CA2344591A1 - Methods for improving the function of heterologous g protein-coupled receptors - Google Patents

Abstract

This invention relates to mutant G protein-coupled receptors with improved G-protein coupling and receptor response, yeast cells expressing such receptors, vectors useful for making such cells, and methods of making and using same.

Description

METHODS FOR IMPROVING THE FUNCTION OF HETERLOGOUS
G PROTEIN-COUPLED RECEPTORS
STATEMENT OF RELATED APPLICATIONS
This application hereby claims the benefit of United States provisional application Serial No. b0/098,704 filed September 1, 1998. The entire disclosure of this provisional application is relied upon and incorporated by reference herein.
FIELD OF THE INVF?NTION
This invention relates to mutant G protein-coupled receptors with improved G-protein coupling and receptor response, host cells expressing such receptors, vectors useful for making such cells, and methods ~of making and using same.
BACKGROUND OF THE INVENTION
The actions of many extracelluIar signals, such as neurotransmitters, hormones, odorants, and light, are mediated by a triad of proteins which has been identified in organisms from yeast to mammals. Tlus triad consists of a receptor, coupled to a trimer~ic guanine nucleotide-binding regulatory protein (G
protein), which in turn is coupled to a cellular effector. These receptors have seven transmembrane domains and are named for their association with W a G protein as "G protein-coupled receptors" ("GPCRs").
The regulatory G proteins are comprised of three subunits: a guanylnucleotide binding a subunit; a ~i subunit; and a y subunit. B.iQ. Conklin and H.R.
Bourne (1993). G proteins cycle between two forms, depending on whether GDP or GTP is bound to the a subunit. When GDP is bound, the G protein exists as a heterotrimer, the Ga(3y complex. When GTP is bound, the a subunit dissociates, leaving a G~iy complex. Importantly, when a Ga~iy complex operatively associates with an activated G protein coupled receptor in a cell membrane, the rate of exchange of GTP
for bound GDP is increased and, hence, the rate of dfisassociation of the bound Ga subunit from the G~iy complex increases. The free Ga subunit and G~iy complex are capable of transmitting a signal to downstream elements of a variety of signal transduction pathways. Examples of these downstream cellular effector proteins include, among others, adenylate cyclases, ion chamiels, and phospholipases.
This fundamental scheme of events forms the basis for a multiplicity of different cell signaling phenomena. H.G. Dohlman et al. (1991).
Because of their ubiquitous nature in important biochemical pathways, the G
protein-coupled receptors represent important targets for new therapeutic drugs. In turn, the discovery of such drugs will necessarily require screening assays of high specif city and throughput termed high-throughput screening (HTS) assays.
Screening assays utilizing microorganisms, such as yeast strains, genetically modified to accommodate functional expression of the G protein-coupled receptors offer significant advantages in research involving ligand binding to numerous receptors implicated in various disease states.
However, microorganisms transformed with 'wild-type receptors may perform poorly in growth assays, exhibiting, for example, the inability to interact with the heterotrimeric G protein, inappropriate localization andlar desensitization.
Many GPCRs are phosphorylated in response to chronic and persistent agonist stimulation which often leads to desensitization followed by sequestration or internalization of the receptors. Desensitization of GPCRs causes uncoupling from interaction with heterotrimeric G proteins. This process is mediated by a variety of regulatory receptor protein kinases, including G protein-coupled receptor kinases (GRK), protein kinase A (PKA), protein kinase C (PKC), and casein kinases (CK). Internalization involves removal of GPCRs from the plasma membrane via receptor-mediated endocytosis.
Internalized receptors may be recycled back to the cell surface, or delivered to a Iysosomal/vacuolar compartment for degradation. The ubiquitin-mediated degradative pathway is also involved in this process. The ultimate result of receptor phosphorylation and sequestration/internalization is often cell growth arrest, which significantly reduces the utility of the genetically modified microorganism in screening assays.
SUMMARY OF THE INVENTION
It is an object of this invention to provide mocEified G protein-coupled receptors that function well in high throughput screening assays, implemented in any eukaryotic cell, preferably yeast cells. Thus, a first aspect of the present invention is directed to nucleotide sequences encoding a G protein-coupled receptor which has been modified to improve the function of the GPCI~ by causing the receptor to couple more efficiently with the heterotrimeric G protein ~u~d/or to fail to interact with the cell desensitization and/or sequestration/internalization machinery, and/or to appropriately localize to the plasma membrane. In preferred embodiments, such modifications lead to improved agonist-stimulated ,growth-promoting ability.
One specific modif cation of the nucleotide sequence encoding a G protein-coupled receptor encompassed by this invention is a mutation in any intracellular domain or membrane region proximal to internal domains. The mutation may be a deletion, including, for example, a point mutation.
This invention is also directed to chimeric C~PCRs in which intracellular domains of heterologous GPCRs that provide favorable G protein coupling properties or domains not subject to the yeast cell desensitization and/or sequestration/internalization machinery are used to ,replace comparable domains in I S GPCRs of interest. This invention also relates to the modified nucleotide sequences encoding the chimeric GPCRs, to expression vectors comprising the modified nucleotide sequences, and to host cells transformed therewith.
An additional aspect of this invention is an improved methad of assaying compounds to determine effects of ligand binding to the mutant or chimeric GPCRs of this invention by measuring the effect of the test cornpound on cell growth.
The mutant GPCRs prevent or reduce the rate of cell growth arrest due to chronic and persistent agonist stimulation, thereby decreasing the number of false negatives that occur with prior art screening methods and/or increasing the sensitivity of the bioassay.
BRIEF DESCRIPTION OF THI; DRAWINGS
FIGURE lA depicts the results of liquid culture assays on yeast cells containing the rat M3 muscarinic acetylcholine receptor {MAR) using MAR
agonist carbachol (CCh). Yeast cells containing a M3 MAR with a deletion in the third intracellular loop (IC3~) produced an agonist-dependent growth response, while the wild type MAR did not, indicating that the M3 MAR'. IC3~ is functional GPCR.

