JP2001197890A - Estrogen receptor gene and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new estrogen receptor gene that can be used for an assay system for evaluating an estrogen receptor activity-regulating ability of a chemical substance. SOLUTION: This is a gene encoding an estrogen receptor selected from (a) an estrogen receptor having a specific amino acid sequence derived from fish Lepomis centrarchidae, (b) an estrogen receptor having an amino acid sequence having a homology to the amino acid sequence of (a) at 95% or more, (c) an estrogen receptor having a specific amino acid sequence that is derived from L. centrarchidae and is different from (a), and (d) an estrogen receptor having an amino acid sequence having a homology to the amino acid sequence of (c) at 95% or more.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an estrogen receptor gene and its use.

[0002]

2. Description of the Related Art In recent years, it has been reported that some chemical substances in the environment show estrogenic activity. For example, reports on feminization of wild fish and the like by certain chemical substances have been reported. (T.Col.)
born, D .; Dumanoski and J.M. P.
Myers: Our Story Future,
1996, Duton, New York). Since the activity of such a chemical substance may disrupt the hormonal balance of various organisms including humans and cause abnormalities and diseases, the estrogenic activity of the chemical substance is measured as part of the safety evaluation of the chemical substance. Attempts have been made. When estrogen binds to the estrogen receptor present on the estrogen target cell, the receptor is activated and binds to an estrogen responsive element on the chromosome, where it is further transcribed to recognize the complex of estrogen and estrogen receptor. The factor groups combine
Promotes the expression of a gene downstream of the response element. Therefore, as a method for measuring the estrogen-like activity of a chemical substance, the development of a test system for evaluating the ability of the chemical substance to regulate estrogen receptor activity is required.
There is a strong need for an estrogen receptor gene that can be used in the test system.

[0003]

Means for Solving the Problems Under such circumstances, the present inventors have conducted intensive studies, and as a result, have succeeded in isolating the estrogen receptor gene from bluegill, which is a model animal of aquatic animals, and reached the present invention. Was. That is, the present invention provides: 1) a gene encoding an estrogen receptor according to any one of the following (a) to (d) (hereinafter referred to as the gene of the present invention): (a) an amino acid represented by SEQ ID NO: 1 Estrogen receptor having a sequence. (B) 95 amino acids relative to the amino acid sequence represented by SEQ ID NO: 1
An estrogen receptor having an amino acid sequence exhibiting at least 100% amino acid identity. (C) an estrogen receptor having the amino acid sequence represented by SEQ ID NO: 4. (D) 95 amino acids relative to the amino acid sequence represented by SEQ ID NO: 4
An estrogen receptor having an amino acid sequence exhibiting at least 100% amino acid identity. 2) base numbers 424 to 224 of the base sequence represented by SEQ ID NO: 2
An estrogen receptor gene having the base sequence represented by 1941 or the base sequence represented by base numbers 74 to 1819 of the base sequence represented by SEQ ID NO: 5, 3) a vector containing the gene of the present invention (hereinafter, the vector of the present invention) 4) A method for producing a vector, which comprises incorporating the gene of the present invention into a vector capable of replicating in a host cell; 5) a transformant in which the gene of the present invention has been introduced into a host cell (hereinafter referred to as the present invention). 6) a method for producing a transformant, which comprises introducing the gene of the present invention or the vector of the present invention into a host cell; 7) culturing the transformant of the present invention to estrogen receptor; A method for producing an estrogen receptor, characterized by being produced; 8) having an amino acid sequence represented by either SEQ ID NO: 1 or SEQ ID NO: 4; 9) an estrogen receptor having an amino acid sequence showing 95% or more amino acid identity to the amino acid sequence represented by either SEQ ID NO: 1 or SEQ ID NO: 4) 10) expressing the gene of the present invention, A transformant into which a reporter gene linked downstream of a transcription control region containing a response element has been introduced, and contacted with a test substance.
A method for evaluating the ability of a test substance to regulate estrogen receptor activity, which comprises the step of measuring the expression level of the reporter gene in the transformant; 11) a transcription-coupling factor capable of binding to an estrogen receptor in a ligand-dependent manner, or In a two-hybrid system in which transcription of a reporter gene is activated by forming a complex between a receptor binding region and an estrogen receptor or a ligand binding region of the receptor in a ligand-dependent manner, the ability of a test substance to regulate estrogen receptor activity is improved. (12) Use of the gene of the present invention for measurement. (12) A receptor binding assay comprising a step of bringing an estrogen receptor described in the above item (8) or (9) into contact with a test substance and keeping the temperature of the test substance warm.

[0004]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. Examples of the gene of the present invention include, for example, a gene encoding an estrogen receptor having the amino acid sequence represented by SEQ ID NO: 1, a gene encoding an estrogen receptor having the amino acid sequence represented by SEQ ID NO: 4, and a gene encoding SEQ ID NO: 1. A gene encoding an estrogen receptor having an amino acid sequence exhibiting 95% or more amino acid identity to the amino acid sequence shown; an amino acid sequence exhibiting 95% or more amino acid identity to the amino acid sequence represented by SEQ ID NO: 4; A gene encoding an estrogen receptor, an estrogen receptor gene having a base sequence represented by base numbers 424 to 1941 in the base sequence represented by SEQ ID NO: 2, and a base sequence represented by base numbers 74 to 1819 in the base sequence represented by SEQ ID NO: 5 Having the base sequence to be determined It is possible to increase the plasminogen receptor gene and the like. Here, “an estrogen receptor having an amino acid sequence showing 95% or more amino acid identity to the amino acid sequence represented by SEQ ID NO: 1” includes, for example, a region comprising about 400 amino acid residues or more. Has an amino acid sequence showing about 95% or more amino acid identity with the amino acid sequence shown, and
Estrogen receptors having receptor functions substantially equivalent to those of the estrogen receptor consisting of the amino acid sequence represented by SEQ ID NO: 1 can be mentioned.
In addition, “9 to the amino acid sequence represented by SEQ ID NO: 4”
Examples of the estrogen receptor having an amino acid sequence showing 5% or more amino acid identity include, for example, about 400
An estrogen receptor having an amino acid sequence having about 95% or more amino acid identity with the amino acid sequence represented by SEQ ID NO: 4 in a region consisting of amino acid residues or more, and substantially having an amino acid sequence represented by SEQ ID NO: 4; And estrogen receptors having receptor functions equivalent to the above. The receptor function can be evaluated based on, for example, a reporter assay, a two-hybrid system, a receptor binding assay, and the like described below. Also, SEQ ID NO: 1 found in the amino acid sequence of such an estrogen receptor
An amino acid difference from the amino acid sequence shown by SEQ ID NO: 4 or the amino acid sequence shown by SEQ ID NO: 4 means deletion of an amino acid,
Substitution, addition, etc., which also include naturally occurring polymorphic mutations such as amino acid sequence differences based on differences in animal strains, individuals, organs, tissues, and the like. The gene encoding such an estrogen receptor may be a natural gene, or may be created by introducing a mutation into the natural gene, for example, by site-directed mutagenesis or mutagenesis. It may be a gene.

The gene of the present invention is, for example, a fish bluegill (scientific name: Lepomis centrarchida).
e) and other organizations. Sambrook, E .; F. F
risch, T .; By Maniatis; Molecular
Cloning 2nd edition (Molecular Cloni
ng 2nd edition), Cold Spring Harbor Laboratory (Cold Spring H)
arbor Laboratory, 1989)
Etc. can be obtained according to the genetic engineering method described in the above. Specifically, for example, first, total RNA derived from bluegill tissue is prepared. Tissues such as bluegill liver are crushed in a solution containing a protein denaturant such as guanidine hydrochloride or guanidine thiocyanate, and phenol, chloroform or the like is added to the crushed material to denature the protein. After removing the denatured protein by centrifugation or the like, the guanidine hydrochloride / phenol method, S
DS-phenol method, guanidine thiocyanate / Cs
Total RNA is extracted by a method such as the Cl method. Commercially available kits based on these methods include, for example, IS
OGEN (Nippon Gene) or Trizol reagent (L
ifTechnologies). Using the obtained total RNA as a template, the oligo dT primer was
A. Annealed to the polyA sequence of A, synthesize a single-stranded cDNA by reverse transcriptase, and then use the single-stranded cDNA as a template and nick and gap the RNA strand using E. coli RNaseH to obtain RNA. A double-stranded cDNA is synthesized using E. coli DNA polymerase I with the fragment as a primer. Further, both ends of the double-stranded cDNA are blunted with T4 DNA polymerase.
The obtained cDNA is purified and recovered by a usual method such as phenol-chloroform extraction and ethanol precipitation. Commercially available kits based on these methods include, for example, cDNA Synthesis System Plus (manufactured by Amersham Pharmacia Biotech) and TimeSaver cDNA Synthesis Kit (manufactured by Amersham Pharmacia Biotech). Next, a cDNA library is prepared by inserting the obtained cDNA into a vector such as plasmid pUC118 or phage λgt10 using ligase. From such a cDNA library,
For example, a hybridization method using a DNA having a partial nucleotide sequence of the nucleotide sequence shown in either SEQ ID NO: 2 or SEQ ID NO: 5 as a probe,
Alternatively, the gene of the present invention can be obtained by a PCR method using an oligonucleotide having a partial nucleotide sequence of the nucleotide sequence shown in any of SEQ ID NO: 5 as a primer. As the probe used for the hybridization method, for example, base numbers 424 to 483, 871 to 924 or 18 of the base sequence represented by SEQ ID NO: 2
DNA having a base sequence represented by 63 to 1881,
Nucleotide numbers 182 to 21 of the nucleotide sequence represented by SEQ ID NO: 5
And DNA having the base sequence represented by 7.
The hybridization conditions include, for example, 6 × SSC (0.9 M NaCl, 0.09 M sodium citrate), 5 × Denhardt solution [0.1 w / v
% Ficoll 400, 0.1% w / v polyvinyl pyrrolidone, 0.1% BSA], 0.5% w / v SDS and 1%
In the presence of 00 μg / ml denatured salmon sperm DNA, or
DIG EAS containing 0 μg / ml denatured salmon sperm DNA
6 in Y Hyb solution (Boehringer Mannheim)
Incubate at 5 ° C., then 1 × SSC (0.15 M NaC
1, 0.015 M sodium citrate) and 0.5%
Incubation was performed twice at room temperature for 15 minutes in the presence of SDS, and 0.1 × SSC (0.015 M NaCl, 0.0
(015M sodium citrate) and 0.5% SDS in the presence of 68 ° C. for 30 minutes. Primers used in the PCR method include:
For example, a length of about 20 bp to about 40 bp and G
Alternatively, a base sequence having a C base ratio of about 40% to about 60% is selected from the 5 ′ untranslated region and the 3 ′ untranslated region of the base sequence represented by either SEQ ID NO: 2 or SEQ ID NO: 5, respectively. It is preferable to synthesize an oligonucleotide having a base sequence selected from the 5 ′ untranslated region and an oligonucleotide having a base sequence complementary to the base sequence selected from the 3 ′ untranslated region. Specifically, for example, a combination using an oligonucleotide having a base sequence represented by SEQ ID NO: 6 as a forward primer and using an oligonucleotide having a base sequence represented by SEQ ID NO: 7 as a reverse primer can be mentioned. P
The CR conditions include, for example, 1 μl in 50 μl of the reaction solution.
5 μl of 0xLATaq buffer (Takara Shuzo), 2.5 m
M dNTP mixture (2.5 mM dATP, dGT
P, dCTP and dTTP. ) 8 μl (dAT
P, dGTP, dCTP and dTTP each have a final concentration of 0.4 mM), 5 μl of a 25 mM MgCl ₂ solution, 10
μM primers 0.5 to 2.5 μl each (final concentration is 0.
1 to 0.5 μM), template cDNA 0.1 to 1 μg, L
ATaq polymerase (Takara Shuzo) 2.5
The conditions include, for example, a reaction liquid having a composition including the unit, in which the temperature is kept at 94 ° C. for 1 minute, then at 55 ° C. for 2 minutes, and further at 72 ° C. for 2.5 minutes as one cycle, and the cycle is carried out for a total of 30 cycles. The gene of the present invention thus obtained is described, for example, in J. Am. Sambrook, E .; F. Frisch,
T. By Maniatis; Molecular Cloning 2nd Edition (Molecular Cloning 2nd)
edition), Cold Spring Harbor Laboratory (Cold Spring Harbor)
Laboratories), 1989 and the like. Specifically, for example, a TA cloning kit (Invitrogen) or pBluescript
Cloning can be performed using a commercially available plasmid vector such as tII (Stratagene).
The gene of the present invention can be prepared, for example, by the phosphite-triester method (Hunkapiller, M. et al., N.A.) based on the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 5.
Nature, 310, 105, 1984) and the like, by performing chemical synthesis of nucleic acids. The nucleotide sequence of the gene of the present invention obtained is M
The maxam Gilbert method (for example, Maxam,
A. M & W. Gilbert, Proc. Nat
l. Acad. Sci. USA, 74, 560, 197
7 and the Sanger method (for example, Sang method).
er, F .; & A. R. Coulson, J .; Mol.
Biol. , 94, 441, 1975, Sanger,
F. & Nicklen and A. R. Couls
on. Proc. Natl. Acad. Sci. US
A, 74, 5463, 1977).

