FR2791360A1 - INDUCIBLE PROMOTER, COMTII, CHIMERE GENE COMPRISING SAME AND TRANSFORMED PLANTS - Google Patents
INDUCIBLE PROMOTER, COMTII, CHIMERE GENE COMPRISING SAME AND TRANSFORMED PLANTS Download PDFInfo
- Publication number
- FR2791360A1 FR2791360A1 FR9907646A FR9907646A FR2791360A1 FR 2791360 A1 FR2791360 A1 FR 2791360A1 FR 9907646 A FR9907646 A FR 9907646A FR 9907646 A FR9907646 A FR 9907646A FR 2791360 A1 FR2791360 A1 FR 2791360A1
- Authority
- FR
- France
- Prior art keywords
- promoter
- plants
- sequence
- sep
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 0 CCO*C(*(C)CC=*)N Chemical compound CCO*C(*(C)CC=*)N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
- C12N9/1011—Catechol O-methyltransferase (2.1.1.6)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8239—Externally regulated expression systems pathogen inducible
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
<Desc/Clms Page number 1> <Desc / Clms Page number 1>
Promoteur inductible COMTII, gène chimère le comprenant et plantes transformées
La présente invention concerne une nouvelle séquence de régulation promotrice inductible en réponse à une blessure, mécanique ou chimique, ou en réponse à une agression par un agent pathogène, notamment bactérien, fongique ou viral, ou par un insecte ou un nématode. COMTII inducible promoter, chimeric gene comprising it and transformed plants
The present invention relates to a novel inducible promoter regulatory sequence in response to a mechanical or chemical injury, or in response to aggression by a pathogen, in particular a bacterial, fungal or viral agent, or an insect or a nematode.
La présente invention concerne également un gène chimère (ou cassette d'expression) comprenant la séquence de régulation promotrice selon l'invention qui contrôle l'expression d'une séquence codante hétérologue, hétérologue signifiant ici une séquence codante différente de la séquence codante native. The present invention also relates to a chimeric gene (or expression cassette) comprising the promoter regulatory sequence according to the invention which controls the expression of a heterologous, heterologous coding sequence, meaning here a coding sequence different from the native coding sequence.
La présente invention concerne également un organisme hôte comprenant ledit gène chimère, les plantes transformées le comprenant et les semences (graines) desdites plantes transformées. The present invention also relates to a host organism comprising said chimeric gene, the transformed plants comprising it and the seeds of said transformed plants.
Il est connu de l'état de la technique que certains gènes, silencieux en l'absence d'agression, ne sont activés que par une agression tant mécanique que chimique et/ou en réponse à une agression par un agent pathogène, un insecte ou un nématode. De tels gènes et leurs facteurs d'activation sont notamment décrits dans le brevet US 5 670 349. It is known from the state of the art that certain genes, silent in the absence of aggression, are activated only by a mechanical as well as chemical aggression and / or in response to an attack by a pathogen, an insect or a nematode. Such genes and their activation factors are described in US Pat. No. 5,670,349.
Ces différents modes de défense sont généralement liés à une régulation de l'expression de certains gènes impliqués dans les mécanismes de défense des plantes par induction de leurs séquences de régulation promotrices. On connaît plusieurs séquences de régulation inductibles comme les promoteurs de phénylalanine ammoniac lyase (PAL), d'HMG-CoA reductase (HMG), de chitinases, de glucanases, d'inhibiteurs de proteinase (PI), de gènes de la famille PR1, de la nopaline synthase (nos) ou du gène vspB, tous ces promoteurs étant rappelés avec les références des publications correspondantes par le Tableau 3 du brevet US 5 670 349. On connaît également le promoteur HMG2 décrit dans ce même brevet US 5 670 349, comme le promoteur de la beta-galactosidase (ABG1) de pomme ou le promoteur de l'amino cyclopropane carboxylate syntase (ACC synthase) de pomme décrits dans la demande de brevet WO 98/45445. These different modes of defense are generally related to a regulation of the expression of certain genes involved in the defense mechanisms of plants by induction of their promoter regulatory sequences. Several inducible regulatory sequences are known, such as the promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, proteinase inhibitors (PI), genes of the PR1 family, of nopaline synthase (nos) or of the vspB gene, all these promoters being recalled with the references of the corresponding publications in Table 3 of US Pat. No. 5,670,349. The HMG2 promoter described in that same patent US Pat. No. 5,670,349 is also known, as the apple beta-galactosidase (ABG1) promoter or the apple amino cyclopropane carboxylate syntase (ACC synthase) promoter described in patent application WO 98/45445.
La présente invention concerne un nouveau fragment d'acide nucléique, en particulier isolé, comprenant un promoteur de plante (ou séquence de régulation promotrice) inductible, ledit promoteur inductible étant constitué par le promoteur d'un The present invention relates to a novel nucleic acid fragment, in particular isolated, comprising an inducible promoter (or promoter regulatory) promoter, said inducible promoter consisting of the promoter of a
<Desc/Clms Page number 2><Desc / Clms Page number 2>
gène d'O-méthyltransférase de classe II (ci-après COMT II) de plante. O-methyltransferase class II gene (hereinafter COMT II) of plant.
Les gènes d'O-méthyltransférase de classe II, dont le gène d'acide caféique-Ométhyltransférase de classe II, de plantes sont silencieux (inactifs) en l'absence de toute agression puisque les plantes non agressées ne l'expriment pas, ou pour le moins à des niveaux indétectables par les méthodes d'analyse usuelles. Ainsi, le messager de la COMT II est indétectable par la technique de " Northern blot " dans différents tissus d'une plante saine non traitée, comme par exemple le tabac (Pellegrini & al., 1993). Class II O-methyltransferase genes, including the Class II caffeic acid-Omethyltransferase gene, of plants are silent (inactive) in the absence of any aggression since unaffected plants do not express it, or at least at undetectable levels by the usual methods of analysis. Thus, the messenger of COMT II is undetectable by the "Northern blot" technique in different tissues of a healthy untreated plant, such as tobacco (Pellegrini et al., 1993).
Cette COMTII et son promoteur sont activés (ou induits) par les blessures, les infections virales, les agressions aux rayons UV, ou aux agressions chimiques par différents produits comme le benzothiazole (BTH), le méthyle jasmonate ou des éliciteurs d'origine végétale comme la pectine. This COMTII and its promoter are activated (or induced) by wounds, viral infections, UV aggressions, or chemical aggressions by different products such as benzothiazole (BTH), methyl jasmonate or elicitors of plant origin as pectin.
De manière avantageuse, le fragment d'acide nucléique isolé selon l'invention est constitué par un promoteur de COMTII de plante. Advantageously, the isolated nucleic acid fragment according to the invention consists of a plant COMTII promoter.
Par COMTII de plante, on entend selon l'invention toute OMT de plante qui n'est pas exprimée dans les plantes saines non traitées, mais qui l'est à la suite d'une agression mécanique, chimique, par un pathogène, un insecte ou un nématode. The term "plant COMTII" is understood to mean any plant OMT which is not expressed in untreated healthy plants, but which is as a result of a mechanical, chemical attack by a pathogen or an insect. or a nematode.
Par plante d'origine de la COMTII, on entend selon l'invention tout organisme pluricellulaire différencié capable de photosynthèse, qu'elle soit monocotylédone ou dicotylédone, comme par exemple le riz, le blé, l'orge, le tournesol, le maïs, le tabac, le colza, le soja ou Arabidopsis thaliana. By plant of origin of the COMTII is meant according to the invention any differentiated pluricellular organism capable of photosynthesis, be it monocotyledonous or dicotyledonous, such as rice, wheat, barley, sunflower, corn, tobacco, rapeseed, soybean or Arabidopsis thaliana.
Selon un mode particulier de réalisation de l'invention, la COMT II est une COMT de plante dicotylédone, de préférence de tabac. According to a particular embodiment of the invention, COMT II is a dicotyledonous plant COMT, preferably tobacco.
Par promoteur, on entend selon l'invention la région non codante d'un gène impliqué dans la liaison avec l'ARN polymérase et d'autres facteurs qui sont responsables de l'initiation et de la modulation de la transcription conduisant à la production d'un transcrit d'ARN. Il s'agit plus particulièrement de toute séquence en 5' du site d'initiation de la traduction ou codon " start " (ATG) de la séquence codante de la COMTII permettant la transcription et l'expression de ladite séquence codante. By promoter is meant according to the invention the non-coding region of a gene involved in binding with RNA polymerase and other factors which are responsible for the initiation and modulation of transcription leading to the production of an RNA transcript. It is more particularly any sequence 5 'of the translation initiation site or "start" codon (ATG) of the coding sequence of COMTII for the transcription and expression of said coding sequence.
Le promoteur selon l'invention comprend avantageusement une séquence de plus de 600 nucléotides en amont de l'ATG de la COMT II, de préférence de plus de 700, de plus de 800 voire de plus de 900 nucléotides en amont de l'ATG, plus préférentiellement de plus de 1000 nucléotides en amont de l'ATG, encore plus The promoter according to the invention advantageously comprises a sequence of more than 600 nucleotides upstream of the ATG of COMT II, preferably more than 700, more than 800 or even more than 900 nucleotides upstream of the ATG, more preferably more than 1000 nucleotides upstream of the ATG, even more
<Desc/Clms Page number 3><Desc / Clms Page number 3>
préférentiellement de plus de 1200 nucléotides en amont de l'ATG. Les promoteurs comprenant plus de 1500 nucléotides en amont de l'ATG de la COMTII font également partie de la présente invention. preferably more than 1200 nucleotides upstream of the ATG. Promoters comprising more than 1500 nucleotides upstream of the ATG of COMTII are also part of the present invention.
Le promoteur comprend un site d'initiation de la transcription. Le site d'initiation de la transcription est généralement situé à moins de 100 nucléotides en amont de l'ATG, avantageusement à environ 90 nucléotides en amont. The promoter comprises a transcription initiation site. The transcription initiation site is generally located within 100 nucleotides upstream of the ATG, preferably about 90 nucleotides upstream.
De manière avantageuse, l'extrémité 3' du promoteur COMTII selon l'invention est située entre le site d'initiation de la transcription et l'ATG. De préférence, l'extrémité 3' du promoteur COMTII est située entre 10 et 50 nucléotides en aval du site d'initiation de la transcription, plus préférentiellement entre 20 et 40 nucléotides en aval, encore plus préférentiellement entre 20 et 30 nucléotides en aval. Advantageously, the 3 'end of the COMTII promoter according to the invention is located between the transcription initiation site and the ATG. Preferably, the 3 'end of the COMTII promoter is located between 10 and 50 nucleotides downstream of the transcription initiation site, more preferably between 20 and 40 nucleotides downstream, even more preferably between 20 and 30 nucleotides downstream.
Le promoteur COMTII selon l'invention comprend également au moins une boite TATA et au moins une boite CAT. La boite TATA est généralement située à moins de 50 nucléotides en amont du site d'initiation de la transcription, à environ 40 nucléotides en amont. La boite CAT est généralement située à moins de 100 nucléotides en amont du site d'initiation de la transcription, de préférence à environ 100 nucléotides et/ou 80 nucléotides en amont. De manière avantageuse, le promoteur comprend deux boites CAT. The COMTII promoter according to the invention also comprises at least one TATA box and at least one CAT box. The TATA box is generally located within 50 nucleotides upstream of the transcription initiation site, at about 40 nucleotides upstream. The CAT box is generally located within 100 nucleotides upstream of the transcription initiation site, preferably about 100 nucleotides and / or 80 nucleotides upstream. Advantageously, the promoter comprises two CAT boxes.
Le promoteur selon l'invention comprend également des éléments régulateurs impliqués dans l'expression de gènes du métabolisme des phénylpropanoïdes et des gènes associés à la défense, en particulier au moins une boite A et/ou au moins une boite L et/ou au moins une boite L inversée et/ou au moins une boite P et/ou au moins une boite W inversée. La boite A comprend la séquence suivante CCGTCC. Elle est généralement située à moins de 410 nucléotides du site d'initiation de la transcription. The promoter according to the invention also comprises regulatory elements involved in the expression of genes for the metabolism of phenylpropanoids and genes associated with defense, in particular at least one box A and / or at least one box L and / or at least one an inverted box L and / or at least one box P and / or at least one inverted box W. Box A includes the following sequence CCGTCC. It is generally located within 410 nucleotides of the transcription initiation site.
La boite L comprend la séquence suivante CTTCAACAACCAACC. Elle est généralement située à moins de 180 nucléotides du site d'initiation de la transcription. The box L comprises the following sequence CTTCAACAACCAACC. It is usually located within 180 nucleotides of the transcription initiation site.
La première boite L inversée comprend la séquence suivante GTTAGGTGAAG. Elle est généralement située à moins de 1000 nucléotides en amont du site d'initiation de la transcription. Avantageusement, le promoteur selon l'invention comprend deux boites L inversées, l'une à environ 970 nucléotides en amont du site d'initiation de la transcription et l'autre à environ 440 nucléotides en amont. La deuxième boite L inversée comprend la séquence suivante TGTTAGGTGTGTGTTT. La boite P The first inverted L box comprises the following sequence GTTAGGTGAAG. It is generally located within 1000 nucleotides upstream of the transcription initiation site. Advantageously, the promoter according to the invention comprises two inverted L-boxes, one at about 970 nucleotides upstream of the transcription initiation site and the other at about 440 nucleotides upstream. The second inverted L box comprises the following sequence TGTTAGGTGTGTGTTT. The P box
<Desc/Clms Page number 4><Desc / Clms Page number 4>
comprend la séquence suivante CACACCAACTCCCA. Elle est généralement située à moins de 750 nucléotides en amont du site d'initiation de la transcription. La boite W inversée comprend la séquence suivante GGTCAA. Elle est généralement située à moins de 1200 nucléotides en amont du site d'initiation de la transcription. includes the following sequence CACACCAACTCCCA. It is generally located within 750 nucleotides upstream of the transcription initiation site. The inverted W box comprises the following sequence GGTCAA. It is generally located within 1200 nucleotides upstream of the transcription initiation site.
Avantageusement, le promoteur selon l'invention comprend deux boites W inversées, l'une à environ 1110 nucléotides en amont et l'autre à environ 210 nucléotides en amont. Advantageously, the promoter according to the invention comprises two inverted W boxes, one at about 1110 nucleotides upstream and the other at about 210 nucleotides upstream.
Le promoteur selon l'invention comprend également au moins une boite E et/ou au moins une boite G et/ou au moins une boite GT. La boite E comprend la séquence suivante TTCCATCAAG. Elle est généralement située à moins de 110 nucléotides en amont du site d'initiation de la transcription. La boite G comprend la séquence suivante CCACGT. Elle est généralement située à moins de 600 nucléotides en amont du site d'initiation de la transcription. La boite GT comprend la séquence suivante GGTTAA. The promoter according to the invention also comprises at least one box E and / or at least one box G and / or at least one box GT. Box E comprises the following sequence TTCCATCAAG. It is generally located within 110 nucleotides upstream of the transcription initiation site. Box G includes the following sequence CCACGT. It is generally located within 600 nucleotides upstream of the transcription initiation site. The GT box includes the following sequence GGTTAA.
Elle est généralement située à moins de 450 nucléotides en amont du site d'initiation de la transcription. Avantageusement, le promoteur selon l'invention comprend deux boites GT, l'une à environ 400 nucléotides en amont et l'autre à environ 280 nucléotides en amont. It is generally located within 450 nucleotides upstream of the transcription initiation site. Advantageously, the promoter according to the invention comprises two GT boxes, one at about 400 nucleotides upstream and the other at about 280 nucleotides upstream.
Selon un mode avantageux de réalisation de l'invention, le promoteur selon l'invention est constitué par le promoteur COMTII de tabac défini par la séquence nucléotidique en amont de l'ATG représentée par l'identificateur de séquence 1 (SEQ ID NO 1), de préférence la séquence comprise entre les nucléotides 557 et 1795 de l'identificateur de séquence n 1, les séquences capables de s'hybridiser de manière sélective aux dites séquences et leurs séquences homologues. According to an advantageous embodiment of the invention, the promoter according to the invention consists of the tobacco COMTII promoter defined by the nucleotide sequence upstream of the ATG represented by the sequence identifier 1 (SEQ ID NO 1). , preferably the sequence between nucleotides 557 and 1795 of the sequence identifier n 1, the sequences capable of hybridizing selectively to said sequences and their homologous sequences.
Par séquence capable de s'hybridiser de manière sélective , on entend selon l'invention les séquencesqui s'hybrident avec les séquences ci-dessus à un niveau suppérieur au bruit de fond de manière significative. Le bruit de fond peut être lié à l'hybridiqtion d'autres séquences d'ADN présentes, notamment d'autres ADNc présentes dans une banque d'ADNc. Le niveau du signal généré par l'interaction entre la séquence capable de s'hybridiser de manière sélective et les séquences définies par les séquence ID ci-dessus selon l'invention est généralement 10 fois, de préférence 100 fois plus intense que celui de l'interaction des autres séquences d'ADN générant le bruit de fond. Le niveau d'interaction peut être mesuré par exemple , par marquage de la sonde By sequence capable of hybridizing selectively is meant according to the invention sequences which hybridize with the above sequences at a level substantially greater than the background. Background noise may be related to the hybridization of other DNA sequences present, including other cDNAs present in a cDNA library. The level of the signal generated by the interaction between the sequence capable of hybridizing selectively and the sequences defined by the above ID sequences according to the invention is generally 10 times, preferably 100 times more intense than that of the invention. interaction of the other DNA sequences generating the background noise. The level of interaction can be measured, for example, by marking the probe
<Desc/Clms Page number 5><Desc / Clms Page number 5>
avec des éléments radioactifs, comme le 32P. L'hybridation sélective est généralement obtenue en employant des conditions de milieu très sévères (par exemple NaCl 0,03 M et citrate de sodium 0,03 M à environ 50 C-60 C). L'hybridation peut bien entendu être effectuée selon les méthodes usuelles de l'état de la technique (notamment Sambrook & al., 1989, Molecular Cloning : A Labratory Manual). with radioactive elements, like the 32P. Selective hybridization is generally achieved by employing very severe environmental conditions (eg, 0.03 M NaCl and 0.03 M sodium citrate at about 50 C-60 C). Hybridization can of course be carried out according to the usual methods of the state of the art (in particular Sambrook et al., 1989, Molecular Cloning: A Labratory Manual).
Par séquence homologue, on entend selon l'invention toute séquence comprenant plus de 70 % d'homologie, préférentiellement plus de 80 % d'homologie, encore plus préférentiellement plus de 90 % d'homologie, et qui conserve les éléments fonctionnels du COMTII lui conférant ses propriétés de promoteur inductible. Les méthodes de mesure et d'identification des homologies entre les séquences d'acides nucléiques sont bien connues de l'homme du métier. On peut employer par exemple les programmes PILEUP ou BLAST (notamment Altschul & al., 1993, J. Mol. Evol. 36 :290-300 ; Altschul & al., 1990, J. Mol. Biol. 215 :403-10). By homologous sequence is meant according to the invention any sequence comprising more than 70% of homology, preferably more than 80% of homology, still more preferably more than 90% of homology, and which retains the functional elements of COMTII itself. conferring its inducible promoter properties. Methods for measuring and identifying homologies between nucleic acid sequences are well known to those skilled in the art. For example, the PILEUP or BLAST programs can be used (in particular Altschul et al., 1993, J. Mol, Evol 36: 290-300, Altschul et al., 1990, J. Mol Biol 215: 403-10). .
L'isolement, le clonage et la caractérisation des promoteurs COMT II à partir des gènes de COMT II se fait selon les méthodes expérimentales usuelles de l'homme du métier pour isoler, cloner et caractériser un promoteur, abondamment décrites dans la littérature. The isolation, cloning and characterization of COMT II promoters from the COMT II genes is done according to the usual experimental methods of those skilled in the art for isolating, cloning and characterizing a promoter, extensively described in the literature.
L'isolement et le clonage d'un gène COMT II se fait par analyse d'une banque génomique préparée à partir de l'ADN de la plante d'intérêt. L'ADN génomique est coupée par une ou plusieurs enzymes de restriction appropriées et introduit dans un vecteur adéquat pour constituer, par des méthodes connues de l'homme du métier, une banque contenant l'ensemble du DNA génomique de la plante (Ausubel et al., 1998; Sambrook et al., 1989). The isolation and cloning of a COMT II gene is done by analysis of a genomic library prepared from the DNA of the plant of interest. The genomic DNA is cleaved by one or more appropriate restriction enzymes and introduced into a suitable vector to constitute, by methods known to those skilled in the art, a library containing all the genomic DNA of the plant (Ausubel et al. 1998, Sambrook et al., 1989).