FIGURE 1B depicts the results of liquid culture fluorescence induction assays on yeast cells containing the rat M3 MAR IC3d and the FUS2-GFP reporter plasmid using the MAR agonist carbachol (CCh). A dose-alependent increase in the expression of the green fluorescent protein is observed in response to CCh activation of the M3 MAR IC3~ expressed in yeast.
FIGURE 2 depicts the results of liquid culture assays on yeast cells containing the Drosophila muscarinic acetylcholine; receptor using the MAR
agonist carbachol (CCh). Yeast cells containing a mutated Drosophila MAR containing the M3 MAR IC3~ produced an agonist-dependent growth response while the wild type Drosophila MAR lacked an agonist-dependent yeast cell growth response.
FIGURE 3 depicts the results of an agar-based plate bioassay. FIGURE 3A
shows a robust growth response of yeast cells containing the IC3~
cholecystokinin CCKB receptor. FIGURE 3B shows only limited l;rowth by yeast cells containing the wild type CCKB receptor, indicating that the de'.letion of a portion of the third intracellular loop of the CCKB receptor improves it;s function in yeast.
FIGURE 4 depicts yeast cells transformed with rSSTR3 and with rSSTR34IC3. FIGURE 4A demonstrates that yeast cells containing p426GPD-rSSTR3 show a weak response to somatostatin (S-1~4). FIGURE 4B demonstrates a much stronger response by yeast cells containing p42dGPD-rSSTR30IC3 assayed under similar conditions.
FIGURE S depicts the results of liquid culture assays on yeast cells containing wild type iC3~ human alpha2A adrenerg;ic receptor using the alpha adrenergic receptor full agonist UK14304. Yeast cells containing the wild type and IC3t1 human alpha 2A adrenergic receptor produced a dose-dependent growth response, indicating that the IC3 deletion is functional.
FIGURE 6 depicts the results of liquid culture assays on yeast cells containing wildtype and carboxy terminally truncated rat NT1-neurotensin receptors using the neurotensin receptor agonist AcNTB-13. Truncation of the rat NTI-neurotensin receptor produces an agonist-dependent growth response that is more sensitive than that observed with the wildtype receptor.

5 pCTIUS99/20013 FIGURE 7 depicts the results of liquid culture assays on yeast cells containing the C. elegans serotonin receptor using serotonin (5HT) to stimulate yeast cells growth. Yeast cells containing a mutated C. elegans serotonin receptor containing the M3 MAR IC30 produced a 5HT-dependent growth response. The growth response was blocked by addition of the serotonin receptor antagonists Iisuride and mianserin.
DETAILED DESCRIPTION OF 'THE INVENTION
Modified G Protein-Coupled Receptors Nucleotide sequences encoding G protein-coupled receptors may be modified to improve the function of the GPCR by causing the receptor to couple more efficiently with the heterotrimeric G protein and/or to fail to interact with the cell desensitization and/or sequestrationliinternalization machinery. Such modifications lead to improved agonist-stimulated yeast cell grov~rth-promoting ability. The improvement of GPCR-G protein coupling and/or a;limination of receptor phosphorylativn and/or sequestration/internalization in the host cell provides a means to improve the function of wildtype heteroIogous GPCRs that fail to stimulate a useful yeast cell growth response. Thus, GPCRs that fail to function in their wild type form may be made to work by the methods of this invention.
The improvement of GPCR-G protein coupl',ing and or elimination of receptor phosporyiation and/or sequestration/internalization in the host cell may be assessed by using routine techniques, such as those described in the Examples set fort below or known to those of skill in the art. For example, improvement of the function of a mutated GPCR over wild type may be quantified as an increase in the signal-to-noise ratio and/or in the sensitivity of the liquid bioassay. The signal-to-noise ratio is determined by comparing the agonist-induced growth rate to the growth rate observed in the absence of agonist. A statistically-signif cant increase in the signal-to-noise ratio resulting from agonist-stimulation of a mutated GPCR over similar values obtained from cells containing a wild type receptor iindicates that the function of the mutated GPCR has been improved.

