FR2791360A1 - INDUCIBLE PROMOTER, COMTII, CHIMERE GENE COMPRISING SAME AND TRANSFORMED PLANTS - Google Patents

Abstract

The invention concerns a novel regulating COMTII promoter sequence inducible in response to a mechanical or chemical injury, or in response to aggression by a pathogenic agent, in particular bacterial, fungal or viral, or by an insect or a threadworm. The invention also concerns a chimera gene (or expression cassette) comprising the inventive regulating promoter sequence controlling the expression of a heterologous coding sequence and host organism comprising said chimera gene, the transformed plants containing it and the seeds of said transformed plants.

Description

<Desc / Clms Page number 1>

COMTII inducible promoter, chimeric gene comprising it and transformed plants
The present invention relates to a novel inducible promoter regulatory sequence in response to a mechanical or chemical injury, or in response to aggression by a pathogen, in particular a bacterial, fungal or viral agent, or an insect or a nematode.

 The present invention also relates to a chimeric gene (or expression cassette) comprising the promoter regulatory sequence according to the invention which controls the expression of a heterologous, heterologous coding sequence, meaning here a coding sequence different from the native coding sequence.

 The present invention also relates to a host organism comprising said chimeric gene, the transformed plants comprising it and the seeds of said transformed plants.

 It is known from the state of the art that certain genes, silent in the absence of aggression, are activated only by a mechanical as well as chemical aggression and / or in response to an attack by a pathogen, an insect or a nematode. Such genes and their activation factors are described in US Pat. No. 5,670,349.

 These different modes of defense are generally related to a regulation of the expression of certain genes involved in the defense mechanisms of plants by induction of their promoter regulatory sequences. Several inducible regulatory sequences are known, such as the promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, proteinase inhibitors (PI), genes of the PR1 family, of nopaline synthase (nos) or of the vspB gene, all these promoters being recalled with the references of the corresponding publications in Table 3 of US Pat. No. 5,670,349. The HMG2 promoter described in that same patent US Pat. No. 5,670,349 is also known, as the apple beta-galactosidase (ABG1) promoter or the apple amino cyclopropane carboxylate syntase (ACC synthase) promoter described in patent application WO 98/45445.

 The present invention relates to a novel nucleic acid fragment, in particular isolated, comprising an inducible promoter (or promoter regulatory) promoter, said inducible promoter consisting of the promoter of a

<Desc / Clms Page number 2>

 O-methyltransferase class II gene (hereinafter COMT II) of plant.

 Class II O-methyltransferase genes, including the Class II caffeic acid-Omethyltransferase gene, of plants are silent (inactive) in the absence of any aggression since unaffected plants do not express it, or at least at undetectable levels by the usual methods of analysis. Thus, the messenger of COMT II is undetectable by the "Northern blot" technique in different tissues of a healthy untreated plant, such as tobacco (Pellegrini et al., 1993).

This COMTII and its promoter are activated (or induced) by wounds, viral infections, UV aggressions, or chemical aggressions by different products such as benzothiazole (BTH), methyl jasmonate or elicitors of plant origin as pectin.

 Advantageously, the isolated nucleic acid fragment according to the invention consists of a plant COMTII promoter.

 The term "plant COMTII" is understood to mean any plant OMT which is not expressed in untreated healthy plants, but which is as a result of a mechanical, chemical attack by a pathogen or an insect. or a nematode.

 By plant of origin of the COMTII is meant according to the invention any differentiated pluricellular organism capable of photosynthesis, be it monocotyledonous or dicotyledonous, such as rice, wheat, barley, sunflower, corn, tobacco, rapeseed, soybean or Arabidopsis thaliana.

 According to a particular embodiment of the invention, COMT II is a dicotyledonous plant COMT, preferably tobacco.

 By promoter is meant according to the invention the non-coding region of a gene involved in binding with RNA polymerase and other factors which are responsible for the initiation and modulation of transcription leading to the production of an RNA transcript. It is more particularly any sequence 5 'of the translation initiation site or "start" codon (ATG) of the coding sequence of COMTII for the transcription and expression of said coding sequence.

 The promoter according to the invention advantageously comprises a sequence of more than 600 nucleotides upstream of the ATG of COMT II, preferably more than 700, more than 800 or even more than 900 nucleotides upstream of the ATG, more preferably more than 1000 nucleotides upstream of the ATG, even more

<Desc / Clms Page number 3>

 preferably more than 1200 nucleotides upstream of the ATG. Promoters comprising more than 1500 nucleotides upstream of the ATG of COMTII are also part of the present invention.

 The promoter comprises a transcription initiation site. The transcription initiation site is generally located within 100 nucleotides upstream of the ATG, preferably about 90 nucleotides upstream.

 Advantageously, the 3 'end of the COMTII promoter according to the invention is located between the transcription initiation site and the ATG. Preferably, the 3 'end of the COMTII promoter is located between 10 and 50 nucleotides downstream of the transcription initiation site, more preferably between 20 and 40 nucleotides downstream, even more preferably between 20 and 30 nucleotides downstream.

 The COMTII promoter according to the invention also comprises at least one TATA box and at least one CAT box. The TATA box is generally located within 50 nucleotides upstream of the transcription initiation site, at about 40 nucleotides upstream. The CAT box is generally located within 100 nucleotides upstream of the transcription initiation site, preferably about 100 nucleotides and / or 80 nucleotides upstream. Advantageously, the promoter comprises two CAT boxes.

 The promoter according to the invention also comprises regulatory elements involved in the expression of genes for the metabolism of phenylpropanoids and genes associated with defense, in particular at least one box A and / or at least one box L and / or at least one an inverted box L and / or at least one box P and / or at least one inverted box W. Box A includes the following sequence CCGTCC. It is generally located within 410 nucleotides of the transcription initiation site.

The box L comprises the following sequence CTTCAACAACCAACC. It is usually located within 180 nucleotides of the transcription initiation site.

The first inverted L box comprises the following sequence GTTAGGTGAAG. It is generally located within 1000 nucleotides upstream of the transcription initiation site. Advantageously, the promoter according to the invention comprises two inverted L-boxes, one at about 970 nucleotides upstream of the transcription initiation site and the other at about 440 nucleotides upstream. The second inverted L box comprises the following sequence TGTTAGGTGTGTGTTT. The P box

<Desc / Clms Page number 4>

 includes the following sequence CACACCAACTCCCA. It is generally located within 750 nucleotides upstream of the transcription initiation site. The inverted W box comprises the following sequence GGTCAA. It is generally located within 1200 nucleotides upstream of the transcription initiation site.

Advantageously, the promoter according to the invention comprises two inverted W boxes, one at about 1110 nucleotides upstream and the other at about 210 nucleotides upstream.

 The promoter according to the invention also comprises at least one box E and / or at least one box G and / or at least one box GT. Box E comprises the following sequence TTCCATCAAG. It is generally located within 110 nucleotides upstream of the transcription initiation site. Box G includes the following sequence CCACGT. It is generally located within 600 nucleotides upstream of the transcription initiation site. The GT box includes the following sequence GGTTAA.

It is generally located within 450 nucleotides upstream of the transcription initiation site. Advantageously, the promoter according to the invention comprises two GT boxes, one at about 400 nucleotides upstream and the other at about 280 nucleotides upstream.

 According to an advantageous embodiment of the invention, the promoter according to the invention consists of the tobacco COMTII promoter defined by the nucleotide sequence upstream of the ATG represented by the sequence identifier 1 (SEQ ID NO 1). , preferably the sequence between nucleotides 557 and 1795 of the sequence identifier n 1, the sequences capable of hybridizing selectively to said sequences and their homologous sequences.

 By sequence capable of hybridizing selectively is meant according to the invention sequences which hybridize with the above sequences at a level substantially greater than the background. Background noise may be related to the hybridization of other DNA sequences present, including other cDNAs present in a cDNA library. The level of the signal generated by the interaction between the sequence capable of hybridizing selectively and the sequences defined by the above ID sequences according to the invention is generally 10 times, preferably 100 times more intense than that of the invention. interaction of the other DNA sequences generating the background noise. The level of interaction can be measured, for example, by marking the probe

<Desc / Clms Page number 5>

 with radioactive elements, like the 32P. Selective hybridization is generally achieved by employing very severe environmental conditions (eg, 0.03 M NaCl and 0.03 M sodium citrate at about 50 C-60 C). Hybridization can of course be carried out according to the usual methods of the state of the art (in particular Sambrook et al., 1989, Molecular Cloning: A Labratory Manual).

 By homologous sequence is meant according to the invention any sequence comprising more than 70% of homology, preferably more than 80% of homology, still more preferably more than 90% of homology, and which retains the functional elements of COMTII itself. conferring its inducible promoter properties. Methods for measuring and identifying homologies between nucleic acid sequences are well known to those skilled in the art. For example, the PILEUP or BLAST programs can be used (in particular Altschul et al., 1993, J. Mol, Evol 36: 290-300, Altschul et al., 1990, J. Mol Biol 215: 403-10). .

 The isolation, cloning and characterization of COMT II promoters from the COMT II genes is done according to the usual experimental methods of those skilled in the art for isolating, cloning and characterizing a promoter, extensively described in the literature.

 The isolation and cloning of a COMT II gene is done by analysis of a genomic library prepared from the DNA of the plant of interest. The genomic DNA is cleaved by one or more appropriate restriction enzymes and introduced into a suitable vector to constitute, by methods known to those skilled in the art, a library containing all the genomic DNA of the plant (Ausubel et al. 1998, Sambrook et al., 1989).