Le ou les clones renfermant un gène COMT II est (sont) isolé(s) grâce à une sonde nucléotidique. La séquence de la sonde est. soit déduite de la séquence protéique si l'enzyme a été purifiée (en suivant son activité, par exemple), soit préparée à partir d'un clone de cDNA issu d'une banque. Cette banque de cDNA est préparée à partir de mRNA extrait de tissus traités de façon à induire l'expression du gène COMT II (par la blessure, l'infection ou un traitement chimique comme décrit dans les exemples ou les figures 1-5). La banque de cDNA est ensuite criblée par des anticorps dirigés contre une protéine COMT II (de tabac par exemple) ou par une sonde nucléotidique déduite de la protéine COMT II de la plante considérée ou déduite des séquences conservées chez les The clone (s) containing a COMT II gene is (are) isolated using a nucleotide probe. The sequence of the probe is. deduced from the protein sequence if the enzyme has been purified (following its activity, for example) or prepared from a cDNA clone from a library. This cDNA library is prepared from mRNA extracted from tissues treated to induce expression of the COMT II gene (by injury, infection or chemical treatment as described in the examples or Figures 1-5). The cDNA library is then screened by antibodies directed against a COMT II protein (tobacco for example) or by a nucleotide probe deduced from the COMT II protein of the plant in question or deduced from the sequences conserved in the
<Desc/Clms Page number 6><Desc / Clms Page number 6>
COMT de plantes. Le cDNA ainsi isolé est caractérisé par sa séquence nucléotidique ou par l'activité enzymatique de la protéine recombinante obtenue après expression du cDNA dans un organisme procaryote ou eucaryote. COMT of plants. The cDNA thus isolated is characterized by its nucleotide sequence or by the enzymatic activity of the recombinant protein obtained after expression of the cDNA in a prokaryotic or eukaryotic organism.
Les séquences non codantes du cDNA (3' et/ou 5') sont utilisées pour sélectionner, par PCR, en conditions très sélectives, le ou les clones génomiques renfermant le gène COMT II exprimé lors du traitement utilisé pour construire la banque cDNA. Les séquences promotrices sont alors être isolées par PCR ou toute autre méthode appropriée bien connue de l'homme du métier. The non-coding sequences of cDNA (3 'and / or 5') are used to select, by PCR, under very selective conditions, the genomic clone (s) containing the COMT II gene expressed during the treatment used to construct the cDNA library. The promoter sequences are then isolated by PCR or any other suitable method well known to those skilled in the art.
Sur la base des informations contenues dans la présente demande de brevet pour le promoteur COMTII de tabac, l'homme du métier sera à même d'identifier d'autres promoteurs COMTII d'autres espèces végétales une fois le gène COMTII identifié et cloné selon les méthodes usuelles, notamment celles décrites ci-dessus. On the basis of the information contained in the present patent application for the tobacco COMTII promoter, a person skilled in the art will be able to identify other COMTII promoters of other plant species once the COMTII gene has been identified and cloned according to the usual methods, especially those described above.
La présente invention concerne également un gène chimère (ou cassette d'expression) fonctionnel dans les cellules végétales et les plantes comprenant dans le sens de la transcription une séquence de régulation en 5', une séquence codante et une séquence de régulation en 3', la séquence de régulation en 5' comprenant un promoteur COMT II selon l'invention défini auparavant. The present invention also relates to a chimeric gene (or expression cassette) functional in plant cells and plants comprising in the sense of transcription a 5 'regulatory sequence, a coding sequence and a 3' regulatory sequence, the 5 'regulatory sequence comprising a COMT II promoter according to the invention defined previously.
Par "cellule végétale", on entend selon l'invention toute cellule issue d'une plante et pouvant constituer des tissus indifférenciés tels que des cals, des tissus différenciés tels que des embryons, des parties de plantes, des plantes ou des semences. By "plant cell" is meant according to the invention any cell derived from a plant and may constitute undifferentiated tissues such as calli, differentiated tissues such as embryos, parts of plants, plants or seeds.
On entend par "plante" selon l'invention, tout organisme multicellulaire différencié capable de photosynthèse, en particulier monocotylédones ou dicotylédones, plus particulièrement des plantes de culture destinées ou non à l'alimentation animale ou humaine, comme le maïs, le blé, le colza, le soja, le riz, la canne à sucre, la betterave, le tabac, le coton, etc. The term "plant" according to the invention is understood to mean any differentiated multicellular organism capable of photosynthesis, in particular monocotyledons or dicotyledons, more particularly culture plants, whether or not intended for animal or human nutrition, such as corn, wheat, cereals or the like. rapeseed, soybeans, rice, sugar cane, beets, tobacco, cotton, etc.
Comme séquence de régulation en 5', on peut utiliser le promoteur COMTII selon l'invention seul ou associé à au moins une partie d'un promoteur d'un gène s'exprimant naturellement dans les plantes en particulier un promoteur s'exprimant notamment dans les feuilles des plantes, comme par exemple des promoteurs dits constitutifs d'origine bactérienne, virale ou végétale ou encore des promoteurs dits lumière dépendants comme celui d'un gène de la petite sous-unité de ribulose- biscarboxylase/oxygénase (RuBisCO) de plante ou tout promoteur convenable connu pouvant être utilisé. Parmi As a 5 'regulatory sequence, the COMTII promoter according to the invention may be used alone or in combination with at least a part of a promoter of a gene expressing naturally in plants, in particular a promoter expressing in particular in the leaves of the plants, such as constitutive promoters of bacterial, viral or plant origin or so-called dependent light promoters such as that of a gene of the small subunit of ribulose-biscarboxylase / oxygenase (RuBisCO) of plant or any known suitable promoter that can be used. Among
<Desc/Clms Page number 7><Desc / Clms Page number 7>
les promoteurs d'origine végétale on citera les promoteurs d'histone tels que décrits dans la demande EP 0 507 698, ou le promoteur d'actine de riz (US 5,641,876). Parmi les promoteurs d'un gène de virus, de plante, on citera celui de la mosaïque du choux fleur (CAMV 19S ou 35S), ou le promoteur du circovirus (AU 689 311). promoters of plant origin are the histone promoters as described in application EP 0 507 698, or the rice actin promoter (US Pat. No. 5,641,876). Among the promoters of a plant virus gene, mention will be made of cauliflower mosaic (CAMV 19S or 35S), or the circovirus promoter (AU 689 311).
On peut encore utiliser le promoteur COMTII selon l'invention en association avec au moins une partie d'un promoteur spécifique de régions ou de tissus particuliers des plantes, et plus particulièrement des promoteurs spécifiques des graines ([22] Datla, R.& al., Biotechnology Ann. Rev. (1997) 3,269-296), notamment les promoteurs de la napine (EP 255 378), de la phaseoline, de la glutenine, de l'héliantinine (WO 92/17580), de l'albumine (WO 98/45460) ou de l'oélosine (WO 98/45461). It is also possible to use the COMTII promoter according to the invention in combination with at least a part of a promoter specific for particular regions or tissues of plants, and more particularly seed-specific promoters ([22] Datla, R. & al Biotechnology Ann Rev. (1997) 3,269-296), including the promoters of napin (EP 255,378), phaseolin, glutenin, heliantinin (WO 92/17580), albumin (WO 98/45460) or oelosine (WO 98/45461).
Selon l'invention, on peut également utiliser, en association avec le promoteur COMTII selon l'invention, d'autres séquences de régulation, qui sont situées entre le promoteur et la séquence codante, telles que des activateurs de transcription ("enhancer"), comme par exemple l'activateur de translation du virus de la mosaïque du tabac (VMT) décrit dans la demande WO 87/07644, ou du virus etch du tabac (VET) décrit par Carrington & Freed. According to the invention, it is also possible to use, in association with the COMTII promoter according to the invention, other regulatory sequences, which are situated between the promoter and the coding sequence, such as enhancer enhancers. , such as, for example, the tobacco mosaic virus (TMV) translational activator described in WO 87/07644, or tobacco etch virus (VET) described by Carrington & Freed.
Comme séquence de régulation terminatrice ou de polyadénylation, on peut utiliser toute séquence correspondante d'origine bactérienne, comme par exemple le terminateur nos d'Agrobacterium tumefaciens, ou encore d'origine végétale, comme par exemple un terminateur d'histone tel que décrit dans la demande EP 0 633 317. As a terminating or polyadenylation regulatory sequence, it is possible to use any corresponding sequence of bacterial origin, such as, for example, the Nos terminator of Agrobacterium tumefaciens, or else of plant origin, such as for example a histone terminator as described in US Pat. EP 0 633 317.
La séquence codante du gène chimère selon l'invention comprend une séquence codante pour un gène rapporteur, comme la séquence codante GUS, ou une séquence codante pour une protéine d'intérêt. Au regard du mode d'induction du promoteur selon l'invention, blessure, infection virale ou réponse à des éliciteurs, la protéine d'intérêt est avantageusement une protéine conférant aux plantes des propriétés de résistance aux maladies ou aux insectes. The coding sequence of the chimeric gene according to the invention comprises a coding sequence for a reporter gene, such as the GUS coding sequence, or a coding sequence for a protein of interest. In view of the mode of induction of the promoter according to the invention, wound, viral infection or response to elicitors, the protein of interest is advantageously a protein conferring on the plants properties of resistance to diseases or insects.
Parmi les protéines ou peptides d'intérêt conférant de nouvelles propriétés de résistance aux maladies on citera notamment les chitinases, les glucanases, l'oxalate oxydase, toutes ces protéines et leurs séquences codantes étant largement décrites dans la littérature, ou encore les peptides antibactériens et/ou antifongiques, en particulier les peptides de moins de 100 acides aminés riches en cystéines comme les thionines ou défensines de plantes, et plus particulièrement les peptides lytiques de toutes origines Among the proteins or peptides of interest conferring new properties of resistance to diseases include chitinases, glucanases, oxalate oxidase, all these proteins and their coding sequences being widely described in the literature, or the antibacterial peptides and / or antifungals, in particular peptides with less than 100 amino acids rich in cysteines, such as thionines or plant defensins, and more particularly lytic peptides of all origins
<Desc/Clms Page number 8><Desc / Clms Page number 8>
comprenant un ou plusieurs ponts disulfures entre les cystéines et des régions comprenant des acides aminés basiques, notamment les peptides lytiques suivants : l'androctonine (WO 97/30082 et PCT/FR98/01814, déposée le 18 août 1998) ou la drosomicine (PCT/FR98/01462, déposée le 8 juillet 1998). comprising one or more disulfide bridges between cysteines and regions comprising basic amino acids, especially the following lytic peptides: androctonin (WO 97/30082 and PCT / FR98 / 01814, filed Aug. 18, 1998) or drosomicin (PCT / FR98 / 01462, filed July 8, 1998).
Selon un mode préférentiel de réalisation de l'invention, la protéine ou peptide d'intérrêt est choisi parmi les peptides éliciteurs fongiques, en particulier les élicitines (Kamoun & al., 1993 ; Panabières & al., 1995). De manière préférentielle, le peptide éliciteur fongique est la mégaspermine. La mégaspermine et sa séquence codante est représentée par l'identificateur de séquence n 13 (SEQ ID 13). De manière plus préférentielle, le gène chimère selon l'invention comprenant dans le sens de la transcription une séquence de régulation en 5' comprenant un promoteur COMT II et une séquence codante pour la mégaspermine comprend la séquence d'ADN représentée par l'identificateur de séquence n 14 (SEQ ID 14). According to a preferred embodiment of the invention, the protein or peptide of interest is chosen from fungal eliciting peptides, in particular elicitins (Kamoun et al., 1993, Panabières et al., 1995). Preferably, the fungal elicitor peptide is megaspermine. Megaspermin and its coding sequence is represented by sequence identifier 13 (SEQ ID 13). More preferably, the chimeric gene according to the invention comprising in the direction of transcription a 5 'regulatory sequence comprising a COMT II promoter and a coding sequence for megaspermine comprises the DNA sequence represented by the identifier of sequence No. 14 (SEQ ID 14).
Parmi les protéines d'intérêt conférant de nouvelles propriétés de résistance aux insectes, on citera plus particulièrement les protéines Bt largement décrites dans la littérature et bien connues de l'homme du métier. On citera aussi les protéines extraites de bactéries comme Photorabdus (WO 97/17432 & WO 98/08932). Among the proteins of interest conferring novel insect resistance properties, mention will be made more particularly of the Bt proteins widely described in the literature and well known to those skilled in the art. Also mentioned are proteins extracted from bacteria such as Photorabdus (WO 97/17432 & WO 98/08932).
La présente invention concerne également un gène chimère (ou cassette d'expression) fonctionnel dans les cellules végétales et les plantes comprenant dans le sens de la transcription une séquence de régulation en 5', une séquence codante pour un éliciteur et une séquence de régulation en 3', la séquence de régulation en 5' comprenant un promoteur inductible. The present invention also relates to a chimeric gene (or expression cassette) functional in plant cells and plants comprising in the sense of transcription a 5 'regulatory sequence, a coding sequence for an elicitor and a regulatory sequence in 3 ', the 5' regulatory sequence comprising an inducible promoter.
De manière préférentielle, l'éliciteur est une élicitine, plus préférentiellement la mégaspermine telle que définie ci-dessus. Preferably, the elicitor is an elicitin, more preferably the megaspermine as defined above.
Le promoteur inductible est avantageusement choisi parmi les promoteurs de phénylalanine ammoniac lyase (PAL), d'HMG-CoA reductase (HMG), de chitinases, de glucanases, d'inhibiteurs de proteinase (PI), de gènes de la famille PR1, de la nopaline synthase (nos) ou du gène vspB (US 5 670 349, Tableau 3), le promoteur HMG2 (US 5 670 349), le promoteur de la beta-galactosidase (ABG1) de pomme ou le promoteur de l'amino cyclopropane carboxylate syntase (ACC synthase) de pomme (WO 98/45445). The inducible promoter is advantageously chosen from promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, proteinase inhibitors (PI), genes of the PR1 family, nopaline synthase (nos) or the vspB gene (US 5,670,349, Table 3), the HMG2 promoter (US 5,670,349), the apple beta-galactosidase (ABG1) promoter or the amino cyclopropane promoter carboxylate syntase (ACC synthase) of apple (WO 98/45445).
La présente invention concerne également un vecteur de clonage et/ou d'expression pour la transformation des cellules végétales ou des plantes contenant au The present invention also relates to a cloning and / or expression vector for the transformation of plant cells or plants containing at least one
<Desc/Clms Page number 9><Desc / Clms Page number 9>
moins un gène chimère tel que défini ci-dessus. Ce vecteur comprend outre le gène chimère ci-dessus, au moins une origine de réplication. Ce vecteur peut être constitué par un plasmide, un cosmde, un bactériophage ou un virus, transformés par l'introduction du gène chimère selon l'invention. De tels vecteurs de transformation sont bien connus de l'homme du métier et largement décrits dans la littérature. Pour la transformation des cellules végétales ou des plantes, il s'agira notamment d'un virus qui peut être employé pour la transformation des plantes développées et contenant en outre ses propres éléments de réplication et d'expression. De manière préférentielle, le vecteur de transformation des cellules végétales ou des plantes selon l'invention est un plasmide. minus a chimeric gene as defined above. This vector comprises, in addition to the above chimeric gene, at least one origin of replication. This vector may consist of a plasmid, a cosmid, a bacteriophage or a virus, transformed by the introduction of the chimeric gene according to the invention. Such transformation vectors are well known to those skilled in the art and widely described in the literature. For the transformation of plant cells or plants, it will include a virus that can be used for the transformation of plants developed and further containing its own elements of replication and expression. Preferably, the transformation vector of the plant cells or plants according to the invention is a plasmid.
Pour la transformation des cellules végétales ou des plantes, le gène chimère selon l'invention peut être employé en association avec un gène marqueur de sélection, soit dans un même vecteur, les deux gènes étant associés de manière convergente, divergente ou colinéaire, ou encore dans deux vecteurs employés simultanément pour la transformation de l'organisme hôte. De tels gènes marqueurs et leur utilisation pour la transformation des plantes sont bien connus de l'homme du métier et largement décrits dans la littérature. For the transformation of plant cells or plants, the chimeric gene according to the invention may be used in combination with a selection marker gene, either in the same vector, the two genes being associated convergently, divergently or collinearly, or in two vectors used simultaneously for transformation of the host organism. Such marker genes and their use for plant transformation are well known to those skilled in the art and widely described in the literature.
Parmi les gènes codant pour des marqueurs de sélection, on peut citer les gènes de résistance aux antibiotiques, les gènes de tolérance aux herbicides (bialaphos, glyphosate ou isoxazoles), des gènes codant pour des enzymes rapporteurs facilement identifiables comme l'enzyme GUS, des gènes codant pour des pigments ou des enzymes régulant la production de pigments dans les cellules transformées. De tels gènes marqueurs de sélection sont notamment décrits dans les demandes de brevet EP 242 236, EP 242 246, GB 2 197 653, WO 91/02071, WO 95/06128, WO 96/38567 ou WO 97/04103. Genes encoding selection markers include antibiotic resistance genes, herbicide tolerance genes (bialaphos, glyphosate or isoxazoles), genes encoding easily identifiable reporter enzymes such as the GUS enzyme, genes encoding pigments or enzymes regulating the production of pigments in transformed cells. Such selection marker genes are in particular described in patent applications EP 242 236, EP 242 246, GB 2 197 653, WO 91/02071, WO 95/06128, WO 96/38567 or WO 97/04103.
L'invention a encore pour objet un procédé de transformation des cellules végétales par intégration au génome des dites cellules végétales d'au moins un gène chimère tel que défini ci-dessus, transformation qui peut être obtenue par tout moyen connu approprié, amplement décrit dans la littérature spécialisée et notamment les références citées dans la présente demande, plus particulièrement par le vecteur selon l'invention. The subject of the invention is also a process for transforming plant cells by integration into the genome of said plant cells of at least one chimeric gene as defined above, which transformation can be obtained by any appropriate known means, amply described in the specialized literature and in particular the references cited in the present application, more particularly by the vector according to the invention.
Une série de méthodes consiste à bombarder des cellules, des protoplastes ou des A series of methods involves bombarding cells, protoplasts or
<Desc/Clms Page number 10><Desc / Clms Page number 10>
tissus avec des particules auxquelles sont accrochées les séquences d'ADN. Une autre série de méthodes consiste à utiliser comme moyen de transfert dans la plante un gène chimère inséré dans un .plasmide Ti d'Agrobacterium tumefaciens ou Ri d'Agrobacterium rhizogenes. D'autres méthodes peuvent être utilisées telles que la micro injection ou l'électroporation, ou encore la précipitation directe au moyen de PEG. tissues with particles to which are attached the DNA sequences. Another series of methods consists in using as transfer means in the plant a chimeric gene inserted into an Agrobacterium tumefaciens Ti plasmid or Agrobacterium rhizogenes Ri plasmid. Other methods can be used such as microinjection or electroporation, or direct precipitation using PEG.
L'homme du métier fera le choix de la méthode appropriée en fonction de la nature de l'organisme hôte, en particulier de la cellule végétale ou de la plante. Those skilled in the art will choose the appropriate method depending on the nature of the host organism, in particular the plant cell or the plant.
La présente invention a encore pour objet les cellules végétales ou plantes transformés et contenant un gène chimère défini ci-dessus. The present invention also relates to plant cells or transformed plants and containing a chimeric gene defined above.
La présente invention a encore pour objet les plantes contenant des cellules transformées, en particulier les plantes régénérées à partir des cellules transformées. La régénération est obtenue par tout procédé approprié qui dépend de la nature de l'espèce, comme par exemple décrit dans les références ci-dessus. Pour les procédés de transformation des cellules végétales et de régénération des plantes, on citera notamment les brevets et demandes de brevet suivants : 4,459,355, US 4,536,475, US 5,464,763, US 5,177,010, US 5,187,073, EP 267,159, EP 604 662, EP 672 752, US 4,945,050, US 5,036,006, US 5,100,792, US 5,371,014, US 5,478,744, US 5,179,022, US 5,565,346, US 5,484,956, US 5,508,468, US 5,538,877, US 5,554,798, US 5,489,520, US 5,510,318, US 5,204,253, US 5,405,765, EP 442 174, EP 486 233, EP 486 234, EP 539 563, EP 674 725, WO 91/02071 et WO 95/06128. The subject of the present invention is also the plants containing transformed cells, in particular the plants regenerated from the transformed cells. Regeneration is obtained by any suitable method which depends on the nature of the species, as for example described in the references above. For plant cell transformation and plant regeneration processes, mention may be made in particular of the following patents and patent applications: 4,459,355, US 4,536,475, US 5,464,763, US 5,177,010, US 5,187,073, EP 267,159, EP 604,662, EP 672,752, US 4,945,050, US 5,036,006, US 5,100,792, US 5,371,014, US 5,478,744, US 5,179,022, US 5,565,346, US 5,484,956, US 5,508,468, US 5,538,877, US 5,554,798, US 5,489,520, US 5,510,318, US 5,204,253, US 5,405,765, EP 442,174, EP 486,233, EP 486,234, EP 539,563, EP 674,725, WO 91/02071 and WO 95/06128.
La présente invention concerne également les plantes transformées issues de la culture et/ou du croisement des plantes régénérées ci-dessus, ainsi que les graines de plantes transformées. The present invention also relates to the transformed plants resulting from the cultivation and / or crossing of the regenerated plants above, as well as the seeds of transformed plants.
Les plantes transformées pouvant être obtenues selon l'invention peuvent être du type monocotylédones telles que par exemple les céréales, la canne à sucre, le riz et le maïs ou dicotylédones comme par exemple le tabac, la soja, le colza, le coton, le tournesol, la betterave, le trèfle, etc. The transformed plants obtainable according to the invention may be of the monocotyledonous type such as, for example, cereals, sugar cane, rice and maize or dicotyledons, for example tobacco, soya, rapeseed, cotton, sunflower, beetroot, clover, etc.