The sensitivity of the liquid bioassay is defiined as the agonist concentration necessary to produce a half maximal growth rate (ED50 or EC50). The sensitivity of the bioassay is increased if a mutated GPCR produces a half maximal growth rate at an agonist concentration that is less than that requiz~ed by the wild type GPCR.
Similarly, the more qualitative agar based bioassay will reflect increases in signal-to-noise ratio and/or sensitivity due to agoni;st stimulation of mutated GPCRs.
In the agar based bioassay, signal-to-noise ratio increases are determined by comparing the extent of growth within the agonist induced growth zone resulting from stimulation of mutated and wild type receptor. The sensitivity of the bioassay is proportional to the radius of the growth zone. Since applied compounds diffuse radially from the site of application to the agar, ago:nist concentration varies with the square of the radius of the growth zone. Thus, a larger zone of growth in response to agonist activation of mutated GPCRs reflects an increase in sensitivity.
Any G protein-coupled receptor may be emI>loyed in practicing this invention.
Examples of such receptors include, but are not limiited to, adenosine receptors, somatostatin receptors, dopamine receptors, cholecystokinin receptors, muscarinic choIinergic receptors, a-adrenergic receptors, (3-adrenergic receptors, opiate receptors, cannabinoid receptors, growth hormone releasing factor, glucagon, serotonin receptors, vasopressin receptors, melanocortin receptors, and neurotensin receptors.
In certain preferred embodiments, the receptor is a nnuscarinic acetylcholine receptor and more preferably, the muscarinic acetylcholine rf;ceptor is of the M3 subtype.
Similarly, any suitable host cell may be tran:;formed with the nucleotide sequences encoding the modified G protein-coupled receptors of this invention.
Examples of suitable host cells are yeast cells, mam~:nalian cells, insect cells, and bacterial cells. Preferably, the host cells are yeast cells.
One generalizable method for improving the function of a GPCR expressed in a host cell is by modification or elimination of intrac;elluIar domains of the GPCR, such as the third intracellular loop (IC3) sequences c~f the G protein-coupled receptor.
Because the desensitization and internalization machinery acts upon the intracellular domains of the GPCR, elimination of the intracellular domains of the GPCRs produces a more stable receptor expression. This has been demonstrated in . PCT/US99/20013 experiments conducted in mammalian cells. Mu~scarinic acetylcholine receptors, including the M3 subtype, lacking a domain of their third intracellular loop thought to be involved in receptor internalization, are maintained in the plasma membrane to a greater extent than their wild type counterparts. ,rl~oro et al. (1993).
Representative embodiments of the invention are described in more detail in the following examples.
Example 1. Functional Expression of A Mutated Rat M3 Muscarinic Acetylchoiine Receptor (MAR) i;n Yeast The third intracellular loops of GPCRs are thought to interact with and participate in the activation of G proteins upon agonist binding. J. Wess (i997).
Mutations in IC3 of the yeast mating pheromone receptors, Ste2 and Ste3 have profound effects on coupling the G proteins. C. Boone et al. (1993) and C.
Clark et al. (1994). Importantly, deletion of portion of the IC3 of mammalian MARs, in particular the rat M3 MAR, is correlated with improved functional expression in mammalian cells with retention of full ability to couple to the heterotrimeric G
protein, Gq (Ga~3y). The mutated M3 MAR retains all external loops.
Transmembrane domains (TMDs) and internal donnains other than the IC3 are unchanged. The IC3, found between Sth and 6th nrtembrane spanning helices, was the only domain modified. The bulk of this domain, 9~6 amino acids in the center of the IC3 (A1a273-Lys469), were deleted, leaving only 22 amino acids proximal to both the 5th and 6th transmembrane helices. Thus, the third. intracellular loop of the MAR
containing the IC3 deletion (IC30) is 44 amino acids in length, compared to amino acids in the IC3 of wild type M3 MAR: The improvement in functional expression may due to elimination of domains knovvn to interact with cellular desensitization mechanisms, allowing more functional MAR to be retained at the cell surface.
In order to test the possibility that this IC3~ mutation would also improve functional expression in yeast, the DNA sequences encoding the wild type and IC3~
rat M3 MARS were cloned into proximity to the glycerol-phosphate dehydrogenase promoter in the yeast expression plasmid, p426GPD, by standard methods. Rat M3 WO 00/12705 ~ PCT/US99/20013 _g_ MAR sequences were amplified by PCR using olig~pnueleotides containing S' BgIII
(AAAAGATCT AAA ATG TAC CCC TAC GAC GTC CCC) (SEQ ID NO: 1 ) and 3' XhoI (AAA CTCGAG CTA CAA GGC CTG C7CC CGG CAC TCG C) (SEQ ID
NO: 2) sites. The resulting PCR product was digested with the appropriate restriction endonucleases, purified and ligated into appropriate sites in p426GPD. To form the rat M3 IC34, three M3 MAR fragments were amplified by PCR. An amino-terminal coding fragment was amplified using oIigonucleotides containing 5' Bglti (AAAAGATCT AAA ATG TAC CCC TAC GAC ~GTC CCC) (SEQ ID NO: 1) and 3' Agel (ATAGTCATGATGGTG ACCGGT ATG7CAAA.AGGCAGCGATC) (SEQ
ID NO: 3) sites. A carboxy-terminal coding fragment was amplifed using oligonucleotides containing 5' PmII (GCCTTCATC'AT CACGTG
GACCCCCTACACC) (SEQ ID NO: 4) and 3' Xholf {AAA CTCGAG CTA CAA
GGC CTG CTC CGG CAC TCG C) (SEQ ID NO: 2) sites. An IC3 coding fragment was amplified using oligonucleotides containing 5' ,qgeI
(CGATCGCTGCCTTTTACTT ACCGGT CACCATCATGACTAT) (SEQ ID NO:
5) and 3' PmII (GTTGTAGGGGGTC CACGTG A7CGATGAAGGC) (SEQ ID NO:
6) sites using the M3 IC3~ sequence. J. Wess (i99i). The resulting PCR
products were digested with the appropriate restriction endonucleases, purified and ligated into appropriate sites in p426GPD. PIasmids were confixrned by restriction endonuclease mapping and DNA sequencing. Using a convention~~l lithium acetate transformation procedure, the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growrth, such as those described in United States Patent 5,691,188, incorporated herein lay reference, including, spexifically, the MPY578fc cells described in PauscJi et al. (1998).
Yeast cells containing the MARS were assayeod in liquid culture using the MAR agonist carbachol (CCh). The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were diluted 500 fold in SC-glucose-ura-his, pH
6.8 medium containing 5 rnM 3-arninotriazole to decrease basal growth rate.
Samples of the cell suspension (180 ~1) were dispensed to wells of sterile 96 well microtiter dishes containing 20 gel of serially-diluted samples (10''-10'g M) of the muscarinic receptor agonists. The plates were incubated at 30°C for 18 hours with agitation (600 _g_ rpm). Growth was monitored by recording increases in OD62o using a microplate reader. Assays were conducted in duplicate and growth rate measurements obtained during the logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean f SEM and were plotted vs. agonist concentration. As shown in Figure l, the yeast cells containing the M3 MAR IC3t1 produced an agonist-dependent growth response, demonstrating that the M3 MAR IC30 is functional, while the wild type MAR is non-functional, as indicated by the lack of agonist-dependent yeast cell growth. The growth response of the M3 MAR IC3L1 containing cells was dose-dependent giving an ECso for carbachol (CCh) equal to 3 pM. This value matches the KD for CCh obtained in HEK cells (7.g 1tM) and the ECso for CCh induced IP3 (inositol triphosphate) accumulation (4.0 pM), suggesting that the M3 MAR IC3d retains t;he expected pharmacological properties when expressed in yeast cell membranes. Further, the growth response is blocked by the MAR-specific antagonist, atropine (At).
Alternatively, the response to CCh by yeast cells containing the M3 MAR
IC3~ may be observed by measuring the agonist-induced increase in fluorescent emission from a green fluorescent protein reporter gene whose expression is stimulated by MAR agonists. Green fluorescent protein (GFP) is a protein from Aequorea that is intrinsically fluorescent when expressed in yeast cells. The fluorescence from GFP is detectable in live yeast c;~Ils, making it possible to measure the level of its expression without any deleterious treatment of the yeast cells. This feature is particularly advantageous in the reporter ~aene assays that do not require additional steps to permit its detection. An inducib;le reporter gene that is useful in detecting the agonist-activation of heterologous GPCRs expressed in yeast utilizes transcriptional promoters that are activated by the rr~ating signal transduction pathway.
One such promoter is the FUS2 promoter. In the absence of agonist stimulation, little or no expression of the Fus2 protein or any other protein whose expression is directed by the FUS2 promoter is detectable. After treatment with agonist, transcription from the FUS2 promoter is induced up to 700 fold, leading to substantial increases in Fus2 expression or in the expression of any gene product whose expression is placed under control of the FUS2 promoter. Thus, yeast cell fluorescence resulting from GFP

expression under the control of the FUS2 promoter from a FUS2-GFP reporter gene is only observed after agonist activation of a heterologous GPCR.
In order to produce a GFP reporter gene, DANA sequences encoding the enhanced GFP (EGFP, Clonetech), FUS2 promoter and FUS2 transcriptional terminator sequences were amplified by PCR. The; fragments were assembled into the centromere containing plasmid pRS414 so as to place EGFP expression under control of the pheromone responsive FUS2 promoter in the centromere containing plasmid pRS414, producing plasmid pMP241. Using a conventional lithium acetate transformation procedure, the resulting plasrnids were introduced into yeast cells of the kind described in United States Patent 5,691,188, that are useful for performing assays of GPCR agonist-stimulated growth of cells containing the M3 MAR IC3~.
Specifically, the plasmids were introduced into the MPY578fc cells described in Paunch et al. (1998).
Yeast cells containing the M3 MAR IC30 and the FUS2-EGFP reporter plasmid were assayed in liquid culture using the MAR agonist carbachol (CCh).
The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were washed and diluted 5 fold in SC-glucose-ura-his, pH 6.8 medium containing 5 mM 3-aminotriazole to decrease basal growth rate. Samples of the cell suspension (180 ~1) were dispensed to wells of sterile 96 well microtiter dishes containing 20 ~1 of serially-diluted samples (10-'-10-8 M) of CCh. The ;plates were incubated at 30°C for 6 hours with agitation (600 rpm). Stimulation of the FUS2-EGFP reporter gene expression was monitored by recording increases in emission at 530 nm after excitation with 480 nm light using a fluorescence microplate reader. Assays were conducted in duplicate and measurements obtained during the logarithmic phase of yeast cell growth. Fluorescence emission measurements were analyzed using GraphPad Prism and were presented as the mean t SEM and were plotted vs.
agonist concentration. As shown in Figure 1B, the yeast cells containing the M3 MAR
1C3~
produced a dose dependent increase in florescence emission, consistent with increased expression of the EGFP from the agonist inducible ~'US2-GFP reporter gene construct. The EC50 for CCh stimulation of fluorescence emission is 4 pM, identical to values obtained in the growth assay.

