Plants according to one of claims 27 to 30, characterized in that that they are of the monocotyledonous type, in particular cereals, cane sugar, the rice and maize, or dicots, in particular tobacco, soya, rapeseed, the cotton, the sunflower, beet, clover. 32. Seeds of the plants according to one of claims 27 to 31.