Les plantes transformées selon l'invention peuvent contenir d'autres gènes d'intérêt, conférant aux plantes de nouvelles propriétés agronomiques. Parmi les gènes conférant de nouvelles propriétés agronomiques aux plantes transformées, on peut citer les gènes conférant une tolérance à certains herbicides, ceux conférant une tolérance à certains insectes, ceux conférant une tolérance à certaines maladies . De tels gènes sont Transformed plants according to the invention may contain other genes of interest, conferring on plants new agronomic properties. Among the genes conferring new agronomic properties to transformed plants include genes conferring tolerance to certain herbicides, those conferring tolerance to certain insects, those conferring tolerance to certain diseases. Such genes are
<Desc/Clms Page number 11><Desc / Clms Page number 11>
notamment décrits dans les demandes de brevet WO 91/02071 et WO 95/06128. On peut également citer les gènes modifiant la constitution des plantes modifiées, en particulier la teneur et la quajité de certains acides gras essentiels (EP 666 918) ou encore la teneur et la qualité des protéines, en particuliers dans les feuilles et/ou les graines desdites plantes. On citera en particulier les gènes codant pour des protéines enrichies en acides aminés soufrés ([1]; WO 98/20133 ; WO 97/41239 ; WO 95/31554 ; WO 94/20828 ; WO 92/14822). Ces protéines enrichies en acides aminés soufrés auront également pour fonction de piéger et stocker la cystéine et/ou la méthionine excédentaire, permettant d'éviter les problèmes éventuels de toxicité liés à une surproduction de ces acides aminés soufrés en les piégeant. On peut citer également des gènes codant pour des peptides riches en acides aminés soufrés et plus particulièrement en cystéines, les dits peptides ayant également une activité antibactérienne et/ou antifongique. On citera plus particulièrement les défensines de plantes, de même que les peptides lytiques de toute origine, et plus particulièrement les peptides lytiques suivants : l'androctonine (WO 97/30082 et PCT/FR98/01814, déposée le 18 août 1998) ou la drosomicine (PCT/FR98/01462, déposée le 8 juillet 1998. especially described in patent applications WO 91/02071 and WO 95/06128. Mention may also be made of genes modifying the constitution of modified plants, in particular the content and the quajity of certain essential fatty acids (EP 666 918) or the content and quality of the proteins, in particular in the leaves and / or seeds. said plants. In particular, the genes encoding proteins enriched in sulfur amino acids ([1], WO 98/20133, WO 97/41239, WO 95/31554, WO 94/20828 and WO 92/14822) will be mentioned in particular. These proteins enriched in sulfur amino acids will also function to trap and store cysteine and / or excess methionine, to avoid the potential problems of toxicity related to overproduction of these sulfur-containing amino acids by trapping them. Mention may also be made of genes coding for peptides rich in sulfur amino acids and more particularly in cysteines, the said peptides also having an antibacterial and / or antifungal activity. Mention may be made more particularly of plant defensins, as well as lytic peptides of any origin, and more particularly the following lytic peptides: androctonine (WO 97/30082 and PCT / FR98 / 01814, filed August 18, 1998) or Drosomicin (PCT / FR98 / 01462, filed July 8, 1998).
Ces autres gènes d'intérêt peuvent être combinés au gène chimère selon l'invention soit par croisement conventionnel de deux plantes contenant chacune l'un des gènes (la première le gène chimère selon l'invention et la seconde le gène codant pour la protéine d'intérêt) soit en effectuant la transformation de cellules végétales d'une plante contenant le gène codant pour la protéine d'intérêt avec le gène chimère selon l'invention. These other genes of interest can be combined with the chimeric gene according to the invention either by conventional crossing of two plants each containing one of the genes (the first the chimeric gene according to the invention and the second the gene coding for the protein of the invention. interest) by carrying out the transformation of plant cells of a plant containing the gene coding for the protein of interest with the chimeric gene according to the invention.
Les exemples ci-après permettent d'illustrer l'invention, sans toutefois chercher à en limiter la portée. The following examples illustrate the invention, without seeking to limit its scope.
Toutes les méthodes ou opérations décrites ci-dessous dans ces exemples sont données à titre d'exemples et correspondent à un choix, effectué parmi les différentes méthodes disponibles pour parvenir au même résultat. Ce choix n'a aucune incidence sur la qualité du résultat et par conséquent, toute méthode adaptée peut être utilisée par l'homme de l'art pour parvenir au même résultat. La plupart des méthodes d'ingénierie des fragments d'ADN sont décrites dans "Current Protocols in Molecular Biology" Volumes 1 et 2, Ausubel F. M. et al ou dans Sambrook et al 1989. All the methods or operations described below in these examples are given as examples and correspond to a choice, made among the various methods available to achieve the same result. This choice has no impact on the quality of the result and therefore, any suitable method can be used by those skilled in the art to achieve the same result. Most methods of engineering DNA fragments are described in "Current Protocols in Molecular Biology" Volumes 1 and 2, Ausubel F.M. et al or Sambrook et al 1989.
Description de la figure 1 : d'activités GUS (1A) correspondant à la Description of Figure 1: GUS activities (1A) corresponding to the
<Desc/Clms Page number 12><Desc / Clms Page number 12>
construction promoteur COMTII(-1215 à +24)/GUS et COMTII (1B) au cours d'une infection virale (VMT) ou lors d'une blessure. construction promoter COMTII (-1215 to +24) / GUS and COMTII (1B) during a viral infection (VMT) or during an injury.
Exemple 1 : Isolement du gène COMT de classe II
Le criblage d'une banque génomique de tabac a permis d'isoler 6 clones différents contenant des gènes de COMT de classe II (COMTII). Ces derniers ont d'abord été caractérisés par leurs profils de restriction qui ont révélé une certaine hétérogénéité parmi les différents clones. Example 1: Isolation of the Class II COMT Gene
Screening of a genomic tobacco library made it possible to isolate 6 different clones containing COMT class II (COMTII) genes. These were first characterized by their restriction profiles which revealed some heterogeneity among the different clones.
Les COMTII forment une famille multigénique composée de six à sept gènes dont un seul est transcrit dans les réactions de défense puisqu'un seul type d'ADNc a été caractérisé dans une banque élaborée à partir de feuilles inoculées par le virus de la mosaïque du tabac (VMT) (Pellegrini & al. 1993). Afin d'identifier le ou les clones renfermant le gène exprimé lors des réactions de défense, des réactions PCR ont été réalisées en utilisant des amorces dérivées de la région 3' non codante de l'ADNc. Dans des conditions de sélectivité élevée un seul clone est alors amplifié. Les produits d'amplifications ont été séquences. Les séquences obtenues ont présenté une homologie parfaite avec celles des régions 3' non codantes de l'ADNc. COMTIIs form a multigenic family composed of six to seven genes, only one of which is transcribed in defense reactions since only one type of cDNA has been characterized in a bank made from leaves inoculated with tobacco mosaic virus. (VMT) (Pellegrini et al., 1993). In order to identify the clone (s) containing the expressed gene in defense reactions, PCR reactions were performed using primers derived from the 3 'non-coding region of the cDNA. Under conditions of high selectivity a single clone is then amplified. The amplification products were sequenced. The sequences obtained showed perfect homology with those of the 3 'non-coding regions of the cDNA.
Exemple 2 : Analyse des séquences du promoteur de gène de la COMT de classe II
Le clone génomique retenu a été sous-cloné dans un vecteur bactérien (puc 18) et représente un insert de 14 kb dont 9 kb sont situés en amont de l'ATG du gène COMTII. Example 2 Sequence Analysis of the Class II COMT Gene Promoter
The retained genomic clone was subcloned into a bacterial vector (puc 18) and represents a 14 kb insert of which 9 kb are located upstream of the ATG of the COMTII gene.
Le site d'initiation de la transcription a été déterminé par la technique d'extension d'amorce et il se place a 90 nucléotides du site d'initiation de la traduction. The transcription initiation site was determined by the primer extension technique and is located at 90 nucleotides from the translation initiation site.
Le promoteur a été séquence sur une longueur de 1771 kilobases. Des éléments non spécifiques et communs aux gènes eucaryotes impliqués dans l'initiation de la transcription tels la TATA box et la CAT box ont été retrouvés dans le promoteur COMTII (SEQ ID NO 1). Des sites de régulation ont été mis en évidence par comparaison des séquences promotrices du gène COMTII avec celles de gènes intervenant dans les mécanismes de défense. Le promoteur COMTII contient des éléments spécifiques des gènes du métabolisme des phénylpropanoïdes impliqués dans la réponse au stress comme les trois boîtes P, A, L (initialement identifiées dans le gène PAL de persil) (SEQ ID NO 1). Ces trois boîtes sont impliquées dans la réponse aux The promoter was sequenced over 1771 kilobases. Non-specific elements common to the eukaryotic genes involved in the initiation of transcription such as the TATA box and the CAT box have been found in the COMTII promoter (SEQ ID No. 1). Regulatory sites have been demonstrated by comparison of the promoter sequences of the COMTII gene with those of genes involved in the defense mechanisms. The COMTII promoter contains specific elements of the phenylpropanoid metabolism genes involved in the stress response such as the three P, A, L boxes (initially identified in the parsley PAL gene) (SEQ ID NO 1). These three boxes are involved in the response to
<Desc/Clms Page number 13><Desc / Clms Page number 13>
éliciteurs et les boîtes P et L sont également impliquées dans la réponse aux UV. La boîte E initialement identifiée dans le gène de la CCoAOMT de persil et extrêmement conservée dans les gènes du métabolisme des phénylpropanoïdes joue aussi un rôle dans la réponse aux éliciteurs. elicitors and the P and L boxes are also involved in the UV response. The E-box initially identified in the parsley CCoAOMT gene and highly conserved in phenylpropanoid metabolism genes also plays a role in the response to elicitors.
Le promoteur COMTII possède également des éléments jouant un rôle important dans l'induction de gènes PR par les éliciteurs telle la boîte W (SEQ ID NO 1). The COMTII promoter also has elements that play an important role in the induction of PR genes by the elicitors such as the W box (SEQ ID No. 1).
Des éléments régulateurs généraux sont retrouvés dans le promoteur de la COMTII telles les boîtes G, GT et l'élément activateur du virus simiens SV40 (SEQ ID NO 1). La boîte G est un élément présent dans une grande variété de promoteurs végétaux. La boîte G, associée à des éléments cis spécifiques, est impliquée dans la régulation de nombreux gènes répondant à différents signaux physiologiques et environnementaux. La région promotrice, responsable de la régulation de gènes par le méthyle jasmonate, est constituée d'une boîte G associée à des séquences riches en nucléotides C. Une organisation similaire est retrouvée au niveau du promoteur de gènes spécifiquement induits lors de la blessure. Les boîtes L, présentes dans le promoteur de la COMTII, pourraient intervenir dans ce genre d'interactions car ce sont des motifs riches en nucléotides C. General regulatory elements are found in the COMTII promoter such as G, GT and simian virus activator element SV40 (SEQ ID NO: 1). Box G is an element found in a wide variety of plant promoters. The G box, associated with specific cis elements, is involved in the regulation of many genes responding to different physiological and environmental signals. The promoter region, responsible for the regulation of genes by methyl jasmonate, consists of a G box associated with sequences rich in nucleotides C. A similar organization is found at the gene promoter specifically induced during the injury. The L boxes, present in the COMTII promoter, could be involved in this kind of interactions because they are rich in C nucleotides.
Les boîtes GT, représentées plusieurs fois dans les promoteurs, semblent jouer un rôle dans la modulation de l'expression de certains gènes végétaux, soit en tant qu'activateur ou en tant que répresseur. The GT boxes, represented several times in the promoters, seem to play a role in modulating the expression of certain plant genes, either as activator or as repressor.
Exemple 3 : Analyse fonctionnelle des régions promotrices du gène COMTII
L'analyse fonctionnelle du promoteur COMTII a été réalisée par transgénèse en expression stable. Le transgène a été obtenu par fusion transcriptionnelle entre le promoteur et un gène rapporteur, le gène GUS (P-glucuronidase). Quatre constructions correspondant à différentes délétions du promoteur ont été réalisées afin de préciser la nature des séquences promotrices importantes responsables de la régulation du gène. Ces constructions correspondent aux séquences promotrices de-1215 à +24 paires de bases (bp), de-420 à +24 bp, de-313 à +24bp et de-121 à +24 bp (par rapport au site +1 de la transcription), 557 à 1795,1352 à 1795,1459 à 1795 et 1651 à 1795 respectivement sur la SEQ ID NO 1 introduites en amont du gène GUS dans le vecteur pBilOI (Clontech). Example 3 Functional Analysis of the Promoting Regions of the COMTII Gene
Functional analysis of the COMTII promoter was performed by transgenesis in stable expression. The transgene was obtained by transcriptional fusion between the promoter and a reporter gene, the GUS gene (β-glucuronidase). Four constructs corresponding to different deletions of the promoter were made in order to specify the nature of the important promoter sequences responsible for the regulation of the gene. These constructs correspond to promoter sequences from -1215 to +24 base pairs (bp), from-420 to +24 bp, from -313 to +24bp, and from -121 to +24 bp (relative to site +1 of the transcription), 557 to 1795,1352 to 1795,1459 to 1795 and 1651 to 1795 respectively on SEQ ID NO 1 introduced upstream of the GUS gene in the vector pBilOI (Clontech).
<Desc/Clms Page number 14> <Desc / Clms Page number 14>
Les différentes constructions ont été introduites via Agrobacterium tumefaciens dans le génome des plantes. Une population d'une dizaine de plants de tabac transformés a été régénérée pour chaque construction. Le niveau d'expression du transgène a été déterminé par dosage de l'activité enzymatique et par des tests histochimiques. The different constructs were introduced via Agrobacterium tumefaciens into the plant genome. A population of about ten transformed tobacco plants has been regenerated for each construction. The expression level of the transgene was determined by enzyme activity assay and histochemical tests.
Parallèlement l'expression des gènes COMTII a été analysée par mesure de l'activité des enzymes correspondantes. In parallel, the expression of the COMTII genes was analyzed by measuring the activity of the corresponding enzymes.
Résultats :
L'activité GUS a été testée dans ces plantes dans différentes conditions d'induction des réactions de défense, par un éliciteur fongique injecté dans les feuilles (mégaspermine), ou après exposition aux UV. Les résultats obtenus sont rapportés dans les Tableaux 1 et 2 ci-dessous. L'activité GUS est exprimée en pmole MU/min. mg. Results:
The GUS activity was tested in these plants under different conditions of induction of defense reactions, by a fungal elicitor injected into the leaves (megaspermin), or after UV exposure. The results obtained are reported in Tables 1 and 2 below. The GUS activity is expressed in pmol MU / min. mg.
Pour le Tableau 1, le témoin (T) est constitué par l'infiltration d'eau dans les feuilles des plantes transformées. Des plantes contrôles transformées avec un vecteur vide avaient une activité d'environ 10-30 pmoles/min.mg. Pour le Tableau 2, le témoin (T) correspond à l'activité GUS basale dans les plantes non traitées. For Table 1, the control (T) consists of the infiltration of water into the leaves of the transformed plants. Control plants transformed with an empty vector had an activity of about 10-30 pmol / min.mg. For Table 2, control (T) corresponds to basal GUS activity in untreated plants.
Tableau 1 - Expression de l'activité GUS correspondant aux différentes constructions COMT II/GUS : induction par la mégaspermine
Table 1 - Expression of the GUS activity corresponding to the different COMT II / GUS constructs: induction by megaspermine
<tb>
<tb> Activité <SEP> GUS
<tb> Construction <SEP> COMT <SEP> II/GUS <SEP> T <SEP> Mégaspermine
<tb> COMT <SEP> Il <SEP> -1215 <SEP> à <SEP> +24 <SEP> 150 <SEP> 1150 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> à <SEP> +24 <SEP> 2 <SEP> 6 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> à <SEP> +24 <SEP> 0,4 <SEP> 0,8
<tb> COMT <SEP> II <SEP> -121 <SEP> à <SEP> +24 <SEP> 0,2 <SEP> 0,8
<tb>
Tableau 2 - Expression de l'activité GUS correspondant aux différentes constructions COMT II/GUS : induction aux UV
<Tb>
<tb> Activity <SEP> GUS
<tb> Construction <SEP> COMT <SEP> II / GUS <SEP> T <SEP> Megaspermine
<tb> COMT <SEP> It <SEP> -1215 <SEP> to <SEP> +24 <SEP> 150 <SEP> 1150 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> to <SEP> +24 <SEP> 2 <SEP> 6 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> to <SEP> +24 <SEP> 0.4 <SEP> 0.8
<tb> COMT <SEP> II <SEP> -121 <SEP> to <SEP> +24 <SEP> 0.2 <SEP> 0.8
<Tb>
Table 2 - Expression of the GUS activity corresponding to the different COMT II / GUS constructs: UV induction
<tb>
<tb> Activité <SEP> GUS
<tb> Construction <SEP> COMT <SEP> II/GUS <SEP> T <SEP> UV <SEP>
<tb> COMT <SEP> II <SEP> -1215 <SEP> à <SEP> +24 <SEP> 90 <SEP> 900 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> à <SEP> +24 <SEP> 10 <SEP> 12 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> à <SEP> +24 <SEP> 10 <SEP> 11 <SEP>
<tb> COMT <SEP> II <SEP> -121 <SEP> à <SEP> +24 <SEP> Il <SEP> 10 <SEP>
<tb> <Tb>
<tb> Activity <SEP> GUS
<tb> Building <SEP> COMT <SEP> II / GUS <SEP> T <SEP> UV <SEP>
<tb> COMT <SEP> II <SEP> -1215 <SEP> to <SEP> +24 <SEP> 90 <SEP> 900 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> to <SEP> +24 <SEP> 10 <SEP> 12 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> to <SEP> +24 <SEP> 10 <SEP> 11 <SEP>
<tb> COMT <SEP> II <SEP> -121 <SEP> to <SEP> +24 <SEP> It <SEP> 10 <SEP>
<Tb>
<Desc/Clms Page number 15> <Desc / Clms Page number 15>
Ces résultats montrent que la taille du promoteur doit être supérieure à 600pb, en l'occurrence 1239 bp pour permettre l'induction et une forte expression du gène GUS. Les délétions du promoteurs correspondant aux constructions (-420 à +24), de (-313 à +24) et de (-121 à +24) provoquent une perte complète de l'expression du gène GUS dans toutes les conditions testées. L'activité du gène GUS sous le contrôle du promoteur de 1239 pb est 1000 fois supérieure à celle observée pour les autres constructions. These results show that the size of the promoter must be greater than 600 bp, in this case 1239 bp to allow induction and strong expression of the GUS gene. The deletions of the promoters corresponding to the constructs (-420 to +24), (-313 to +24) and (-121 to +24) cause a complete loss of the expression of the GUS gene under all the conditions tested. The activity of the GUS gene under the control of the 1239 bp promoter is 1000 times greater than that observed for the other constructs.
Les construits suivants pour différentes tailles de promoteurs supérieures à 600 bp ont été préparés et transférés dans les tabacs pour analyse : {liste des construits}
Activation du promoteur de la COMTII par la blessure et le méthyle jasmonate et par des éliciteurs d'origine et de nature variées. The following constructs for different sizes of promoters greater than 600 bp were prepared and transferred to tobacco for analysis: {list of constructs}
Activation of the COMTII promoter by injury and methyl jasmonate and by elicitors of various origin and nature.
Les plantes transgéniques possédant la construction COMTII(- 1215 à +24)/GUS ont été traitées avec différents produits chimiques, régulateurs des réactions de défense, par l'acide salicylique (SA) et le méthyl-2-6-dichloroisonicotinique (INA), par des éliciteurs fongiques comme des glucanes ou des fragments de chitine et un éliciteur d'origine végétale comme la pectine. L'activité GUS a été mesurée dans les feuilles 16h après infiltration de ces composés et les résultats rapportés dans le Tableau 3 ci-dessous. L'activité GUS est exprimée en pmole MU/min.mg. Le témoin (T) correspond à l'activité GUS basale dans les plantes transformées non traitées. Transgenic plants with the construction COMTII (- 1215 to +24) / GUS were treated with different chemicals, regulators of defense reactions, by salicylic acid (SA) and methyl-2-6-dichloroisonicotinic (INA) by fungal elicitors such as glucans or fragments of chitin and an elicitor of plant origin such as pectin. GUS activity was measured in leaves 16h after infiltration of these compounds and the results reported in Table 3 below. The GUS activity is expressed in pmol MU / min.mg. The control (T) corresponds to the basal GUS activity in the untreated transformed plants.
Tableau 3 - Induction de l'activité GUS par des éliciteurs
Table 3 - Induction of GUS activity by elicitors
<tb>
<tb> Activité <SEP> GUS <SEP> Induction <SEP> %
<tb> T <SEP> 600 <SEP> 100 <SEP>
<tb> H20 <SEP> 1200 <SEP> 200
<tb> SA <SEP> (lmM) <SEP> 1200 <SEP> 200
<tb> INA <SEP> (lmM) <SEP> 1700 <SEP> 200
<tb> Chitines <SEP> (100 g/ml) <SEP> 1200 <SEP> 200
<tb> Glucanes <SEP> (200 g/ml) <SEP> 1400 <SEP> 200
<tb> Pectines <SEP> (200 g/ml) <SEP> 3700 <SEP> 600
<tb> <Tb>
<tb> Activity <SEP> GUS <SEP> Induction <SEP>%
<tb> T <SEP> 600 <SEP> 100 <SEP>
<tb> H20 <SEP> 1200 <SEP> 200
<tb> SA <SEP> (lmM) <SEP> 1200 <SEP> 200
<tb> INA <SEP> (lmM) <SEP> 1700 <SEP> 200
<tb> Chitin <SEP> (100 g / ml) <SEP> 1200 <SEP> 200
<tb> Glucans <SEP> (200 g / ml) <SEP> 1400 <SEP> 200
<tb> Pectins <SEP> (200 g / ml) <SEP> 3700 <SEP> 600
<Tb>
L'augmentation la plus forte de l'activité GUS (de l'ordre de 3) est obtenue dans les plantes infiltrées par des fragments pectiques par rapport au contrôle. The highest increase in GUS activity (of the order of 3) is obtained in plants infiltrated by pectic fragments compared to the control.