 The clone (s) containing a COMT II gene is (are) isolated using a nucleotide probe. The sequence of the probe is. deduced from the protein sequence if the enzyme has been purified (following its activity, for example) or prepared from a cDNA clone from a library. This cDNA library is prepared from mRNA extracted from tissues treated to induce expression of the COMT II gene (by injury, infection or chemical treatment as described in the examples or Figures 1-5). The cDNA library is then screened by antibodies directed against a COMT II protein (tobacco for example) or by a nucleotide probe deduced from the COMT II protein of the plant in question or deduced from the sequences conserved in the

<Desc / Clms Page number 6>

 COMT of plants. The cDNA thus isolated is characterized by its nucleotide sequence or by the enzymatic activity of the recombinant protein obtained after expression of the cDNA in a prokaryotic or eukaryotic organism.

 The non-coding sequences of cDNA (3 'and / or 5') are used to select, by PCR, under very selective conditions, the genomic clone (s) containing the COMT II gene expressed during the treatment used to construct the cDNA library. The promoter sequences are then isolated by PCR or any other suitable method well known to those skilled in the art.

 On the basis of the information contained in the present patent application for the tobacco COMTII promoter, a person skilled in the art will be able to identify other COMTII promoters of other plant species once the COMTII gene has been identified and cloned according to the usual methods, especially those described above.

 The present invention also relates to a chimeric gene (or expression cassette) functional in plant cells and plants comprising in the sense of transcription a 5 'regulatory sequence, a coding sequence and a 3' regulatory sequence, the 5 'regulatory sequence comprising a COMT II promoter according to the invention defined previously.

 By "plant cell" is meant according to the invention any cell derived from a plant and may constitute undifferentiated tissues such as calli, differentiated tissues such as embryos, parts of plants, plants or seeds.

 The term "plant" according to the invention is understood to mean any differentiated multicellular organism capable of photosynthesis, in particular monocotyledons or dicotyledons, more particularly culture plants, whether or not intended for animal or human nutrition, such as corn, wheat, cereals or the like. rapeseed, soybeans, rice, sugar cane, beets, tobacco, cotton, etc.

 As a 5 'regulatory sequence, the COMTII promoter according to the invention may be used alone or in combination with at least a part of a promoter of a gene expressing naturally in plants, in particular a promoter expressing in particular in the leaves of the plants, such as constitutive promoters of bacterial, viral or plant origin or so-called dependent light promoters such as that of a gene of the small subunit of ribulose-biscarboxylase / oxygenase (RuBisCO) of plant or any known suitable promoter that can be used. Among

<Desc / Clms Page number 7>

 promoters of plant origin are the histone promoters as described in application EP 0 507 698, or the rice actin promoter (US Pat. No. 5,641,876). Among the promoters of a plant virus gene, mention will be made of cauliflower mosaic (CAMV 19S or 35S), or the circovirus promoter (AU 689 311).

 It is also possible to use the COMTII promoter according to the invention in combination with at least a part of a promoter specific for particular regions or tissues of plants, and more particularly seed-specific promoters ([22] Datla, R. & al Biotechnology Ann Rev. (1997) 3,269-296), including the promoters of napin (EP 255,378), phaseolin, glutenin, heliantinin (WO 92/17580), albumin (WO 98/45460) or oelosine (WO 98/45461).

 According to the invention, it is also possible to use, in association with the COMTII promoter according to the invention, other regulatory sequences, which are situated between the promoter and the coding sequence, such as enhancer enhancers. , such as, for example, the tobacco mosaic virus (TMV) translational activator described in WO 87/07644, or tobacco etch virus (VET) described by Carrington & Freed.

 As a terminating or polyadenylation regulatory sequence, it is possible to use any corresponding sequence of bacterial origin, such as, for example, the Nos terminator of Agrobacterium tumefaciens, or else of plant origin, such as for example a histone terminator as described in US Pat. EP 0 633 317.

 The coding sequence of the chimeric gene according to the invention comprises a coding sequence for a reporter gene, such as the GUS coding sequence, or a coding sequence for a protein of interest. In view of the mode of induction of the promoter according to the invention, wound, viral infection or response to elicitors, the protein of interest is advantageously a protein conferring on the plants properties of resistance to diseases or insects.

 Among the proteins or peptides of interest conferring new properties of resistance to diseases include chitinases, glucanases, oxalate oxidase, all these proteins and their coding sequences being widely described in the literature, or the antibacterial peptides and / or antifungals, in particular peptides with less than 100 amino acids rich in cysteines, such as thionines or plant defensins, and more particularly lytic peptides of all origins

<Desc / Clms Page number 8>

 comprising one or more disulfide bridges between cysteines and regions comprising basic amino acids, especially the following lytic peptides: androctonin (WO 97/30082 and PCT / FR98 / 01814, filed Aug. 18, 1998) or drosomicin (PCT / FR98 / 01462, filed July 8, 1998).

 According to a preferred embodiment of the invention, the protein or peptide of interest is chosen from fungal eliciting peptides, in particular elicitins (Kamoun et al., 1993, Panabières et al., 1995). Preferably, the fungal elicitor peptide is megaspermine. Megaspermin and its coding sequence is represented by sequence identifier 13 (SEQ ID 13). More preferably, the chimeric gene according to the invention comprising in the direction of transcription a 5 'regulatory sequence comprising a COMT II promoter and a coding sequence for megaspermine comprises the DNA sequence represented by the identifier of sequence No. 14 (SEQ ID 14).

 Among the proteins of interest conferring novel insect resistance properties, mention will be made more particularly of the Bt proteins widely described in the literature and well known to those skilled in the art. Also mentioned are proteins extracted from bacteria such as Photorabdus (WO 97/17432 & WO 98/08932).

 The present invention also relates to a chimeric gene (or expression cassette) functional in plant cells and plants comprising in the sense of transcription a 5 'regulatory sequence, a coding sequence for an elicitor and a regulatory sequence in 3 ', the 5' regulatory sequence comprising an inducible promoter.

 Preferably, the elicitor is an elicitin, more preferably the megaspermine as defined above.

 The inducible promoter is advantageously chosen from promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, proteinase inhibitors (PI), genes of the PR1 family, nopaline synthase (nos) or the vspB gene (US 5,670,349, Table 3), the HMG2 promoter (US 5,670,349), the apple beta-galactosidase (ABG1) promoter or the amino cyclopropane promoter carboxylate syntase (ACC synthase) of apple (WO 98/45445).

 The present invention also relates to a cloning and / or expression vector for the transformation of plant cells or plants containing at least one

<Desc / Clms Page number 9>

 minus a chimeric gene as defined above. This vector comprises, in addition to the above chimeric gene, at least one origin of replication. This vector may consist of a plasmid, a cosmid, a bacteriophage or a virus, transformed by the introduction of the chimeric gene according to the invention. Such transformation vectors are well known to those skilled in the art and widely described in the literature. For the transformation of plant cells or plants, it will include a virus that can be used for the transformation of plants developed and further containing its own elements of replication and expression. Preferably, the transformation vector of the plant cells or plants according to the invention is a plasmid.

 For the transformation of plant cells or plants, the chimeric gene according to the invention may be used in combination with a selection marker gene, either in the same vector, the two genes being associated convergently, divergently or collinearly, or in two vectors used simultaneously for transformation of the host organism. Such marker genes and their use for plant transformation are well known to those skilled in the art and widely described in the literature.

 Genes encoding selection markers include antibiotic resistance genes, herbicide tolerance genes (bialaphos, glyphosate or isoxazoles), genes encoding easily identifiable reporter enzymes such as the GUS enzyme, genes encoding pigments or enzymes regulating the production of pigments in transformed cells. Such selection marker genes are in particular described in patent applications EP 242 236, EP 242 246, GB 2 197 653, WO 91/02071, WO 95/06128, WO 96/38567 or WO 97/04103.

 The subject of the invention is also a process for transforming plant cells by integration into the genome of said plant cells of at least one chimeric gene as defined above, which transformation can be obtained by any appropriate known means, amply described in the specialized literature and in particular the references cited in the present application, more particularly by the vector according to the invention.

 A series of methods involves bombarding cells, protoplasts or

<Desc / Clms Page number 10>

 tissues with particles to which are attached the DNA sequences. Another series of methods consists in using as transfer means in the plant a chimeric gene inserted into an Agrobacterium tumefaciens Ti plasmid or Agrobacterium rhizogenes Ri plasmid. Other methods can be used such as microinjection or electroporation, or direct precipitation using PEG.

Those skilled in the art will choose the appropriate method depending on the nature of the host organism, in particular the plant cell or the plant.

 The present invention also relates to plant cells or transformed plants and containing a chimeric gene defined above.

 The subject of the present invention is also the plants containing transformed cells, in particular the plants regenerated from the transformed cells. Regeneration is obtained by any suitable method which depends on the nature of the species, as for example described in the references above. For plant cell transformation and plant regeneration processes, mention may be made in particular of the following patents and patent applications: 4,459,355, US 4,536,475, US 5,464,763, US 5,177,010, US 5,187,073, EP 267,159, EP 604,662, EP 672,752, US 4,945,050, US 5,036,006, US 5,100,792, US 5,371,014, US 5,478,744, US 5,179,022, US 5,565,346, US 5,484,956, US 5,508,468, US 5,538,877, US 5,554,798, US 5,489,520, US 5,510,318, US 5,204,253, US 5,405,765, EP 442,174, EP 486,233, EP 486,234, EP 539,563, EP 674,725, WO 91/02071 and WO 95/06128.

 The present invention also relates to the transformed plants resulting from the cultivation and / or crossing of the regenerated plants above, as well as the seeds of transformed plants.

 The transformed plants obtainable according to the invention may be of the monocotyledonous type such as, for example, cereals, sugar cane, rice and maize or dicotyledons, for example tobacco, soya, rapeseed, cotton, sunflower, beetroot, clover, etc.