wU ~012705 Thus, deletion of a portion of the IC3 of the rat M3 MAR has produced a functional GPCR when expressed in yeast, suggesting that modif cation of internal domains may be a generalizable method for improving the function of heteroIogous GPCRs expressed in yeast.
S
Example 2. Functional Expression of a Mutated D. melanogaster Muscarinic Acetylcholine Receptor in Yeast Agonist of the G protein-coupled insect muscarinic acetylchoIine receptors (MARS) possess substantial insecticidal and miticidaI activity. M.R. Dick et al.
(1997). These observations suggest that development of a yeast-based high throughput screen (HTS) for agonists active at insect MARS may be useful in identifying Iead compounds that might be developed into insecticides with novel mode of action. Preliminary experiments indicate that the wild type D.
medanogaster 1S MAR (DMA,R), an insect G protein-coupled receptors (GPCRs), is non-functional in yeast. Thus, an effort to develop a method for improving the function of the DMAR
in yeast was mounted, via replacement of the DIVIt~R IC3 with the functional from the M3 MAR IC3tl.
In insect cells, the DMAR interacts with the heterotrimeric Gq protein leading to an increase in intracellular calcium in response to muscarinic agonists.
One potential explanation for the inactivity of the DMA.R in yeast is an inability to efficiently couple to the yeast heterotrimeric G protein. Thus, to devise a method to improve the DMAR function in yeast, selected mutations in the GPCRs that serve to improve functional expression and coupling to the 1'ieterotrimeric G protein were 2S examined.
In order to construct the IC3 replacement, PCR fragments encoding three domains were prepared by standard means. Fragment 1 consisted of the amino terminal coding portion of the Drosophila MAR up to an Agel site within the Sth TMD, amplified by PCR using oliganucleotides (AAA, AGATCT AAA ATG
TACGGAAACCAGACGAAC) (SEQ ID NO: 7) and (CCA GTA GAG GAA
GCACATGATGGTC AGGCCT AAG TAG AAG (iCG GCC AGT GC) (SEQ ID
NO: 8). The second fragment of the DMAR was composed of carboxy terminal coding sequences starting with a PmII site in the 6th TMD, amplified by PCR
using oligonucleotides (TTCATCATCACGTGGACTCC;GTACAACATC) (SEQ ID NO: 9) and (AAA CTCGAG TTATCTAATTGTAGACGCGGC) (SEQ ID NO: 10). The M3 MAR IC3~ domain was amplified as anAgel-PmII fragment with coding sequence in S frame with fragments 1 and 2, described in Example 1. These fragments were assembled in plasmid p426GPD to place the mutated DMAR under control of the GPD promoter. The wild type DMAR was cloned unto the expression vector, pMP3, described in United States Patent 5,691,188. Using a conventional lithium acetate transformation procedure, the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, including, specifically, the MPY578fc cells described in Pausch et al. (1998).
Yeast cells containing the DMAR and the plasmid containing the wild type DMAR were assayed in liquid culture using the MA.R agonist carbachol (CCh).
The cells were cultured overnight in 2 ml SC-glucose-una medium. The cells were diluted 500 fold in SC-glucose-ura-his, pH 6.8, medium containing S mM 3-aminotriazole to decrease basal growth rate. Samples of the cell suspension (180 ~.I) were dispensed to wells of sterile 96 well microtiter dishes containing :Z0 ~1 of serially-diluted samples (10-' -10-8 M) of the muscarinic receptor agonists. The plates were incubated at 30°C
for 18 hours with agitation (600 rpm). Growth was monitored by recording increases in OD620 using a microplate reader. Assays were conducted in duplicate and growth rate measurements obtained during the logarithmic phase of yeast cell growth.
Optical density measurements were analyzed using (iraphPad Prism and are presented as the mean t SEM and were plotted vs. agonist concentration: As shown in Figure 2, the yeast cells containing the mutated DMAR, i.e., the M3 MAR IC3L1, produced an agonist-dependent growth response, demonstrating that the DMAR-M3 MAR IC30 is functional. The wild type DMAR is non-functional, .as indicated by the lack of agonist-dependent yeast cell growth.
Thus, replacing IC3 of the DMAR with the functional deleted IC3 from the rat M3 MAR produces a functional chimeric GPCR when expressed in yeast, indicating that this method of replacing internal domains may bc: a generalizable method for improving the functional expression of heterologo~.is GPCRs in cell-based assays, such as yeast assays.
Example 3. Functional Expression of a Mutated Rat Cholecystokinin CCKB
Receptor in Yeast As shown in Examples l and 2, deletion of portion of the IC3 of mammalian MARS, in particular the rat M3 MAR, is correlated with improved functional expression in mammalian and yeast cells with retention of full ability to couple to the heterotrirneric G protein. In order to test the possibility that this IC3~
mutation would also improve functional expression of other GPCRs in yeast, the DNA sequences encoding the rat wild type and IC3~ cholecystokinin CCKB receptor were amplified by PCR and cloned into proximity to the glycerol-phosphate dehydrogenase promoter in yeast expression plasmid, p426GPD, by standard methods. The wild type CCKBR
was amplified by PCR using oligonucIeotides (ACTTAGATCAAAAAATGGAGCGCTCAAGCTGAACCG) (SEQ ID NO: I I ) and (TCCCGTCGACTCAGCCAGGCCCCAGTG TGCTG) {SEQ ID NO: 12) . The IC30 cholecystokinin CCKB receptor was prepared. by fusing two overlapping fragments. Fragment 1 contained amino terminal coding sequences including 22 amino acids proximal to the 5th TMD, amplified by PCR using oligonucleotides (ACTTAGATCAAAAAATGGAGCGCTCAAGCTGAACCG) (SEQ ID NO: 11 ) and (CGAGGGCCAGGGACTGGCCCCGGCCGGGCt~CGGCTTTGGGTCTCG) (SEQ
ID NO: I3). Fragment 2 contained carboxy terminal coding sequences including amino acids proximal to the 6th TMD, amplified by PCR using oligonucIeotides (TCCCGTCGACTCAGCCAGGCCCCAGTGTGC'TG) (SEQ ID NO: 12) and (CGAGACCCAAAGCCGGGCCCGGCCGGGGCI:AGTCCCTGGCCCTCG) (SEQ
ID NO: I4). The two fragments were fused by amplification by PCR using oligos at 5' and 3' ends of the full length CCKB receptor. Using a conventional lithium acetate transformation procedure, the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, including, specifically, the MPY578fc cells described in Pausch et al. (1998).