<Desc/Clms Page number 16> <Desc / Clms Page number 16>
L'induction du promoteur de 1239 pb a été étudiée lors de la blessure ou après traitement par le méthyle jasmonate (molécule jouant un rôle dans la signalisation des réponses de défense lors de la blessure) et par le benzothiadiazole (BTH) (inducteur chimique de la SAR). L'activité GUS est mesuré 16h après traitement. Les résultats sont rapportés sur le Tableau 4 ci-dessous. Induction of the 1239-bp promoter was studied during injury or after treatment with methyl jasmonate (a molecule involved in the signaling of defense responses during injury) and benzothiadiazole (BTH) (chemical inducer of the SAR). The GUS activity is measured 16 hours after treatment. The results are reported in Table 4 below.
Tableau 4 - Induction de l'activité GUS par différents composés et stress
Table 4 - Induction of GUS activity by different compounds and stress
<tb>
<tb> Induction <SEP> de <SEP> l'activité <SEP> GUS <SEP> %
<tb> T <SEP> 100 <SEP>
<tb> BTH <SEP> 250
<tb> Blessure <SEP> 600 <SEP>
<tb> Méthyle <SEP> jasmonate <SEP> 1450
<tb> UV <SEP> 1000 <SEP>
<tb> <Tb>
<tb> Induction <SEP> of <SEP> activity <SEP> GUS <SEP>%
<tb> T <SEP> 100 <SEP>
<tb> BTH <SEP> 250
<tb> Injury <SEP> 600 <SEP>
<tb> Methyl <SEP> jasmonate <SEP> 1450
<tb> UV <SEP> 1000 <SEP>
<Tb>
Le témoin (T) correspond à l'activité GUS des plantes non traitées. Le promoteur est activé par les différents traitements. The control (T) corresponds to the GUS activity of the untreated plants. The promoter is activated by the different treatments.
Les facteurs d'induction varient de 2,5 (BTH) à 14,5 (méthyle jasmonate). Induction factors range from 2.5 (BTH) to 14.5 (methyl jasmonate).
Activation du promoteur de la COMTII lors de l'infection virale. Activation of the COMTII promoter during viral infection.
L'inoculation du VMT chez le tabac nécessite la production de micro blessures au niveau des feuilles permettant l'entrée du virus et sa multiplication. L'activité GUS et l'activité COMTII ont été mesurées dans les feuilles blessées et dans les feuilles inoculées par le virus. Les résultats (figure 1) montrent que le gène GUS sous le contrôle du promoteur COMTII a une cinétique d'induction identique à celle du gène COMTII endogène, suivie par la mesure de l'activité catalytique des protéines correspondantes. Le promoteur COMTII est induit précocement par la blessure et présente un maximum d'activité à 16h. Le même pic d'activité est observé à 16h au cours de l'infection virale et est dû à la blessure des feuilles provoquée par l'inoculation du virus. Dans les feuilles inoculées, l'activité GUS est fortement stimulée à partir du 3ème jour et progresse jusqu'au 7ème jour. L'induction locale et systémique du promoteur lors de l'infection virale a été mesurée à 3 et 7 jours après l'inoculation du VMT. Les activités GUS exprimées en pmol MU/min. mg, sont rapportées dans le Tableau 5 et représentent une moyenne des valeurs obtenues dans 9 transformants. Le témoin T correspond à l'activité GUS des plantes non traitées. The inoculation of TMV in tobacco requires the production of micro leaf wounds allowing the entry of the virus and its multiplication. GUS activity and COMTII activity were measured in the injured leaves and in the leaves inoculated by the virus. The results (FIG. 1) show that the GUS gene under the control of the COMTII promoter has induction kinetics identical to that of the endogenous COMTII gene, followed by the measurement of the catalytic activity of the corresponding proteins. The COMTII promoter is induced early by the wound and has a maximum of activity at 16h. The same peak of activity is observed at 16h during viral infection and is due to leaf injury caused by virus inoculation. In the inoculated leaves, the GUS activity is strongly stimulated from the 3rd day and progresses until the 7th day. Local and systemic induction of the promoter during viral infection was measured at 3 and 7 days after inoculation of TMV. GUS activities expressed in pmol MU / min. mg, are reported in Table 5 and represent an average of the values obtained in 9 transformants. The control T corresponds to the GUS activity of the untreated plants.
<Desc/Clms Page number 17> <Desc / Clms Page number 17>
Tableau 5 - Induction locale et systémique (SAR) de l'activité GUS
Table 5 - Local and Systemic Induction (SAR) of GUS Activity
<tb>
<tb> Activité <SEP> GUS
<tb> T <SEP> 700 <SEP>
<tb> Feuilles <SEP> inoculées <SEP> après <SEP> 3 <SEP> jours <SEP> 3800
<tb> Feuilles <SEP> inoculées <SEP> après <SEP> 7 <SEP> jours <SEP> 7100
<tb> Feuilles <SEP> SAR <SEP> après <SEP> 7 <SEP> jours <SEP> 2700 <SEP>
<tb> <Tb>
<tb> Activity <SEP> GUS
<tb> T <SEP> 700 <SEP>
<tb><SEP> leaves inoculated <SEP> after <SEP> 3 <SEP> days <SEP> 3800
<tb><SEP> leaves inoculated <SEP> after <SEP> 7 <SEP> days <SEP> 7100
<tb> Leaves <SEP> SAR <SEP> after <SEP> 7 <SEP> days <SEP> 2700 <SEP>
<Tb>
Ces résultats montrent une induction de 1100% du promoteur à 7 jours dans les feuilles inoculées. L'activité GUS mesurée à 7 jours dans les feuilles SAR est plus faible mais très significative. Cependant, dans les feuilles non inoculées les facteurs d'induction calculés à partir des activités GUS sont plus fortes que celles obtenues à partir des activités COMTII (Tableau 6). Ceci est dû, d'une part au fait que le test d'activité GUS est plus sensible que celui de la COMTII et, d'autre part au fait que la protéine GUS est extrêmement stable et que l'activité GUS mesurée correspond à une accumulation de cette protéine après le traitement. La comparaison des activités GUS et COMTII est rapportée dans le Tableau 6 ci-dessous. Les feuilles non inoculées où se développe la résistance systémique acquise sont appelées " feuilles SAR ". These results show an induction of 1100% of the promoter at 7 days in the inoculated leaves. The GUS activity measured at 7 days in the SAR sheets is lower but very significant. However, in the uninoculated leaves the induction factors calculated from the GUS activities are higher than those obtained from the COMTII activities (Table 6). This is due, on the one hand, to the fact that the GUS activity test is more sensitive than that of COMTII and, on the other hand, to the fact that the GUS protein is extremely stable and that the measured GUS activity corresponds to a accumulation of this protein after treatment. The comparison of GUS and COMTII activities is reported in Table 6 below. Uninoculated leaves where systemic acquired resistance develops are called "SAR leaves".
Tableau 6-Facteurs d'induction des activités GUS et COMTII 3 et 7 jours après inoculation par le VMT dans les feuilles infectées et les feuilles SAR
Table 6-Induction Factors for GUS and COMTII Activities 3 and 7 Days After VMT Inoculation in Infected Leaves and SAR Sheets
<tb>
<tb> Induction <SEP> des <SEP> activités <SEP> GUS <SEP> Induction <SEP> des <SEP> activités <SEP> COMTII
<tb> Feuilles <SEP> Inoculées <SEP> Feuilles <SEP> SAR <SEP> Feuilles <SEP> Inoculées <SEP> Feuilles <SEP> SAR
<tb> 3 <SEP> jours <SEP> 5,8 <SEP> - <SEP> 5,8 <SEP> -
<tb> 7 <SEP> jours <SEP> 11 <SEP> 3,9 <SEP> 15 <SEP> 1,8
<tb> <Tb>
<tb> Induction <SEP> of <SEP> activities <SEP> GUS <SEP> Induction <SEP> of <SEP> activities <SEP> COMTII
<tb> Leaves <SEP> Inoculated <SEP> Leaves <SEP> SAR <SEP> Leaves <SEP> Inoculated <SEP> Leaves <SEP> SAR
<tb> 3 <SEP> days <SEP> 5.8 <SEP> - <SEP> 5.8 <SEP> -
<tb> 7 <SEP> days <SEP> 11 <SEP> 3.9 <SEP> 15 <SEP> 1.8
<Tb>
Analyse histochimique de l'activité GUS lors d'une infection virale et après blessure. Histochemical analysis of GUS activity during viral infection and after injury.
Une analyse histochimique de l'activité GUS dans des feuilles inoculées par le VMT, 7 jours après virose, montre que l'expression du gène GUS est localisée dans les cellules entourant le site d'infection. Des coupes transversales des feuilles au niveau des lésions ont été réalisées afin de déterminer les types cellulaires impliqués et, montrent que l'induction du gène GUS n'est pas tissu spécifique mais concerne toutes les cellules Histochemical analysis of GUS activity in VMT-inoculated leaves 7 days post-viral shows that GUS gene expression is localized in the cells surrounding the site of infection. Cross sections of the leaves at the lesions were made to determine the cell types involved and show that the induction of the GUS gene is not specific tissue but affects all cells
<Desc/Clms Page number 18><Desc / Clms Page number 18>
autour des lésions. around the lesions.
L'analyse histochimique de l'expression du gène GUS dans des feuilles blessées, 2 jours après traitement, montre, une induction du gène GUS dans les tissus non blessés entourant les sites de blessure par piqûres ou à l'aide de forceps. Ces résultats impliquent qu'un signal est émis à partir des tissus blessés vers les tissus intacts induisant une expression systémique du gène GUS. Le méthyle jasmonate synthétisé dans les tissus blessés pourrait induire à distance le gène GUS, car une application exogène de méthyle jasmonate induit une activité GUS. Le test histochimique réalisé sur des feuilles issues de plantes transgéniques 35S/GUS est le contrôle positif de l'expérience. Des coupes transversales de feuilles blessées montrent également que tous les types cellulaires sont induits par la blessure. Histochemical analysis of GUS gene expression in wounded leaves, 2 days after treatment, shows induction of the GUS gene into uninjured tissues surrounding sites of puncture injury or forceps. These results imply that a signal is emitted from the injured tissues to the intact tissues inducing systemic expression of the GUS gene. Methyl jasmonate synthesized in injured tissues could remotely induce the GUS gene, since an exogenous application of methyl jasmonate induces GUS activity. The histochemical test performed on leaves from 35S / GUS transgenic plants is the positive control of the experiment. Cross sections of injured leaves also show that all cell types are induced by the injury.
Exemple 4 : Activité anti-infectieuse de COMTII/mégaspermine dans le tabac
4. 1. Clonage d'un ADNc codant pour la ss mégaspermine. Example 4: Anti-infectious activity of COMTII / megaspermine in tobacco
4. 1. Cloning of a cDNA coding for ss megaspermine.
Le clonage de gènes d'élicitine tels que ceux de la parasiticéine et de la cryptogéine ont montré que ces gènes codaient pour une préprotéine (Kamoun et al., 1993 ; Panabières et al., 1995). La séquence codante de ces élicitines comprend un peptide signal de 20 acides aminés, permettant leur excrétion dans le milieu extracellulaire suivi d'une séquence de 98 acides aminés correspondant à la protéine mature. Cloning of elicitin genes such as those of parasiticin and cryptogein have shown that these genes code for a preprotein (Kamoun et al., 1993; Panabieres et al., 1995). The coding sequence of these elicitins comprises a signal peptide of 20 amino acids, allowing their excretion in the extracellular medium followed by a sequence of 98 amino acids corresponding to the mature protein.
La séquence protéique de la P mégaspermine, préalablement déterminée (Kauffmann S., résultats non publiés), montre une forte homologie avec celle de la cryptogéine (Kamoun et al., 1993). Nous avons émis l'hypothèse que les séquences nucléotidiques des gènes correspondants pouvaient être très proches. Des amorces dérivées de la séquence nucléotidique du gène de la cryptogéine ont été synthétisées afin d'isoler par PCR un ADNc codant pour la ss mégaspermine. Ces amorces se placent au niveau de la séquence codant pour le peptide signal et contiennent le codon d'initiation de la traduction. Des réactions d'amplification ont été effectuées sur les reverse transcrits de Phytophthora megasperma en utilisant une amorce sens dérivée de la séquence nucléotidique de la cryptogéine et l'oligodT comme amorce antisens. Un fragment amplifié d'environ 450 nucléotides a été obtenu. Ce fragment a été cloné dans un vecteur bactérien afin d'être séquence. The protein sequence of P megaspermine, previously determined (Kauffmann S., unpublished results), shows strong homology with that of cryptogein (Kamoun et al., 1993). We hypothesized that the nucleotide sequences of the corresponding genes could be very close. Primers derived from the nucleotide sequence of the cryptogein gene were synthesized to isolate by PCR a cDNA encoding ss megaspermine. These primers are placed at the level of the coding sequence for the signal peptide and contain the translation initiation codon. Amplification reactions were performed on reverse transcripts of Phytophthora megasperma using a sense primer derived from the nucleotide sequence of cryptogein and oligodT as antisense primer. An amplified fragment of about 450 nucleotides was obtained. This fragment was cloned into a bacterial vector in order to be sequenced.
L'analyse des séquences a révélé que le clone ainsi obtenu code pour une Sequence analysis revealed that the clone thus obtained encodes a
<Desc/Clms Page number 19><Desc / Clms Page number 19>
préprotéine comprenant une séquence signal de 20 acides aminés et une séquence de 98 acides aminés correspondant à la ss mégaspermine (SEQ ID NO 12). La séquence nucléotidique correspondant au peptide signal présente par ailleurs 100% d'identité avec celle de la cryptogéine. preprotein comprising a signal sequence of 20 amino acids and a sequence of 98 amino acids corresponding to ss megaspermine (SEQ ID NO 12). The nucleotide sequence corresponding to the signal peptide also has 100% identity with that of cryptogein.
L'ADNc natif de la ss mégaspermine a été fusionné d'une part au promoteur COMT II et d'autre part au promoteur 35S. Le promoteur COMT II de 1239 pb a été utilisé car il possède tous les éléments régulateurs nécessaires à son induction. The native cDNA of ss megaspermine was fused on the one hand to the COMT II promoter and on the other hand to the 35S promoter. The 1239bp COMT II promoter was used because it has all the regulatory elements necessary for its induction.
4.2. Obtention des tabacs transgéniques
Des plants de tabac Nicotiana tabacum Samsun NN ont été transformés avec les deux constructions via Agrobacterium tumefaciens. Six transformants primaires pour chaque construction ont été régénérés et autofécondés. Les plantes issues de la seconde génération présentent un phénotype normal excepté certains individus possédant le gène de la P mégaspermine sous le contrôle du promoteur 35S. Ces plantes présentent un délai de croissance et ont également un système racinaire peu développé. Cependant aucune nécrose tissulaire rappelant celle développée par l'infiltration foliaire et pouvant être liée à l'expression de l'élicitine n'est observée dans les plantes transgéniques. 4.2. Obtaining transgenic tobacco
Tobacco plants Nicotiana tabacum Samsun NN were transformed with both constructs via Agrobacterium tumefaciens. Six primary transformants for each construct were regenerated and self-fertilized. Plants from the second generation have a normal phenotype except for some individuals with the megaspermin P gene under the control of the 35S promoter. These plants have a growth period and also have a poorly developed root system. However, no tissue necrosis reminiscent of that developed by foliar infiltration and possibly linked to the expression of elicitin is observed in transgenic plants.
4. 3. Analyse de l'expression de la P mégaspermine dans les tabacs transgéniques. 4. 3. Analysis of P megaspermin expression in transgenic tobacco.
L'expression de la p mégaspermine a été analysée dans les feuilles des plantes transgéniques possédant l'ADNc de l'élicitine sous le contrôle du promoteur 35S par Western-Blot (figure 2A) et par Northern-Blot (figure 2B). De façon surprenante, la (3 mégaspermine est indétectable dans tous les transformants analysés (figure 2A). Le niveau de transcription de l'élicitine a donc été examinée dans ces plantes par NorthernBlot (figure 2B). Les transcrits ont pu être détectés et le niveau d'expression varie d'un transformant à l'autre. Il apparaît que dans 2 types de plantes (E et F) la taille des transcrits est plus petite que la taille du messager complet. Dans ce cas, l'absence de protéine pourrait être expliquée par le fait que l'ADNc est tronqué. Pour les plantes A, B, C, D la taille des transcrits correspond à celle de l'élicitine exprimée par le champignon et le taux de transcrits n'est pas négligeable, sauf pour la plante B montrant une très faible proportion de transcrits. Les plantes A qui possèdent les niveaux de transcrits les plus élevés montrent également un retard de croissance. Par la suite, seuls les transformants présentant les transcrits complets de P mégaspermine ont été testés Expression of p megaspermine was analyzed in the leaves of transgenic plants possessing the elicitin cDNA under the control of the 35S promoter by Western-Blot (Figure 2A) and by Northern-Blot (Figure 2B). Surprisingly, (3 megaspermin is undetectable in all the transformants analyzed (Figure 2A) .The level of transcription of elicitin was therefore examined in these plants by NorthernBlot (Figure 2B), the transcripts could be detected and the level of expression varies from one transformant to another.It appears that in 2 types of plants (E and F) the size of the transcripts is smaller than the size of the complete messenger.In this case, the absence of protein could be explained by the fact that the cDNA is truncated For plants A, B, C, D the size of the transcripts corresponds to that of the elicitin expressed by the fungus and the transcript rate is not negligible, except for plant B showing a very low proportion of transcripts, plants A which have the highest transcript levels also show growth retardation, after which only transformants presenting complete transcripts of P megaspermin e have been tested
<Desc/Clms Page number 20><Desc / Clms Page number 20>
pour leur résistance. for their resistance.
De la même manière, l'expression de la (5 mégaspermine sous contrôle du promoteur COMT II a été analysée par Western-Blot dans les feuilles des tabacs transgéniques (figure 3). L'expression a été étudiée dans les plantes saines non traitées pour déterminer le niveau de base d'expression de l'élicitine et après blessure pour analyser le niveau d'induction obtenu. Dans les tissus non traités, le niveau de la P mégaspermine est indétectable. Par contre, l'élicitine est détectée en très faible quantité dans les tissus blessés. Ceci est dû à l'activation du promoteur COMT II par la blessure. Similarly, the expression of megaspermine under the control of the COMT II promoter was analyzed by Western Blot in the leaves of transgenic tobacco (Figure 3) .The expression was studied in healthy plants not treated for determine the level of expression base of elicitin and after injury to analyze the level of induction obtained.In untreated tissues, the level of P megaspermine is undetectable.In contrast, elicitin is detected in very low This is due to the activation of the COMT II promoter by the injury.
L'accumulation de la COMT II a été également examinée dans les mêmes plantes transgéniques en utilisant des anticorps anti-COMT II. De façon surprenante la COMT II est détectée à un niveau non négligeable dans les tissus non traités, alors que normalement seule une très faible activité COMT II est détectée dans les plantes saines non transformées ou transformées avec le gène chimérique COMT II::GUS (Collendavelloo et al., 1981 ; et al., 1993). La COMT II est également produite en quantité plus grande dans les tissus blessés par comparaison aux plantes contrôles blessées de la même façon. The accumulation of COMT II was also examined in the same transgenic plants using anti-COMT II antibodies. Surprisingly, COMT II is detected at a non-negligible level in untreated tissues, whereas normally only very low COMT II activity is detected in healthy plants not transformed or transformed with the chimeric COMT II :: GUS gene (Collendavelloo et al., 1981, et al., 1993). COMT II is also produced in larger quantities in injured tissues compared to control plants injured in the same way.
Le promoteur COMT II permet une expression induite de l'élicitine dans les tabacs transgéniques. Ceci a été vérifié pour les 6 transformants. Cependant la quantité d'élicitine détectée dans les plantes après induction est très faible. La présence de COMT II dans les plantes non traitées laisse supposer qu'une très faible quantité d'élicitine (non détectée par la méthode utilisée) est produite dans la plante saine et que cette synthèse est suffisante pour induire le gène COMT II endogène. De plus, il semblerait qu'une expression induite de l'élicitine lors de la blessure permette également une plus forte induction du gène COMT II endogène. The COMT II promoter allows an induced expression of elicitin in transgenic tobacco. This was verified for the 6 transformants. However, the amount of elicitin detected in plants after induction is very low. The presence of COMT II in untreated plants suggests that a very small amount of elicitin (not detected by the method used) is produced in the healthy plant and that this synthesis is sufficient to induce the endogenous COMT II gene. In addition, it would appear that an induced expression of elicitin during injury also allows for greater induction of the endogenous COMT II gene.