 Transformed plants according to the invention may contain other genes of interest, conferring on plants new agronomic properties. Among the genes conferring new agronomic properties to transformed plants include genes conferring tolerance to certain herbicides, those conferring tolerance to certain insects, those conferring tolerance to certain diseases. Such genes are

<Desc / Clms Page number 11>

 especially described in patent applications WO 91/02071 and WO 95/06128. Mention may also be made of genes modifying the constitution of modified plants, in particular the content and the quajity of certain essential fatty acids (EP 666 918) or the content and quality of the proteins, in particular in the leaves and / or seeds. said plants. In particular, the genes encoding proteins enriched in sulfur amino acids ([1], WO 98/20133, WO 97/41239, WO 95/31554, WO 94/20828 and WO 92/14822) will be mentioned in particular. These proteins enriched in sulfur amino acids will also function to trap and store cysteine and / or excess methionine, to avoid the potential problems of toxicity related to overproduction of these sulfur-containing amino acids by trapping them. Mention may also be made of genes coding for peptides rich in sulfur amino acids and more particularly in cysteines, the said peptides also having an antibacterial and / or antifungal activity. Mention may be made more particularly of plant defensins, as well as lytic peptides of any origin, and more particularly the following lytic peptides: androctonine (WO 97/30082 and PCT / FR98 / 01814, filed August 18, 1998) or Drosomicin (PCT / FR98 / 01462, filed July 8, 1998).

 These other genes of interest can be combined with the chimeric gene according to the invention either by conventional crossing of two plants each containing one of the genes (the first the chimeric gene according to the invention and the second the gene coding for the protein of the invention. interest) by carrying out the transformation of plant cells of a plant containing the gene coding for the protein of interest with the chimeric gene according to the invention.

 The following examples illustrate the invention, without seeking to limit its scope.

 All the methods or operations described below in these examples are given as examples and correspond to a choice, made among the various methods available to achieve the same result. This choice has no impact on the quality of the result and therefore, any suitable method can be used by those skilled in the art to achieve the same result. Most methods of engineering DNA fragments are described in "Current Protocols in Molecular Biology" Volumes 1 and 2, Ausubel F.M. et al or Sambrook et al 1989.

 Description of Figure 1: GUS activities (1A) corresponding to the

<Desc / Clms Page number 12>

 construction promoter COMTII (-1215 to +24) / GUS and COMTII (1B) during a viral infection (VMT) or during an injury.

Example 1: Isolation of the Class II COMT Gene
Screening of a genomic tobacco library made it possible to isolate 6 different clones containing COMT class II (COMTII) genes. These were first characterized by their restriction profiles which revealed some heterogeneity among the different clones.

 COMTIIs form a multigenic family composed of six to seven genes, only one of which is transcribed in defense reactions since only one type of cDNA has been characterized in a bank made from leaves inoculated with tobacco mosaic virus. (VMT) (Pellegrini et al., 1993). In order to identify the clone (s) containing the expressed gene in defense reactions, PCR reactions were performed using primers derived from the 3 'non-coding region of the cDNA. Under conditions of high selectivity a single clone is then amplified. The amplification products were sequenced. The sequences obtained showed perfect homology with those of the 3 'non-coding regions of the cDNA.

Example 2 Sequence Analysis of the Class II COMT Gene Promoter
The retained genomic clone was subcloned into a bacterial vector (puc 18) and represents a 14 kb insert of which 9 kb are located upstream of the ATG of the COMTII gene.

 The transcription initiation site was determined by the primer extension technique and is located at 90 nucleotides from the translation initiation site.

 The promoter was sequenced over 1771 kilobases. Non-specific elements common to the eukaryotic genes involved in the initiation of transcription such as the TATA box and the CAT box have been found in the COMTII promoter (SEQ ID No. 1). Regulatory sites have been demonstrated by comparison of the promoter sequences of the COMTII gene with those of genes involved in the defense mechanisms. The COMTII promoter contains specific elements of the phenylpropanoid metabolism genes involved in the stress response such as the three P, A, L boxes (initially identified in the parsley PAL gene) (SEQ ID NO 1). These three boxes are involved in the response to

<Desc / Clms Page number 13>

 elicitors and the P and L boxes are also involved in the UV response. The E-box initially identified in the parsley CCoAOMT gene and highly conserved in phenylpropanoid metabolism genes also plays a role in the response to elicitors.

 The COMTII promoter also has elements that play an important role in the induction of PR genes by the elicitors such as the W box (SEQ ID No. 1).

 General regulatory elements are found in the COMTII promoter such as G, GT and simian virus activator element SV40 (SEQ ID NO: 1). Box G is an element found in a wide variety of plant promoters. The G box, associated with specific cis elements, is involved in the regulation of many genes responding to different physiological and environmental signals. The promoter region, responsible for the regulation of genes by methyl jasmonate, consists of a G box associated with sequences rich in nucleotides C. A similar organization is found at the gene promoter specifically induced during the injury. The L boxes, present in the COMTII promoter, could be involved in this kind of interactions because they are rich in C nucleotides.

 The GT boxes, represented several times in the promoters, seem to play a role in modulating the expression of certain plant genes, either as activator or as repressor.

Example 3 Functional Analysis of the Promoting Regions of the COMTII Gene
Functional analysis of the COMTII promoter was performed by transgenesis in stable expression. The transgene was obtained by transcriptional fusion between the promoter and a reporter gene, the GUS gene (β-glucuronidase). Four constructs corresponding to different deletions of the promoter were made in order to specify the nature of the important promoter sequences responsible for the regulation of the gene. These constructs correspond to promoter sequences from -1215 to +24 base pairs (bp), from-420 to +24 bp, from -313 to +24bp, and from -121 to +24 bp (relative to site +1 of the transcription), 557 to 1795,1352 to 1795,1459 to 1795 and 1651 to 1795 respectively on SEQ ID NO 1 introduced upstream of the GUS gene in the vector pBilOI (Clontech).

<Desc / Clms Page number 14>

 The different constructs were introduced via Agrobacterium tumefaciens into the plant genome. A population of about ten transformed tobacco plants has been regenerated for each construction. The expression level of the transgene was determined by enzyme activity assay and histochemical tests.

In parallel, the expression of the COMTII genes was analyzed by measuring the activity of the corresponding enzymes.

Results:
The GUS activity was tested in these plants under different conditions of induction of defense reactions, by a fungal elicitor injected into the leaves (megaspermin), or after UV exposure. The results obtained are reported in Tables 1 and 2 below. The GUS activity is expressed in pmol MU / min. mg.

For Table 1, the control (T) consists of the infiltration of water into the leaves of the transformed plants. Control plants transformed with an empty vector had an activity of about 10-30 pmol / min.mg. For Table 2, control (T) corresponds to basal GUS activity in untreated plants.

Table 1 - Expression of the GUS activity corresponding to the different COMT II / GUS constructs: induction by megaspermine

<Tb>
<tb> Activity <SEP> GUS
<tb> Construction <SEP> COMT <SEP> II / GUS <SEP> T <SEP> Megaspermine
<tb> COMT <SEP> It <SEP> -1215 <SEP> to <SEP> +24 <SEP> 150 <SEP> 1150 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> to <SEP> +24 <SEP> 2 <SEP> 6 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> to <SEP> +24 <SEP> 0.4 <SEP> 0.8
<tb> COMT <SEP> II <SEP> -121 <SEP> to <SEP> +24 <SEP> 0.2 <SEP> 0.8
<Tb>
Table 2 - Expression of the GUS activity corresponding to the different COMT II / GUS constructs: UV induction

<Tb>
<tb> Activity <SEP> GUS
<tb> Building <SEP> COMT <SEP> II / GUS <SEP> T <SEP> UV <SEP>
<tb> COMT <SEP> II <SEP> -1215 <SEP> to <SEP> +24 <SEP> 90 <SEP> 900 <SEP>
<tb> COMT <SEP> II <SEP> -420 <SEP> to <SEP> +24 <SEP> 10 <SEP> 12 <SEP>
<tb> COMT <SEP> II <SEP> -313 <SEP> to <SEP> +24 <SEP> 10 <SEP> 11 <SEP>
<tb> COMT <SEP> II <SEP> -121 <SEP> to <SEP> +24 <SEP> It <SEP> 10 <SEP>
<Tb>

<Desc / Clms Page number 15>

These results show that the size of the promoter must be greater than 600 bp, in this case 1239 bp to allow induction and strong expression of the GUS gene. The deletions of the promoters corresponding to the constructs (-420 to +24), (-313 to +24) and (-121 to +24) cause a complete loss of the expression of the GUS gene under all the conditions tested. The activity of the GUS gene under the control of the 1239 bp promoter is 1000 times greater than that observed for the other constructs.

The following constructs for different sizes of promoters greater than 600 bp were prepared and transferred to tobacco for analysis: {list of constructs}
Activation of the COMTII promoter by injury and methyl jasmonate and by elicitors of various origin and nature.

 Transgenic plants with the construction COMTII (- 1215 to +24) / GUS were treated with different chemicals, regulators of defense reactions, by salicylic acid (SA) and methyl-2-6-dichloroisonicotinic (INA) by fungal elicitors such as glucans or fragments of chitin and an elicitor of plant origin such as pectin. GUS activity was measured in leaves 16h after infiltration of these compounds and the results reported in Table 3 below. The GUS activity is expressed in pmol MU / min.mg. The control (T) corresponds to the basal GUS activity in the untreated transformed plants.

Table 3 - Induction of GUS activity by elicitors

<Tb>
<tb> Activity <SEP> GUS <SEP> Induction <SEP>%
<tb> T <SEP> 600 <SEP> 100 <SEP>
<tb> H20 <SEP> 1200 <SEP> 200
<tb> SA <SEP> (lmM) <SEP> 1200 <SEP> 200
<tb> INA <SEP> (lmM) <SEP> 1700 <SEP> 200
<tb> Chitin <SEP> (100 g / ml) <SEP> 1200 <SEP> 200
<tb> Glucans <SEP> (200 g / ml) <SEP> 1400 <SEP> 200
<tb> Pectins <SEP> (200 g / ml) <SEP> 3700 <SEP> 600
<Tb>

The highest increase in GUS activity (of the order of 3) is obtained in plants infiltrated by pectic fragments compared to the control.