WO 00!12705 PCT/US99/20013 Yeast strains containing wild type and IC3~' cholecystokinin CCKB receptor were grown overnight in 2 ml synthetic complete !liquid medium containing glucose (2%) and lacking uracil {SCD-ura) medium. In this agar-based plate bioassay, molten (50°C) SCD-ura-his agar medium {35 ml, adjusted to pH 6.8 by addition of concentrated KOH or NH40H prior to autoclaving) containing 0.5 mM AT {3-aminotriazole) was inoculated with the overnight culture {2 x 10°
cells/ml) and poured into square (9 x 9 cm) petrii plates. Solutions of CC',K agonists in DMSO ( 1 mM, 10 ~Cl) were applied to the surface of the solidified agar (Upper left: CCK8S;
upper right, CCKBUS; lower left, CCKS; lower right, CCK4). Compounds applied to the surface of the plate diffused radially from the site of application and bound to CCKB
receptors expressed on the surface of cells embedded in the agar, resulting in induction of FUSI-HIS3 expression. The responding cells formed a dense growth zone readily detectable over the limited growth of cells observed in response to basal FUSI-HISS expression. Plates were incubated at 30°C for 3 days (Figure 3). Figure 3A demonstrates the robust growth response of yeast cells containing the IC3a cholecystokinin CCKB receptor, while Figure 3B shows only limited growth by yeast cells containing the wild type CCKB receptor, indicating that the deletion of portion of the third intracellular loop of the CCKB receptor improves its function in yeast.
Example 4. Functional Expression of a Mutated Rat Somatostatin Receptor (SSTR) in Yeast The third intracellular loop participates in many GPCR functions, including G
protein coupling, desensitization and interaction witlh diverse modifying proteins.
Somatostatin receptors are encoded in five subtypes;, labeled SSTR1-5. Several amino acids are found in the third intracellular loop of the SSTR3 subtype, but not in the equivalent region of SSTR2 subtype. Since SSTR2 functions efficiently in yeast, deletion of those amino acids from IC3 may impart this functional efficiency upon SSTR3. Thus, 8 amino acids, Gln-Trp-Val-Gln-Ala-Pro-Ala-Cys (SEQ ID NO: 15), were deleted from the third intracellular loop of the rSSTR3 cDNA, enabling more efficient receptor signaling in yeast.