[0006] The thus obtained gene of the present invention contains a vector that can be used in a host cell to be transformed, such as a vector containing genetic information that can be replicated in the host cell.
A vector that can grow autonomously, can be isolated and purified from a host cell, and has a detectable marker (hereinafter referred to as a basic vector) by using a general genetic engineering technique. The vector of the present invention can be constructed by integration. As a basic vector that can be used for constructing the vector of the present invention, specifically, when a microorganism, Escherichia coli is used as a host cell, for example, plasmid pUC119 (manufactured by Takara Shuzo) or phagemid pBl
Ususcript II (manufactured by Stratagene) or the like. When budding yeast is used as a host cell, plasmids pGBT9, pGAD424, pACT
2 (manufactured by Clontech). When mammalian cells are used as host cells, pR
plasmids such as c / RSV, pRc / CMV (manufactured by Invitrogen), bovine papilloma virus plasmid pBPV (manufactured by Amersham Pharmacia Biotech), and EB virus plasmid pCEP4 (Invitrogen)
and a virus containing an autonomous origin of replication derived from a virus (eg, Rogen Co., Ltd.), a virus such as vaccinia virus, and an insect virus such as a baculovirus when an insect animal cell is used as a host cell. Can be. Vectors containing an autonomous origin of replication, such as the above-described plasmid pACT2 for yeast, bovine papilloma virus plasmid pBPV, and EB virus plasmid pC
When the vector of the present invention is constructed using EP4 or the like, when the vector is introduced into a host cell, the vector is retained as an episome in the cell. In order to incorporate the gene of the present invention into viruses such as baculovirus and vaccinia virus, a transfer vector containing a nucleotide sequence homologous to the genome of the virus to be used can be used. Specific examples of such transfer vectors include Phar
pVL1392, p commercially available from Mingen
VL1393 (Smith, GE, Summers)
M. D. et al. : Mol. Cell. Bio
l. , 3,2156-2165 (1983)), pSF
B5 (Funahashi, S. et al .: JV
irol. , 65, 5584-5588 (1991)).
And the like. When the gene of the present invention is inserted into the transfer vector as described above, and the transfer vector and the viral genome are simultaneously introduced into a host cell, homologous recombination occurs between the transfer vector and the viral genome, and the gene of the present invention appears on the genome. You can get a virus that is engulfed. Examples of the viral genome include Baculovirus, Ad
Genomes such as enovirus, Vacciniavirus and the like can be used. More specifically, for example, when the gene of the present invention is incorporated into a baculovirus, the gene of the present invention is inserted into a multiple cloning site of a transfer vector pVL1393, pVL1392, or the like, and then the DNA of the transfer vector and Baculovirus are inserted.
viral genome DNA (Baculogo)
ld; manufactured by Pharmingen) and insect cells Sf2
1 (available from ATCC), introduced by the calcium phosphate method or the like, and the cells are cultured. The Baculog
When the old DNA is used, only the virus particles containing the viral DNA into which the gene of the present invention has been inserted are released into the culture medium of the host cell. By recovering such a recombinant virus particle from the culture solution and subjecting it to deproteinization with phenol or the like, the DNA of the virus containing the gene of the present invention is obtained.
Can be obtained. Further, the DNA of the virus is
The recombinant virus particles can be increased by introducing the cells into a host cell having the ability to form virus particles such as the insect cell strain Sf21 by the calcium phosphate method or the like and culturing the cells. On the other hand, the gene of the present invention can be directly integrated into a relatively small genome such as a mouse leukemia retrovirus without using a transfer vector. For example, virus vector-DC (X) (Eli Gi
lboa et al. , BioTechnique
s, 4,504-512 (1986)) and the like, the gene of the present invention may be incorporated into a cloning site on the vector. The recombinant virus thus constructed is used, for example, in Ampli-GPE (J. Virol., 66, 375).
5 (1992)), it is possible to obtain virus particles containing the viral DNA into which the gene of the present invention has been inserted.

[0007] A promoter operable in a host cell is operably linked to the upstream of the gene of the present invention and inserted into a basic vector as described above to express the gene of the present invention in the host cell. Possible vectors of the invention can be constructed. As used herein, the term "operably linked" means that the promoter and the gene of the present invention are linked so that the gene of the present invention is expressed under the control of the promoter in the host cell into which the gene of the present invention is introduced. Means to let. The promoter used is
It shows promoter activity in the host cell to be transformed, for example, when the host cell is Escherichia coli,
E. coli lactose operon promoter (lac
P), tryptophan operon promoter (trp
P), the promoter of the arginine operon (arg
P), the galactose operon promoter (gal
P), tac promoter, T7 promoter, T3 promoter, phage λ promoter (λ-pL, λ
-PR) and the like. When the host cell is an animal cell or fission yeast, for example, Rous sarcoma virus (RSV) promoter, cytomegalovirus (CM
V) promoter, early or late simian virus (SV40) promoter, mouse papillomavirus (M
MTV) promoter and the like. When the host cell is a budding yeast, examples include the ADH1 promoter. When a basic vector having a promoter that functions in a host cell is used in advance, the gene of the present invention is placed downstream of the promoter so that the promoter of the vector and the gene of the present invention are operably linked. Just insert it. For example,
The aforementioned plasmids such as pRc / RSV and pRc / CMV have a cloning site provided downstream of a promoter operable in animal cells. If the gene of the present invention is inserted into the cloning site and introduced into animal cells, The gene can be expressed. Since the autonomous replication origin (ori) of SV40 is previously incorporated in these plasmids, when the plasmids are introduced into cultured cells, such as COS cells, transformed with the ori (-) SV40 genome, intracellular The copy number of the plasmid is greatly increased, and as a result, the gene of the present invention incorporated in the plasmid can be expressed in a large amount. The above-described yeast plasmid pACT2 has an ADH1 promoter. If the gene of the present invention is inserted downstream of the ADH1 promoter of the plasmid or its derivative, the gene of the present invention can be transformed into, for example, CG1945 (manufactured by Clontech).
Thus, the vector of the present invention that can be expressed in large amounts in budding yeasts can be constructed.

The transformant of the present invention can be obtained by introducing the constructed vector of the present invention into a host cell. As a method for introducing the vector of the present invention into a host cell, an ordinary method for introduction corresponding to the host cell to be transformed can be applied. For example, when Escherichia coli, which is a microorganism, is used as a host cell, conventional methods such as the calcium chloride method and electroporation method described in "Molecular Cloning" (J. Sambrook et al., Cold Spring Harbor, 1989) and the like are used. Can be used. When a mammalian cell, a fish animal cell or an insect animal cell is used as a host cell, the cell may be prepared by a common gene transfer method such as a calcium phosphate method, a DEAE dextran method, an electroporation method, or a lipofection method. Can be introduced. When a yeast is used as a host cell, for example, the yeast transform based on the lithium method is used.
ion kit (manufactured by Clontech) or the like. When a virus is used as a vector, viral DNA can be introduced into host cells by a general gene transfer method as described above, or by infecting host cells with recombinant virus particles containing viral DNA. Viral DNA can be introduced into a host cell.

In order to select the transformant of the present invention, for example, a method according to the properties of each marker gene of the introduced vector of the present invention may be used. For example, when the marker gene is a gene that imparts drug resistance to a selected drug that exhibits lethal activity to the host cell, the host cell into which the vector of the present invention has been introduced is cultured using a medium containing the drug. Good. As a combination of the drug resistance imparting gene and the selected drug, for example, a combination of a neomycin resistance imparting gene and neomycin,
Examples of the combination include a combination of a hygromycin resistance imparting gene and hygromycin, and a combination of a blasticidin S resistance imparting gene and blasticidin S. When the marker gene is a gene that complements the auxotrophy of a host cell, cells into which the vector of the present invention has been introduced may be cultured using a minimal medium not containing the nutrient. Furthermore, when the vector of the present invention capable of expressing the gene of the present invention in a host cell is introduced, a detection method based on estrogen binding activity can be used. In order to obtain the transformant of the present invention in which the gene of the present invention has been introduced into the chromosome of a host cell, for example, the vector of the present invention is linearized by digestion with a restriction enzyme or the like, and then the vector is subjected to the above-described method. , The cells are usually cultured for several weeks, and the target transformant may be selected using the expression of the marker gene encoded by the introduced vector of the present invention as an index. For example, the vector of the present invention having a gene imparting resistance to the selective drug as a marker gene as described above is introduced into a host cell by the above-described method, and the cell is subcultured for several weeks or more in a medium to which the selective drug is added. The transformant of the present invention in which the gene of the present invention has been introduced into the chromosome of the host cell can be selected by culturing and purifying the selected drug-resistant clone that has survived in a colony form. Since the transformant can be cryopreserved and awakened as needed, it can be used as compared to a strain into which the gene of the present invention has been transiently introduced.
It is possible to save the trouble of preparing a transformant for each experiment, and to perform a test using a transformant whose properties and handling conditions have been confirmed in advance.