<Desc / Clms Page number 16>

 Induction of the 1239-bp promoter was studied during injury or after treatment with methyl jasmonate (a molecule involved in the signaling of defense responses during injury) and benzothiadiazole (BTH) (chemical inducer of the SAR). The GUS activity is measured 16 hours after treatment. The results are reported in Table 4 below.

Table 4 - Induction of GUS activity by different compounds and stress

<Tb>
<tb> Induction <SEP> of <SEP> activity <SEP> GUS <SEP>%
<tb> T <SEP> 100 <SEP>
<tb> BTH <SEP> 250
<tb> Injury <SEP> 600 <SEP>
<tb> Methyl <SEP> jasmonate <SEP> 1450
<tb> UV <SEP> 1000 <SEP>
<Tb>

The control (T) corresponds to the GUS activity of the untreated plants. The promoter is activated by the different treatments.

 Induction factors range from 2.5 (BTH) to 14.5 (methyl jasmonate).

 Activation of the COMTII promoter during viral infection.

 The inoculation of TMV in tobacco requires the production of micro leaf wounds allowing the entry of the virus and its multiplication. GUS activity and COMTII activity were measured in the injured leaves and in the leaves inoculated by the virus. The results (FIG. 1) show that the GUS gene under the control of the COMTII promoter has induction kinetics identical to that of the endogenous COMTII gene, followed by the measurement of the catalytic activity of the corresponding proteins. The COMTII promoter is induced early by the wound and has a maximum of activity at 16h. The same peak of activity is observed at 16h during viral infection and is due to leaf injury caused by virus inoculation. In the inoculated leaves, the GUS activity is strongly stimulated from the 3rd day and progresses until the 7th day. Local and systemic induction of the promoter during viral infection was measured at 3 and 7 days after inoculation of TMV. GUS activities expressed in pmol MU / min. mg, are reported in Table 5 and represent an average of the values obtained in 9 transformants. The control T corresponds to the GUS activity of the untreated plants.

<Desc / Clms Page number 17>

Table 5 - Local and Systemic Induction (SAR) of GUS Activity

<Tb>
<tb> Activity <SEP> GUS
<tb> T <SEP> 700 <SEP>
<tb><SEP> leaves inoculated <SEP> after <SEP> 3 <SEP> days <SEP> 3800
<tb><SEP> leaves inoculated <SEP> after <SEP> 7 <SEP> days <SEP> 7100
<tb> Leaves <SEP> SAR <SEP> after <SEP> 7 <SEP> days <SEP> 2700 <SEP>
<Tb>

These results show an induction of 1100% of the promoter at 7 days in the inoculated leaves. The GUS activity measured at 7 days in the SAR sheets is lower but very significant. However, in the uninoculated leaves the induction factors calculated from the GUS activities are higher than those obtained from the COMTII activities (Table 6). This is due, on the one hand, to the fact that the GUS activity test is more sensitive than that of COMTII and, on the other hand, to the fact that the GUS protein is extremely stable and that the measured GUS activity corresponds to a accumulation of this protein after treatment. The comparison of GUS and COMTII activities is reported in Table 6 below. Uninoculated leaves where systemic acquired resistance develops are called "SAR leaves".

Table 6-Induction Factors for GUS and COMTII Activities 3 and 7 Days After VMT Inoculation in Infected Leaves and SAR Sheets

<Tb>
<tb> Induction <SEP> of <SEP> activities <SEP> GUS <SEP> Induction <SEP> of <SEP> activities <SEP> COMTII
<tb> Leaves <SEP> Inoculated <SEP> Leaves <SEP> SAR <SEP> Leaves <SEP> Inoculated <SEP> Leaves <SEP> SAR
<tb> 3 <SEP> days <SEP> 5.8 <SEP> - <SEP> 5.8 <SEP> -
<tb> 7 <SEP> days <SEP> 11 <SEP> 3.9 <SEP> 15 <SEP> 1.8
<Tb>

Histochemical analysis of GUS activity during viral infection and after injury.

 Histochemical analysis of GUS activity in VMT-inoculated leaves 7 days post-viral shows that GUS gene expression is localized in the cells surrounding the site of infection. Cross sections of the leaves at the lesions were made to determine the cell types involved and show that the induction of the GUS gene is not specific tissue but affects all cells

<Desc / Clms Page number 18>

 around the lesions.

 Histochemical analysis of GUS gene expression in wounded leaves, 2 days after treatment, shows induction of the GUS gene into uninjured tissues surrounding sites of puncture injury or forceps. These results imply that a signal is emitted from the injured tissues to the intact tissues inducing systemic expression of the GUS gene. Methyl jasmonate synthesized in injured tissues could remotely induce the GUS gene, since an exogenous application of methyl jasmonate induces GUS activity. The histochemical test performed on leaves from 35S / GUS transgenic plants is the positive control of the experiment. Cross sections of injured leaves also show that all cell types are induced by the injury.

Example 4: Anti-infectious activity of COMTII / megaspermine in tobacco
4. 1. Cloning of a cDNA coding for ss megaspermine.

 Cloning of elicitin genes such as those of parasiticin and cryptogein have shown that these genes code for a preprotein (Kamoun et al., 1993; Panabieres et al., 1995). The coding sequence of these elicitins comprises a signal peptide of 20 amino acids, allowing their excretion in the extracellular medium followed by a sequence of 98 amino acids corresponding to the mature protein.

 The protein sequence of P megaspermine, previously determined (Kauffmann S., unpublished results), shows strong homology with that of cryptogein (Kamoun et al., 1993). We hypothesized that the nucleotide sequences of the corresponding genes could be very close. Primers derived from the nucleotide sequence of the cryptogein gene were synthesized to isolate by PCR a cDNA encoding ss megaspermine. These primers are placed at the level of the coding sequence for the signal peptide and contain the translation initiation codon. Amplification reactions were performed on reverse transcripts of Phytophthora megasperma using a sense primer derived from the nucleotide sequence of cryptogein and oligodT as antisense primer. An amplified fragment of about 450 nucleotides was obtained. This fragment was cloned into a bacterial vector in order to be sequenced.

 Sequence analysis revealed that the clone thus obtained encodes a

<Desc / Clms Page number 19>

 preprotein comprising a signal sequence of 20 amino acids and a sequence of 98 amino acids corresponding to ss megaspermine (SEQ ID NO 12). The nucleotide sequence corresponding to the signal peptide also has 100% identity with that of cryptogein.

 The native cDNA of ss megaspermine was fused on the one hand to the COMT II promoter and on the other hand to the 35S promoter. The 1239bp COMT II promoter was used because it has all the regulatory elements necessary for its induction.

4.2. Obtaining transgenic tobacco
Tobacco plants Nicotiana tabacum Samsun NN were transformed with both constructs via Agrobacterium tumefaciens. Six primary transformants for each construct were regenerated and self-fertilized. Plants from the second generation have a normal phenotype except for some individuals with the megaspermin P gene under the control of the 35S promoter. These plants have a growth period and also have a poorly developed root system. However, no tissue necrosis reminiscent of that developed by foliar infiltration and possibly linked to the expression of elicitin is observed in transgenic plants.

 4. 3. Analysis of P megaspermin expression in transgenic tobacco.

 Expression of p megaspermine was analyzed in the leaves of transgenic plants possessing the elicitin cDNA under the control of the 35S promoter by Western-Blot (Figure 2A) and by Northern-Blot (Figure 2B). Surprisingly, (3 megaspermin is undetectable in all the transformants analyzed (Figure 2A) .The level of transcription of elicitin was therefore examined in these plants by NorthernBlot (Figure 2B), the transcripts could be detected and the level of expression varies from one transformant to another.It appears that in 2 types of plants (E and F) the size of the transcripts is smaller than the size of the complete messenger.In this case, the absence of protein could be explained by the fact that the cDNA is truncated For plants A, B, C, D the size of the transcripts corresponds to that of the elicitin expressed by the fungus and the transcript rate is not negligible, except for plant B showing a very low proportion of transcripts, plants A which have the highest transcript levels also show growth retardation, after which only transformants presenting complete transcripts of P megaspermin e have been tested

<Desc / Clms Page number 20>

 for their resistance.

 Similarly, the expression of megaspermine under the control of the COMT II promoter was analyzed by Western Blot in the leaves of transgenic tobacco (Figure 3) .The expression was studied in healthy plants not treated for determine the level of expression base of elicitin and after injury to analyze the level of induction obtained.In untreated tissues, the level of P megaspermine is undetectable.In contrast, elicitin is detected in very low This is due to the activation of the COMT II promoter by the injury.

The accumulation of COMT II was also examined in the same transgenic plants using anti-COMT II antibodies. Surprisingly, COMT II is detected at a non-negligible level in untreated tissues, whereas normally only very low COMT II activity is detected in healthy plants not transformed or transformed with the chimeric COMT II :: GUS gene (Collendavelloo et al., 1981, et al., 1993). COMT II is also produced in larger quantities in injured tissues compared to control plants injured in the same way.

 The COMT II promoter allows an induced expression of elicitin in transgenic tobacco. This was verified for the 6 transformants. However, the amount of elicitin detected in plants after induction is very low. The presence of COMT II in untreated plants suggests that a very small amount of elicitin (not detected by the method used) is produced in the healthy plant and that this synthesis is sufficient to induce the endogenous COMT II gene. In addition, it would appear that an induced expression of elicitin during injury also allows for greater induction of the endogenous COMT II gene.

 Moreover, the analysis of the megaspermine on denaturing gel shows a lower electrophoretic migration than that of the purified mature megaspermine (FIG. 3). This difference in migration was evaluated at 3 kD, which corresponds to the size of the signal peptide. This result suggests that the signal peptide has not been cleaved. However it is possible that the mature protein is produced in smaller amounts by the plant cells and that this amount is below the detection limit on this Western-Blot.