Rat SSTR3 sequences were amplified by PCR using oligonucleotides containing 5' BgIII and 3' XhoI sites. The resulting; PCR product of approximately I .3 kb was digested with BgIII and XhoI, purified and inserted between the BamHI
and XhoI sites in p426GPD to generate the plasmid p426GPD-rSSTR3. Recombinant plasmids were confirmed by restriction endonuclease digestion and DNA
sequencing.
Standard PCR reactions were used to amplify the rSSTR3 cDNA to yield two PCR fragments that have 36 by overlap as follows. PCR insert A of approximate size 750 by was generated using the 5' Bgl oligonucleotiide (AAAAAGATCT
AAAATGGCCA CTGTTACCTA 'I~ (SEQ ID NO: 16) and the 3' oligonucieotide CTCAGAGCGG CGTCGCCGCT GACACGAGG~G CGCCCG (SEQ ID NO: 17).
PCR insert B of approximate size 530 by was generated using the 5' oligonucleotide GCGCCCTCGT GTCAGCGGCG ACGCCGCTC'f GAG
(SEQ ID NO: 18) and the 3' XhoI oligonucleotide (AAAACTCGAG TTACAGATGG
CTCAGTGTGC T) (SEQ ID NO: 19). PCR fragments A and B were gel purified, annealed and amplified by PCR using the flanking 5~' BgIII and 3' XhoI
oligonucleotides to yield the ~ 1.3 kb rSSTR30IC31?CR product. Following purification and digestion with BgIII-XhoI, the rSS'f3~IC3 insert was ligated into BamI-II-XhoI sites of p426GPD to generate the plasmid p426GPD-rSSTR30IC3.
Restriction mapping and DNA sequencing confirmed correct reading frame and sequence.
Yeast cells of the type useful for expression of GPCRs, described in United States Patent 5,69I,188, were transformed with p42EiGPD-rSSTR3 and p426GPD-rSSTR3~IC3, using standard procedures. The cells (i.e., the LY296 cells, described in Price et al. (1995)) were assayed using the agar-based bioassay format described in Example 3. Samples (IO ul) of Somatostatin (S-14, 1mM) were applied to the surface of the selective agar medium containing the yeast cells expressing the SSTR3.
The plates were incubated for 3 days at 30°C. Yeast cells transformed with p426GPD-rSSTR3 along with pLP82 (containing a Gpal/Gaii2 c;himeric G-protein expression plasmid) showed a weak growth response to S-14 (Figure 4A), whereas a much stronger response was observed when p426GPD-rSS'TR3~IC3 was assayed under - lb -similar conditions {Figure 4B). These results indicate that deletion of a portion of the IC3 improves the function of the SSTR3 in yeast.
Example 5. An IC3 deleted Human Alpha2A .Adrenergic Receptor S
As shown in Examples 1-4, deletion of pori:ion of the IC3 of mammalian GPCRs is correlated with improved functional expression in mammalian and yeast cells with retention of full ability to couple to the heterotrimeric G
protein. The mutated MARs, CCKBR, and SSTR3 retain all external loops. Transmembrane domains and internal domains other than the IC3 are unchanged: The IC3, found between 5th and 6th membrane spanning helices, was the only domain modified.
The bulk of this domain was deleted leaving only 22 amino acids proximal to both the 5th and 6th transmembrane helices. 'Thus, IC3 of the GPCRs containing the IC3 deletion (IC3d ) is 44 amino acids in length. The improvement in functional expression may 1 S be due to elimination of domains known to interact with cellular desensitization mechanisms, allowing more functional MAR to be retained at the cell surface.
In order to test the possibility that other IC3~1 mutations would also improve functional expression of other GPCRs in yeast, DNA sequences encoding an IC3t1 human alpha2A adrenergic receptor were amplified by PCR and cloned into proximity to the glycerol-phosphate dehydrogenase promoter in yeast expression plasmid, p426GPD, by standard methods. The IC3~ human ~alpha2A adrenergic receptor was prepared by fusing two overlapping fragments. Fral;ment 1 contained amino terminal coding sequences including 39 amino acids proximal to the 5th TMD, amplified by PCR using oligonucleotides (GGCCAGGATCCAA.AAATGGGCTCCCTGCAG~CCGGACGC) (SEQ ID NO: 20) and (CGGGCCCCGCGCTGCGCTCGGGGCCCAGACCGTTGGGC) (SEQ ID NO:
21). Fragment 2 contained carboxy terminal coding sequences including 41 amino acids proximal to the 6th TMD, amplified by PCR using oligonucleotides (CGGGCGACAGCCTGCCGCGGC) (SEQ ID NO: 22) and (AGCGGTCGACTCACACGATCCGCTTCCTGTC;CCC) (SEQ ID NO: 23). The two fragments were fused by amplification by PCR using oligos at 5' and 3' ends of the full length alpha2A adrenergic receptor. Using a conventional lithium acetate transformation procedure, the resulting plasmids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, including, specifically, the MPY578fc cells described in Pausch et al. (1998).
Yeast cells containing the wild type IC3~ human alpha2A adrenergic receptor were assayed in liquid culture using the alpha adrenergic receptor full agonist UK14304 (RBI) and partial agonist clonidine. The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were diluted S00 fold in SC-glucose-ura-his, pH 6.8 medium. Samples of the cell suspension (1.80 pl) were dispensed to wells of sterile 96 well microtiter dishes containing 20 ~.l of'serially-diluted samples of the adrenergic receptor agonist, UK14304 (10'' - 10''° M). The plates were incubated at 30°C for 18 hours with agitation (600 rpm). Grovv~~h was monitored by recording increases in OD620 using a microplate reader. Assays were conducted in duplicate and growth rate measurements obtained during the :logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean t SEM and were plotted vs. agonist concentration.
The yeast cells containing the wild type IC3d human alpha 2A adrenergic receptor produced a dose-dependent growth response, indicating that this IC3 deletion is functional (Figure S).
Example 6. Truncation of the Rat Neurotensin NT1 Receptor Causes an Iacrcase in Agonist Sensitivity In examples 1-4, modification of the third intracellular loop leads to improvement in functional expression of a variety ojFheterologous GPCRs expressed in yeast. Agonist induced desensitization of the GPCRs is also mediated in part by GPCR internal domains other than the third intracellular loop, such as the intracellular carboxy-terminal tail.
Elimination of the carboxy terminal domains from GPCRs has been shown to improve functional expression in yeast and mamrnal:ian cells. Truncation of the carboxy terminal tail of the G protein-coupled alpha mating pheromone receptor expressed in a-mating type yeast cells causes supersensitivity to the presence of mating pheromone (Reneke et al. (1988); Konopka et al (1988)). Consistent with these observations, a mutated rat neurotensin NT1 receptor (rNTRl) lacking its carboxy terminal tail is resistant to agonist-induced internalization when expressed in mammalian cells (Hermans et al. (1996)).
To test whether carboxy-terminal truncation improves the functional response of a heterologous GPCR expressed in yeast, the rat NTRI was modified by deleting the 52 amino acids that constitute the carboxy terminal tail, leaving a shortened receptor 372 amino acids in length. The coding sequences of the wild type and truncated neurotensin NT1 receptor (rNTRI C-term d), were amplified by PCR
using a 5' oligonucleotide primer that specified a common. amino-terminal coding sequence (AGTCAGATCTAAGCTT AAAA ATG CAC CT(: AAC AGC TCC) (SEQ ID NO:
24) and separate oligos that define the wild type (AGTC AGATCT CTA GTA CAG
GGTCTCCC) {SEQ ID NO: 25} and truncated carboxy termini (AGAG AGATCT
TTAGCGCCACCCAGGACAAAGGC) (SEQ ID 1\f0: 26). These fragments were cloned into proximity of the PGK promoter in the yeast expression vector pPGK
by standard methods (Y S. Kong et al. (1990)}. Using a conventional lithium acetate transformation procedure, the resulting plasrnids were introduced into yeast cells of the kind described in United States Patent 5,691,188. that are useful for performing assays of GPCR agonist-stimulated growth, including, specifically, the MPY578fc cells described in Paunch et al. (1998).
Yeast cells containing the NTRIs were assayed in liquid culture using the NT
receptor agonist acetyl neurotensin 8-13 {AcNtB-13). The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were diluted 500 fold in SC-glucose-ura-his, pH 6.8 medium containing 2 mM 3-~aminotriazole to decrease basal growth rate. Samples of the cell suspension (180 Pl) were dispensed to wells of sterile 96 well microtiter dishes containing 20 ul of serially-diluted samples (10-3-10-'0 M) of AcNTB-13. The plates were incubated at 30 °C for I8 hours with agitation (600 rpm}. Growth was monitored by recording increases. in ODbzo using a microplate reader. Growth rate measurements were obtained during the logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean ~ SEM and were plotted against agonist concentration. As shown in Figure _6, the yeast cells containing the NTRIs produced an agonist-dependent growth response demonstrating that both the wild type and carboxy terminally truncated NTRI s were functional. The growth response of the rNTRl C-term D containing cells was dose-dependent giving an ECSO for AcNTB-13 equal to 520 nM. This value is five fold lower than observed for cells expressing the wild type NTR1 (2.I uM): The carboxy terminal deletion has produced a rNTRl that responds to a Iower concentration of NTR agonise improving the sensitivity of the yeast bioassay.
Thus, deletion of a portion of the carboxy terminal intracellular domain of the I0 rat NTRI has produced a functional GPCR with increased agonist sensitivity when expressed in yeast, suggesting that modif cation of this internal domain is a generaIizable method for improving the function of heterologous GPCRs expressed in yeast.
15 Example 7. Functional Expression of a Mutated C, elegans Serotonin Receptor in Yeast Agonists of the G protein-coupled C. elegans serotonin receptor (Ce SHTR) may possess substantial nematacidal activity. These observations suggest that 20 development of a yeast-based HTS for agonists active at Ce SHTRs may be useful in identifying lead compounds that might be deveiope;d into nematacides with a novel mode of action. Preliminary experiments indicated. that the wild type Ce SHTR
was non-functional in yeast. Thus, an effort to develop a method for improving the function of the Ce SHTR in yeast was mounted, via. replacement of the Ce SHTR