Par ailleurs, l'analyse de la p mégaspermine sur gel dénaturant montre une migration électrophorétique inférieure à celle de la P mégaspermine mature purifiée (figure 3). Cette différence de migration a été évaluée à 3 kD ce qui correspond à la taille du peptide signal. Ce résultat semble indiquer que le peptide signal n'a pas été clivé. Cependant il est possible que la protéine mature soit produite en plus petite quantité par les cellules végétales et que cette quantité se situe en dessous du seuil de détection sur ce Western-Blot. Moreover, the analysis of the megaspermine on denaturing gel shows a lower electrophoretic migration than that of the purified mature megaspermine (FIG. 3). This difference in migration was evaluated at 3 kD, which corresponds to the size of the signal peptide. This result suggests that the signal peptide has not been cleaved. However it is possible that the mature protein is produced in smaller amounts by the plant cells and that this amount is below the detection limit on this Western-Blot.
L'étude de l'expression de la (3 mégaspermine dans des tabacs transgéniques The study of the expression of (3 megaspermine in transgenic tobacco
<Desc/Clms Page number 21><Desc / Clms Page number 21>
semble indiquer qu'une expression constitutive d'élicitine ne soit pas tolérée par les plantes et par conséquent ne permette pas son accumulation dans les cellules végétales. Seule une expression induite permet une synthèse de la p mégaspermine à un niveau détectable. Ces résultats pourraient être liés au caractère toxique de la protéine. seems to indicate that a constitutive expression of elicitin is not tolerated by plants and therefore does not allow its accumulation in plant cells. Only an induced expression allows synthesis of megaspermine at a detectable level. These results could be related to the toxicity of the protein.
4. 4. Analyse du niveau de résistance des plantes transgéniques vis à vis de différents agents pathogènes. 4. 4. Analysis of the level of resistance of transgenic plants to different pathogens.
Résistance antivirale. a) Résistance vis à vis du Virus de la Mosaïque du Tabac (VMT). Antiviral resistance. a) Resistance to the Tobacco Mosaic Virus (VMT).
Les tabacs transformés possèdent le gène de résistance N et réagissent donc par une HR lors de l'inoculation par le VMT. Dans ces expériences la résistance au virus est quantifiée par la mesure de la taille des lésions 7 jours après infection, lorsqu'elles ont atteint leur taille presque définitive. Plus la résistance développée par la plante est grande, plus les tailles des lésions sont petites, illustrant ainsi un confinement plus important du pathogène au site d'infection. Le promoteur du gène COMT II étant fortement induit autour des lésions lors de la HR au VMT, il devrait permettre une forte expression de la P mégaspermine au site d'infection. Pour le vérifier, les plantes transgéniques a, b,c,d,e et f exprimant l'élicitine sous le contrôle du promoteur COMT II et les transformants A, B, C, D possédant l'ADNc de la p mégaspermine sous le contrôle du promoteur 35S ont été inoculés par le VMT. Les plantes témoins sont des plantes transgéniques pour le gène chimérique "promoteur COMT II::GUS". The transformed tobaccos possess the resistance gene N and therefore react with an HR during the inoculation by the VMT. In these experiments, resistance to the virus is quantified by measuring the size of the lesions 7 days after infection, when they have reached their almost definitive size. The greater the resistance developed by the plant, the smaller the lesion sizes, thus illustrating greater containment of the pathogen at the site of infection. As the promoter of the COMT II gene is strongly induced around the lesions during VMT HR, it should allow a strong expression of megaspermine P at the site of infection. To verify this, transgenic plants a, b, c, d, e and f expressing elicitin under the control of the COMT II promoter and transformants A, B, C, D possessing the p megaspermin cDNA under control. 35S promoter were inoculated with TMV. The control plants are transgenic plants for the chimeric gene "COMT II promoter :: GUS".
Sept jours après virose, les lésions développées sur les plantes exprimant la p mégaspermine sous le contrôle du promoteur 35S ne semblent pas différentes de celles des plantes témoins. Par contre des lésions plus petites sont observées sur les plantes transgéniques exprimant la ss mégaspermine sous le contrôle du promoteur COMT II par rapport à celles obtenues sur les plantes témoins. Seven days after virosis, lesions developed on p megaspermin-expressing plants under the control of the 35S promoter do not appear to be different from those of control plants. On the other hand, smaller lesions are observed on the transgenic plants expressing ss megaspermine under the control of the COMT II promoter compared to those obtained on the control plants.
Une analyse statistique de la taille des lésions a été effectuée en mesurant le diamètre de 100 à 150 lésions chez les plantes témoins et chez les plantes transgéniques pour la ss mégaspermine. La figure 4 représente la distribution de la taille des lésions mesurées sur les plantes témoins et pour une lignée exprimant l'élicitine sous le contrôle du promoteur 35S (plantes A) et une lignée exprimant l'élicitine sous le contrôle du promoteur COMT II (plantes b). Cette distribution suit une courbe de Gauss ce qui autorise l'analyse statistique des résultats. Les plantes témoins présentent une taille de Statistical analysis of lesion size was performed by measuring the diameter of 100-150 lesions in control and transgenic plants for ss measpaspermine. Figure 4 shows the size distribution of the lesions measured on the control plants and for a line expressing elicitin under the control of the 35S promoter (plants A) and a line expressing elicitin under the control of the COMT II promoter (plants b). This distribution follows a Gaussian curve which allows the statistical analysis of the results. The control plants have a size of
<Desc/Clms Page number 22><Desc / Clms Page number 22>
lésions dont la moyenne est de 3,30,5 mm. La moyenne de la taille des lésions obtenue pour les plantes A n'est pas significativement différente de celle des témoins (3,1 0,6 mm) par contre celle obtenue pour les plantes b est fortement inférieure au témoins (1,4~0,6 mm). Les résultats obtenus pour chaque lignée indépendante sont regroupés sur la figure 5 et montrent que tous les transformants (plantes A, B, C et D) possédant l'ADNc de la P mégaspermine sous le contrôle du promoteur 35S présentent une taille de lésions ne différant pas de celle des témoins. En revanche, toutes les plantes exprimant l'élicitine sous le contrôle du promoteur COMT II présentent une taille moyenne de lésions significativement inférieure à celle des plantes témoins. Cette diminution est plus ou moins importante selon les transformants. Une forte réduction, d'environ 60%, de la taille des lésions est obtenue pour les transformants COMT II::meg a, b, et f et la plus faible observée est de 36% et correspond au transformant COMT II::meg e. lesions averaging 3.30.5 mm. The mean size of the lesions obtained for the plants A is not significantly different from that of the controls (3.1 0.6 mm) whereas that obtained for the plants b is significantly lower than the controls (1.4 ~ 0 , 6 mm). The results obtained for each independent line are grouped together in FIG. 5 and show that all the transformants (plants A, B, C and D) possessing the megaspermin P cDNA under the control of the 35S promoter have a lesion size that does not differ. not that of the witnesses. In contrast, all plants expressing elicitin under the control of the COMT II promoter have an average lesion size significantly less than that of control plants. This decrease is more or less important depending on the transformants. A strong reduction of lesion size by about 60% is obtained for the COMT II :: meg transformants a, b, and f and the lowest observed is 36% and corresponds to the COMT II :: meg e transformant. .
L'ensemble des résultats obtenus montrent que les plantes exprimant la b mégaspermine sous le contrôle du promoteur 35S présentent un niveau de résistance antiviral équivalent à celui des plantes témoins. Par contre, une résistance accrue au VMT est obtenue pour les tabacs transgéniques exprimant 1a ss mégaspermine sous le contrôle du promoteur COMT II. Cependant tous les lignées transgéniques ne présentent pas le même niveau de résistance. Ceci pourrait être lié à des niveaux d'expression différents de 1a ss mégaspermine dans ces différentes plantes transgéniques. b) Résistance au Virus de la Mosaïque de la Luzerne (VML). All the results obtained show that the plants expressing the megaspermine under the control of the 35S promoter have a level of antiviral resistance equivalent to that of the control plants. In contrast, increased resistance to TMV is obtained for transgenic tobaccos expressing megaspermine ss under the control of the COMT II promoter. However not all transgenic lines have the same level of resistance. This could be related to different levels of expression of megaspermine ss in these different transgenic plants. b) Resistance to the Lucerne Mosaic Virus (MLV).
Nous avons testé la résistance des tabacs transgéniques COMT II::mégaspermine vis à vis d'un autre virus, le VML, qui infecte le tabac de façon systémique. Une dizaine de jours après virose, le VML s'est propagé dans toute la plante et produit au niveau des feuilles non inoculées des symptômes de mosaïque. We tested the resistance of transgenic tobacco COMT II :: megaspermine to another virus, VML, which systemically infects tobacco. About ten days after virosis, VML spread throughout the plant and produced mosaic symptoms in uninoculated leaves.
Les plantes exprimant la (3 mégaspermine sous le contrôle du promoteur COMT II choisies pour ce test correspondent à la lignée b qui présente un niveau de résistance élevé au VMT. Les plantes A possédant l'ADNc de la P mégaspermine sous le contrôle du promoteur 35S ont été également inoculées ainsi que des plantes témoins COMT II::GUS. Pour chaque lignée transgénique, 5 plantes ont été inoculées. Nous avons examiné le phénotype des différentes plantes quinze jours après traitement. A ce stade les symptômes de mosaïque sont bien développés sur les plantes COMT II::GUS. Les Plants expressing the megaspermin under the control of the COMT II promoter selected for this test correspond to line b which has a high level of resistance to TMV Plants A possessing megaspermin P cDNA under the control of the 35S promoter were inoculated as well as control plants COMT II :: GUS For each transgenic line, 5 plants were inoculated We examined the phenotype of the different plants fifteen days after treatment At this stage the mosaic symptoms are well developed on plants COMT II :: GUS.
<Desc/Clms Page number 23><Desc / Clms Page number 23>
plantes transgéniques A montrent une mosaïque similaire aux plantes témoins. Par contre, une réduction de ces symptômes est observée dans les plantes transgéniques b. Transgenic A plants show a mosaic similar to the control plants. On the other hand, a reduction of these symptoms is observed in transgenic plants b.
La charge virale a été examinée dans les feuilles systémiques de même niveau (3 ème feuille au dessus de la feuille inoculée). Cette analyse a été effectuée par WesternBlot en utilisant des anticorps dirigés contre la coque protéique du virus (figure 6). La quantité de virus présente dans les différentes plantes transgéniques est évaluée par rapport à la quantité de virus présente dans les plantes témoins. Les résultats obtenus montrent que les plantes exprimant la ss mégaspermine sous le contrôle du promoteur 35S ont de 10 à 15 fois moins de virus que les plantes témoins. Cette réduction de la quantité de virus peut paraître importante. II faut savoir cependant que les quantités de virus produites dans les plantes sauvages peuvent varier dans les mêmes proportions. The viral load was examined in systemic leaves of the same level (3rd leaf above the inoculated leaf). This assay was performed by WesternBlot using antibodies directed against the protein hull of the virus (Figure 6). The amount of virus present in the different transgenic plants is evaluated in relation to the amount of virus present in the control plants. The results obtained show that the plants expressing megaspermine ss under the control of the 35S promoter have 10 to 15 times less virus than the control plants. This reduction in the amount of virus may seem important. It must be known, however, that the quantities of virus produced in wild plants may vary in the same proportions.
Par contre les plantes transgéniques exprimant la mégaspermine sous le contrôle du promoteur COMT II contiennent 1000 à 10000 fois moins de virus que les plantes témoins. Ceci représente une réduction considérable et très significative de la charge virale. On the other hand, transgenic plants expressing megaspermine under the control of the COMT II promoter contain 1000 to 10000 times less virus than control plants. This represents a significant and very significant reduction in viral load.
Ces résultats suggèrent que seules les plantes transformées avec la ss mégaspermine sous le contrôle du promoteur inductible COMT II sont moins sensibles vis à vis d'une infection systémique virale. Ceci montre également une corrélation entre la réduction des symptômes d'infection et la diminution de la charge virale dans ces feuilles. These results suggest that only plants transformed with ss megaspermine under the control of the inducible COMT II promoter are less susceptible to systemic viral infection. This also shows a correlation between reducing the symptoms of infection and decreasing the viral load in these leaves.
Résistance antifongique. Antifungal resistance.
Nous avons examiné si la production d'élicitines in planta conférait une résistance induite vis à vis d'un champignon du sol, Phytophthora parasitica var.nicotianae. Ce champignon infecte les plants de tabac par les racines envahissant le système racinaire puis vasculaire provoquant ainsi une sclérose des vaisseaux conducteurs. Les symptômes d'infection se traduisent par une pourriture noire au niveau du collet. Ce mode d'infection est difficile à mettre en oeuvre car il nécessite une concentration en zoospores adéquate et répond à des conditions strictes de température et d'humidité. Un mode "artificiel" d'inoculation consiste à appliquer après décapitation des tabacs le mycélium du champignon au niveau de la tige sectionnée. Après 7 jours les tiges sont prélevées et les symptômes d'infection sont examinés à l'intérieur des tiges. We examined whether the production of elicitin in planta conferred resistance against a soil fungus, Phytophthora parasitica var.nicotianae. This fungus infects tobacco plants by the roots invading the root system and vascular thereby causing sclerosis of the conductive vessels. Symptoms of infection result in black rot at the neck. This mode of infection is difficult to implement because it requires an adequate concentration of zoospores and meets strict conditions of temperature and humidity. An "artificial" mode of inoculation consists in applying, after decapitation of tobacco, the mycelium of the fungus at the level of the sectioned stem. After 7 days the stems are removed and the symptoms of infection are examined inside the stems.
L'inoculation a été effectuée sur 7 plantes témoins COMT II ::GUS. chaque Inoculation was performed on 7 control plants COMT II :: GUS. each
<Desc/Clms Page number 24><Desc / Clms Page number 24>
lignée transgénique pour la (3 mégaspermine, cinq plantes ont été inoculées. Les plantes
A, B, C et D possédant la construction "promoteur 35S-mégaspermine" ont été testées.
Pour les plantes possédant le gène de la P mégaspermine sous le contrôle du promoteur
COMT II, les lignées a et b présentant une forte résistance accrue au VMT ont été choisies ainsi que la lignée e présentant un niveau plus faible de résistance. transgenic line for (3 megaspermin, five plants were inoculated.
A, B, C and D having the construct "35S-megaspermine promoter" were tested.
For plants with the megaspermin P gene under the control of the promoter
COMT II, lines a and b with high resistance to VMT were chosen as well as line e having a lower level of resistance.
La progression des symptômes mesurée dans les tiges des plantes témoins atteint une longueur moyenne de 5,3 cm. Un ralentissement des symptômes d'infection est observé dans les tiges des plantes transgéniques exprimant la ss mégaspermine sous le contrôle du promoteur 35S. Cette diminution est variable d'un génotype à l'autre (figure 7). La progression du champignon est fortement ralentie dans les plantes 35S ::meg (d=0,8cm) et plus faiblement dans les plantes 35S ::meg (d=3,8cm) par rapport au plantes témoins (d=5,3cm). Les plantes A correspondent aux plantes qui présentent la plus forte proportion de transcrits de P mégaspermine, alors que les plantes B ont un taux très faible de transcrits codant pour l'élicitine. Ceci pourrait suggérer une corrélation entre les niveaux de transcrits d'élicitine détectés (et sans doute les niveaux de ss mégaspermine produits même si ceux ci restent sous le seuil de détection) et le niveau de résistance antifongique induit. The progression of symptoms measured in the stems of control plants reaches an average length of 5.3 cm. A slowing down of infection symptoms is observed in the stems of transgenic plants expressing ss megaspermine under the control of the 35S promoter. This decrease is variable from one genotype to another (Figure 7). The growth of the fungus is strongly retarded in plants 35S :: meg (d = 0.8cm) and more weakly in plants 35S :: meg (d = 3.8cm) compared to control plants (d = 5.3cm) . Plants A correspond to plants with the highest proportion of P megaspermine transcripts, while plants B have a very low level of transcripts encoding elicitin. This could suggest a correlation between the detected levels of elicitin transcripts (and probably the megaspermine ss levels produced even if they remain below the detection limit) and the level of induced antifungal resistance.
La progression du champignon est également fortement ralentie dans les tiges des plantes transgéniques exprimant la (3 mégaspermine sous le contrôle du promoteur COMT II. Nous avons montré par ailleurs que le promoteur COMT II était induit lors de l'infection par P. parasitica. Les tiges des transformants COMT II::meg a, b et e sont respectivement infectées sur une longueur de 0,7 cm, 1 cm et de 3,5 cm. Les plantes a et b sont les plus résistantes à l'infection par P. nicotianae et correspondent également aux plantes présentant la plus forte résistance au VMT. Ainsi, il apparaît que les mêmes niveaux de résistance relatifs sont détectés avec les deux agents pathogènes testés. Nous pouvons supposer que les niveaux de résistance induits dans ces plantes sont liés au taux d'expression de l'élicitine. Une analyse des niveaux de transcrits par Northern-Blot permettrait peut être de confirmer cette hypothèse, sachant la difficulté de détecter la protéine par Western-Blot. The growth of the fungus is also strongly retarded in the stems of transgenic plants expressing (3 megaspermin under the control of the COMT II promoter, and we have shown that the COMT II promoter was induced during infection with P. parasitica. stems of the COMT II :: meg a, b and e transformants are respectively 0.7 cm, 1 cm and 3.5 cm long.Plants a and b are the most resistant to P. infection. nicotianae and also correspond to the plants with the highest resistance to VMT, so it appears that the same levels of relative resistance are detected with both pathogens tested.We can assume that the resistance levels induced in these plants are related to the rate Expression of elicitin: an analysis of the levels of transcripts by Northern-Blot may be able to confirm this hypothesis, knowing the difficulty of detecting the protein by Wester No blotting.
Ces résultats montrent que l'expression constitutive ou induite de (3 mégaspermine dans des tabacs transgéniques permet de conférer un niveau de résistance accru vis à vis de d'une infection fongique. These results show that the constitutive or induced expression of megaspermine in transgenic tobaccos makes it possible to confer an increased level of resistance with respect to a fungal infection.
<Desc/Clms Page number 25> <Desc / Clms Page number 25>
Résistance antibactérienne
Nous avons également testé la résistance des plantes transgéniques exprimant la ss mégaspermine sous le contrôle du promoteur COMT II vis à vis d'une bactérie, Erwinia carotovora. Cette bactérie est un agent pathogène bien connu de la pomme de terre et est capable de macérer les tissus végétaux par la synthèse d'enzymes pectinolytiques. Antibacterial resistance
We also tested the resistance of transgenic plants expressing ss megaspermine under the control of the COMT II promoter against a bacterium, Erwinia carotovora. This bacterium is a well-known pathogen of the potato and is able to macerate plant tissues by the synthesis of pectinolytic enzymes.
Cependant elle peut également infecter d'autres plantes tel le tabac. However, it can also infect other plants such as tobacco.
Pour ce test, une suspension d'E. carotovora a été infiltrée dans les feuilles des plantes transgéniques COMT II::mégaspermine ainsi que dans les feuilles des plantes contrôles (correspondant aux plantes transgéniques pour le gène chimérique COMT II::GUS). Une population de 7 plantes a été inoculée pour chacun des transformants. For this test, a suspension of E. carotovora was infiltrated into the leaves of the transgenic COMT II :: megaspermin plants as well as into the leaves of the control plants (corresponding to the transgenic plants for the chimeric COMT II :: GUS gene). A population of 7 plants was inoculated for each of the transformants.
Deux jours après inoculation des bactéries, 60% des plantes contrôles (4 plantes sur 7) présentent des symptômes d'infection sévères, les feuilles inoculées sont entièrement macérées et l'infection tend à se propager au niveau de la plante entière. A l'inverse 85% des plantes transgéniques exprimant la P mégaspermine sous le contrôle du promoteur COMTII (6 plantes sur 7) sont résistantes à l'infection bactérienne. Two days after inoculation of the bacteria, 60% of the control plants (4 plants out of 7) show severe symptoms of infection, the inoculated leaves are completely macerated and the infection tends to spread to the whole plant. Conversely, 85% of transgenic plants expressing P megaspermine under the control of the COMTII promoter (6 plants out of 7) are resistant to bacterial infection.
Ces résultats montrent que l'expression induite de l'élicitine accroît fortement la résistance vis à vis d'E. carotovora. Nous avons précédemment montré que le promoteur COMT II était inductible par des éliciteurs secondaires parmi lesquels les fragments pectiques. Ainsi nous pouvons supposer que les fragments pectiques produits lors de la lyse des tissus végétaux induisent le promoteur COMT II et par conséquent la synthèse de p mégaspermine. Cependant le mécanisme permettant la mise en place de la résistance antibactérienne reste encore à déterminer. These results show that the induced expression of elicitin greatly increases resistance to E. coli. carotovora. We have previously shown that the COMT II promoter is inducible by secondary elicitors among which the pectic fragments. Thus we can assume that the pectic fragments produced during the lysis of plant tissues induce the COMT II promoter and consequently the synthesis of megaspermine p. However, the mechanism allowing the establishment of the antibacterial resistance remains to be determined.
Matériel et méthodes
Criblage d'une banque génomique et identification du clone correspondant au gène exprimé pendant la réponse de défense. Material and methods
Screening of a genomic library and identification of the clone corresponding to the gene expressed during the defense response.