 The study of the expression of (3 megaspermine in transgenic tobacco

<Desc / Clms Page number 21>

 seems to indicate that a constitutive expression of elicitin is not tolerated by plants and therefore does not allow its accumulation in plant cells. Only an induced expression allows synthesis of megaspermine at a detectable level. These results could be related to the toxicity of the protein.

 4. 4. Analysis of the level of resistance of transgenic plants to different pathogens.

 Antiviral resistance. a) Resistance to the Tobacco Mosaic Virus (VMT).

 The transformed tobaccos possess the resistance gene N and therefore react with an HR during the inoculation by the VMT. In these experiments, resistance to the virus is quantified by measuring the size of the lesions 7 days after infection, when they have reached their almost definitive size. The greater the resistance developed by the plant, the smaller the lesion sizes, thus illustrating greater containment of the pathogen at the site of infection. As the promoter of the COMT II gene is strongly induced around the lesions during VMT HR, it should allow a strong expression of megaspermine P at the site of infection. To verify this, transgenic plants a, b, c, d, e and f expressing elicitin under the control of the COMT II promoter and transformants A, B, C, D possessing the p megaspermin cDNA under control. 35S promoter were inoculated with TMV. The control plants are transgenic plants for the chimeric gene "COMT II promoter :: GUS".

 Seven days after virosis, lesions developed on p megaspermin-expressing plants under the control of the 35S promoter do not appear to be different from those of control plants. On the other hand, smaller lesions are observed on the transgenic plants expressing ss megaspermine under the control of the COMT II promoter compared to those obtained on the control plants.

 Statistical analysis of lesion size was performed by measuring the diameter of 100-150 lesions in control and transgenic plants for ss measpaspermine. Figure 4 shows the size distribution of the lesions measured on the control plants and for a line expressing elicitin under the control of the 35S promoter (plants A) and a line expressing elicitin under the control of the COMT II promoter (plants b). This distribution follows a Gaussian curve which allows the statistical analysis of the results. The control plants have a size of

<Desc / Clms Page number 22>

 lesions averaging 3.30.5 mm. The mean size of the lesions obtained for the plants A is not significantly different from that of the controls (3.1 0.6 mm) whereas that obtained for the plants b is significantly lower than the controls (1.4 ~ 0 , 6 mm). The results obtained for each independent line are grouped together in FIG. 5 and show that all the transformants (plants A, B, C and D) possessing the megaspermin P cDNA under the control of the 35S promoter have a lesion size that does not differ. not that of the witnesses. In contrast, all plants expressing elicitin under the control of the COMT II promoter have an average lesion size significantly less than that of control plants. This decrease is more or less important depending on the transformants. A strong reduction of lesion size by about 60% is obtained for the COMT II :: meg transformants a, b, and f and the lowest observed is 36% and corresponds to the COMT II :: meg e transformant. .

 All the results obtained show that the plants expressing the megaspermine under the control of the 35S promoter have a level of antiviral resistance equivalent to that of the control plants. In contrast, increased resistance to TMV is obtained for transgenic tobaccos expressing megaspermine ss under the control of the COMT II promoter. However not all transgenic lines have the same level of resistance. This could be related to different levels of expression of megaspermine ss in these different transgenic plants. b) Resistance to the Lucerne Mosaic Virus (MLV).

 We tested the resistance of transgenic tobacco COMT II :: megaspermine to another virus, VML, which systemically infects tobacco. About ten days after virosis, VML spread throughout the plant and produced mosaic symptoms in uninoculated leaves.

 Plants expressing the megaspermin under the control of the COMT II promoter selected for this test correspond to line b which has a high level of resistance to TMV Plants A possessing megaspermin P cDNA under the control of the 35S promoter were inoculated as well as control plants COMT II :: GUS For each transgenic line, 5 plants were inoculated We examined the phenotype of the different plants fifteen days after treatment At this stage the mosaic symptoms are well developed on plants COMT II :: GUS.

<Desc / Clms Page number 23>

 Transgenic A plants show a mosaic similar to the control plants. On the other hand, a reduction of these symptoms is observed in transgenic plants b.

 The viral load was examined in systemic leaves of the same level (3rd leaf above the inoculated leaf). This assay was performed by WesternBlot using antibodies directed against the protein hull of the virus (Figure 6). The amount of virus present in the different transgenic plants is evaluated in relation to the amount of virus present in the control plants. The results obtained show that the plants expressing megaspermine ss under the control of the 35S promoter have 10 to 15 times less virus than the control plants. This reduction in the amount of virus may seem important. It must be known, however, that the quantities of virus produced in wild plants may vary in the same proportions.

On the other hand, transgenic plants expressing megaspermine under the control of the COMT II promoter contain 1000 to 10000 times less virus than control plants. This represents a significant and very significant reduction in viral load.

 These results suggest that only plants transformed with ss megaspermine under the control of the inducible COMT II promoter are less susceptible to systemic viral infection. This also shows a correlation between reducing the symptoms of infection and decreasing the viral load in these leaves.

 Antifungal resistance.

 We examined whether the production of elicitin in planta conferred resistance against a soil fungus, Phytophthora parasitica var.nicotianae. This fungus infects tobacco plants by the roots invading the root system and vascular thereby causing sclerosis of the conductive vessels. Symptoms of infection result in black rot at the neck. This mode of infection is difficult to implement because it requires an adequate concentration of zoospores and meets strict conditions of temperature and humidity. An "artificial" mode of inoculation consists in applying, after decapitation of tobacco, the mycelium of the fungus at the level of the sectioned stem. After 7 days the stems are removed and the symptoms of infection are examined inside the stems.

 Inoculation was performed on 7 control plants COMT II :: GUS. each

<Desc / Clms Page number 24>

transgenic line for (3 megaspermin, five plants were inoculated.
A, B, C and D having the construct "35S-megaspermine promoter" were tested.
For plants with the megaspermin P gene under the control of the promoter
COMT II, lines a and b with high resistance to VMT were chosen as well as line e having a lower level of resistance.

 The progression of symptoms measured in the stems of control plants reaches an average length of 5.3 cm. A slowing down of infection symptoms is observed in the stems of transgenic plants expressing ss megaspermine under the control of the 35S promoter. This decrease is variable from one genotype to another (Figure 7). The growth of the fungus is strongly retarded in plants 35S :: meg (d = 0.8cm) and more weakly in plants 35S :: meg (d = 3.8cm) compared to control plants (d = 5.3cm) . Plants A correspond to plants with the highest proportion of P megaspermine transcripts, while plants B have a very low level of transcripts encoding elicitin. This could suggest a correlation between the detected levels of elicitin transcripts (and probably the megaspermine ss levels produced even if they remain below the detection limit) and the level of induced antifungal resistance.

 The growth of the fungus is also strongly retarded in the stems of transgenic plants expressing (3 megaspermin under the control of the COMT II promoter, and we have shown that the COMT II promoter was induced during infection with P. parasitica. stems of the COMT II :: meg a, b and e transformants are respectively 0.7 cm, 1 cm and 3.5 cm long.Plants a and b are the most resistant to P. infection. nicotianae and also correspond to the plants with the highest resistance to VMT, so it appears that the same levels of relative resistance are detected with both pathogens tested.We can assume that the resistance levels induced in these plants are related to the rate Expression of elicitin: an analysis of the levels of transcripts by Northern-Blot may be able to confirm this hypothesis, knowing the difficulty of detecting the protein by Wester No blotting.

 These results show that the constitutive or induced expression of megaspermine in transgenic tobaccos makes it possible to confer an increased level of resistance with respect to a fungal infection.

<Desc / Clms Page number 25>

Antibacterial resistance
We also tested the resistance of transgenic plants expressing ss megaspermine under the control of the COMT II promoter against a bacterium, Erwinia carotovora. This bacterium is a well-known pathogen of the potato and is able to macerate plant tissues by the synthesis of pectinolytic enzymes.

However, it can also infect other plants such as tobacco.

 For this test, a suspension of E. carotovora was infiltrated into the leaves of the transgenic COMT II :: megaspermin plants as well as into the leaves of the control plants (corresponding to the transgenic plants for the chimeric COMT II :: GUS gene). A population of 7 plants was inoculated for each of the transformants.

Two days after inoculation of the bacteria, 60% of the control plants (4 plants out of 7) show severe symptoms of infection, the inoculated leaves are completely macerated and the infection tends to spread to the whole plant. Conversely, 85% of transgenic plants expressing P megaspermine under the control of the COMTII promoter (6 plants out of 7) are resistant to bacterial infection.

 These results show that the induced expression of elicitin greatly increases resistance to E. coli. carotovora. We have previously shown that the COMT II promoter is inducible by secondary elicitors among which the pectic fragments. Thus we can assume that the pectic fragments produced during the lysis of plant tissues induce the COMT II promoter and consequently the synthesis of megaspermine p. However, the mechanism allowing the establishment of the antibacterial resistance remains to be determined.

Material and methods
Screening of a genomic library and identification of the clone corresponding to the gene expressed during the defense response.

 A genomic tobacco DNA library (Nicotiana tabacum var Xanthi) constructed in -EMBL3 (Clontech) was screened with a COMT II cDNA radioactive probe (Pellegrini et al., 1993). Six positive genomic clones were isolated after four rounds of purification. These purified clones were tested by PCR to identify one that includes the COMT gene expressed during the hypersensitivity (HR) response of tobacco leaves to TMV. The 5 'and 3' primers for PCR analysis are represented

<Desc / Clms Page number 26>

by oligonucleotides 1 and 2 below (SEQ ID NO 4 and SEQ ID NO 5 respectively): Oligo 1: 5 'CGTTTCGCAA TGTGATTTGA TC 3' Oligo2: 5 'CTCAAAATGA CATCCTTTCA TAC 3'
They are derived from the 3 'untranslated region of the COMT II cDNA. The PCR analysis is carried out at 62 ° C. (theoretical melting temperature) so as to promote a specific hybridization. A single clone allows amplification of the expected 400 base pair fragment as does the cDNA employed as a positive control. The genomic clone of COMT II was purified on Quiagen tip according to the protocol described by the manufacturer and subcloned into the SalI restriction site of the vector plasmid puc 18.