25 with the functional IC3 from the M3 MAR IC30.
In order to construct the IC3 replacement, PCR fragments encoding three domains were prepared by standard means. Fragment 1 contains the amino terminal-coding portion of the Ce SHTR to the intracellular interface of the 5th TMD, amplified by PCR using oligonucleotides 30 (AAAAGATCTAAAATGATCGACGAGACGCT1'C) (SEQ ID NO: 27) and (CCGCTTGGTGATCTGACTTCTGGTTTCTGTCCCAGAGGCCTGTAGGCCAG
CCAGCTCTTTGGTACGCTTCTCAGTTTCCTTA;TAGATCTTCCAGTACACGC

AAATTATTGC) (SEQ ID NO: 28}. The second :fragment of the Ce SHTR contains carboxy-terminal coding sequences starting proximal to the intracellular interface of the 6th TMD, amplified by PCR using oligonucleotides (AAAACTCGAGTCAATAATCGTGAATAAGtiCA) (SEQ ID NO: 29) and S (GGCCTACAGGCCTCTGGGACAGAAACCACiAAGTCAGATCACCAAGCGGA
AGAGGATGTCGCTCATCAAGGAGAAGAAGGCCGCCAGAACGCTAGCAAT
TATTACAGGTAC) (SEQ ID NO: 30). The M3 MAR IC30 domain was amplified by PCR as described in Example 1.
These fragments were isolated, mixed and amplified by PCR with S' (AAAAGATCTA,AAATGATCGACGAGACGC'fTC) (SEQ ID NO: 27) and 3' (AAAACTCGAGTCAATAATCGTGAATAAGGCA} {SEQ ID NO: 29) oIigonucleotides. The resulting fragment was digested with appropriate restriction endonucleases and assembled in p426GPD to place the mutated Ce SIEiTR under control of the GPD
1 S promoter. Using a conventional lithium acetate transformation procedure, the resulting plasrnids were introduced into yeast cells useful for performing assays of GPCR agonist-stimulated growth, such as those described in United States Patent 5,691,188, including, specifically, the MPYS78fc cells described in Pausch et al.
1998.
Yeast cells containing the Ce SHTR were assayed in liquid culture. The cells were cultured overnight in 2 ml SC-glucose-ura medium. The cells were diluted fold in SC-glucose-ura-his, pH 6.8 medium containing 2 mM 3-aminotriazole to decrease basal growth rate. Samples of the cell suspension (200 p,l) were dispensed to wells of sterile 96 well microtiter dishes containing 2.0 p,l of serially-diluted samples 2S (10'2 -10'9 M) of serotonin (SHT). In similar reactions, the serotonergic antagonists lisuride and mianserin were added to each well at I 0 p,M. The plates were incubated at 30°C for I8 hours with agitation (600 rpm). Growtlh was monitored by recording increases in OD620 using a microplate reader. Assays were conducted in duplicate and growth rate measurements were obtained during the logarithmic phase of yeast cell growth. Optical density measurements were analyzed using GraphPad Prism and are presented as the mean ~ SEM, plotted vs. agonist concentration. Ki values were WO OOIi2705 determined using the equation of Cheng and Pnxesoff. (Y. Cheng et al. (1973)).
As shown in Figure 7, the yeast cells containing thE; mutated Ce SHTR containing the M3 MAR. IC3~ produced an agonist-dependent growth response; demonstrating that the Ce SHTR-M3 MAR IC3e is functional. As expected, the serotonergic antagonists lisuride and mianserin blocked the growth inducing effect of serotonin, demonstrating that the Ce SHTR exhibits the expected pharmacological properties when expressed in yeast.
Thus, replacing IC3 of the Ce SHTR with the functional deleted IC3 from the rat M3 MAR produces a functional chimeric GPCR when expressed in yeast, indicating that this method of replacing internal domains may be a generalizabie method for improving the functional expression of heterologous GPCRs in cell-based assays, such as yeast assays.
Other embodiments of the invention will 'be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein.
It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being; indicated by the following claims.
The references cited herein are specificall.~ incorporated by reference in their entirety.

REFERENCES
C. Boone et al., "Mutations That Alter the 'Third Cytoplasmic Loop of the A-Factor Receptor Lead to a Constitutive and Hypersensitive Phenotype,"
Genetics, Proc. Nat'1. Acad Sci. U.S.A., 90:9921-9925 (Nove;mber 1993).
M. G. Carom "The Guanine Nucleotide Regulatory Protein-Coupled Receptors for Nucelotides, Amino Acids, and Amine Neurotransmitters," Cell Biology, 1:159-166 (/989).
Y. Cheng et al., "Relationship between the inhibition constant (Ki) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction," Biochem. Pharmacol:, 22: 3099-3108 (1973).
C. D. Clark et al., "Systematic Mutagenesis of the Yeast Mating Pheromone Receptor Third Intracellular Loop," J. Biol. Chem., 269(12):8831-8841 (1994).
B.R. Conklin and H.R. Bourne, "Structurz~I Elements of G Alpha Subunits that Interact with G Beta Gamma Receptors, and Ef~ectors," Cell, 73:631-641 (1993).
M. R. Dick et al., "Muscarinic Agonists as Insecticides and Acaricides,"
Pestic. Sci., 49:268-276 ( 1997).
H.G. Dohlman et al., "Model Systems for the Study of Seven Transmembrane-Segment Receptors," Ann. Rev. Bic~chem., 60:653-688 ( I 991 ).
E. Hermans et al., "Interaction of the COO;H-Terminal Domain of the Neurotensin Receptor with a G Protein Does Not Control the Phospholipase C
Activation But is Involved in the Agonist Induced Internalization," Mol.
Pharmacol., 49:365-372 (1996).
Y. S. Kang et al., "Effects of Expression of Mammalian G Alpha and Hybrid Mammalian-Yeast G Alpha Proteins on the Yeast P'.heromone Response Signal Transduction Pathway," Mol. Cell. Biol., /0(6):2582-2590 (1990).
J. B. Konopka et al., "The C-Terminus of t1e S. cerevisiae Alpha Pheromone Receptor Mediates an Adaptive Response to Pheromone," Cell, 54:609-620 (1988).
M. Krieger et al., "Isolation of Chinese Hannster Cell Mutants Defective in the Receptor-Mediated Endocytosis of Low Density Lipoprotein," J. Mol. Biol., 150(2);167-84 {Aug. 1981 ).
J. Lameh et al., "Hm 1 Muscarinic Cholinergic Receptor Internalization Requires a Domain in the Third Cytoplasmic Loop,"' J. Biol. Chem., 267(19):13406-/3412 {1992).