Une banque d'ADN génomique de tabac (Nicotiana tabacum var. Xanthi) construite dans -EMBL3 (Clontech) a été criblée avec une sonde radioactive d'ADNc de COMT II (Pellegrini & al., 1993). Six clones génomiques positifs ont été isolés après quatre tours de purification. Ces clones purifiés ont été testés par PCR pour identifier celui qui comprend le gène COMT exprimé pendant la réponse d'hypersensibilité (HR) des feuilles de tabac au VMT. Les amorces 5' et 3' pour l'analyse PCR sont représentés A genomic tobacco DNA library (Nicotiana tabacum var Xanthi) constructed in -EMBL3 (Clontech) was screened with a COMT II cDNA radioactive probe (Pellegrini et al., 1993). Six positive genomic clones were isolated after four rounds of purification. These purified clones were tested by PCR to identify one that includes the COMT gene expressed during the hypersensitivity (HR) response of tobacco leaves to TMV. The 5 'and 3' primers for PCR analysis are represented
<Desc/Clms Page number 26><Desc / Clms Page number 26>
par les oligonucléotides 1 et 2 ci-dessous (SEQ ID NO 4 et SEQ ID NO 5 respectivement) : Oligo 1 : 5' CGTTTCGCAA TGTGATTTGA TC 3' Oligo2:5' CTCAAAATGA CATCCTTTCA TAC 3'
Ils sont dérivés de la région non traduite en 3' de l'ADNc de COMT II. L'analyse PCR est effectuée à 62 C (température de fusion théorique) de manière à promouvoir une hybridation spécifique. Un seul clone permet l'amplification du fragment attendu de 400 paires de bases comme le fait l'ADNc employé comme contrôle positif. Le clone génomique de COMT II a été purifié sur Quiagen tip selon le protocole décrit par le fabriquant et sous cloné dans le site de restriction Sall du vecteur plasmide puc 18. by oligonucleotides 1 and 2 below (SEQ ID NO 4 and SEQ ID NO 5 respectively): Oligo 1: 5 'CGTTTCGCAA TGTGATTTGA TC 3' Oligo2: 5 'CTCAAAATGA CATCCTTTCA TAC 3'
They are derived from the 3 'untranslated region of the COMT II cDNA. The PCR analysis is carried out at 62 ° C. (theoretical melting temperature) so as to promote a specific hybridization. A single clone allows amplification of the expected 400 base pair fragment as does the cDNA employed as a positive control. The genomic clone of COMT II was purified on Quiagen tip according to the protocol described by the manufacturer and subcloned into the SalI restriction site of the vector plasmid puc 18.
Séquençage de l'ADN. Sequencing of DNA.
Le séquençage de l'ADN a été effectué sur l'ADN double brin dénaturé selon la méthode de Sanger & al. (1977) en employant le le kit " rhodamin dye terminator cycle ready " avec l'ADN polymérase FS ampliPaq (Perkin-Elmer, P/N402078) et un séquenceur Applied Biosystems 373 (Perkin-Elmer). La séquence a été déterminée sur les deux brins avec des recouvrements en employant des amorces synthétisées à partir de séquences déjà déterminées. DNA sequencing was performed on the denatured double-stranded DNA according to the method of Sanger et al. (1977) using the "rhodamin dye terminator cycle ready" kit with FS ampliPaq DNA polymerase (Perkin-Elmer, P / N402078) and an Applied Biosystems 373 sequencer (Perkin-Elmer). The sequence was determined on both strands with overlays using primers synthesized from already determined sequences.
Analyse des produits d'extension d'amorces. Analysis of primer extension products.
La réaction d'extension des amorces a été effectuée sur l'ARN total selon la méthode décrite dans Current Protocols in Molecular Biology (Trienzenberg, 1992). The primer extension reaction was performed on total RNA according to the method described in Current Protocols in Molecular Biology (Trienzenberg, 1992).
L'ARN total isolé de feuilles de tabacs infectées par le VMT et de feuilles de tabacs non infectées (comme contrôle négatif) a été hybridé à l'oligonucléotide suivant (SEQ ID NO 6), complémentaire de l'ARNm du COMT II et marqué à l'extrémité 5' :
Oligo 3 : 5' CTGAAGATGT CAATAGTTGC ATGGC 3'
Le produit de l'extension a été séparé sur un gel de polyacrylamide à 6 %. La localisation du site d'initiation de la transcription a été déterminée sur la base de la comigration des produits d'extension avec l'échelle de séquence de la obtenue à partir de la région correspondante du gène (Sanger & al., 1977). Total RNA isolated from tobacco leaves infected with TMV and uninfected tobacco leaves (as a negative control) was hybridized to the following oligonucleotide (SEQ ID NO 6), complementary to COMT II mRNA and labeled at the 5 'end:
Oligo 3: 5 'CTGAAGATGT CAATAGTTGC ATGGC 3'
The extension product was separated on a 6% polyacrylamide gel. The location of the transcription initiation site was determined on the basis of the comigration of the extension products with the sequence sequence of the obtained from the corresponding region of the gene (Sanger et al., 1977).
Construction des plasmides. Construction of plasmids
Les versions tronquées du promoteur COMTII ont été amplifiés par PCR en employant les amorces PAS1 en 3' et PSI, PS2, PS3 et PS4 en 5' représentés ci-après (SEQ ID NO 7 à 11respectivement), conduisant respectivement à l'amplification des The truncated versions of the COMTII promoter were amplified by PCR using the 3 'PAS1 primers and 5' PSI, PS2, PS3 and PS4 shown hereinafter (SEQ ID Nos. 7 to 11 respectively), respectively leading to the amplification of the
<Desc/Clms Page number 27><Desc / Clms Page number 27>
fragments nucléotidiques de longueurs suivantes : -1215/+24, (nouveaux construits dupérieurs à 600 bp) -420/+24, -313/+24 et -121/+24 (numérotation relative au site d'initiation de la transcription)
PAS1 : 5' GGTCTAGAGG GCCTTTTAGA GTGTTTTTGT TAG 3' PSI : 5' AAAGTCGACC GTCCACCTGT GCCAACAAT 3'
PS2 : 5' TGTTTGGTGT TATGCTTCCG TCCT 3' PS3 : 5' AAAAAGCTTT TTTAGGATGG AGTACAGCC 3' PS4 : 5' TTTAAGCTTA AAGAGAACCA GACAATATT 3'
Les construits -1728/+24, -1471/+24, -956/+24, -937/+24, -882/+24, -746/+24, - 676/+24, -560/+24, -435/+24, ont été obtenus avec les amorces PAS2 en 3' et respectivement les amorces PS5, PS6, PS7, PS8, PS9, PS10, PSl1 PS12 et PS13 en 5' présentées ci après (SEQ ID NO 15à 24 respectivement):
PAS2: 5' CGCGGATCCC CTTTTAGAGT GTTTTTGTTA GGC 3' PS5 : 5' ACGCGTCGAC GTTAGGGACA ATCTATAGTG TCAC 3' PS6 : 5' ACGCGTCGAC GCTCCGAGGA TTTGGCTGTC GCGG 3' PS7 : 5' ACGCGTCGAC GCTGGTTAGG TGAAGTAAAG CATG 3' PS8 : 5' ACGCGTCGAC GCATGTTATA TGAGGAAAGT ACG 3' PS9 : 5' ACGCGTCGAC GCAGCCAGCA CAAGCAAATT CGC 3'
PS10: 5' ACGCGTCGAC GACTTTAACA CACCAACTCC C 3'
PS11: 5' ACGCGTCGAC CGGATCTAGA ATTTGGGTTC ATTC 3'
PS12: 5' ACGCGTCGAC GTGTATACTC CACGTCTCCG GATAC 3'
PS13: 5' ACGCGTCGAC GTTCAATGTT AGGTGTGTTT GG 3'
La séquence-1073/-435 qui a été placée en amont du promoteur 35S minimum a été obtenue en utilisant l'amorce PAS3 en 3' et l'amorce PS14 en 5' (SEQ ID NO 25 et 26): PAS3 : 5' CGCGGATCCG CTTAACACCA AACACACCTA ACATTG 3'
PS14 : 5' ACGCGTCGAC CAGTGGTGAG TTTAGCTGTC 3'
L'amplification a été effectuée pendant 30 cycles avec une étape initiale de 4 min à 95 C et une étape finale de 5 min à 72 C, en utilisant le clone génomique comme matrice.Chaque cycle consiste en 1 min à 95 C suivie d'1min d'hybridation puis de 1,5-2 min à 72 C.L'étape d'hybridation est réalisée à 54 C, 59 C, 55 C, et 50 C pour amplifier ,respectivement,les fragments -1215/+24, -420/+24, -313/+24 et -121/+24. nucleotide fragments of the following lengths: -1215 / + 24, (new constructs greater than 600 bp) -420 / + 24, -313 / + 24 and -121 / + 24 (relative numbering at the transcription initiation site)
PAS1: 5 'GGTCTAGAGG GCCTTTTAGA GTGTTTTTGT TAG 3' PSI: 5 'AAAGTCGACC GTCCACCTGT GCCAACAAT 3'
PS2: 5 'TGTTTGGTGT TATGCTTCCG TCCT 3' PS3: 5 'AAAAAGCTTT TTTAGGATGG AGTACAGCC 3' PS4: 5 'TTTAAGCTTA AAGAGAACCA GACAATATT 3'
The constructs -1728 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, -882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24, -435 / + 24, were obtained with the 3 'PAS2 primers and respectively the PS5, PS6, PS7, PS8, PS9, PS10, PS1, PS12 and PS13 5' primers presented below (SEQ ID NO 15 to 24 respectively). :
PAS2: 5 'CGCGGATCCC CTTTTAGAGT GTTTTTGTTA GGC 3' PS5: 5 'ACGCGTCGAC GTTAGGGACA ATCTATAGTG TCCA 3' PS6: 5 'ACGCGTCGAC GCTCCGAGGA TTTGGCTGTC GCGG 3' PS7: 5 'ACGCGTCGAC GCTGGTTAGG TGAAGTAAAG CATG 3' PS8: 5 'ACGCGTCGAC GCATGTTATA TGAGGAAAGT ACG 3' PS9: 5 'ACGCGTCGAC GCAGCCAGCA CAAGCAAATT CGC 3'
PS10: 5 'ACGCGTCGAC GACTTTAACA CACCAACTCC C 3'
PS11: 5 'ACGCGTCGAC CGGATCTAGA ATTTGGGTTC ATTC 3'
PS12: 5 'ACGCGTCGAC GTGTATACTC CACGTCTCCG GATAC 3'
PS13: 5 'ACGCGTCGAC GTTCAATGTT AGGTGTGTTT GG 3'
The 1073 / -435 sequence that was placed upstream of the minimum 35S promoter was obtained using the 3 'PAS3 primer and the 5' PS14 primer (SEQ ID Nos. 25 and 26): PAS3: 5 ' CGCGGATCCG CTTAACACCA AACACACCTA ACATTG 3 '
PS14: 5 'ACGCGTCGAC CAGTGGTGAG TTTAGCTGTC 3'
The amplification was carried out for 30 cycles with an initial step of 4 min at 95 ° C. and a final step of 5 min at 72 ° C., using the genomic clone as template. Each cycle consists of 1 min at 95 ° C. followed by 1min of hybridization then 1.5-2 min at 72 ° C.The hybridization step is carried out at 54 ° C., 59 ° C., 55 ° C. and 50 ° C. to amplify, respectively, the fragments -1215 / + 24, -420 / + 24, -313 / + 24 and -121 / + 24.
Pour tous les autres fragments du promoteur, la température d'hybridation est de 60 C.Après sous-clonage dans le plasmide pGEM-T (Promega) et amplification dans E. For all other fragments of the promoter, the hybridization temperature is 60 C. After subcloning in the plasmid pGEM-T (Promega) and amplification in E.
<Desc/Clms Page number 28> <Desc / Clms Page number 28>
Coli, le fragment de promoteur-1215/+24 est digéré par Sali et Xbal, les sites correspondants étant présents dans les amorces PSI et PSA1 respectivement. Les fragments de promoteur de 420,313 et 121 paires de bases sont digérés avec HindIII et XbaI (le site pour HindIII est présent dans les amorces PS2, PS3 et PS4, et le site Xbal dans l'amorce PASI).Les fragments -1768/+24, -1471/+24,-956/+24, -937/+24, - 882/+24, -746/+24,-676/+24, -560/+24 et-435/+24 sont digérés par BamHl présent dans PAS2 et PAS3 et par Sali present dans les amorces PS5 à PS14. Tous les fragments sont clonés dans le plasmide pBI101 (Qiagen) de façon à créer une fusion transcriptionnelle avec le gène rapporteur GUS. Tous les construits sont séquences pour confirmer leur structure et les frontières de jonction. Coli, the promoter-1215 / + 24 fragment is digested with SalI and XbaI, the corresponding sites being present in the primers PSI and PSA1 respectively. The 420,313 and 121 base pair promoter fragments are digested with HindIII and XbaI (the HindIII site is present in the PS2, PS3 and PS4 primers, and the XbaI site in the PASI primer). Fragments -1768 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, - 882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24 and-435 / + 24 are digested with BamHI present in PAS2 and PAS3 and with SalI present in primers PS5 to PS14. All fragments are cloned into plasmid pBI101 (Qiagen) so as to create a transcriptional fusion with the GUS reporter gene. All constructs are sequenced to confirm their structure and junction boundaries.
Le construit constitué du promoteur 35S du CaMV en amont du gène de la mégaspermine a été obtenu en remplaçant le gène Gus par le gène de la mégaspermine (SEQ ID NO 12) dans le plasmide pBil21(Clontech). The CaMV 35S promoter construct upstream of the megaspermin gene was obtained by replacing the Gus gene with the megaspermin gene (SEQ ID NO: 12) in plasmid pBil21 (Clontech).
Clonage de l'ADNc de Phytophthora megasperma
10 mg d'ARN totaux de Phytophthora megasperma sont utilisés comme matrice pour la synthèse du premier brin. Les ARN totaux sont chauffés 3 min à 65 C, refroidis sur glace, et incubés 2 h à 42 C dans 50 ml de tampon de transcription inverse (50 mM Tris-HCL pH 8,3 - 15 mM MgCl2 - 75 mM KCL - 1 mM DTT) contenant 1 mM de chaque dNTP, 40 pmol d'amorce anti-sens correspondant à l'oligodT, et 20 U de transcriptase inverse d'AMV (virus de la myéloblastose aviaire). Le mélange est chauffé a 94 C pour stopper la réaction. Après précipitation du mélange réactionnnel à l'éthanol, le culot est dissous dans de l'eau stérile distillée. Cloning of Phytophthora megasperma cDNA
10 mg total RNA of Phytophthora megasperma are used as a template for first strand synthesis. The total RNAs are heated for 3 min at 65 ° C., cooled on ice, and incubated for 2 h at 42 ° C. in 50 ml of reverse transcription buffer (50 mM Tris-HCL pH 8.3 - 15 mM MgCl 2 - 75 mM KCL - 1 mM DTT) containing 1 mM of each dNTP, 40 pmol of antisense primer corresponding to oligodT, and 20 U of AMV reverse transcriptase (avian myeloblastosis virus). The mixture is heated to 94 ° C to stop the reaction. After precipitation of the reaction mixture with ethanol, the pellet is dissolved in sterile distilled water.
La synthèse du second brin est initiée par la Taq ADN polymérase. 1/20 du produit de transcription inverse est utilisé pour l'amplification par PCR dans 50 ml de tampon (10 mM Tris-HCL pH 8,3 - 50 mM KCL - 1,5 mM MgCl2 - 0,01% BSA), 200 mM de dNTP, 0,1 mM d'amorces sens et anti-sens et 1 unité de Taq. L'amorce sens (5' ATGAACTTCACCGCTCTGCT 3') dérive de la séquence nucléotidique de la cryptogéine, l'amorce anti-sens correspond à l'oligodT possédant les sites de restriction SstI-EcoRI-HindIII à son extrémité 5'. Le mélange réactionnel est chauffé pendant 3 min à 94 C, puis est soumis à 30 cycles de réaction comprenant chacun 3 étapes : 1 min à 94 C, 1 min à 49 C et 1 min à 72 C. Après le dernier cycle, l'élongation est Second strand synthesis is initiated by Taq DNA polymerase. 1/20 of the reverse transcript is used for PCR amplification in 50 ml buffer (10 mM Tris-HCL pH 8.3 - 50 mM KCL - 1.5 mM MgCl2 - 0.01% BSA), 200 mM dNTP, 0.1 mM sense and antisense primers and 1 unit Taq. The sense primer (5 'ATGAACTTCACCGCTCTGCT 3') derives from the nucleotide sequence of cryptogein, the antisense primer corresponds to the oligodT having the SstI-EcoRI-HindIII restriction sites at its 5 'end. The reaction mixture is heated for 3 min at 94 ° C., then is subjected to 30 reaction cycles each comprising 3 steps: 1 min at 94 ° C., 1 min at 49 ° C. and 1 min at 72 ° C. After the last cycle, the elongation is
<Desc/Clms Page number 29><Desc / Clms Page number 29>
poursuivie 10 min à 72 C. Le produit d'amplification obtenu est ensuite cloné dans le vecteur pGEM (Promega) afin d'être séquence. continued for 10 minutes at 72 ° C. The amplification product obtained is then cloned into the pGEM vector (Promega) in order to be sequenced.
Transformation des plantes
Les différents construits promoteur COMTII-GUS obtenus précédemment dans le plasmide pBI101 sont introduits dans une souche d'Agrobacterium tumefaciens GV3101 (pPM6000) (Rossi & al., 1993) par électroporation (Nagel & al., 1990). Les plants de tabac (Nicotiana tabacum cv Samsun NN) sont transformés par infiltration d'Agrobacterium sur des plants de 10 jours (Rossi & al., 1993). Les plantes sont régénérées sur un milieu Murashige & Skoog (MS) (GIBCO BRL) supplémenté avec du saccharose (30 g/1 pour la formation des tiges et 15 g/1 pour la formation des racines), de la 6-benzylaminopurine (Serva) (2 mg/ml), et de l'acide naphtalène acétique (Serva) (0,05 mg/ml). La kanamycine (150 mg/ml) est employée comme agent de sélection durant les étapes de régénération in vitro et de propagation. Des plantes contrôles ont été préparées par transformation avec le vecteur vide pBI101. Sept à 10 transformants indépendants sont régénérés pour chaque construit. Les transformants primaires sont auto fécondés et les graines FIsont germées sur un milieu MS comprenant 300 mg/1 de kanamycine. Plant transformation
The different COMTII-GUS promoter constructs obtained previously in the plasmid pBI101 are introduced into a strain of Agrobacterium tumefaciens GV3101 (pPM6000) (Rossi et al., 1993) by electroporation (Nagel et al., 1990). Tobacco plants (Nicotiana tabacum cv Samsun NN) are transformed by Agrobacterium infiltration on 10-day-old plants (Rossi & al., 1993). Plants are regenerated on Murashige & Skoog (MS) medium (GIBCO BRL) supplemented with sucrose (30 g / l for stem formation and 15 g / l for root formation), 6-benzylaminopurine (Serva ) (2 mg / ml), and naphthalene acetic acid (Serva) (0.05 mg / ml). Kanamycin (150 mg / ml) is used as a selection agent during the in vitro regeneration and propagation steps. Control plants were prepared by transformation with the empty vector pBI101. Seven to 10 independent transformers are regenerated for each construct. The primary transformants are self fertilized and the IF seeds are germinated on an MS medium comprising 300 mg / l kanamycin.
Essais enzymatiques
La localisation histochimique du GUS dans les plantes transgéniques est effectuée selon la méthode décrite par Jefferson & al. (1987). La réaction histochimique est incubée dans l'obscurité à 37 C pendant 12 heures. Les tissus sont rincés, d'abord avec un tampon phosphate 50 mM pour terminer la réaction, puis plusieurs fois avec de l'éthanol de 70% à 90% pour éliminer la pigmentation des tissus. Après la réaction histochimique, les tissus sont rincés dans l'éthanol à 70% et sont inclus dans une historésine de fixation (Jung) pour des sections transversales de feuilles. Les blocs d'historésines sont coupés avec un microtome et des photographies sont prises à un grossissement de 10 à 40 fois par un microscope binoculaire. Enzymatic tests
The histochemical localization of GUS in the transgenic plants is carried out according to the method described by Jefferson et al. (1987). The histochemical reaction is incubated in the dark at 37 C for 12 hours. The tissues are rinsed first with a 50 mM phosphate buffer to complete the reaction and then several times with 70% to 90% ethanol to remove the pigmentation of the tissues. After the histochemical reaction, the tissues are rinsed in 70% ethanol and are included in a fixation history (Jung) for cross sections of leaves. The blocks of historesines are cut with a microtome and photographs are taken at a magnification of 10 to 40 times by a binocular microscope.