 Sequencing of DNA.

 DNA sequencing was performed on the denatured double-stranded DNA according to the method of Sanger et al. (1977) using the "rhodamin dye terminator cycle ready" kit with FS ampliPaq DNA polymerase (Perkin-Elmer, P / N402078) and an Applied Biosystems 373 sequencer (Perkin-Elmer). The sequence was determined on both strands with overlays using primers synthesized from already determined sequences.

 Analysis of primer extension products.

 The primer extension reaction was performed on total RNA according to the method described in Current Protocols in Molecular Biology (Trienzenberg, 1992).

Total RNA isolated from tobacco leaves infected with TMV and uninfected tobacco leaves (as a negative control) was hybridized to the following oligonucleotide (SEQ ID NO 6), complementary to COMT II mRNA and labeled at the 5 'end:
Oligo 3: 5 'CTGAAGATGT CAATAGTTGC ATGGC 3'
The extension product was separated on a 6% polyacrylamide gel. The location of the transcription initiation site was determined on the basis of the comigration of the extension products with the sequence sequence of the obtained from the corresponding region of the gene (Sanger et al., 1977).

 Construction of plasmids

 The truncated versions of the COMTII promoter were amplified by PCR using the 3 'PAS1 primers and 5' PSI, PS2, PS3 and PS4 shown hereinafter (SEQ ID Nos. 7 to 11 respectively), respectively leading to the amplification of the

<Desc / Clms Page number 27>

nucleotide fragments of the following lengths: -1215 / + 24, (new constructs greater than 600 bp) -420 / + 24, -313 / + 24 and -121 / + 24 (relative numbering at the transcription initiation site)
PAS1: 5 'GGTCTAGAGG GCCTTTTAGA GTGTTTTTGT TAG 3' PSI: 5 'AAAGTCGACC GTCCACCTGT GCCAACAAT 3'
PS2: 5 'TGTTTGGTGT TATGCTTCCG TCCT 3' PS3: 5 'AAAAAGCTTT TTTAGGATGG AGTACAGCC 3' PS4: 5 'TTTAAGCTTA AAGAGAACCA GACAATATT 3'
The constructs -1728 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, -882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24, -435 / + 24, were obtained with the 3 'PAS2 primers and respectively the PS5, PS6, PS7, PS8, PS9, PS10, PS1, PS12 and PS13 5' primers presented below (SEQ ID NO 15 to 24 respectively). :
PAS2: 5 'CGCGGATCCC CTTTTAGAGT GTTTTTGTTA GGC 3' PS5: 5 'ACGCGTCGAC GTTAGGGACA ATCTATAGTG TCCA 3' PS6: 5 'ACGCGTCGAC GCTCCGAGGA TTTGGCTGTC GCGG 3' PS7: 5 'ACGCGTCGAC GCTGGTTAGG TGAAGTAAAG CATG 3' PS8: 5 'ACGCGTCGAC GCATGTTATA TGAGGAAAGT ACG 3' PS9: 5 'ACGCGTCGAC GCAGCCAGCA CAAGCAAATT CGC 3'
PS10: 5 'ACGCGTCGAC GACTTTAACA CACCAACTCC C 3'
PS11: 5 'ACGCGTCGAC CGGATCTAGA ATTTGGGTTC ATTC 3'
PS12: 5 'ACGCGTCGAC GTGTATACTC CACGTCTCCG GATAC 3'
PS13: 5 'ACGCGTCGAC GTTCAATGTT AGGTGTGTTT GG 3'
The 1073 / -435 sequence that was placed upstream of the minimum 35S promoter was obtained using the 3 'PAS3 primer and the 5' PS14 primer (SEQ ID Nos. 25 and 26): PAS3: 5 ' CGCGGATCCG CTTAACACCA AACACACCTA ACATTG 3 '
PS14: 5 'ACGCGTCGAC CAGTGGTGAG TTTAGCTGTC 3'
The amplification was carried out for 30 cycles with an initial step of 4 min at 95 ° C. and a final step of 5 min at 72 ° C., using the genomic clone as template. Each cycle consists of 1 min at 95 ° C. followed by 1min of hybridization then 1.5-2 min at 72 ° C.The hybridization step is carried out at 54 ° C., 59 ° C., 55 ° C. and 50 ° C. to amplify, respectively, the fragments -1215 / + 24, -420 / + 24, -313 / + 24 and -121 / + 24.

For all other fragments of the promoter, the hybridization temperature is 60 C. After subcloning in the plasmid pGEM-T (Promega) and amplification in E.

<Desc / Clms Page number 28>

Coli, the promoter-1215 / + 24 fragment is digested with SalI and XbaI, the corresponding sites being present in the primers PSI and PSA1 respectively. The 420,313 and 121 base pair promoter fragments are digested with HindIII and XbaI (the HindIII site is present in the PS2, PS3 and PS4 primers, and the XbaI site in the PASI primer). Fragments -1768 / + 24, -1471 / + 24, -956 / + 24, -937 / + 24, - 882 / + 24, -746 / + 24, -676 / + 24, -560 / + 24 and-435 / + 24 are digested with BamHI present in PAS2 and PAS3 and with SalI present in primers PS5 to PS14. All fragments are cloned into plasmid pBI101 (Qiagen) so as to create a transcriptional fusion with the GUS reporter gene. All constructs are sequenced to confirm their structure and junction boundaries.

 The CaMV 35S promoter construct upstream of the megaspermin gene was obtained by replacing the Gus gene with the megaspermin gene (SEQ ID NO: 12) in plasmid pBil21 (Clontech).

Cloning of Phytophthora megasperma cDNA
10 mg total RNA of Phytophthora megasperma are used as a template for first strand synthesis. The total RNAs are heated for 3 min at 65 ° C., cooled on ice, and incubated for 2 h at 42 ° C. in 50 ml of reverse transcription buffer (50 mM Tris-HCL pH 8.3 - 15 mM MgCl 2 - 75 mM KCL - 1 mM DTT) containing 1 mM of each dNTP, 40 pmol of antisense primer corresponding to oligodT, and 20 U of AMV reverse transcriptase (avian myeloblastosis virus). The mixture is heated to 94 ° C to stop the reaction. After precipitation of the reaction mixture with ethanol, the pellet is dissolved in sterile distilled water.

 Second strand synthesis is initiated by Taq DNA polymerase. 1/20 of the reverse transcript is used for PCR amplification in 50 ml buffer (10 mM Tris-HCL pH 8.3 - 50 mM KCL - 1.5 mM MgCl2 - 0.01% BSA), 200 mM dNTP, 0.1 mM sense and antisense primers and 1 unit Taq. The sense primer (5 'ATGAACTTCACCGCTCTGCT 3') derives from the nucleotide sequence of cryptogein, the antisense primer corresponds to the oligodT having the SstI-EcoRI-HindIII restriction sites at its 5 'end. The reaction mixture is heated for 3 min at 94 ° C., then is subjected to 30 reaction cycles each comprising 3 steps: 1 min at 94 ° C., 1 min at 49 ° C. and 1 min at 72 ° C. After the last cycle, the elongation is

<Desc / Clms Page number 29>

 continued for 10 minutes at 72 ° C. The amplification product obtained is then cloned into the pGEM vector (Promega) in order to be sequenced.

Plant transformation
The different COMTII-GUS promoter constructs obtained previously in the plasmid pBI101 are introduced into a strain of Agrobacterium tumefaciens GV3101 (pPM6000) (Rossi et al., 1993) by electroporation (Nagel et al., 1990). Tobacco plants (Nicotiana tabacum cv Samsun NN) are transformed by Agrobacterium infiltration on 10-day-old plants (Rossi & al., 1993). Plants are regenerated on Murashige & Skoog (MS) medium (GIBCO BRL) supplemented with sucrose (30 g / l for stem formation and 15 g / l for root formation), 6-benzylaminopurine (Serva ) (2 mg / ml), and naphthalene acetic acid (Serva) (0.05 mg / ml). Kanamycin (150 mg / ml) is used as a selection agent during the in vitro regeneration and propagation steps. Control plants were prepared by transformation with the empty vector pBI101. Seven to 10 independent transformers are regenerated for each construct. The primary transformants are self fertilized and the IF seeds are germinated on an MS medium comprising 300 mg / l kanamycin.

Enzymatic tests
The histochemical localization of GUS in the transgenic plants is carried out according to the method described by Jefferson et al. (1987). The histochemical reaction is incubated in the dark at 37 C for 12 hours. The tissues are rinsed first with a 50 mM phosphate buffer to complete the reaction and then several times with 70% to 90% ethanol to remove the pigmentation of the tissues. After the histochemical reaction, the tissues are rinsed in 70% ethanol and are included in a fixation history (Jung) for cross sections of leaves. The blocks of historesines are cut with a microtome and photographs are taken at a magnification of 10 to 40 times by a binocular microscope.