Estrogen receptor can be produced by culturing the transformant of the present invention obtained as described above. For example, when the transformant of the present invention is a microorganism, the transformant may be cultured using various media containing a carbon source or a nitrogen source, an organic or inorganic salt, and the like, which are used for ordinary culture in a general microorganism. Is done. The cultivation is carried out in accordance with a general method for general microorganisms, and solid culture and liquid culture (test tube shaking culture, reciprocal shaking culture, jar fermenter (Jar Fermente)
r) culture, tank culture, etc.). The culture temperature can be appropriately changed within a range in which the microorganism grows. For example, it is general that the culture is performed at a culture temperature of about 15 ° C. to about 40 ° C. and a medium pH of about 6 to about 8. The culture time varies depending on various culture conditions, but is usually about 1 day to about 5 days. When an expression vector having an inducible promoter such as a temperature-shift type or an IPTG-inducible type is used, the induction time is preferably within one day, and is usually several hours. When the transformant is an animal cell such as a mammal, fish, insect or the like, the transformant can be cultured using a medium used for ordinary culture of general cultured cells.
When the transformant was prepared using the selected drug,
It is desirable to culture in the presence of the selected drug. In the case of mammalian cells, for example, the cells are renewed every several days using a DMEM medium (manufactured by Nissui) supplemented with FBS to a final concentration of 10 v / v% at 37 ° C. in the presence of 5% CO _2. What is necessary is just to culture | cultivate, exchanging with a culture solution. When cells grow to confluence, for example, 0.25 w /
About v% of a trypsin PBS solution is added to disperse the cells into individual cells, diluted several times, seeded on a new petri dish, and cultured. Similarly, in the case of insect animal cells, for example, Gr
ace's medium + 10v / v% FBS + 2
The culture may be performed at a culture temperature of 25 ° C. to 35 ° C. using a culture solution for insect cells such as w / v% Yeastlate. At this time, in the case of cells that are easily detached from a petri dish such as Sf21 cells, the cells can be dispersed by pipetting without using a trypsin solution and subculture can be performed. Also, Bac
In the case of a transformant containing a viral vector such as ulovirus, the culturing time is preferably before cell death due to the appearance of a cytoplasmic effect, for example, up to 72 hours after virus infection. Recovery of the estrogen receptor produced by the transformant of the present invention may be appropriately performed by combining ordinary isolation and purification methods.For example, after completion of the culture, cells of the transformant are collected by centrifugation or the like. The collected cells are transferred to a normal buffer, for example, 20 mM HEPES p.
H7, 1 mM EDTA, 1 mM DTT, 0.5 mM
After suspended in a buffer composed of PMSF, crushed with a polytron, sonication, dounce homogenizer, etc.
The crushed liquid is ultracentrifuged at tens of thousands of xg for several tens of minutes to about 1 hour, and the supernatant fraction is collected, whereby a fraction containing an estrogen receptor can be obtained. Furthermore, the purified estrogen receptor can be recovered by subjecting the supernatant fraction to various chromatography such as ion exchange, hydrophobicity, gel filtration, and affinity. At this time, the estrogen response element, that is, 15 bp to 2 bp containing the base sequence to which the estrogen receptor binds.
Fractions containing the estrogen receptor of the present invention can also be identified by a DNA binding assay or the like using an oligonucleotide having a length of about 00 bp as a probe. The estrogen receptor of the present invention thus produced can be used, for example, in a receptor binding assay for evaluating the binding ability and amount of a test substance to the estrogen receptor.

The gene of the present invention can be used, for example, in a reporter assay for evaluating the ability of a test substance to regulate estrogen receptor activity. Examples of the ability to regulate estrogen receptor activity include agonist activity and antagonist activity for estrogen receptor. The “reporter gene linked downstream of a transcription control region containing an estrogen response element” used in a reporter assay using the gene of the present invention is specifically, for example, a Xenopus vitellogenin gene containing an estrogen response element. A chimeric gene in which a reporter gene is linked downstream of a transcription control region or the like, or a chimeric gene in which a base sequence required for transcription initiation and a reporter gene are linked downstream of an estrogen response element, and the like. It is a gene used to monitor the transcriptional regulation ability of the receptor.
Reporter genes used for producing such a chimeric gene include a luciferase gene, a secreted alkaline phosphatase gene, a β-galactosidase gene,
Chloramphenicol acetyltransferase gene, growth hormone gene, GFP (Green Flu
oresent Protein) gene, BFP
(Blue Fluorescent Protei
n) A gene or the like can be used, and a gene encoding a reporter protein having relatively high stability in a host cell is preferable. For example, first, a gene of the present invention and a reporter gene linked downstream of a transcription control region containing an estrogen response element are combined with an estrogen receptor non-endogenous host cell, specifically, for example, a HeLa cell, CV-
1 cell, Hepal cell, NIH3T3 cell, HepG
2 cells, COS1 cells, BF-2 cells, CHH-1 cells, etc., to obtain transformants. Here, for example, the gene of the present invention is operably linked to a promoter operable in a host cell, integrated into a vector, and introduced into the cell. A reporter gene linked downstream of a transcription control region containing an estrogen response element may also be introduced into the vector. Further, for example, a transformant using a vector incorporating a reporter gene linked downstream of a transcription control region containing an estrogen response element, a vector of the present invention and a marker gene into a host cell at the same time, and using the marker gene expression as an index, , A reporter gene linked downstream of a transcription control region containing an estrogen response element and a transformant in which the gene of the present invention has been introduced into the chromosome of a host cell may be obtained. Since the transformant can be cryopreserved and can be used after awakening as needed, once it is obtained, these genes are introduced into host cells every time the assay is performed, and new transformants are obtained. Since it is not necessary to obtain a transformant and the performance of the transformant can be kept constant, it is useful, for example, when performing a large-scale screening by an automated robot. While culturing the transformant prepared as described above, for example, for one to several days, a test substance is added to a medium and brought into contact with the transformant, and the expression level of the reporter gene in the transformant Is measured. When the estrogen receptor produced by the transformant is activated by the binding of an estrogen-like active substance in the test substance, transcription of the reporter gene is promoted, and the protein encoded by the reporter gene is transferred into the cells of the transformant. Etc. or secreted into the medium. By measuring the amount of this protein, the expression level of the reporter gene per cell of the transformant is measured. Specifically, for example, when a luciferase gene is used as a reporter gene, when luciferin which is a substrate of luciferase is added to the crude cell extract, light is emitted at an intensity proportional to the amount of luciferase in the cell extract. Therefore, by measuring the luminescence intensity with a measuring device such as a luminometer, the amount of luciferase and, consequently, the expression level of the luciferase gene can be known. Similarly, by measuring the expression level of the reporter gene under the condition that the test substance is not brought into contact with the transformant, by comparing the expression level with the reporter gene expression level under the condition that the test substance is brought into contact, The agonist activity of the estrogen-like active substance in the test substance on the estrogen receptor, that is, the ability to activate the receptor can be evaluated. In addition, for example, 17β-estradiol (hereinafter referred to as E2
It is written. ), And under the conditions in which the estrogen and the test substance are simultaneously contacted, the expression level of the reporter gene is measured by the same method as described above. If the expression level of the reporter gene under the condition where the estrogen is contacted with the test substance is lower than the expression level of the reporter gene under the condition where the transformant is contacted with the estrogen, then the test substance will Antagonist activity,
That is, it can be evaluated that the receptor has an anti-activating ability.