S. B. Liggett et al., "Sites in the Third Intracellular Loop of the a~,-Adrenergic Receptor Confer Short Term Agonise-Promoted Desensitization," J.
Biol.
Chem., 267(7}:4740-4746 (1992}.
O. Moro et al., "Serine- and Threonine-rich Domain Regulates Internalization of Muscarinic Cholinergic Receptors," J. Biol. Chem., 268(I O}:6862-6865 (1993).
M. H. Pausch et al., "G-Protein-Coupledl Receptors in Saccharomyces Cerevisiae: high-Throughput Screening Assays for Drug Discovery,"Trends in Biotechnology, 15:487-494 (I997}.
M. H. Pausch et al., "Heterologous G protein-coupled receptors in Saccharomyces cerevisiae, Methods for genetic analysis and ligand identif cation,"
Identification and expression of G protein-coupled receptors, Lynch, K. R., Ed., Wiley-Liss, New York, NY, 196-212 (1998}.
L. A. Price et al., "Functional coupling,oi"a mammalian somatostatin receptor to the yeast pheromone response pathway," Mol. Cell. Biol. 15, 6188-6195, (1995).
J. E. Reneke et al., "The Carboxy Terminal Segment of the Yeast Alpha Factor Receptor Is a Regulatory Domain," Cell, 5 5:221-234 ( 1988}.
A. B. Tabin et al., "Identification of a Novel Receptor Kinase That Phosphorylates A PhasphoIipase C-linked Muscannic Receptor," J. Biol. Chem., 271(7):3907-3916 (1996).
A. B. Tobin et al., "Stimulus-Dependent P'hosphorylation of G-Protein-Coupled Receptors by Casein Kinase la," J. Biol: Chem., 272(33):20844-20849 ( 1997).
H. Tsuga et al., "Internalization and Down-Regulation of Human Muscarinic Acetylcholine Receptor m2 Subtypes," J. Biol. Chem., 273(9):5323-5330 {I996}.
J. Wess, "G-Protein-Coupled Receptors: Molecular Mechanisms Involved in Receptor Activation and Selectivity of G-Protein R:ecognition," FASEB J., 11:

354 (1997}.

Claims

We claim:
1. A yeast cell comprising a nucleic acid sequence encoding a modified, heterologous G protein-coupled receptor (GPCR), wherein the modification comprises a mutation in an intracellular domain of the G protein-coupled receptor and results in an improved functional response in a cell-based assay as compared to a wild-type form of the heterologous G protein-coupled receptor, and wherein the modified G protein-coupled receptor is selected from the group consisting of a muscarinic acetyleholine receptor, a chalecyslokinin CCKB receptor, a somatostatin receptor, an alpha 2A adrenergic receptor, and a serotonin receptor.
2. The yeast cell according to claim 1, wherein the modification promotes agonist stimulated growth and wherein the agonist is a G protein-coupled receptor agonist.
3. The yeast cell according to claim 2, wherein the modification results in improved coupling between the receptor and a heterotrimeric G protein or failure of the receptor to interact with cell desensitization or sequestration-internalization machinery or proper plasma membrane localization.
4. The yeast cell according to claim 1, wherein the mutation is a deletion.
5. The yeast cell according to claim 4, wherein the deletion is a point mutation.
6. The yeast cell according to claim 4, wherein the deletion is in the third intracellular loop of the G protein-coupled receptor.
7, The yeast cell according to claim 6, wherein the G protein-coupled receptor is selected from the group consisting of a muscarinic acetylcholine receptor, a cholecystokinin CCKB receptor, and an alpha 2A adrenergic receptor.
8. The yeast cell according to claim 1, wherein the serotonin receptor is Ce 5HTR.
9. The yeast cell according to claim 1, wherein the muscarinic acetylchloline receptor is a rat M3 muscarinic acetylcholine receptor or a D. melanogaster muscarinic acetylcholine receptor.
10. The yeast cell according to claim 1, wherein the chalecystokinin CCKB
receptor is a rat cholecystakinin CCKB receptor.
11. The yeast cell according to claim 1, wherein the somatostatin receptor is a rat somatostatin receptor subtype 3.

12. The yeast cell according io claim 1, wherein the alpha 2A adrenergic receptor is a human alpha 2A adrenergic receptor.
14. The yeast cell according to claim 6, wherein the deleted third intracellular loop is 44 amino acids in length.
15. The yeast cell according to claim 11, wherein a sequence Gln-Trp-Val-Gln-Ala-Pro-Ala-Cys (SEQ 117 NO:15) is deleted from the third intracellular loop of the mutant G protein-coupled receptor.
16. A yeast cell comprising a nucleic acid sequence encoding a chimeric G
protein-coupled receptor, wherein the chimeric G protein-coupled receptor comprises a first heterolagous G protein-coupled receptor in which an intracellular domain has been replaced with a modified intracellular domain of a second heterologous G
protein-coupled receptor, and wherein the modified intracellular domain ref the second heterologous G protein-coupled receptor confers an improved functional response to the chimeric G protein-coupled receptor in a cell-based assay as compared to a wild-type form of the first heterologous G protein-coupled receptor.
17. The yeast cell according to claim 16, wherein the modified intracellular domain is the third intracellular loop.
20. The yeast cell according to claim 1 or 16, further comprising a plasmid comprising an inducible reporter gene.
24. The yeast cell according to claim 20, wherein the reporter gene is a green fluorescent protein.
25. The yeast cell according to claim 24, wherein the green fluorescent protein is operably linked to a FUS2 promoter.
26. A method for screening compounds capable of binding to G protein-coupled receptors comprising:
(a) subjecting the yeast cell according to claim 1 or 16 to a test compound;
and (b) measuring the effect of the test compound in cell growth, 27. A yeast cell comprising a heterolagous G protein-coupled receptor, wherein the G protein-coupled receptor has a deletion in an intracellular domain that results in an improved functional response of the G protein-coupled receptor in a cell-based assay as compared to a wild-type form of the heterologous G protein-coupled receptor.

28. The yeast cell according to claim 27, wherein the modification promotes agonist stimulated growth, and wherein the agonist is a G protein-coupled receptor agonist 29. The yeast cell according to claim 28, wherein the modification results in improved coupling between the heterologous G protein coupled receptor and a heterotrimeric G protein or failure of the heterologous G protein-coupled receptor to interact with cell desensitization or sequestration-internalization machinery or proper plasma membrane localization.
32. The yeast cell according io claim 27, wherein the intracellular domain is the third intracellular domain.
33. The yeast cell according to claim 27, wherein the heterologous G protein-coupled receptor is modified at the carboxy terminal of the G protein-coupled receptor.
35. The yeast cell according to claim 33, wherein the modified G protein-coupled receptor is a neurotensin receptor.
36. The yeast cell according to claim 35, wherein the neurotensin receptor is a rat neurotensin NT1 receptor.
37. A method far screening compounds capable of binding to G protein-coupled receptors comprising:
(a) subjecting the yeast cell according to claim 27 to a test compound; and (b) measuring the effect of the rest compound on yeast cell growth.
38. The yeast cell according to claim 6, wherein the deletion is IC3.DELTA..