Le dosage des activités COMTII et GUS a été effectué sur 100mg de tissus. Le tissu est homogénisé dans un tampon phosphate de sodium 100mM à pH 7,5 et 10 mM de DTT après addition de polyclar AT (Serva) et de quartz. Les extraits bruts sont clarifiés par centrifugation et par filtration sur de la laine de verre. La mesure des activités GUS et COMTII est effectuée sur les même extraits bruts. Pour la mesure de The dosage of COMTII and GUS activities was performed on 100 mg of tissue. The tissue is homogenized in 100mM sodium phosphate buffer pH 7.5 and 10mM DTT after addition of AT polyclar (Serva) and quartz. The crude extracts are clarified by centrifugation and filtration on glass wool. The measurement of GUS and COMTII activities is performed on the same raw extracts. For the measurement of
<Desc/Clms Page number 30><Desc / Clms Page number 30>
l'activité COMTII, un aliquote de l'extrait protéique est ajouté à 1 ml de tampon phosphate comprenant 100M de catéchol, 50uM de S-adénosyl-L-méthionine tritiée (1,5 105 cpm/ml) et incubé pendant 3 heures à 37 C. La réaction est stoppée par addition de 1001 d'acide sulfurique 9M. Le produit radioactif de la réaction, l'acide ferulique, est extrait par 5 ml d'une solution NA de scintillation (Beckman) et la radioactivité est comptée sur un appareil Beckman LS 9000. La mesure fluorimétrique de l'activité GUS est effectuée sur les mêmes échantillons selon la procédure de Jefferson & al. (1987). Le contenu protéique est déterminé par la méthode de Bradford (1976) en employant les réactifs Biorad. COMTII activity, an aliquot of the protein extract is added to 1 ml of phosphate buffer comprising 100M of catechol, 50uM of tritiated S-adenosyl-L-methionine (1.5 10 5 cpm / ml) and incubated for 3 hours at room temperature. C. The reaction is stopped by adding 1001 of 9M sulfuric acid. The radioactive product of the reaction, ferulic acid, is extracted with 5 ml of a scintillation NA solution (Beckman) and the radioactivity is counted on a Beckman LS 9000 apparatus. The fluorimetric measurement of the GUS activity is carried out on the same samples according to the procedure of Jefferson & al. (1987). Protein content is determined by the method of Bradford (1976) using Biorad reagents.
Construits COMTII-meg et 35S-meg
Le vecteur pGEM (Promega) ne possédant pas les sites de clonage compatibles ceux du pBI101, une étape de sous clonage dans le vecteur Bluescript (pSK) a été nécessaire. L'insert BamHI/SstI provenant du pSK::mégaspermine a été purifié pour le clonage dans le vecteur binaire pBilOI (Clontech). Constructed COMTII-meg and 35S-meg
As the pGEM vector (Promega) did not possess the cloning sites compatible with those of pBI101, a subcloning step in the Bluescript vector (pSK) was necessary. The BamHI / SstI insert from pSK :: megaspermine was purified for cloning into the pBilOI binary vector (Clontech).
Le vecteur pBi101::COMT II-GUS précédemment construit et correspondant au promoteur-1215/+24 fusionné au gène rapporteur GUS a été utilisé pour obtenir le gène chimérique comt II-meg. Le gène GUS est excisé par digestion du plasmide binaire par BamHI et Sstl. Un site SnabI présent dans le gène GUS permet de couper celui-ci et évite qu'il se religue avec le plasmide binaire puisque aucune étape de purification du vecteur n'est effectuée. Les enzymes de restriction sont inactivées par la chaleur. L'ADN digéré est extrait par un mélange phénol : chloroforme (1 : 1), puis chloroforme : alcool isoamilique (24 : 1) et précipité à l'éthanol. L'ADN digéré est remis en suspension dans de l'eau stérile et ligué avec l'insert. The vector pBi101 :: COMT II-GUS previously constructed and corresponding to the promoter-1215 / + 24 fused to the GUS reporter gene was used to obtain the chimeric gene comt II-meg. The GUS gene is excised by digestion of the binary plasmid with BamHI and SstI. A SnabI site present in the GUS gene makes it possible to cut it and prevents it from being religated with the binary plasmid since no step of purification of the vector is carried out. Restriction enzymes are inactivated by heat. The digested DNA is extracted with a phenol: chloroform (1: 1) mixture, then chloroform: isoamyl alcohol (24: 1) and precipitated with ethanol. The digested DNA is resuspended in sterile water and ligated with the insert.
Le vecteur pBil21 (Clontech) portant le gène 35S-GUS a été utilisé pour obtenir le gène chimérique 35S-meg. Le clonage est effectué selon la méthode décrite précédemment. The pBil21 vector (Clontech) carrying the 35S-GUS gene was used to obtain the 35S-meg chimeric gene. Cloning is performed according to the method described above.
Les constructions ont été ensuite vérifiées par séquençage. The constructs were then verified by sequencing.
Plants de tabac. Tobacco plants.
Les plants de tabac transgéniques (Nicotiana tabacum cv. Samsun NN) sont cultivés in vitro sous un cycle de lumière de 12h(24 C)/12(20 C) pendant 5 semaines après la germination. Ils sont propagés sur un milieu MS avec addition de kanamycine (150 mg/1) comme agent de sélection. Ils sont ensuite transférés en serre et cultivés en The transgenic tobacco plants (Nicotiana tabacum cv Samsun NN) are cultured in vitro under a 12h (24 C) / 12 (20 C) light cycle for 5 weeks after germination. They are propagated on MS medium with addition of kanamycin (150 mg / l) as selection agent. They are then transferred to a greenhouse and grown in
<Desc/Clms Page number 31><Desc / Clms Page number 31>
sol sous un cycle de lumière 16h/8h à 22 +2 C. ground under a light cycle 16h / 8h to 22 +2 C.
Analyse des ARN de plantes par Northern
Extraction des ARN totaux
Les tissus sont finement broyés dans de l'azote liquide, puis dans 1 à 2 volumes de tampon d'extraction (0,2 M borate de sodium pH 9 - 30 mM EGTA - SDS 1% - 5 mM DTT). Le mélange est versé dans un tube contenant 1 volume de phénol/chloroforme (1:1), vortexé, puis centrifugé 10 min à 5000g. Une deuxième extraction au phénol/chloroforme (1:1) est réalisée, suivie d'une troisième au chloroforme/alcool isoamylique (24:1). Les ARN présents dans le surnageant sont spécifiquement précipités par addition de 1 volume d'une solution de LiCI (4 M) EDTA (10 mM) pendant une nuit à 0 C. Le tout est centrifugé 30 min à 10000g et le culot est lavé avec une solution de LiCl (2 M), EDTA (5 mM). Les ARN totaux sont repris dans de l'eau et à nouveau précipités à l'éthanol 70%, NaCl (0,2 mM). Après centrifugation 30 min à 10000 g, le culot est lavé deux fois à l'éthanol 70%, puis repris dans 50 l d'eau. Les ARN sont dosés en mesurant l'absorbance d'une solution diluée à 260 (1 unité D0260 = 40 g/ml d'ARN), et leur intégrité est vérifiée par migration sur un gel d'agarose non dénaturant coloré au BET. Northern Plant RNA Analysis
Extraction of total RNA
The tissues are finely ground in liquid nitrogen and then in 1 to 2 volumes of extraction buffer (0.2 M sodium borate pH 9 - 30 mM EGTA - 1% SDS - 5 mM DTT). The mixture is poured into a tube containing 1 volume of phenol / chloroform (1: 1), vortexed and then centrifuged for 10 min at 5000 g. A second phenol / chloroform extraction (1: 1) is carried out, followed by a third chloroform / isoamyl alcohol (24: 1). The RNAs present in the supernatant are specifically precipitated by adding 1 volume of a solution of LiCl (4 M) EDTA (10 mM) overnight at 0 C. The whole is centrifuged for 30 min at 10000 g and the pellet is washed with a solution of LiCl (2M), EDTA (5mM). The total RNAs are taken up in water and again precipitated with 70% ethanol and NaCl (0.2 mM). After centrifugation for 30 min at 10,000 g, the pellet is washed twice with 70% ethanol and then taken up in 50 l of water. The RNAs are assayed by measuring the absorbance of a solution diluted at 260 (1 unit D0260 = 40 g / ml RNA), and their integrity is verified by migration on a non-denaturing BET-stained agarose gel.
Electrophorèse
Les ARN sont séparés sur gel d'agarose dénaturant préparé dans un tampon MOPS xl contenant 16% de formaldéhyde. Des gels de 1,2% d'agarose (p/v) ont été utilisés. Les échantillons d'ARN sont dénaturés 15 min à 65 C en présence de 3 volumes de solution de dénaturation (MOPS x5 10 l, formamide 50(il, formaldéhyde 16 l) par volume d'ARN, et refroidis rapidement dans la glace. Du tampon de charge est ajouté (MOPSxl, glycérol 50 % , bleu de bromophénol 0,05 %) à raison de 1/10 du volume. Après migration dans du tampon MOPS xl, le gel peut être coloré au BET (0,5 ug/ml) 1 à 2 min, puis abondamment lavé à l'eau stérile. Les ARN sont alors visualisés sous lumière UV. Electrophoresis
RNAs are separated on denaturing agarose gel prepared in MOPS xl buffer containing 16% formaldehyde. Gels of 1.2% agarose (w / v) were used. The RNA samples are denatured for 15 min at 65 ° C. in the presence of 3 volumes of denaturation solution (MOPS × 5 10 l, formamide 50 μl, formaldehyde 16 l) per volume of RNA, and cooled rapidly in ice. Charge buffer is added (MOPSx1, 50% glycerol, 0.05% bromophenol blue) at 1/10 volume After migration into MOPS xl buffer, the gel can be stained with BET (0.5 μg / ml). ml) 1 to 2 min, then abundantly washed with sterile water.The RNA are then visualized under UV light.
"Northern Blot"
La technique du "Northern-blot" permet de détecter, parmi les ARN totaux, les messagers homologues à une sonde d'ADN radioactive. Celle ci est réalisée à l'aide du kit de "Random Priming" (Amersham) en suivant le protocole fourni. "Northern Blot"
The "Northern blot" technique makes it possible to detect, among the total RNA, the messengers homologous to a radioactive DNA probe. This is done using the "Random Priming" kit (Amersham) following the protocol provided.
<Desc/Clms Page number 32> <Desc / Clms Page number 32>
10 g d'ARN totaux de tige ou de feuille sont déposés sur gel d'agarose 1,2% (p/v) dénaturant ainsi qu'un marqueur de taille d'ARN (Promega) déposé en bordure du gel. Après migration, le gel est rincé à l'eau stérile afin d'enlever l'excès de formaldéhyde. La bande de migration correspondant au marqueur de taille est découpée, colorée au BET et photographiée. 10 g of total stem or leaf RNA are deposited on 1.2% (w / v) denaturing agarose gel and an RNA size marker (Promega) deposited at the edge of the gel. After migration, the gel is rinsed with sterile water to remove excess formaldehyde. The migration strip corresponding to the size marker is cut, stained with BET and photographed.
Les ARN sont transférés par capillarité pendant 5 h sur une membrane de Nylon positivement chargée (Hybond N+, Amersham) avec du tampon SSC x20. Après transfert la membrane est rincée dans le tampon SSC x2 et les ARN sont fixés de façon covalente sur la membrane de nylon par exposition à la lumière ultraviolette (1200 J, UV Stratalinker 2400, Stratagene). La membrane est hybridée à une sonde radioactive et traitée comme decrit dans Sambrook et al.. The RNAs are transferred by capillarity for 5 h onto a positively charged nylon membrane (Hybond N +, Amersham) with SSC x20 buffer. After transfer the membrane is rinsed in x2 SSC buffer and the RNAs are covalently attached to the nylon membrane by exposure to ultraviolet light (1200 J, UV Stratalinker 2400, Stratagene). The membrane is hybridized to a radioactive probe and treated as described in Sambrook et al.
Analyse des protéines de plantes par Western
Extraction des protéines foliaires
L'extraction peut se faire immédiatement après la récolte ou sur des échantillons congelés. 150 g de tissus foliaires sont broyés au mortier dans du tampon acétate de sodium 0. 5 M pH 5. 2 contenant du 2-B-mercaptoéthanol (15 mM) et du charbon actif. Western protein analysis of plants
Extraction of foliar proteins
Extraction can be done immediately after harvest or on frozen samples. 150 g of leaf tissue are ground in a 0.5 M sodium acetate pH 5.2 buffer containing 2-B-mercaptoethanol (15 mM) and activated charcoal.
Le volume de tampon est ajusté de manière à obtenir un broyât fin et homogène. Celuici est ensuite filtré sur gaze puis centrifugé pendant 30 min à 15000 g. Le surnageant constituant l'extrait brut est alors analysé. The volume of buffer is adjusted so as to obtain a fine and homogeneous mill. This is then filtered on gauze and then centrifuged for 30 min at 15,000 g. The supernatant constituting the crude extract is then analyzed.
Dosage des protéines
La concentration protéique des extraits bruts est dosée par la méthode de Bradford (1976) dans des plaques de microtitration : 10 l d'un extrait à tester sont ajoutés 200 l de réactif de Bradford xl (Biorad). 2 l d'extrait brut de feuille sont complétés à 10 l par du tampon. Chaque échantillon est testé trois fois. Après 5 à 10 min, la plaque est lue au spectrophotomètre MR 700 (Dynatech) avec le filtre 5 (660 nm). Le blanc est constitué de 10 l de tampon et les valeurs sont comparées à une gamme étalon réalisée avec de la sérum-albumine bovine (SAB, Sigma). Protein assay
The protein concentration of the crude extracts is assayed by the method of Bradford (1976) in microtiter plates: 10 l of an extract to be tested are added 200 l of Bradford xl reagent (Biorad). 2 l of crude leaf extract are filled to 10 l with buffer. Each sample is tested three times. After 5 to 10 min, the plate is read on MR 700 spectrophotometer (Dynatech) with filter 5 (660 nm). The blank consists of 10 l of buffer and the values are compared to a standard range made with bovine serum albumin (BSA, Sigma).
Séparation des protéines sur gel depolyacrylamide dénaturant
L'analyse sur gel permet de déterminer la masse moléculaire des protéines en comparant leur mobilité relative à celles de protéines de masse moléculaire connue. A l'extrait protéique est ajouté 20% (v/v) de tampon de charge (60 mM Tris-HCl pH 6.8, Separation of proteins on denaturing polyacrylamide gel
The gel analysis makes it possible to determine the molecular mass of the proteins by comparing their relative mobility with those of proteins of known molecular mass. To the protein extract is added 20% (v / v) of loading buffer (60 mM Tris-HCl pH 6.8,
<Desc/Clms Page number 33><Desc / Clms Page number 33>
5% (v/v) 2-B-mercaptoéthanol, 10% (v/v) glycérol, 0.01% (v/v) bleu de bromophénol, 1% SDS). Les échantillons sont chauffés à 100 C pendant 1 min avant d'être déposés. 5% (v / v) 2-B-mercaptoethanol, 10% (v / v) glycerol, 0.01% (v / v) bromophenol blue, 1% SDS). The samples are heated at 100 C for 1 min before being deposited.
Les gels (0. 75 mm x 7 cm x 9 cm) sont coulés entre une plaque de verre et une plaque d'alumine. Le tampon d'électrophorèse est composé de 192 mM glycine, 25 mM Tris et 0.1% SDS. La migration verticale est réalisée dans une cuve d'électrophorèse Hoeffner à une intensité de 20 mA par gel pour une tension de 100 à 160 V. The gels (0.75mm x 7cm x 9cm) are cast between a glass plate and an alumina plate. The electrophoresis buffer is composed of 192 mM glycine, 25 mM Tris and 0.1% SDS. The vertical migration is carried out in a Hoeffner electrophoresis tank at an intensity of 20 mA per gel for a voltage of 100 to 160 V.
Transfert et immunodétection des protéines sur nitrocellulose (Western-Blot)
Après migration électrophorétique sur gel d'acrylamide, les protéines peuvent être transférées, en milieu liquide dans le tampon de transfert (0,16 M Tris - 1,20 M glycine), sur membrane de type nitrocellulose ou nylon PVDF (Immobilon, Millipore). Transfer and immunodetection of proteins on nitrocellulose (Western-Blot)
After electrophoretic migration on acrylamide gel, the proteins can be transferred, in liquid medium, into the transfer buffer (0.16 M Tris - 1.20 M glycine), on nitrocellulose membrane or PVDF nylon (Immobilon, Millipore). .
Avant le transfert le gel est équilibré dans le tampon de transfert. La membrane PVDF est activée 1 min dans le méthanol puis équilibrée également dans le tampon de transfert. L'électrotransfert s'effectue pendant 90 min à 150 mA. Before transfer, the gel is equilibrated in the transfer buffer. The PVDF membrane is activated for 1 min in methanol and then equilibrated also in the transfer buffer. Electrotransfer is carried out for 90 min at 150 mA.
L'immunodétection a été réalisée grace à des anticorps spécifiques dirigés contre la mégaspermine ou la protéine de coque du VML. La révélation est effectuée par chimioluminescence avec le kit ECL (Amersham). Immunodetection was performed with specific antibodies against megaspermin or MLV shell protein. The revelation is carried out by chemiluminescence with the ECL kit (Amersham).
Traitement des plantes. Plant treatment.
Avant le traitement, les plantes sont conditionnées quelques jours dans une logette climatisée à 22 C 1 C, sous une luminosité de 5000 lux et une photopériode J/N de 16h/8h. Ces conditions sont maintenues durant l'infection, à l'exception de l'infection par Erwinia carotovora. Before the treatment, the plants are conditioned for a few days in an air-conditioned cubicle at 22 C 1 C, under a luminosity of 5000 lux and a photoperiod J / N of 16h / 8h. These conditions are maintained during infection with the exception of Erwinia carotovora infection.
Inoculation du virus de la mosaïque du tabac (VMT)
Les feuilles de plants de tabac, âgés de 6 semaines, sont frottées à l'aide d'un coton préalablement imbibé dans une suspension de VMT purifié (souche commune U1 0,1 à 1 ug/ml) contenant un abrasif, la célite (10 mg/ml). Après quelques minutes de contact, les feuilles sont rincées à l'eau pour enlever l'excès de célite et de particules virales. Inoculation of the tobacco mosaic virus (VMT)
The leaves of tobacco plants, aged 6 weeks, are rubbed with a cotton wool previously soaked in a suspension of purified VMT (common strain U1 0.1 to 1 μg / ml) containing an abrasive, celite ( 10 mg / ml). After a few minutes of contact, the leaves are rinsed with water to remove excess celite and virus particles.
Inoculation du virus de la mosaïque de la luzerne (VML)
Les feuilles de plants de tabac, âgés de 6 semaines, sont frottées à l'aide d'une spatule en verre trempée dans une solution tampon contenant l'ARN viral (1 à 5 ug/ml) et un abrasif, la célite (10 mg/ml). L'inoculum par feuille (pour une plante) correspond à Inoculation of alfalfa mosaic virus (MLV)
The leaves of tobacco plants, 6 weeks old, are rubbed with a glass spatula dipped in a buffer solution containing the viral RNA (1-5 μg / ml) and an abrasive, celite (10 mg / ml). Inoculum per leaf (for a plant) corresponds to
<Desc/Clms Page number 34><Desc / Clms Page number 34>
200 ml de solution tampon : Kpi , pH 7,2,0,04M, 1 ml RNAsine, DTT ImM final, Macaloïd (0,05%), ARN total de levure 0,25 mg/ml, ARN viral (1 à 5 g/ml)
Inoculation de Phytophthora parasitica var. nicotianae
Le mycélium de P. p. nicotianae est cultivé sur boîte de Pétri contenant un milieu solide (milieu avoine: 100 g de graines d'avoine broyées sont mises en suspension dans 1 1 d'eau distillée. Le milieu est filtré sur gaze. Le milieu est autoclavé après addition de 15 g d'agar). 200 ml buffer solution: Kpi, pH 7.2.0.04M, 1 ml RNAsin, DTT ImM final, Macaloid (0.05%), total yeast RNA 0.25 mg / ml, viral RNA (1 to 5 g / ml)
Inoculation of Phytophthora parasitica var. nicotianae
The mycelium of P. p. Nicotianae is grown on a petri dish containing a solid medium (oat medium: 100 g of crushed oat seeds are suspended in 1 liter of distilled water, the medium is filtered on gauze and the medium is autoclaved after the addition of 15 ml of agar).
L'inoculation a été effectuée après décapitation des plants de tabac. La tige de plants de tabac âgés de 10 semaines est sectionnée sous le bourgeon apical. Une pastille de mycélium de P. p. nicotianae est prélevée en périphérie d'une culture de 7 jours sur milieu d'avoine et est déposée sur la section de la tige. La tige mise en contact avec la pastille de mycélium est en capsulée dans une feuille d'aluminium afin d'éviter une dessiccation trop rapide des tissus au site d'inoculation. Inoculation was performed after decapitation of the tobacco plants. The stem of 10 weeks old tobacco plants is cut under the apical bud. A mycelium pellet of P. p. Nicotianae is collected at the periphery of a 7-day culture on oatmeal and is deposited on the section of the stem. The stem placed in contact with the mycelium pellet is encapsulated in an aluminum foil to prevent too rapid desiccation of the tissues at the site of inoculation.
Inoculation d'Erwinia carotovora
La souche d'Erwinia carotovora est mise en culture toute une nuit à 28 C dans du milieu LB. Après centrifugation, le culot bactérien est repris dans une solution de MgS04 (10mM) pour obtenir une concentration bactérienne approximative de 1.107 cfu (colony-forming units)/ml. Les feuilles de plants de tabac âgés de 4 à 5 semaines sont infiltrées par cette suspension bactérienne. Un seul site est inoculé par feuille, en infiltrant à l'aide d'un pipette-man 50 ml de la suspension bactérienne. Les plantes sont placées ensuite en logettes en condition d'humidité élevée et à une température de 26 C ~1 C pendant l'infection. Inoculation of Erwinia carotovora
The Erwinia carotovora strain is cultured overnight at 28 ° C. in LB medium. After centrifugation, the bacterial pellet is taken up in a solution of MgSO 4 (10 mM) to obtain an approximate bacterial concentration of 1 × 10 7 cfu (colony-forming units) / ml. The leaves of tobacco plants aged 4 to 5 weeks are infiltrated by this bacterial suspension. A single site is inoculated per sheet, by infiltrating with a pipette-man 50 ml of the bacterial suspension. The plants are then placed in stalls under conditions of high humidity and at a temperature of 26 C ~ 1 C during infection.