In addition, the gene of the present invention can be used to form a complex of two fusion proteins (two-hybrid) in a cell and the ability to regulate the transcription of the formed complex using the expression level of a reporter gene in the cell as an index. Test system (two-hybrid system; Nishi
Kawa et al. , Toxicol. Appl.
Pharmacol. , 154, 76-83 (199
9)) can be used. Specifically, for example, the estrogen receptor encoded by the gene of the present invention or a ligand binding region of the receptor, and a transcription coupling factor capable of binding to the receptor in a ligand-dependent manner or a receptor binding region of the transcription coupling factor are ligand-dependent. In a two-hybrid system in which the transcription of the reporter gene is activated by binding to the target, the increase or decrease in the expression level of the reporter gene due to the addition of the test substance is evaluated to evaluate the ability of the test substance to regulate estrogen receptor activity be able to. Examples of the ability to regulate estrogen receptor activity include agonist activity and antagonist activity for estrogen receptor. Examples of such a two-hybrid system include a transformant in which the following genes (e) to (g) are introduced into host cells. (E) fusion of the DNA-binding region of a transcriptional regulatory factor, which is connected downstream of a promoter operable in a host cell and can function in the host cell, with the estrogen receptor of the present invention or the ligand-binding region of the receptor; A chimeric gene consisting of a nucleotide sequence encoding a protein. (F) a transcriptional activation region of a transcriptional regulator that is connected downstream of a promoter operable in the host cell, and is operable in the host cell, and a transcription factor capable of binding to the estrogen receptor of the present invention in a ligand-dependent manner. A chimeric gene comprising a nucleotide sequence encoding a coupling factor or a fusion protein with a receptor binding region of the transcription coupling factor. (G) a reporter gene connected downstream of a base sequence capable of binding to the DNA-binding region described in (e) and a promoter that can be activated by the transcription activation region described in (f). Examples of host cells include budding yeast cells and HeLa
And mammalian cells such as cells. In order to accurately measure the ability of the test substance to regulate the activity of the test substance to the estrogen receptor of the present invention, it is preferable to use cells that are non-endogenous to the estrogen receptor. Examples of the “transcriptional activation region of a transcriptional regulator capable of functioning in a host cell” described in the above (e) include a yeast-derived transcriptional regulator GAL4 when a budding yeast cell is used as a host cell.
DNA-binding domain, bacterial repressor Le
xA and the like. DN that codes these
A and a DNA encoding the ligand-binding region of the gene of the present invention or the estrogen receptor of the present invention are ligated in such a manner that their base sequences are read in frame.
(E) A "chimeric gene comprising a base sequence encoding a fusion protein of the DNA binding region of a transcriptional regulator capable of functioning in a host cell and the estrogen receptor of the present invention or the ligand binding region of the receptor" is obtained. Can be Examples of the “transcriptional activation region of a transcriptional regulator capable of functioning in a host cell” described in (f) include GAL
4 and a B42 acidic transcription activation region derived from Escherichia coli. The “transcription coupling factor capable of binding to the estrogen receptor of the present invention in a ligand-dependent manner” is a transcription coupling factor capable of recognizing and binding to a complex of the estrogen receptor and the ligand of the present invention, and specifically, Include SRC1 / NCoA1 (Onate,
S. A. Et al., Science, 1995, 270, 13.
54), TIF2 / GRIP1 (Voegel, J. et al.
J. EMBO, J. et al. , 1996, 15, 3667).
And so on. DNA encoding the above-mentioned transcription activation region, and DNA encoding the above-mentioned transcription coupling factor
Alternatively, by linking the DNA encoding the receptor binding region of the transcription conjugation factor with the reading frame of the base sequence thereof, the “transcriptional activation of a transcription regulatory factor operable in a host cell” described in (f) can be performed. A chimeric gene comprising a nucleotide sequence encoding a fusion protein of a region and a transcription-coupling factor capable of binding to the estrogen receptor of the present invention in a ligand-dependent manner or a receptor-binding region of the transcription-coupling factor can be obtained. Here, the constitutions of the chimeric genes are exchanged with each other, and “a DNA binding region of a transcription regulatory factor operable in a host cell and a transcription coupling factor capable of binding to an estrogen receptor of the present invention in a ligand-dependent manner or the transcription coupling factor” A chimeric gene comprising a nucleotide sequence encoding a fusion protein with a receptor-binding region of the present invention "and a" transcriptional activation region of a transcriptional regulator capable of functioning in a host cell, and an estrogen receptor of the present invention or a ligand-binding region of the receptor. And a chimeric gene consisting of a nucleotide sequence encoding the fusion protein of the above. Each of these chimeric genes is connected downstream of a “promoter operable in a host cell”, and examples of such a promoter include a GAL1 promoter when the host cell is a budding yeast cell. Inducible promoters and promoters that are constantly expressed, such as the ADH promoter, are used. As the reporter gene described in (f), a luciferase gene, a secreted alkaline phosphatase gene, a β-galactosidase gene, a chloramphenicol acetyltransferase gene, a growth hormone gene, and the like can be used. Genes encoding high reporter proteins are preferred. Such a reporter gene is connected downstream of a base sequence to which the DNA binding region can bind and a promoter that can be activated by the transcription activation region. For example, the base sequence to which the DNA binding region of GAL4 can bind is the GAL4 binding region of the GAL1 promoter.
The base sequence to which A can bind includes a LexA binding region. Examples of the promoter that can be activated by the transcriptional activation region of GAL4 include, for example, a minimal TATAbox sequence derived from yeast. For example, the above-described chimeric gene and reporter gene are inserted into, for example, vectors, respectively, and introduced into host cells to obtain transformants. When the host cell has a usable endogenous reporter gene, the endogenous reporter gene may be used, and the introduction of the reporter gene can be omitted.
Also, commercially available kits for preparing two-hybrid systems, such as Matchmaker Two-hy
brid System (Clontech), C
HeckMateMammalian Two-Hyb
A transformant can also be prepared using lid System (manufactured by Promega) or the like. The estrogen receptor encoded by the gene of the present invention or the ligand-binding region of the receptor, and a transcription-coupling factor capable of binding to the receptor in a ligand-dependent manner or a receptor-binding region of the transcription-coupling factor are bound in a ligand-dependent manner. As an example of the configuration of a two-hybrid system in which the transcription of a reporter gene is activated, for example, the following genes (h) and (i) are expressed by an endogenous GAL1
UAS (upstream activation)
sequence) and minimal TATAb from yeast
budding yeast strain Y190 having a LacZ gene (reporter gene) connected downstream of the ox sequence (Clon
(made by Tech Co., Ltd.). (H) connected downstream of the ADH1 promoter,
A chimeric gene comprising a nucleotide sequence encoding a fusion protein of the DNA binding region of GAL4 and the estrogen receptor of the present invention or the ligand binding region of the receptor. (I) connected downstream of the ADH1 promoter,
Transcriptional activating region of GAL4 and transcription coupling factor T capable of binding to the estrogen receptor of the present invention in a ligand-dependent manner
A chimeric gene comprising a nucleotide sequence encoding a fusion protein with IF2 or TIF2 receptor binding region. The transformant produced as described above is, for example, during culturing for several hours to several days, a test substance is added to a medium and contacted with the transformant, and an estrogen receptor or a ligand binding region of the receptor, The transcriptional coupling factor or the binding of the factor to the receptor binding region is induced, and the transcriptional control ability of the resulting complex of the two fusion proteins is measured using the expression level of the reporter gene as an index. Specifically, for example, when a luciferase gene is used as a reporter gene, luciferin, which is a substrate of luciferase, is added to a crude cell extract prepared from a transformant contacted with a test substance, thereby obtaining a crude cell extract. It emits light at an intensity proportional to the amount of luciferase in the product.
Therefore, by measuring the luminescence intensity with a measuring device such as a luminometer, the amount of luciferase and, consequently, the expression level of the luciferase gene can be known. Similarly, by measuring the expression level of the reporter gene under the condition that the transformant is not contacted with the test substance, and comparing the expression level with the expression level under the condition that the test substance is contacted, Agonist activity of estrogen-like active substances in estrogen receptor,
That is, the ability to activate the receptor can be evaluated. For example, the reporter gene expression level can be reduced by the same method as described above under the conditions in which the above-mentioned transformant is contacted with an estrogen such as E2, and under the condition where the estrogen and the test substance are simultaneously contacted. Measure. If the expression level of the reporter gene under the condition where the estrogen is contacted with the test substance is lower than the expression level of the reporter gene under the condition where the estrogen is brought into contact with the transformant, the test substance is capable of responding to the estrogen receptor. It can be evaluated that it has antagonist activity, that is, the receptor has an anti-activating ability.

The receptor binding assay using the estrogen receptor of the present invention is a test method capable of measuring the binding ability of a chemical substance to the estrogen receptor, quantifying the amount of binding, as well as analyzing the binding specificity and avidity. . For example, the estrogen receptor of the present invention recovered from the transformant of the present invention as described above,
When a test substance is allowed to coexist with a labeled ligand (hereinafter, referred to as a labeled ligand), the labeling is performed according to the affinity between the test substance and the labeled ligand due to the competition between the test substance and the labeled ligand. The ligand is released from the receptor,
The amount of labeled ligand bound to the receptor decreases, and thus the amount of label bound to the receptor decreases. Therefore, by monitoring the amount of free labeled ligand or the amount of bound labeled ligand, the ability of the test substance to bind to the receptor can be indirectly determined. As the labeling ligand, for example, tritium-labeled E2 or the like can be used. Separation of the bound / free form of the labeled ligand can be performed by a hydroxyapatite method, a glycerol density gradient ultracentrifugation method, or the like. The reaction system is roughly divided into three groups. One system is a group in which only the solvent is added to the place where the labeled ligand binds to the estrogen receptor, and corresponds to a system where the concentration of the test substance is zero, and the bound labeled ligand obtained from this system is used. The labeling amount indicates the total binding amount of the labeling ligand to the estrogen receptor. Another system provides for the binding of a labeled ligand to an estrogen receptor, such as unlabeled E2.
Is added so as to have a concentration (for example, 10 μM) sufficient to saturate the receptor and prevent the binding of the labeled ligand. The labeling amount of the bound labeled ligand obtained from this system is determined by the estrogen receptor of the labeled ligand. Is determined as the amount of non-specific binding to. Therefore,
The specific binding amount of the labeled ligand to the estrogen receptor is a value obtained by subtracting this non-specific binding amount from the total binding amount. In the third system, the test substance is, for example, at a final concentration of 10 μM where the labeled ligand is bound to the estrogen receptor (this concentration is arbitrarily changed depending on the purpose).
It is a system added so that When the test substance has the ability to bind to the estrogen receptor, the amount of the labeled labeled ligand obtained from this system is determined by the amount of the labeled ligand to the estrogen receptor when the test substance concentration determined as described above is zero. Is smaller than the specific binding amount of By performing the receptor binding assay in this manner, the ability of the test substance to bind to the estrogen receptor of the present invention can be examined. When the test substance contains a plurality of substances, the test substance shows an affinity for the estrogen receptor. You can also check if a substance is present. Further, in order to evaluate the binding ability of the test substance to the estrogen receptor of the present invention in more detail, for example, the concentration of the test substance in the third system is changed and the same assay is carried out to label the bound labeled ligand. Measure the amount. Based on the measured values, the amount of the bound and free ligands in each assay is calculated, for example, by performing a Scatchard analysis, whereby the binding affinity between the test substance and the estrogen receptor of the present invention, the binding specificity, The coupling capacity and the like can be evaluated.

The reporter assay, two-hybrid system and receptor binding assay of the present invention can be used for safety evaluation of chemical substances and detection of estrogen-like active substances in the environment.

[0015]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example 1 (Acquisition of the gene of the present invention) (1) Preparation of a probe for acquiring the gene of the present invention Total RNA was extracted from about 100 mg of bluegill liver using Trizol reagent (Life Technologies) according to the attached manual. did. This all RN
About 1 μg of A and ThermoScript RT-PC
R system (Life Technology
(manufactured by s Co., Ltd.). Next, an oligonucleotide having the base sequence of SEQ ID NO: 8 and an oligonucleotide having the base sequence of SEQ ID NO: 9 were synthesized. PCR (1 cycle of 94 ° C. for 1 minute, followed by 55 ° C. for 1 minute and further incubation at 74 ° C. for 2.5 minutes as one cycle, and 30 cycles of this cycle) using the oligonucleotide prepared above as a template and the cDNA prepared above as a template. went. About 1 kbp amplified
Was subcloned into a TA cloning vector prepared using the EcoRV site of a pBluescriptIISK (+) vector (Stratagene), and the nucleotide sequence of the DNA inserted into the vector was analyzed. From the results, a DNA having the nucleotide sequence of SEQ ID NO: 3 was obtained. About 2 μg of the DNA of the vector into which the DNA was inserted was ligated with restriction enzymes EcoRI and S
After digestion with alI and separation by 1% agarose gel electrophoresis, about 1 kb of DNA was recovered from the gel. AlkPhos Direct system is added to the obtained DNA.
A probe was prepared by directly labeling a thermostable alkaline phosphatase using stem (manufactured by Amersham Pharmacia Biotech).

(2) Preparation of cDNA library From bluegill liver tissue, phenol-chloroform-
Isoamyl alcohol method (Plant Cell Ph
ysiol. 36 (1): pp85-93 (199
5) Total RNA was prepared according to the above. The yield of total RNA was about 2.8 mg. From about 500 μg of total RNA, O
ligotex (dT) ₃₀ -Super (Takara Shuzo)
Was used to prepare poly (A) ⁺ RNA. pol
The yield of y (A) ⁺ RNA was about 10 μg. Then G
c based on the ubler and Hoffman method
A DNA library was prepared. First, 2.4 μg of po
ly (A) ⁺ RNA, Oligo (dT) ₁₈ -linker primer ((GA) ₁₀ ACGCGTCGACTCGA
GCGGCCGCGGACCG (T) ₁₈ contains an XhoI recognition sequence. ), RAV-2 RTase (Takara Shuzo)
And SuperScript II RTase (Gi
bco-BRL) and using 5-methylidCT
P was added to synthesize a single-stranded cDNA. After synthesizing a double-stranded cDNA from the obtained single-stranded cDNA, its end was blunted and ligated with an EcoRI-NotI-BamHI adapter (code 4510, manufactured by Takara Shuzo). After digesting the DNA with the restriction enzyme XhoI and subjecting it to a spin column to remove low molecular weight DNA, Ec
Ligation was performed with λZAPII digested with oRI and XhoI. Obtained DNA and in vitro
packaging kit (Stratagene
In vitro packagin
g) to obtain a cDNA library. For this library, E. coli XL1 Blue MRF '
When titration was performed using a strain (Stratagene), the insert content was estimated to be about 95% based on the appearance rates of blue colonies and white colonies.