 The dosage of COMTII and GUS activities was performed on 100 mg of tissue. The tissue is homogenized in 100mM sodium phosphate buffer pH 7.5 and 10mM DTT after addition of AT polyclar (Serva) and quartz. The crude extracts are clarified by centrifugation and filtration on glass wool. The measurement of GUS and COMTII activities is performed on the same raw extracts. For the measurement of

<Desc / Clms Page number 30>

 COMTII activity, an aliquot of the protein extract is added to 1 ml of phosphate buffer comprising 100M of catechol, 50uM of tritiated S-adenosyl-L-methionine (1.5 10 5 cpm / ml) and incubated for 3 hours at room temperature. C. The reaction is stopped by adding 1001 of 9M sulfuric acid. The radioactive product of the reaction, ferulic acid, is extracted with 5 ml of a scintillation NA solution (Beckman) and the radioactivity is counted on a Beckman LS 9000 apparatus. The fluorimetric measurement of the GUS activity is carried out on the same samples according to the procedure of Jefferson & al. (1987). Protein content is determined by the method of Bradford (1976) using Biorad reagents.

Constructed COMTII-meg and 35S-meg
As the pGEM vector (Promega) did not possess the cloning sites compatible with those of pBI101, a subcloning step in the Bluescript vector (pSK) was necessary. The BamHI / SstI insert from pSK :: megaspermine was purified for cloning into the pBilOI binary vector (Clontech).

 The vector pBi101 :: COMT II-GUS previously constructed and corresponding to the promoter-1215 / + 24 fused to the GUS reporter gene was used to obtain the chimeric gene comt II-meg. The GUS gene is excised by digestion of the binary plasmid with BamHI and SstI. A SnabI site present in the GUS gene makes it possible to cut it and prevents it from being religated with the binary plasmid since no step of purification of the vector is carried out. Restriction enzymes are inactivated by heat. The digested DNA is extracted with a phenol: chloroform (1: 1) mixture, then chloroform: isoamyl alcohol (24: 1) and precipitated with ethanol. The digested DNA is resuspended in sterile water and ligated with the insert.

 The pBil21 vector (Clontech) carrying the 35S-GUS gene was used to obtain the 35S-meg chimeric gene. Cloning is performed according to the method described above.

 The constructs were then verified by sequencing.

 Tobacco plants.

 The transgenic tobacco plants (Nicotiana tabacum cv Samsun NN) are cultured in vitro under a 12h (24 C) / 12 (20 C) light cycle for 5 weeks after germination. They are propagated on MS medium with addition of kanamycin (150 mg / l) as selection agent. They are then transferred to a greenhouse and grown in

<Desc / Clms Page number 31>

 ground under a light cycle 16h / 8h to 22 +2 C.

Northern Plant RNA Analysis
Extraction of total RNA
The tissues are finely ground in liquid nitrogen and then in 1 to 2 volumes of extraction buffer (0.2 M sodium borate pH 9 - 30 mM EGTA - 1% SDS - 5 mM DTT). The mixture is poured into a tube containing 1 volume of phenol / chloroform (1: 1), vortexed and then centrifuged for 10 min at 5000 g. A second phenol / chloroform extraction (1: 1) is carried out, followed by a third chloroform / isoamyl alcohol (24: 1). The RNAs present in the supernatant are specifically precipitated by adding 1 volume of a solution of LiCl (4 M) EDTA (10 mM) overnight at 0 C. The whole is centrifuged for 30 min at 10000 g and the pellet is washed with a solution of LiCl (2M), EDTA (5mM). The total RNAs are taken up in water and again precipitated with 70% ethanol and NaCl (0.2 mM). After centrifugation for 30 min at 10,000 g, the pellet is washed twice with 70% ethanol and then taken up in 50 l of water. The RNAs are assayed by measuring the absorbance of a solution diluted at 260 (1 unit D0260 = 40 g / ml RNA), and their integrity is verified by migration on a non-denaturing BET-stained agarose gel.

Electrophoresis
RNAs are separated on denaturing agarose gel prepared in MOPS xl buffer containing 16% formaldehyde. Gels of 1.2% agarose (w / v) were used. The RNA samples are denatured for 15 min at 65 ° C. in the presence of 3 volumes of denaturation solution (MOPS × 5 10 l, formamide 50 μl, formaldehyde 16 l) per volume of RNA, and cooled rapidly in ice. Charge buffer is added (MOPSx1, 50% glycerol, 0.05% bromophenol blue) at 1/10 volume After migration into MOPS xl buffer, the gel can be stained with BET (0.5 μg / ml). ml) 1 to 2 min, then abundantly washed with sterile water.The RNA are then visualized under UV light.

"Northern Blot"
The "Northern blot" technique makes it possible to detect, among the total RNA, the messengers homologous to a radioactive DNA probe. This is done using the "Random Priming" kit (Amersham) following the protocol provided.

<Desc / Clms Page number 32>

 10 g of total stem or leaf RNA are deposited on 1.2% (w / v) denaturing agarose gel and an RNA size marker (Promega) deposited at the edge of the gel. After migration, the gel is rinsed with sterile water to remove excess formaldehyde. The migration strip corresponding to the size marker is cut, stained with BET and photographed.

The RNAs are transferred by capillarity for 5 h onto a positively charged nylon membrane (Hybond N +, Amersham) with SSC x20 buffer. After transfer the membrane is rinsed in x2 SSC buffer and the RNAs are covalently attached to the nylon membrane by exposure to ultraviolet light (1200 J, UV Stratalinker 2400, Stratagene). The membrane is hybridized to a radioactive probe and treated as described in Sambrook et al.

Western protein analysis of plants
Extraction of foliar proteins
Extraction can be done immediately after harvest or on frozen samples. 150 g of leaf tissue are ground in a 0.5 M sodium acetate pH 5.2 buffer containing 2-B-mercaptoethanol (15 mM) and activated charcoal.

The volume of buffer is adjusted so as to obtain a fine and homogeneous mill. This is then filtered on gauze and then centrifuged for 30 min at 15,000 g. The supernatant constituting the crude extract is then analyzed.

Protein assay
The protein concentration of the crude extracts is assayed by the method of Bradford (1976) in microtiter plates: 10 l of an extract to be tested are added 200 l of Bradford xl reagent (Biorad). 2 l of crude leaf extract are filled to 10 l with buffer. Each sample is tested three times. After 5 to 10 min, the plate is read on MR 700 spectrophotometer (Dynatech) with filter 5 (660 nm). The blank consists of 10 l of buffer and the values are compared to a standard range made with bovine serum albumin (BSA, Sigma).

Separation of proteins on denaturing polyacrylamide gel
The gel analysis makes it possible to determine the molecular mass of the proteins by comparing their relative mobility with those of proteins of known molecular mass. To the protein extract is added 20% (v / v) of loading buffer (60 mM Tris-HCl pH 6.8,

<Desc / Clms Page number 33>

 5% (v / v) 2-B-mercaptoethanol, 10% (v / v) glycerol, 0.01% (v / v) bromophenol blue, 1% SDS). The samples are heated at 100 C for 1 min before being deposited.

The gels (0.75mm x 7cm x 9cm) are cast between a glass plate and an alumina plate. The electrophoresis buffer is composed of 192 mM glycine, 25 mM Tris and 0.1% SDS. The vertical migration is carried out in a Hoeffner electrophoresis tank at an intensity of 20 mA per gel for a voltage of 100 to 160 V.

Transfer and immunodetection of proteins on nitrocellulose (Western-Blot)
After electrophoretic migration on acrylamide gel, the proteins can be transferred, in liquid medium, into the transfer buffer (0.16 M Tris - 1.20 M glycine), on nitrocellulose membrane or PVDF nylon (Immobilon, Millipore). .

Before transfer, the gel is equilibrated in the transfer buffer. The PVDF membrane is activated for 1 min in methanol and then equilibrated also in the transfer buffer. Electrotransfer is carried out for 90 min at 150 mA.

 Immunodetection was performed with specific antibodies against megaspermin or MLV shell protein. The revelation is carried out by chemiluminescence with the ECL kit (Amersham).

 Plant treatment.

 Before the treatment, the plants are conditioned for a few days in an air-conditioned cubicle at 22 C 1 C, under a luminosity of 5000 lux and a photoperiod J / N of 16h / 8h. These conditions are maintained during infection with the exception of Erwinia carotovora infection.

Inoculation of the tobacco mosaic virus (VMT)
The leaves of tobacco plants, aged 6 weeks, are rubbed with a cotton wool previously soaked in a suspension of purified VMT (common strain U1 0.1 to 1 μg / ml) containing an abrasive, celite ( 10 mg / ml). After a few minutes of contact, the leaves are rinsed with water to remove excess celite and virus particles.

Inoculation of alfalfa mosaic virus (MLV)
The leaves of tobacco plants, 6 weeks old, are rubbed with a glass spatula dipped in a buffer solution containing the viral RNA (1-5 μg / ml) and an abrasive, celite (10 mg / ml). Inoculum per leaf (for a plant) corresponds to

<Desc / Clms Page number 34>

200 ml buffer solution: Kpi, pH 7.2.0.04M, 1 ml RNAsin, DTT ImM final, Macaloid (0.05%), total yeast RNA 0.25 mg / ml, viral RNA (1 to 5 g / ml)
Inoculation of Phytophthora parasitica var. nicotianae
The mycelium of P. p. Nicotianae is grown on a petri dish containing a solid medium (oat medium: 100 g of crushed oat seeds are suspended in 1 liter of distilled water, the medium is filtered on gauze and the medium is autoclaved after the addition of 15 ml of agar).

 Inoculation was performed after decapitation of the tobacco plants. The stem of 10 weeks old tobacco plants is cut under the apical bud. A mycelium pellet of P. p. Nicotianae is collected at the periphery of a 7-day culture on oatmeal and is deposited on the section of the stem. The stem placed in contact with the mycelium pellet is encapsulated in an aluminum foil to prevent too rapid desiccation of the tissues at the site of inoculation.

Inoculation of Erwinia carotovora
The Erwinia carotovora strain is cultured overnight at 28 ° C. in LB medium. After centrifugation, the bacterial pellet is taken up in a solution of MgSO 4 (10 mM) to obtain an approximate bacterial concentration of 1 × 10 7 cfu (colony-forming units) / ml. The leaves of tobacco plants aged 4 to 5 weeks are infiltrated by this bacterial suspension. A single site is inoculated per sheet, by infiltrating with a pipette-man 50 ml of the bacterial suspension. The plants are then placed in stalls under conditions of high humidity and at a temperature of 26 C ~ 1 C during infection.