Traitement par un éliciteur : Des solutions sont infiltrées par un seringue équipée d'une aiguille fine dans le mésophyle des feuilles. Les zones infiltrées sont délimitées avec un marqueur " felt-tip ". Les zones infiltrées sont récoltées 16 heures après le traitement. Les feuilles sont traitées avec une solution de b-mégaspermine, un éliciteur protéique purifié d'un milieu de culture de Phytophthora megasperma (Kauffmann & al., 1993), ou d'oligosaccharides comme les oligomères de chitine (100 mg/ml), des fragments de glucane (200 mg/ml), et des fragments pectiques (200 mg/ml). Treatment with an elicitor: Solutions are infiltrated by a syringe equipped with a fine needle into the mesophyle of the leaves. The infiltrated areas are delimited with a felt-tip marker. The infiltrated areas are harvested 16 hours after treatment. The leaves are treated with a solution of b-megaspermine, a purified protein elicitor of a Phytophthora megasperma culture medium (Kauffmann et al., 1993), or oligosaccharides such as chitin oligomers (100 mg / ml), fragments of glucan (200 mg / ml), and pectic fragments (200 mg / ml).
Les plantes témoins sont infiltrées avec de l'eau. Control plants are infiltrated with water.
Blessure : Des feuilles totalement développées sont blessées avec un hémostat ou percées avec des aiguilles. Les feuilles blessées sont ensuite récoltées 16 ou 24 heures Injury: Fully developed leaves are injured with a hemostat or pierced with needles. The injured leaves are then harvested 16 or 24 hours
<Desc/Clms Page number 35><Desc / Clms Page number 35>
après blessure pour les analyses fluorimétriques ou histochimiques. after injury for fluorimetric or histochemical analyzes.
Traitement UV : La partie supérieure de plantes transgéniques âgées de 5 semaines est exposée aux rayons UV (1=254nm) pendant 10 minutes puis les plantes sont placées dans l'obscurité jusqu'à la collecte des tissus 16 heures suivant le traitement. UV treatment: The upper part of 5-week-old transgenic plants is exposed to UV rays (1 = 254nm) for 10 minutes then the plants are placed in the dark until tissue collection 16 hours after treatment.
Traitements chimiques : (1) Des solutions de SA (ImM) ou de INA (50mM) sont infiltrées dans les feuilles de tabac en employant le protocole décrit pour le traitement par des éliciteurs. (2) Sous des conditions de culture identiques, on pulvérise sur les plantes transgéniques des solutions de SA (IOmM), INA (1mM) ou BTH (50mM). Les tissus sont recueillis 16 heures après traitement. Les plantes traitées avec de l'eau sont utilisées comme témoin. (3) Des plantes âgées de sept semaines sont transférées dans des boites transparentes et hermétiques et soumises à une atmosphère de 3,5mM de MeJa (Serva). Les tissus sont prélevés à différents temps suivant le traitement. Les plantes témoins sont placées dans les même boites sans MeJa. Chemical treatments: (1) Solutions of SA (ImM) or INA (50mM) are infiltrated into tobacco leaves using the protocol described for treatment with elicitors. (2) Under identical culture conditions, solutions of SA (10 mM), INA (1 mM) or BTH (50 mM) are sprayed on the transgenic plants. The tissues are collected 16 hours after treatment. Plants treated with water are used as a control. (3) Plants aged seven weeks are transferred to transparent, sealed boxes and subjected to an atmosphere of 3.5mM MeJa (Serva). The tissues are taken at different times following the treatment. The control plants are placed in the same boxes without MeJa.
Références : Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J.G., Smith, J.A., Struhl, K. (1998) Current protocols in molecular biology. John Wiley & Sons. References: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1998). Current protocols in molecular biology. John Wiley & Sons.
Bradford M.M. (1976). A rapide and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein-dye binding, Anal. Biochem. 72, 248-254. Bradford M.M. (1976). A rapid and sensitive method for the quantitation of micrograms of protein using the principle of protein-dye binding, Anal. Biochem. 72, 248-254.
Collendavelloo J, Legrand M, Geoffroy P, Barthelemy J & Fritig B (1981). Purification and properties of the three o-diphenol O-methyltransferases of tobacco leaves. Collendavelloo J, Legrand M, Geoffrey P, Barthelemy J & Fritig B (1981). Purification and properties of the o-diphenol O-methyltransferases of tobacco leaves.
Phytochemistry 20, 611-616. Phytochemistry 20, 611-616.
Jefferson R. A., Kavanagh T.A. & Bevan M. W. (1987). GUS fusions : b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6,3901-3907. Kamoun S, Young M, Glascock CB & Tyler BM (1993). A gene encoding a hostspecific elicitor protein ofPhytophthora: host specificity and induction of resistance to bacterial and fungal pathogens. Mol. Plant Microbe Interact. 6,15-25. Jefferson R. A., Kavanagh T. A. & Bevan M. W. (1987). GUS fusions: B-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6,3901-3907. Kamoun S, Young M, CB Glascock & Tyler BM (1993). A gene encoding a hostspecific elicitor protein of Phytophthora: host specificity and induction of resistance to bacterial and fungal pathogens. Mol. Plant Microbe Interact. 6.15 to 25.
Kauffmann S., Baillieul F., Genetet I., Kopp M. & Fritig B. (1993). Two proteins secreted by Phytophthora megasperma elicit and defense-related responses in tobacco. In Mechanisms of plant defense responses, B. Fritig and M. Legrand, Dordrecht : Kauffmann S., Baillieul F., Genetet I., Kopp M. & Fritig B. (1993). Two proteins secreted by Phytophthora megasperma elicit and defense-related responses in tobacco. In Mechanisms of Plant Defense Responses, B. Fritig and M. Legrand, Dordrecht:
<Desc/Clms Page number 36><Desc / Clms Page number 36>
Kluwer Academic Publishers, 140-143. Kluwer Academic Publishers, 140-143.
Nagel R., Eliott A., Masel A., Birch R. G. & Manners J.M. (1990). Electroporation of binary Ti plasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes. FEMS Microbiol. Lett. 67,325-328. Nagel R., Eliott A., Masel A., Birch R. G. & Manners J.M. (1990). Electroporation of binary Ti plasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes. FEMS Microbiol. Lett. 67.325-328.
Panabières F, Marais A, Berre JYL, Penot I, Fournier D & Ricci P (1995). Panabières F, Swamp A, Berre JYL, Penot I, Fournier D & Ricci P (1995).
Characterization of a gene cluster ofPhytophthora cryptogea which codesfor elicitins, proteins inducing a hypersensitive-like response in tobacco. Mol. Plant Microbe Interact. 8, 1995. Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hypersensitive-like response in tobacco. Mol. Plant Microbe Interact. 8, 1995.
Pellegrini L., Geoffroy P., Fritig B. & Legrand M. (1993). Molecular cloning and expression of a new class of ortho-diphenol-O-methyltransferases induced in tobacco (Nicotiana tabacum L.) leaves by infection or elicitor treatment. Plant Physiol. 103, 509-517. Pellegrini L., Geoffrey P., Fritig B. & Legrand M. (1993). Molecular cloning and expression of a new class of ortho-diphenol-O-methyltransferases in tobacco (Nicotiana tabacum L.) leaves by infection or elicitor treatment. Plant Physiol. 103, 509-517.
Rossi L., Escudero J., Hohn B. & Tinland B. (1993). Efficient and sensitive assay for TDNA dependant transient gene expression. Plant Mol. Biol. Rep. 12, 220-229. Rossi L., J. Escudero, Hohn B. & Tinland B. (1993). Efficient and sensitive assay for TDNA dependent transient gene expression. Plant Mol. Biol. Rep. 12, 220-229.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York : Spring Harbor Laboratory Press. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Spring Harbor Laboratory Press.
Sanger F., Nicklens S. & Coulson A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74,5463-5467. F. Sanger, Nicklens S. & Coulson A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74.5463-5467.
Trienzenberg S. J. (1992). Primer extension. In Current Protocols in Molecular Biology. Trienzenberg S.J. (1992). Primer extension. In Current Protocols in Molecular Biology.
J. Wiley & Sons eds. 20.4.8.1 J. Wiley & Sons eds. 20.4.8.1
Claims (32)
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR9907646A FR2791360B1 (en) | 1999-03-22 | 1999-06-11 | INDUCTIBLE PROMOTER, COMTII, CHIMERIC GENE COMPRISING SAME AND TRANSFORMED PLANTS |
PCT/FR2000/000714 WO2000056897A1 (en) | 1999-03-22 | 2000-03-22 | Inducible comtii promoter, chimera gene containing same and transformed plants |
EP00912723A EP1163348A1 (en) | 1999-03-22 | 2000-03-22 | Inducible comtii promoter, chimera gene containing same and transformed plants |
CA002366217A CA2366217A1 (en) | 1999-03-22 | 2000-03-22 | Inducible comtii promoter, chimera gene containing same and transformed plants |
AU34380/00A AU3438000A (en) | 1999-03-22 | 2000-03-22 | Inducible comtii promoter, chimera gene containing same and transformed plants |
US10/633,840 US20040029167A1 (en) | 1999-03-22 | 2003-08-04 | Inducible COMT_II promoter, chimeric gene containing same and plants transformed therewith |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR9903700A FR2791359A1 (en) | 1999-03-22 | 1999-03-22 | Inducible promoter for plants, useful for controlling expression of e.g. disease-resistance genes, is derived from an O-methyltransferase gene and is induced by injury or infection |
FR9907646A FR2791360B1 (en) | 1999-03-22 | 1999-06-11 | INDUCTIBLE PROMOTER, COMTII, CHIMERIC GENE COMPRISING SAME AND TRANSFORMED PLANTS |
Publications (2)
Publication Number | Publication Date |
---|---|
FR2791360A1 true FR2791360A1 (en) | 2000-09-29 |
FR2791360B1 FR2791360B1 (en) | 2003-10-10 |
Family
ID=26234879
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
FR9907646A Expired - Fee Related FR2791360B1 (en) | 1999-03-22 | 1999-06-11 | INDUCTIBLE PROMOTER, COMTII, CHIMERIC GENE COMPRISING SAME AND TRANSFORMED PLANTS |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1163348A1 (en) |
AU (1) | AU3438000A (en) |
CA (1) | CA2366217A1 (en) |
FR (1) | FR2791360B1 (en) |
WO (1) | WO2000056897A1 (en) |
Families Citing this family (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002009501A1 (en) * | 2000-07-28 | 2002-02-07 | Molecular Plant Brdding Nominees Ltd. | Modification of plant resistance to diseases and/or pests |
PT2557174T (en) | 2004-04-06 | 2016-08-18 | Fibria Celulose S/A | Cambium/xylem-preferred promoters and uses thereof |
BR112013030724B1 (en) | 2011-05-31 | 2020-10-27 | Keygene N.V | chimeric gene, vector, host cell, use of a nucleic acid molecule and method to produce a transgenic plant having increased resistance to the insect pest |
EP2768952A2 (en) | 2011-10-19 | 2014-08-27 | Keygene N.V. | Methods for producing cinnamolide and/or drimendiol |
WO2013095125A1 (en) | 2011-12-16 | 2013-06-27 | Keygene N.V. | Method for producing a plant having enhanced disease resistance to nematodes |
WO2014142647A1 (en) | 2013-03-14 | 2014-09-18 | Wageningen Universiteit | Fungals strains with improved citric acid and itaconic acid production |
WO2017039452A1 (en) | 2015-09-04 | 2017-03-09 | Keygene N.V. | Diplospory gene |
BR112021023769A2 (en) | 2019-05-29 | 2022-01-11 | Keygene Nv | gene for parthenogenesis |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015585A1 (en) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Method for the protection of plants against pathogens |
WO1993005160A1 (en) * | 1991-09-10 | 1993-03-18 | Zeneca Limited | Modification of lignin synthesis in plants |
WO1995003690A1 (en) * | 1993-08-02 | 1995-02-09 | Virginia Tech Intellectual Properties, Inc. | Hmg2 promoter expression system and post-harvest production of gene products in plants and plant cell cultures |
WO1996036697A1 (en) * | 1995-05-18 | 1996-11-21 | Board Of Trustees Of The University Of Kentucky | Transcriptional control sequences and methods |
WO1999009188A2 (en) * | 1997-08-13 | 1999-02-25 | Vlaams Interuniversitair Instituut Voor Biotechnologie | Tissue-specific poplar promoters |
-
1999
- 1999-06-11 FR FR9907646A patent/FR2791360B1/en not_active Expired - Fee Related
-
2000
- 2000-03-22 AU AU34380/00A patent/AU3438000A/en not_active Abandoned
- 2000-03-22 WO PCT/FR2000/000714 patent/WO2000056897A1/en not_active Application Discontinuation
- 2000-03-22 EP EP00912723A patent/EP1163348A1/en not_active Withdrawn
- 2000-03-22 CA CA002366217A patent/CA2366217A1/en not_active Abandoned
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015585A1 (en) * | 1990-04-02 | 1991-10-17 | Rijkslandbouwuniversiteit Wageningen | Method for the protection of plants against pathogens |
WO1993005160A1 (en) * | 1991-09-10 | 1993-03-18 | Zeneca Limited | Modification of lignin synthesis in plants |
WO1995003690A1 (en) * | 1993-08-02 | 1995-02-09 | Virginia Tech Intellectual Properties, Inc. | Hmg2 promoter expression system and post-harvest production of gene products in plants and plant cell cultures |
WO1996036697A1 (en) * | 1995-05-18 | 1996-11-21 | Board Of Trustees Of The University Of Kentucky | Transcriptional control sequences and methods |
WO1999009188A2 (en) * | 1997-08-13 | 1999-02-25 | Vlaams Interuniversitair Instituut Voor Biotechnologie | Tissue-specific poplar promoters |
Non-Patent Citations (17)
Title |
---|
BAILLIEUL, F., ET AL.: "A new elicitor of the hypersensitive response in tobacco: a fungal glycoprotein elicits cell death, expression of defense genes, production of salicylic acid, and induction of systemic acquired resistance", THE PLANT JOURNAL, vol. 8, no. 4, 1995, pages 551 - 560, XP002124704 * |
CAPELLADES M ET AL: "THE MAIZE CAFFEIC ACID O-METHYLTRANSFERASE GENE PROMOTER IS ACTIVE IN TRANGENIC TOBACCO AND MAIZE PLANT TISSUES", PLANT MOLECULAR BIOLOGY,NL,NIJHOFF PUBLISHERS, DORDRECHT, vol. 31, 1996, pages 307-322, XP002054327, ISSN: 0167-4412 * |
CHEMICAL ABSTRACTS, vol. 120, no. 11, 14 March 1994, Columbus, Ohio, US; abstract no. 129730, KAUFFMANN, S. ET AL: "Two proteins secreted by Phytophthora megasperma elicit necrosis and defense-related responses in tobacco." XP002124706 * |
CHEMICAL ABSTRACTS, vol. 128, no. 23, 8 June 1998, Columbus, Ohio, US; abstract no. 279382, LEE, J. E. ET AL: "Genomic sequence and mapping of a methyljasmonate-induced O- methyltransferase from barley (Hordeum vulgare L.)" XP002124705 * |
CHEN, C.: "Populus trichocarpa CCoAOMT2 gene, exon 1 to exon 5", EMBL ACCESSION NO:AJ223620, 4 September 1998 (1998-09-04), XP002124699 * |
DEV. PLANT PATHOL. (1993), 2(MECHANISMS OF PLANT DEFENSE RESPONSES), 140-3 * |
DNA SEQUENCE, vol. 7, no. 6, 1997, pages 357 - 363 * |
GRIMMIG, BERNHARD ET AL: "Structure of the parsley caffeoyl -CoA O- methyltransferase gene, harboring a novel elicitor responsive cis-acting element", PLANT MOL. BIOL. (1997), 33(2), 323-341, XP002054325 * |
HUET, J.C., ET AL.: "Alpha-elicitin MGM-alpha", SWISSPROT ACCESSION NO:P35698, 1 June 1994 (1994-06-01), XP002124702 * |
HUET, J.C., ET AL.: "Beta-elicitin MGM-beta", SWISSPROT ACCESSION NO:P35699, 1 June 1994 (1994-06-01), XP002124703 * |
KELLER, HARALD ET AL: "Pathogen- induced elicitin production in transgenic tobacco generates a hypersensitive response and nonspecific disease resistance", PLANT CELL (1999), 11(2), 223-235, February 1999 (1999-02-01), XP002124696 * |
LEE, J.E., ET AL.: "Hordeum vulgare caffeic acid O-methyltransferase (HvCOMT) gene, complete cds", EMBL ACCESSION NO:U54767, 23 August 1996 (1996-08-23), XP002124698 * |
PANABIERES, F.: "Beta-elcitin cryptogein precursor", SWISSPROT ACCESSIO NO:P15570, 1 April 1990 (1990-04-01), XP002124701 * |
PANABIERES, F.: "P.cryptogea X24 gene for cryptogein", EMBL ACCESSION NO:Z34459, 1 December 1994 (1994-12-01), XP002124700 * |
PANABIERESS, F., ET AL.: "Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, protein inducing a hypersensitive-like response in tobacco", MOL PLANT MICROBE INTERACT., vol. 8, 1995, pages 996 - 1003 * |
PELLEGRINI, L.: "N.tabacum mRNA for o-diphenol-O-methyltransferase", EMBL ACCESSION NO:X71430, 23 November 1993 (1993-11-23), XP002124695 * |
PELLEGRINI, LUCA ET AL: "Molecular cloning and expression of a new class of ortho-diphenol-O- methyltransferases induced in tobacco (Nicotiana tabacum L.) leaves by infection or elicitor treatment", PLANT PHYSIOL. (1993), 103(2), 509-17, XP002124694 * |
Also Published As
Publication number | Publication date |
---|---|
FR2791360B1 (en) | 2003-10-10 |
AU3438000A (en) | 2000-10-09 |
EP1163348A1 (en) | 2001-12-19 |
CA2366217A1 (en) | 2000-09-28 |
WO2000056897A1 (en) | 2000-09-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111225980B (en) | Control of fungal pathogens using RNAi-based strategies | |
FR2889540A1 (en) | SAME-SPECIFIC CHLOROPHYLL A / C PROTEIN PROMOTER | |
FR2791360A1 (en) | INDUCIBLE PROMOTER, COMTII, CHIMERE GENE COMPRISING SAME AND TRANSFORMED PLANTS | |
EP1196581B1 (en) | Promoter expressed specifically in the cells of plant roots, recombinant vectors and host cells comprising same and transgenic plants obtained | |
EP2627667B1 (en) | Production of plants having improved water-deficit tolerance | |
FR2775000A1 (en) | INDUCIBLE PROMOTER IN PLANTS, SEQUENCE INCORPORATING THIS PROMOTER AND PRODUCT OBTAINED | |
CN107446946B (en) | Esterase gene for disease-resistant regulation of gramineous plants | |
EP1185669B1 (en) | Promoter enabling transgene expression in the whole plant except in the seed | |
US20040029167A1 (en) | Inducible COMT_II promoter, chimeric gene containing same and plants transformed therewith | |
FR2791359A1 (en) | Inducible promoter for plants, useful for controlling expression of e.g. disease-resistance genes, is derived from an O-methyltransferase gene and is induced by injury or infection | |
WO2003060135A2 (en) | Use of a wdv promoter for phloem-specific expression | |
WO1995020046A1 (en) | Plant aconitases and nucleic acids coding therefor | |
Sultana et al. | Epidermal cell-patterning genes of the stem parasitic plant Cuscuta campestris are involved in the development of holdfasts | |
CA2737405A1 (en) | Importation of a ribozyme into vegetable mitochondria by a pseudo-trna that can be aminoacylated by valine | |
FR2811680A1 (en) | INDUCTIBLE LIPOXYGENASE PROMOTER, EXPRESSION CASSETTES COMPRISING THE SAME AND TRANSFORMED PLANTS | |
EP1121451B1 (en) | Method for obtaining transgenic plants expressing a protein with activity producing hydrogen peroxide by transformation by agrobacterium rhizogenes | |
EP1392834A2 (en) | Lipoxygenase overexpression in plants and reduction in plant sensitivity to diseases and attacks from pathogenic organisms | |
EP1414966A2 (en) | Regulating nucleic acid for expressing a polynucleotide of interest specifically in the endothelium of a plant seed and uses thereof | |
WO2005063989A1 (en) | Promoter nucleotidic sequences inducible by infection by pathogens | |
FR2995613A1 (en) | New nucleic acid sequence having specified nucleotide sequence, useful as promoter to control the expression of reporter genes in plants of coffee/tobacco and to control transgene expression in response to biotic/abiotic stress in coffee | |
FR3141177A1 (en) | NEW PEPTIDES AND THEIR USE TO MODULATE THE ACCUMULATION OF A PROTEIN | |
WO2012049661A1 (en) | Production of plants with improved tolerance to water deficit | |
WO2005116214A2 (en) | Destructive insect-inducible promoters and uses thereof | |
WO2004005329A1 (en) | Plant peptide with antimicrobial activity | |
FR2897871A1 (en) | Use of a nucleic acid coding for a CYP98A9 protein to produce plants with increased resistance to environmental stress |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ST | Notification of lapse |