(3) Acquisition of the gene bgerα of the present invention The cDNA library prepared in Example 1 (2) was introduced into E. coli XL1 Blue MRF '
mm LB plate (1% Bacto-Tripto
ne, 0.5% Yeast extract, 0.5
% NaCl, 1.5% agar) to about 50,000
Each clone was plated to form plaques. Prepare a total of 6 plates, and a total of 300,0
00 clones were subjected to the following screening. Phage DNA was transferred from each plate to Hybond N + membrane (manufactured by Amersham Pharmacia Biotech), and the membrane was denatured (1.5 M NaCl,
0.5N NaOH) for 5 minutes, then neutralization solution (1.5
M NaCl, 0.5 M Tris-HCl (pH 7.
2) Dipped in 1 mM EDTA) for 10 minutes and dried. After keeping the membrane at 80 ° C. for 2 hours, using the above probe, AlkPhos Direct was used.
Screening by hybridization was performed according to the protocol of system. In other words, the membrane was O.D. It was immersed in a hybridization solution (5 ng probe / ml, manufactured by Amersham Pharmacia Biotech) containing 5M NaCl, and was immersed at 55 °
It was kept warm for 6 hours. The membrane was then washed with primary wash buffer (2 M urea, 0.1% SDS, 150 mM Na
Cl, 50 mM sodium phosphate buffer with 1 mM MgCl ₂ and 0.2% blocking reagent, pH
After keeping the temperature in (7.0) at 60 ° C. for 10 minutes, it was again kept in the primary washing buffer at 65 ° C. for 10 minutes. Furthermore, washing was performed twice at room temperature in a secondary washing buffer (50 mM sodium phosphate buffer containing 100 mM NaCl and 2 mM MgCl ₂ ) for 5 minutes. For the washed membrane, AlkPhos Direc
Using CDP-Star contained in the t system as a substrate, a signal was detected by a chemiluminescence system using an alkaline phosphatase enzyme. Hyperfilm ECL (manufactured by Amersham Pharmacia Biotech) was used for the film. Ten positive clones were selected in order from the one with the strongest signal, collected using a sterilized chip, and SM buffer (50 mM Tri).
s-HCl (pH 7.5), 100 mM NaCl,
MgSO ₄ .H ₂ O, 0.01% gelatin)
Stored at 4 ° C. Each of the positive clones was cultured and placed on an LB plate having a diameter of about 90 mm for 1,000 to 1,50.
Plaques were formed by plating 0 clones at a time (total of 10 plates), and screening by hybridization was performed in the same manner as described above. As a result, among the 10 positive clones, positive signals were obtained for 3 clones, and thus the positive clones were collected. Next, these 3 positive clones were cultured and plated on LB plates having a diameter of about 90 mm by about 200 clones at a time to form plaques, and screening was performed by hybridization in the same manner as described above.
A clone that gave a positive signal in this screening was isolated as a single clone. From the vector possessed by the positive clone, i was used according to the protocol attached to the λZAPII vector kit (manufactured by Stratagene).
By using the n vivo excision system, the DNA inserted into the vector is pBl
XRI and EcoRI site of humanscript SK (-)
A plasmid cloned between the oI site was obtained. The nucleotide sequence of the DNA cloned in the plasmid was analyzed by the Primer Walking method. As a result, the DNA was found to have the nucleotide sequence of SEQ ID NO: 2 and encode the amino acid sequence of SEQ ID NO: 1 (hereinafter, the estrogen receptor having the amino acid sequence is referred to as BGERα, The gene encoding the receptor is referred to as the gene bgerα of the present invention.
It was named GERα. ). Plasmid pBSBGERα
Escherichia coli DH5α strain (Escherichi
a. coli DH5α / pBSBGERα) has the accession number of FERM to the Institute of Biotechnology and Industrial Technology, National Institute of Advanced Industrial Science and Technology.
Deposited as BP-6876.

(4) Acquisition of the gene bgerα2 of the present invention Total RNA was extracted from about 100 mg of bluegill liver using Trizol reagent (Life Technologies) according to the attached manual. About 1 μg of the obtained total RNA was added to ThermoScript RT-
PCR system (Life Technology
(manufactured by IES) was used to prepare a cDNA library. On the other hand, an oligonucleotide having the base sequence of SEQ ID NO: 10 and an oligonucleotide having the base sequence of SEQ ID NO: 11 were synthesized. PCR (94 ° C. for 1 minute and then 60 ° C. 1) using LA-Taq (manufactured by Takara Shuzo) with the oligonucleotide as a primer.
The DNA was amplified for 30 minutes at a temperature of 74 ° C. for 0.5 minute and a cycle of incubation at 0.5 minute for 30 minutes. The amplified DNA was electrophoresed using a 3% NuSieve 3: 1 agarose gel (manufactured by FMC Bioproducts). As a result, two types of DNAs having different lengths were detected. Each DNA was recovered from the gel and subjected to direct sequencing. The longer DNA has a partial nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 2, while
The shorter DNA had a base sequence in which the base sequence of SEQ ID NO: 12 was deleted from the partial base sequence. Thus, using the above-described cDNA derived from bluegill liver as a template, LA-Ta was used as a primer with an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 13 and an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 7.
PCR (manufactured by Takara Shuzo Co., Ltd.) was performed (30 cycles of 1 cycle of 94 ° C. for 1 minute, followed by 1 minute of 55 ° C., and 2.5 minutes of 74 ° C. as one cycle). The amplified DNA of about 2.0 kbp was cloned using a TA cloning vector (pGEM-T, manufactured by Promega) in accordance with the relevant product manual, and the nucleotide sequence of the obtained vector DNA of a plurality of clones was obtained. It was confirmed. As a result, DN having the nucleotide sequence represented by nucleotide numbers 424 to 1941 of the nucleotide sequence represented by SEQ ID NO: 2
A and base number 7 of the base sequence represented by SEQ ID NO: 5
DNA having the nucleotide sequence represented by 4-1819 was obtained. SEQ ID NO: 74 to SEQ ID NO: 74 of the nucleotide sequence represented by SEQ ID NO: 5
The nucleotide sequence represented by 1819 was found to encode the amino acid sequence represented by SEQ ID NO: 4 (hereinafter, referred to as the nucleotide sequence represented by SEQ ID NO: 4).
The estrogen receptor having the amino acid sequence is BG
The gene encoding the receptor is referred to as ERα2, and the gene encoding the receptor is referred to as bgerα2 of the present invention. ).

Example 2 (Construction of the Vector of the Present Invention for Expression of Animal Cells Containing the Gene bgerα of the Present Invention) An expression plasmid pRc / R having an RSV promoter
2 μg of SV (Invitrogen) was added to restriction enzyme X
The mixture was digested with ba I (10 U) at 37 ° C. overnight, and further reacted with 5 U of alkaline phosphatase (BAP) at 65 ° C. for 1 hour. This is agarose (Agarose S;
Electrophoresis using gel (manufactured by Nippon Gene Co., Ltd.)
DNA was recovered from the band portion having a length of ~ 6 kbp using Geneclean (manufactured by Funakoshi), and the vector D was recovered.
NA. On the other hand, using the DNA of the plasmid pBSBGERα obtained in Example 1 (3) as a template, an oligonucleotide having the base sequence of SEQ ID NO: 14 and an oligonucleotide having the base sequence of SEQ ID NO: 15, and LA-Taq PC (from Takara Shuzo)
R (94 ° C for 1 minute, 55 ° C for 2 minutes, 74 ° C
The DNA amplification was carried out by 30 cycles of 2.5 cycles of one minute. After the amplified DNA is treated with chloroform / phenol, it is precipitated with ethanol,
After centrifugal washing with 70% ethanol and drying, TE
And then dissolved with restriction enzyme XbaI at 37 ° C. for 5 minutes.
Digested for hours. Next, the digest was subjected to 1% agarose gel electrophoresis to separate, a gel portion containing about 1.5 kbp DNA was cut out, and the DNA contained therein was purified using Geneclean (Funakoshi). About 1
00ng of the vector DNA 50n prepared as described above.
g, and add 5 U of T4 ligase and add
For 3 hours. This reaction mixture was introduced into Escherichia coli DH5α competent cells (manufactured by TOYOBO) according to the method described in the attached instruction manual, and plasmid DNA was prepared from ampicillin-resistant colonies by an alkali method.
The base sequence of the obtained plasmid DNA was analyzed, and RSV was analyzed.
Gene bger of the present invention linked downstream of the promoter
The plasmid having α was named pRc / RSV-BGERα.

Example 3 (Construction of the Vector of the Present Invention for Expression of Animal Cells Containing the Gene bgerα2 of the Present Invention) The BGERα expression plasmid pRc prepared in Example 2
/ RSV-BGERα out of the restriction enzyme Hin
Digest with dIII (10 U) at 37 ° C. overnight, and add 5 U of alkaline phosphatase (BAP) at 65 ° C. 1
Allowed to react for hours. This was subjected to gel electrophoresis using agarose (Agarose S; manufactured by Nippon Gene),
DNA was recovered from the band portion having a length of 6 kbp using Geneclean (manufactured by Funakoshi) and vector DN was collected.
A. On the other hand, cDNA prepared in Example 1 (4)
Using a oligonucleotide having the nucleotide sequence of SEQ ID NO: 16 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 15 as a template, LA-Ta
PCR (manufactured by Takara Shuzo) at 94 ° C for 1 minute and then at 55 ° C
One cycle of the incubation at 74 ° C. for 2.5 minutes for 2 minutes was repeated 30 cycles) to amplify the DNA of the gene of the present invention. After treating this with chloroform / phenol,
After ethanol precipitation, centrifugal washing with 70% ethanol, drying, and addition of TE to dissolve, restriction enzyme H
Digested with indIII overnight at 37 ° C. Next, the digest was subjected to 1% agarose gel electrophoresis to separate the gel, a gel portion containing about 1.0 kbp DNA was cut out, and the DNA contained therein was purified using Geneclean (Funakoshi). About 100 ng thereof was mixed with 50 ng of the vector DNA prepared as described above, and 5 U of T4
ligase was added and the mixture was kept at 16 ° C. for 3 hours. This reaction solution was used for E. coli DH5α strain competent cells (TO
YOBO) according to the method described in the attached manual, and plasmid D was isolated from colonies showing ampicillin resistance.
NA was prepared by the alkaline method. Obtained plasmid DN
Analyze the nucleotide sequence of A, and downstream of the RSV promoter,
Nucleotide numbers 74 to 181 of the nucleotide sequence represented by SEQ ID NO: 5
A plasmid containing the nucleotide sequence represented by No. 9 was selected and named pRc / RSV-BGERα2.