 Treatment with an elicitor: Solutions are infiltrated by a syringe equipped with a fine needle into the mesophyle of the leaves. The infiltrated areas are delimited with a felt-tip marker. The infiltrated areas are harvested 16 hours after treatment. The leaves are treated with a solution of b-megaspermine, a purified protein elicitor of a Phytophthora megasperma culture medium (Kauffmann et al., 1993), or oligosaccharides such as chitin oligomers (100 mg / ml), fragments of glucan (200 mg / ml), and pectic fragments (200 mg / ml).

Control plants are infiltrated with water.

 Injury: Fully developed leaves are injured with a hemostat or pierced with needles. The injured leaves are then harvested 16 or 24 hours

<Desc / Clms Page number 35>

 after injury for fluorimetric or histochemical analyzes.

 UV treatment: The upper part of 5-week-old transgenic plants is exposed to UV rays (1 = 254nm) for 10 minutes then the plants are placed in the dark until tissue collection 16 hours after treatment.

 Chemical treatments: (1) Solutions of SA (ImM) or INA (50mM) are infiltrated into tobacco leaves using the protocol described for treatment with elicitors. (2) Under identical culture conditions, solutions of SA (10 mM), INA (1 mM) or BTH (50 mM) are sprayed on the transgenic plants. The tissues are collected 16 hours after treatment. Plants treated with water are used as a control. (3) Plants aged seven weeks are transferred to transparent, sealed boxes and subjected to an atmosphere of 3.5mM MeJa (Serva). The tissues are taken at different times following the treatment. The control plants are placed in the same boxes without MeJa.

 References: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (1998). Current protocols in molecular biology. John Wiley & Sons.

Bradford M.M. (1976). A rapid and sensitive method for the quantitation of micrograms of protein using the principle of protein-dye binding, Anal. Biochem. 72, 248-254.

Collendavelloo J, Legrand M, Geoffrey P, Barthelemy J & Fritig B (1981). Purification and properties of the o-diphenol O-methyltransferases of tobacco leaves.

Phytochemistry 20, 611-616.

Jefferson R. A., Kavanagh T. A. & Bevan M. W. (1987). GUS fusions: B-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6,3901-3907. Kamoun S, Young M, CB Glascock & Tyler BM (1993). A gene encoding a hostspecific elicitor protein of Phytophthora: host specificity and induction of resistance to bacterial and fungal pathogens. Mol. Plant Microbe Interact. 6.15 to 25.

Kauffmann S., Baillieul F., Genetet I., Kopp M. & Fritig B. (1993). Two proteins secreted by Phytophthora megasperma elicit and defense-related responses in tobacco. In Mechanisms of Plant Defense Responses, B. Fritig and M. Legrand, Dordrecht:

<Desc / Clms Page number 36>

 Kluwer Academic Publishers, 140-143.

Nagel R., Eliott A., Masel A., Birch R. G. & Manners J.M. (1990). Electroporation of binary Ti plasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes. FEMS Microbiol. Lett. 67.325-328.

Panabières F, Swamp A, Berre JYL, Penot I, Fournier D & Ricci P (1995).

Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hypersensitive-like response in tobacco. Mol. Plant Microbe Interact. 8, 1995.

Pellegrini L., Geoffrey P., Fritig B. & Legrand M. (1993). Molecular cloning and expression of a new class of ortho-diphenol-O-methyltransferases in tobacco (Nicotiana tabacum L.) leaves by infection or elicitor treatment. Plant Physiol. 103, 509-517.

Rossi L., J. Escudero, Hohn B. & Tinland B. (1993). Efficient and sensitive assay for TDNA dependent transient gene expression. Plant Mol. Biol. Rep. 12, 220-229.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Spring Harbor Laboratory Press.

F. Sanger, Nicklens S. & Coulson A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74.5463-5467.

Trienzenberg S.J. (1992). Primer extension. In Current Protocols in Molecular Biology.

 J. Wiley & Sons eds. 20.4.8.1

Claims (32)

claims A nucleic acid fragment comprising an inducible plant promoter, characterized in that said inducible promoter is constituted by the promoter of a plant O-methyltransferase class II (COMT II) gene.  2. Fragment of nucleic acid according to claim 1, characterized in that it consists of a plant COMT II promoter.  3. Fragment of nucleic acid according to one of claims 1 or 2, characterized in that the promoter is activated by wounds, viral infections, UV aggressions, chemical attacks, or attacks by pathogen, a insect or nematode 4. Fragment of nucleic acid according to one of claims 1 to 3, characterized in that the plant COMTII is a plant COMT which is not expressed in untreated healthy plants, but which is expressed as a result mechanical, chemical, or pathogen, insect or nematode attack.  5. Fragment of nucleic acid according to one of claims 1 to 4, characterized in that the plant is a monocotyledonous or dicotyledonous plant, in particular selected from rice, wheat, barley, sunflower, corn, tobacco, rapeseed, soybean or Arabidopsis thaliana.  6. Fragment of nucleic acid according to claim 5, characterized in that the plant is a dicotyledonous plant, preferably tobacco.  7. fragment of nucleic acid according to one of claims 1 to 6, characterized in that the promoter comprises a sequence 5 'of the translation initiation site or codon "start" (ATG) of the coding sequence of COMTII allowing transcription and expression of said coding sequence.  8. Fragment of nucleic acid according to claim 1 to 7, characterized in that the promoter comprises a sequence of more than 600 nucleotides upstream of the ATG of COMTII, preferably more than 1000 nucleotides upstream of the ATG, more preferably more than 1200 nucleotides upstream of ATG.  9. fragment of nucleic acid according to one of claims 1 to 8, characterized in that the promoter comprises a transcription initiation site located less than 100 nucleotides upstream of the ATG, preferably about 90 nucleotides upstream. <Desc / Clms Page number 38>  10. Nucleic acid fragment according to one of claims 1 to 9, characterized in that the 3 'end of the promoter is located between the transcription initiation site and the ATG.  11. Fragment of nucleic acid according to claim 10, characterized in that the 3 'end of the promoter is located between 10 and 50 nucleotides downstream of the transcription initiation site, more preferably between 20 and 40 nucleotides downstream, more preferably between 20 and 30 nucleotides downstream.  12. Nucleic acid fragment according to one of claims 1 to 11, characterized in that it consists of the tobacco COMTII promoter defined by the nucleotide sequence upstream of the ATG represented by the sequence identifier 1 (SEQ ID NO: 1) sequences capable of hybridizing selectively to said sequence and homologous sequences.  13. Nucleic acid fragment according to claim 12, characterized in that it consists, by the sequence between nucleotides 557 and 1796 of the sequence identifier n 1 14. Chimeric gene (or expression cassette) functional in plant cells and plants comprising in the direction of transcription a 5 'regulatory sequence, a coding sequence and a 3' regulatory sequence, characterized in that the 5 'regulatory sequence comprises the nucleic acid fragment according to one of claims 1 to 13.  15. Chimeric gene according to claim 14, characterized in that the coding sequence comprises a coding sequence for a reporter gene or a coding sequence for a protein of interest.  16. Chimeric gene according to claim 15, characterized in that the protein of interest is a protein conferring on the plants properties of resistance to diseases or insects.  17. Chimeric gene according to claim 16, characterized in that the protein or peptide of interest is chosen from fungal eliciting peptides, in particular elicitins.  18. Chimeric gene according to claim 17, characterized in that the fungal elicitor peptide is megaspermine.  19. Chimeric gene according to claim 18, characterized in that the <Desc / Clms Page number 39>  megaspermine is represented by sequence identifier 13 (SEQ ID 13).  20. Chimeric gene according to claim 19, characterized in that it comprises the DNA sequence represented by the sequence identifier n 14 (SEQ ID 14).  21. Functional chimeric gene in plant cells and plants characterized in that it comprises in the direction of transcription a 5 'regulatory sequence comprising an inducible promoter, a coding sequence for an elicitor and a regulatory sequence in 3 .  22. chimeric gene according to claim 21, characterized in that the elicitor is defined in claims 17 to 19.  23. Chimeric gene according to one of claims 21 or 22, characterized in that the inducible promoter is chosen from promoters of phenylalanine ammonia lyase (PAL), HMG-CoA reductase (HMG), chitinases, glucanases, proteinase (PI) inhibitors, PR1 family genes, nopaline synthase (nos) or the vspB gene, the HMG2 promoter, the apple beta-galactosidase (ABG1) promoter or the promoter of the amino cyclopropane carboxylate syntase (ACC synthase) apple.  24. cloning vector and / or expression for the transformation of plant cells or plants, characterized in that it contains at least one chimeric gene according to claims 14 to 23.  25. A method of transforming plant cells, characterized in that it consists in integrating into the genome of said plant cells at least one chimeric gene according to one of claims 14 to 23.  26. Transformed plant cells characterized in that they comprise a chimeric gene according to one of claims 14 to 23.  27. Transformed plants characterized in that they comprise a chimeric gene according to claims 14 to 23.  Plants, characterized in that they contain transformed cells according to claim 26 or obtained by the process according to claim 25.  Plants according to claim 28, characterized in that they are regenerated from the transformed cells according to claim 19 or obtained by the process according to claim 18.  30. Plants derived from the cultivation and / or crossing of regenerated plants according to claim 29. <Desc / Clms Page number 40>  31. Plants according to one of claims 27 to 30, characterized in that they are of the monocotyledonous type, in particular cereals, sugarcane, rice and maize, or dicotyledonous, in particular tobacco, soybean , rapeseed, cotton, sunflower, beetroot, clover.  Plant seeds according to one of claims 27 to 31.