Example 4 (Reporter Assay Using the Gene of the Present Invention) (1) Preparation of Reporter Plasmid for Reporter Assay Using the Isogen reagent (Nippon Gene), the method described in the protocol attached to the reagent was used to prepare Africa. Xenopus genomic DNA was purified. Using the genomic DNA as a template, a report by Walker et al. (Nucleica
cid Res. (1984) 12,8611-86
By performing PCR according to 26), a DNA containing from the TATA box upstream of the Xenopus laevis vitellogenin gene to the estrogen receptor response element was amplified. The amplified DNA is recovered, and its end is
The DNA was blunted using an unting kit (manufactured by Takara Shuzo Co., Ltd.) (this DNA is hereinafter referred to as ERE DNA). An oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 17 and an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 18 [Base sequence near the TATA box of the mouse metallothionein I gene and leader sequence (Ge
nbankAccession No. J00605)
) To give a double-stranded DNA,
This was reacted with T4 polynucleotide kinase to phosphorylate both ends (the DNA was hereinafter referred to as TATA).
DNA)). On the other hand, a plasmid pGL3 (promega) containing the firefly luciferase gene was digested with restriction enzymes Bgl II and Hind III, and then digested with Bacterial alkaline phos.
Phatase (BAP) was added, and the mixture was kept at 65 ° C. for 1 hour. Next, the heat-retaining liquid was added to low-melting point agarose (Agar
oL (manufactured by Nippon Gene Co., Ltd.) and electrophoresed with Bgl containing pGL3-derived luciferase gene.
DNA showing an electrophoretic mobility corresponding to the length of the II-Hind III fragment was recovered. About 100 ng of the DNA and 1 μg of the above-mentioned TATA DNA were mixed and ligated with T4 ligase to give plasmid pGL3-TAT.
A was prepared. Next, pGL3-TATA was replaced with restriction enzyme S.
After digestion with maI, BAP was added and the mixture was kept at 65 ° C for 1 hour. The incubation solution was subjected to low-melting point agarose gel electrophoresis, and DNA was recovered from the gel in the band portion. The DN
A about 100 ng and the above ERE DNA about 1 μg were mixed and reacted with T4 ligase.
It was introduced into a 5α competent cell (manufactured by TOYOBO). DNAs of respective plasmids were prepared from several colonies of Escherichia coli showing ampicillin resistance, digested with restriction enzymes KpnI and XhoI, and the digested solution was analyzed by agarose gel electrophoresis. pGL
A plasmid having a structure in which one copy of ERE DNA was introduced into the SmaI site of 3-TATA was designated as pGL3-T.
ATA-ERE, and ERD D
A plasmid having a structure in which five copies of NA were introduced was designated as plasmid pGL3-TATA-EREx5.

(2) Reporter assay by transient expression system HeLa cells About 2 × 10 ⁶ cells were seeded on a 10 cm plate, and FBS treated with charcoal dextran (hereinafter referred to as FBS) was added to 10 v / v%. E-MEM medium at 37 ° C under 5% CO _{2 for} 1 hour.
Culture was performed for a day. Then, Lipofect was added to the cells.
3.75 μg of pRc / RSV-BGERα or pRc / RSV-B using Amine (manufactured by Life Technologies) according to the protocol.
GERα2 and 3.75 μg of pGL3-TATA-E
REx5 was introduced at the same time. After culturing at 37 ° C. for 16 hours, the medium was replaced and the cells were further cultured for 3 hours. Thereafter, the cells were collected, and EBS added to adjust the FBS to 10 v / v% was added.
-E2 (manufactured by Wako Pure Chemical Industries), various concentrations of E2 (manufactured by Wako Pure Chemical Industries), diethylstilbestrol (DES) (manufactured by Nacalai Tesque), bisphenol A (manufactured by Wako Pure Chemical Industries, Ltd.) ), Genistein (manufactured by Wako Pure Chemical Industries) or o, p'-DDT (Lancaste)
(manufactured by R. Co.) was added to a 96-well plate (DMSO final concentration: 0.1%). In order to measure the anti-estrogenic effect, the cells were seeded on a 96-well plate (final concentration of DMSO: 0.1%) to which 4-hydroxytamoxifen of various concentrations and E2 of 10 nM were simultaneously added. The 96-well plate in which the cells were seeded was cultured at 37 ° C. for about 40 hours, and then a 5-fold diluted cell lysing agent PGC
50 (manufactured by Nippon Gene Co., Ltd.) was added at 50 μl / well, and the cells were lysed by standing at room temperature for 30 minutes with occasional gentle shaking. 10 μl of the cell lysate thus prepared was collected in a 96-well white sample plate (manufactured by Berthold), and 50 μl was collected using a luminometer LB96p (manufactured by Berthold) equipped with an automatic substrate injector.
While the enzyme substrate solution PGL100 (manufactured by Nippon Gene Co., Ltd.) was added at a rate of 1 / well, the luminescence was measured immediately for 5 seconds. The results using cells into which pRc / RSV-BGERα was introduced are shown in FIGS.
7 to 11 show the results obtained using the cells into which 2 was introduced. As described above, the ability of the test substance to activate or inhibit the estrogen receptor could be measured by the luciferase reporter assay using the gene of the present invention. In addition, by testing other subjects in the same way,
A substance having an estrogen receptor activation ability or a substance having an estrogen receptor activation inhibitory ability can be detected.

(3) Preparation of transformant for reporter assay in which the gene of the present invention has been introduced into the chromosome Plasmid pUCSV-BSD (purchased from Funakoshi)
Is digested with BamHI to prepare a DNA encoding a blasticidin S deaminase gene expression cassette.
The DNA and the plasmid pGL3 described in Example 4 (1) were used.
-TATA-ERE is digested with BamHI and mixed with DNA obtained by BAP treatment, and reacted with T4 ligase. Then, the reaction solution is introduced into Escherichia coli DH5α competent cells (manufactured by TOYOBO). A plasmid DNA is prepared from the obtained ampicillin-resistant Escherichia coli clone, each is digested with a restriction enzyme BamHI, and the digested solution is analyzed by agarose gel electrophoresis. The blasticidin S deaminase gene expression cassette contains plasmid pG
A plasmid having a structure inserted into the BamHI cleavage site of L3-TATA-ERE was selected, and plasmid pG was selected.
L3-TATA-ERE-BSD. Next, the DNA of the plasmid pGL3-TATA-ERE-BSD prepared as described above and the DNA of the expression vector in which the gene of the present invention was incorporated into pRc / RSV were each linearly introduced into human-derived HeLa cells. Example 4 (2)
To obtain a transformant obtained by introducing these DNAs into the chromosome of the host cell. First, DNA of plasmid pGL3-TATA-ERE-BSD,
Then, the DNA of the expression vector in which the gene of the present invention is integrated into pRc / RSV is digested with SalI.
HeLa cells were prepared in DMEM containing 10 v / v% FBS.
5% CO ₂ at 37 ° C using a medium (manufactured by Nissui Pharmaceutical Co., Ltd.)
In the presence, culture is performed using a petri dish (Falcon) having a diameter of about 10 cm. Cultivate about 5 × 10 ⁵ cells,
The next day, the DNA of the above-described linearized plasmid is simultaneously introduced into the cells by a lipofection method using lipofectin (manufactured by GIBCO). The conditions of the lipofection method were as described in the manual attached to Lipofectin, for a treatment time of 5 hours, and for the linearized plasmid DN.
The total amount of A is 7 μg (3.5 μg each) / dish, and the amount of lipofectin is 20 μl / dish. After the lipofection, the cells are cultured as they are in a DMEM medium containing 10 v / v% FBS for 3 days. Next, the cells are detached from the Petri dish by trypsin treatment, seeded on 10 new Petri dishes in 1/10 volume, and cultured as it is until the next day. next,
G418 (manufactured by SIGMA) at a final concentration of 400 μg / m
and blasticidin S is added to the culture solution to a final concentration of 8 μg / ml, and the culture is continued. One week later, G418 and Blastcidin S
Is replaced with a fresh medium containing the same concentration as above, and the culture is continued. One week later, the same operation is performed again. One week later, the petri dish was observed with an inverted microscope, and 30 colonies having a diameter of several mm appeared, and a 96-well view plate (manufactured by Berthold) in which a medium was previously dispensed.
And then continue the culture. Cells are detached by trypsinization before being confluent, collected, divided into three equal parts, and seeded on three new 96-well view plates. Subculture and culturing are continued for one sheet, and E2 is added to one of the remaining two sheets to a final concentration of 50 nM, and the other is not added, and each is cultured for 2 days. Two days later, each culture supernatant was removed and 200 μl /
After the cells were washed twice with well PBS (-), PGC50 (manufactured by Nippon Gene Co., Ltd.) diluted 5-fold was added to 20 μl.
Add 1 liter at a time and leave at room temperature for 30 minutes to lyse the cells. Each of the plates is set in a luminometer LB96p (manufactured by Berthold) equipped with an enzyme substrate automatic injector, and luciferase activity is measured while automatically dispensing 50 μl of a substrate solution PGL1000 (manufactured by Nippon Gene). In the system to which E2 has been added, a transformant showing luciferase activity that is at least twice as high as that in the system to which E2 has not been added is selected.

(4) Reporter assay using a transformant in which the gene of the present invention has been introduced into a chromosome HeLa prepared as described in Example 4 (3)
The cell transformant was seeded at about ⁴ × 10 ⁴ cells / well on a 24-well plate, and charcoal dextran-treated 10 v / v% FBS, 400 μg / ml G418 was used.
And EM containing 8 μg / ml blasticidin S
EM medium (hereinafter, E-MEM containing FBS and antibiotics)
This is referred to as a medium. ), The cells are cultured at 37 ° C. under 5% CO _{2 for} 1 day. The test substance was dissolved in DMSO (manufactured by Wako Pure Chemical Industries, Ltd.), and F was added to a final concentration of 1 nM to 50 μM.
E-MEM medium containing BS and antibiotics, FBS supplemented with the same amount of DMSO as the test sample solution, and FBS supplemented with E-MEM medium containing antibiotics dissolved in DMSO to a final concentration of 1 μM Then, an E-MEM medium containing an antibiotic is prepared, and this is replaced with the culture supernatant of the cells. The cells are cultured in a CO ₂ incubator, and after 24 hours, the culture supernatant is removed, and 1 ml / well of PB is removed so as not to remove the cells adhered to the wells.
The wells were washed twice with S (-), and the cell lysing agent PGC50 (manufactured by Nippon Gene Co., Ltd.) diluted 5 times was added at 50 μl / w.
ell and add at room temperature for 30
Let stand for minutes to lyse cells. 10 μl of the cell lysate thus prepared was collected in a 96-well white sample plate (manufactured by Berthold), and 50 μl / well of the enzyme substrate solution PGL100 was used in a luminometer LB96p with an automatic substrate injector (manufactured by Berthold).
Immediately after adding (manufactured by Nippon Gene), the luminescence amount is measured for 5 seconds. By the luciferase reporter assay using such a transformant in which the gene of the present invention has been introduced into a chromosome, a test substance containing a substance having the ability to activate estrogen receptor can be found.

Example 5 (two-hybrid system using the gene of the present invention) (1) A vector containing a chimeric gene encoding a fusion protein of the ligand-binding region of the estrogen receptor and the DNA-binding region of the transcription factor of the present invention Preparation of plasmid pBSB containing gene bgerα of the present invention
Using GERα as a template, a primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a primer consisting of the nucleotide sequence of SEQ ID NO: 20, and LA-Taq (Takara Shuzo)
PCR (1 cycle of 94 ° C. for 1 minute, followed by 1 cycle of 55 ° C. for 1 minute, followed by 1.5 cycles of 74 ° C. for 30 cycles) according to the attached manual to encode the ligand binding region of the estrogen receptor of the present invention. DNA was amplified. The amplified DNA was treated with chloroform / phenol and precipitated with ethanol.
After washing by centrifugation with% ethanol, it was dried. This D
After TE was added to NA and dissolved, the restriction enzyme EcoRI was used.
And SalI at 37 ° C. for about 5 hours. 1 digestion
% Agarose gel electrophoresis to separate, about 1100
The gel portion containing the bp DNA was cut out, and the DNA contained therein was recovered using Geneclean (Funakoshi) according to the attached manual. On the other hand, a vector pGBT for preparing a fusion protein with the DNA binding region of GAL4 protein
9 (Clontech) (about 50 ng) with EcoR
After digestion with I and SalI, the resultant was subjected to agarose gel electrophoresis, and the vector DNA digested with EcoRI and SalI was recovered using Geneclean (Funakoshi). The vector DNA and the recovered DNA (about 10)
ng, and the same volume of a ligation solution (a ligation kit manufactured by Takara Shuzo) was added. The mixture was incubated at 16 ° C. for about 1 hour, and then introduced into competent cells DH5α (manufactured by TOYOBO) according to the method described in the attached manual. A colony showing ampicillin resistance was isolated, and a plasmid DNA was prepared from the colony by an alkaline method. After confirming the nucleotide sequence of the obtained plasmid, pGBT9-BGE
It was named RαLID. The above plasmid can be used in a two-hybrid system using budding yeast cells as host cells.

(2) Preparation of a Vector Containing a Chimeric Gene Encoding a Fusion Protein of a Receptor Binding Region of a Transcription Coupling Factor and a Transcription Activating Region of a Transcriptional Regulator Human mRNA derived from human brain (manufactured by Clontech) and RT-
CDNA was prepared using a PCR kit (Takara Shuzo) according to the protocol attached to the product. Using the prepared cDNA as a template, LA-Taq (manufactured by Takara Shuzo) and SEQ ID NO: 2
PCR using an oligonucleotide consisting of the nucleotide sequence shown by No. 1 and an oligonucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 22 at 94 ° C. for 1 minute, then at 55 ° C. for 1 minute, and further at 72 ° C. for 2.5 minutes One cycle of the incubation was 30 cycles), and the DNA encoding the amino acid sequence from the 624th amino acid to the 1287th amino acid from the amino terminus of the transcription coupling factor TIF2 was amplified. The amplified DNA was treated with chloroform / phenol and precipitated with ethanol.
After centrifugal washing with 0% ethanol, it was dried. After TE was added to this DNA to dissolve it, the restriction enzyme EcoR
Digestion with I and Bgl II at 37 ° C for 5 hours. The digest was separated by 1% agarose gel electrophoresis and separated by about 2.
A gel portion containing 0 kbp DNA was cut out, and the DNA contained therein was purified using Geneclean (Funakoshi). On the other hand, a vector pGAD424 (Clont) for producing a chimeric protein with the transcription activation region of the GAL4 protein
ech) (about 50 ng) with EcoRI and Bam
After digestion with HI, the digested vector DNA was subjected to agarose gel electrophoresis and collected using Geneclean (Funakoshi). The recovered vector DNA was mixed with about 10 ng of the purified DNA, and an equal volume of a ligation solution (a ligation kit manufactured by Takara Shuzo) was added.
Incubate at 6 ° C for about 1 hour, then competent cell DH5
α (manufactured by TOYOBO) according to the method described in the attached instruction manual. Colonies showing ampicillin resistance were isolated, and plasmid DNA was prepared from the colonies by an alkaline method. After confirming the nucleotide sequence of the obtained plasmid, it was named pGAD424-TIF2RID. This plasmid can be used in a two-hybrid system using budding yeast cells as host cells.

(3) Preparation of a Two-Hybrid System Using Budding Yeast Cells as Host Cells Yeast Y190 (manufactured by Clontech) was purchased from Matchm.
aker Two-Hybrid System (Cl
The culture was carried out with shaking at 30 ° C. overnight in a YPD medium according to the manual of Ontech Co.). After collecting the yeast, pGBT9-BGERαLI described in Example 5 (1) was introduced into the cells.
D and pGAD424-TIF described in Example 5 (2)
2 RID is converted to Yeastmaker yeast tr
information system (Clont
ech). The yeast cells into which the plasmid has been introduced are seeded on an SD plate containing no tryptophan and leucine, and cultured at 30 ° C. for about 2 days. After cultivation, 3 colonies were selected and plated again on an SD plate containing no tryptophan and leucine.
C. for about 2 days.

(4) Measurement of Estrogen Receptor Activity-Controlling Ability of Test Substance Using Yeast Two-Hybrid System A part of the yeast prepared in Example 5 (3) was inoculated into 1 ml of SD medium not containing tryptophan and leucine. And
After shaking culture at 30 ° C. overnight, the resulting culture was diluted about 80-fold with an SD medium containing no tryptophan and leucine. In each well of a 96-well deep well plate, various concentrations of E2 (manufactured by Wako Pure Chemical Industries), estriol (manufactured by Wako Pure Chemical Industries), estrone (manufactured by Wako Pure Chemical Industries), and 1 μM diethyl ether dissolved in DMSO were added. Stilvesterol (DES) (manufactured by Nacalai Tesque), 1 mM bisphenol A (manufactured by Wako Pure Chemical Industries), 100 μM p-nonylphenol (manufactured by Kanto Kagaku), 100 μM genistein (manufactured by Wako Pure Chemical), 100 μM Coumesterol (I
NDOFINE Chemical, 1 mM daidzein (Sigma), 1 mM methoxychlor (Wako Pure Chemical Industries), or 1 mM o, p'-DDT (La
2.5 μl (manufactured by Ncaster Co., Ltd.) (to a final concentration of 1% in DMSO).
and shaking culture at 30 ° C. for 4 hours. After culture
Collect 100 μl of yeast solution from each well and add 100 μl
l of a luminescence reaction solution for measurement of β-galactosidase activity (Gal
-Screen, manufactured by Tropix) and added for about 1.5
After keeping at room temperature for a period of time, the luminescence was measured with a luminometer LB96p (Berthold). FIG.
(Manufactured by Wako Pure Chemical Industries), estriol (manufactured by Wako Pure Chemical Industries),
The results of concentration-dependent activity induction of estrone (manufactured by Wako Pure Chemical Industries, Ltd.) are shown. FIG. 13 also shows a final concentration of 10 nM diethylstilbestrol (DES), 10 μM bisphenol A, 1 μM p-nonylphenol, 1 μM genistein, 1 μM coumesterol, 10 μM daidzein, 10 μM methoxychlor and 10 μM o,
The result of p'-DDT activity induction is shown.

Example 6 (Preparation of Recombinant Virus Vector and Recombinant Virus Particle Containing the Gene of the Present Invention) DNA of the vector pRc / RSV-BGERα of the present invention
2 μg of pRc / RSV with 10 U of restriction enzyme XbaI
-2 µg of BGERα2 DNA was added to 10 U of restriction enzyme H
After each digestion with indIII at 37 ° C. for 1 hour, each is subjected to low melting point agarose gel electrophoresis to collect a DNA fragment of about 1.5 to 1.7 kbp. pR
c / RSV-BGERα2-derived DNA is about 1 μg
Is treated with a DNA blunting kit (manufactured by Takara Shuzo Co., Ltd.) to blunt its ends, which are then reacted with T4 polynucleotide kinase to phosphorylate its ends. After the DNA is treated with phenol, the DNA is purified by an ethanol precipitation method, and the whole amount is used as the insert DNA for preparing the following expression plasmid. On the other hand, 2 μg of p
VL1392 vector DNA was replaced with 10 U of restriction enzyme Xba.
I or SmaI, digested with 10 U of alkaline phosphatase at 65 ° C. for 1 hour, and subjected to low melting point agarose gel electrophoresis to collect DNA, and to obtain pVL13
92-XbaI and pVL1392-SmaI. This pVL1392-XbaI vector DNA 1
00ng, pRc / RSV-BGERα as described above.
Approximately 100 ng of about 1.5 kbp DNA prepared from
In addition, 3 U at 16 ° C. using 5 U T4 Ligase
Insulate for hours. This is called E. E. coli DH5α strain is introduced into competent cells (manufactured by TOYOBO) according to the method described in the attached manual, and plasmid DNA is prepared from the obtained colonies by an alkali method. About 1 μg of each plasmid DNA was digested with 10 U of restriction enzyme XbaI at 37 ° C.
And analyzed by agarose electrophoresis using agarose S (manufactured by Nippon Gene).
A clone in which a kbp band is detected is selected. In addition, pVL1392-SmaI vector DNA100n
About 100 ng of about 1.7 kbp DNA prepared from pRc / RSV-BGERα2 as described above is added to g, and the mixture is incubated at 16 ° C. for 3 hours using 5 U of T4 Ligase. This is called E. E. coli DH5α strain is introduced into competent cells (manufactured by TOYOBO) according to the method described in the attached manual, and plasmid DNA is prepared from the obtained colonies by an alkali method. About 1 μg of each plasmid DNA was added to 10 U of restriction enzymes XbaI and Hi.
agarose S after digestion with ndIII for 1 hour at 37 ° C.
Analysis is performed by agarose electrophoresis using Nippon Gene Co., Ltd., and a plasmid from which a band of about 1.7 kbp is detected is selected. The DNA of the plasmid was prepared by an alkaline method, and the transfer vector pVL1392-BGERα used for the production of the recombinant Baculo virus was prepared.
And pVL1392-BGERα2. 1x10
Grace's containing 10% FBS and 2% Yeastlate in a 75 cm ² T-flask (Falcon) in ⁶ Sf21 cells (obtained from ATCC)
The medium is cultured overnight at 27 ° C. using medium (hereinafter, referred to as FBS-containing Grace's medium). On the other hand, the transfer vector pVL1 prepared as described above
392-BGERα or pVL1392-BGERα
10 μg of the DNA of No. 2 and viral genomic DNA Baculogold (Pharming
En's) 20 ng with Grace's medium
10 μl of lipofectin (manufactured by GIBCO) diluted twice with sterile water is added to 100 μl, and left at room temperature for 30 minutes. Grace's m without serum except for the culture supernatant of the Sf21 cells cultured overnight.
After washing the cells with a small amount of edium, 5 ml of the same medium is added to the cells, and the entire lipofectin-DNA mixture is added thereto, followed by incubation at 27 ° C. for 3 hours. Then, FB
After washing the cells with S-containing Grace's medium, FBS-containing G
Race medium (20 ml) is added to the cells, and the cells are cultured at 27 ° C. for 5 days. On the fifth day, the culture supernatant is collected and collected in a 50-ml centrifuge tube, and centrifuged at 5000 × g for 15 minutes to precipitate cell debris, and the centrifuged supernatant is collected. The entire amount of the supernatant is ultracentrifuged at 100,000 × g for 24 hours to obtain virus particles as a pellet. The pellet is suspended in 100 μl of TE, an equivalent amount of TE-saturated phenol is added and mixed gently for 24 hours at room temperature. After centrifugation at 10,000 × g for 10 minutes, the aqueous layer was recovered, and an equivalent amount of chloroform was added thereto.
Mix gently for 0 minutes and centrifuge again at 10,000 xg for 10 minutes. The aqueous layer is collected, and NaCl in an amount to give a final concentration of 0.2 M and 2.5-fold amount of ethanol are added to the aqueous layer.
The NA is recovered as a precipitate.

Example 7 (Construction of a transformant in which the recombinant virus vector of the present invention was introduced into Sf21 cells and production of an estrogen receptor of the present invention) Sf21 cells (obtained from ATCC) were placed in a 75 cm ² T-type flask ( Falcon) 1 × 10 ⁶ pieces total 10
And incubate at 27 ° C. in GRACE medium containing FBS. To the cells, a culture supernatant containing the recombinant virus particles prepared as in Example 6 is added at a rate of 10 μl / flask, and the cells are cultured for 4 days. The culture supernatant is collected, and 1 ml of the culture supernatant is added to each Sf21 cell previously cultured in 10 75 cm ² T-type flasks (manufactured by Falcon) in the same manner as described above, and cultured for 60 hours. . After 60 hours, the cells were suspended by pipetting and collected from the flask, and the obtained cell suspension was suspended in 5.0 or more.
Centrifuge at 00 xg for 15 minutes to form a pellet. The cell pellet was washed with 20 mM HEPES pH 7.1
M EDTA, 1 mM DTT, 0.5 mM PMSF
After suspending in a buffer, the resulting cell suspension is homogenized up and down 30 times with a dounce glass homogenizer to disrupt the cells. This crushed liquid is treated at 30,000 xg for 1
The fraction containing the estrogen receptor of the present invention is obtained by collecting the supernatant fraction by ultracentrifugation for an hour.

Example 8 (Receptor Binding Assay) The binding reaction buffer had a final composition of 20 mM HEPE.
S-KOH pH 7.9, 10 mM sodium molybdate, 1 mM DTT, 0.5 mM EDTA, 0.5
It is prepared to be mM PMSF (all manufactured by Wako Pure Chemical Industries, Ltd.). The reaction system was adjusted to a total volume of 100 μl, added with 10 μg of a protein extract containing the estrogen receptor of the present invention, and added tritium-labeled E2 from 1 pM to 1 μM.
It is added so as to be about 00 nM. Unlabeled E2 was added to a final concentration of 1 in the test plot for non-specific binding.
Add further to 0 μM. The binding reaction is performed as follows. After keeping the reaction solution on ice for 15 hours, a charcoal dextran solution [composition: 10 mM Tris-H
Cl, 0.2% pickling activated carbon (Nakarai Tesque No.
ritA), 0.005% Pharmacia Dextran
T70], and left on ice for 10 minutes. The reaction solution is centrifuged at 1,000 × g for 10 minutes with a low-speed centrifuge to precipitate activated carbon, 100 μl of the supernatant is collected, and the radioactivity is measured with a liquid scintillation counter. Based on this measured value, the label E in the supernatant fraction was determined.
The amount of 2, ie, the amount of labeled E2 bound to the receptor (the amount of bound labeled ligand) is determined. The amount of the bound type labeled ligand in the test group to which only the label E2 was added corresponds to the total amount of the labeled E2 bound to the receptor. On the other hand, the amount of bound labeled ligand in the test group to which unlabeled E2 was added in addition to labeled E2 corresponds to the amount of nonspecific binding of labeled E2 to the receptor. For each of the reaction systems to which various concentrations of the label E2 have been added, the amount of non-specific binding is subtracted from the total amount of binding to determine the amount of specific binding of the labeled ligand to the receptor in the reaction system. Then, the specific binding label ligand concentration is plotted on the Y axis (specific binding label ligand concentration / free label ligand concentration), and the X axis is plotted for Scatchard analysis. Ask for.
To measure the affinity of the test substance for the estrogen receptor, the test substance is added to a binding assay binding reaction solution containing about 1 nM of tritium-labeled E2 in the same manner as described above so that the final concentration becomes about 1%. . In a system to which no test substance is added, the same amount of solvent as the test substance is added to the system. Labeling of receptor E by addition of test substance
When the binding amount of No. 2 decreases, it is determined that the test substance contains a substance that binds to the estrogen receptor.

[0033]

According to the present invention, it is possible to provide a novel estrogen receptor gene or the like which can be used in a test system for evaluating the ability of a chemical substance to regulate estrogen receptor activity.

[Sequence List Free Text] SEQ ID NO: 6 Oligonucleotide primer designed for PCR SEQ ID NO: 7 Oligonucleotide primer designed for PCR SEQ ID NO: 8 Oligonucleotide primer designed for PCR SEQ ID NO: 9 oligonucleotide primer designed for PCR SEQ ID NO: 10 oligonucleotide primer designed for PCR SEQ ID NO: 11 oligonucleotide primer designed for PCR SEQ ID NO: 12 oligonucleotide primer designed for PCR SEQ ID NO: 13 oligonucleotide primer designed for PCR SEQ ID NO: 14 oligonucleotide primer designed for PCR SEQ ID NO: 15 oligonucleotide designed for PCR Primer SEQ ID NO: 16 Oligonucleotide primer designed for PCR SEQ ID NO: 17 Oligonucleotide designed to generate promoter DNA SEQ ID NO: 18 Oligonucleotide designed to generate promoter DNA SEQ ID NO: 19 PCR SEQ ID NO: 20 oligonucleotide primer designed for PCR SEQ ID NO: 21 oligonucleotide primer designed for PCR SEQ ID NO: 22 oligonucleotide primer designed for PCR

[0035]

[Sequence List] <110> Sumitomo Chemical Company Limited <120> Estrogen receptor genes <130> P152169 <150> JP 11/318113 <151> 1999-11-09 <160> 22 <210> 1 <211> 506 <212 > PRT <213> Lepomis centrarchidae <400> 1 Met Ser Leu Lys Asp Trp Leu Leu Gly Lys Glu Arg Thr Val Val Thr 1 5 10 15 Met Glu Glu Leu Arg Ser Ser Val Pro Ser Ser Gln Gln Pro Val Pro 20 25 30 Arg Glu Asp Gln Cys Ala Thr Ser Asp Glu Ser Tyr Ser Val Gly Glu 35 40 45 Ser Gly Ala Gly Ala Arg Gly Phe Glu Met Ala Lys Glu Met Arg Phe 50 55 60 Cys Ala Val Cys Ser Asp Tyr Ala Ser Gly Tyr His Tyr Gly Val Trp 65 70 75 80 Ser Cys Glu Gly Cys Lys Ala Phe Phe Lys Arg Ser Ile Gln Gly His 85 90 95 Asn Asp Tyr Met Cys Pro Ala Thr Asn Gln Cys Thr Ile Asp Arg Asn 100 105 110 Arg Arg Lys Ser Cys Gln Ala Cys Arg Leu Arg Lys Cys Tyr Glu Val 115 120 125 Gly Met Met Lys Gly Gly Val Arg Lys Asp Arg Gly Arg Val Leu Arg 130 135 140 Arg Asp Lys Arg Arg Ala Gly Thr Asn Asp Arg Glu Lys Ala Ser Lys 145 150 155 160 Asp Leu Glu Tyr Lys Thr Val Pro Pro Gln Asp Arg Arg Lys His Ser 165 170 175 Ser Ser Ser Ser Ala Gly Gly Gly Gly Gly Lys Ser Ser Val Thr Gly 180 185 190 Met Ser Pro Asp Gln Val Leu Leu Leu Leu Gln Gly Ala Glu Pro Pro 195 200 205 Met Leu Cys Ser Arg Gln Lys Leu Ser Arg Pro Tyr Thr Glu Val Thr 210 215 220 Ile Met Thr Leu Leu Thr Ser Met Ala Asp Lys Glu Leu Val His Met 225 230 235 240 Ile Thr Trp Ala Lys Lys Leu Pro Gly Phe Leu Gln Leu Ser Leu His 245 250 255 Asp Gln Val Gln Leu Leu Glu Ser Ser Trp Leu Glu Val Leu Met Ile 260 265 270 Gly Leu Ile Trp Arg Ser Ile His Cys Pro Gly Lys Leu Ile Phe Ala 275 280 280 285 Gln Asp Leu Ile Leu Asp Arg Asn Glu Gly Asp Cys Val Glu Gly Phe 290 295 300 Val Glu Ile Phe Asp Met Leu Leu Ala Thr Ala Ser Arg Phe Arg Met 305 310 315 320 Leu Lys Leu Lys Pro Glu Glu Phe Val Cys Leu Lys Ala Ile Ile Leu 325 330 335 Leu Asn Ser Gly Ala Phe Ser Phe Cys Thr Gly Thr Met Glu Pro Leu 340 345 350 His Asn Ser Met Ala Val Gln Asn Met Leu Asp Thr Ile Thr Asp Ala 355 360 365 Leu Ile His His Ile Ser Gln Ser Gly Cys SerAla Gln Gln Gln Ser 370 375 380 Arg Arg Gln Ala Gln Leu Leu Leu Leu Leu Ser His Ile Arg His Met 385 390 395 400 400 Ser Asn Lys Gly Met Glu His Leu Tyr Ser Met Lys Cys Lys Asn Lys 405 410 415 Val Pro Leu Tyr Asp Leu Leu Leu Glu Met Leu Asp Ala His Arg Ile 420 425 430 His Arg Pro Asp Arg Pro Ala Gln Phe Trp Ser Gln Ala Asp Gly Glu 435 440 445 Pro Pro Phe Ile Asn Asn Asn Asn Ser Ser Asn Ser Gly Ser Asn Gly 450 455 460 Gly Val Ser Ser Ser Val Gly Ser Ser Ser Gly Pro Arg Val Asn His 465 470 475 480 Glu Ser Pro Ser Arg Gly Pro Thr Gly Pro Gly Val Leu Gln Tyr Gly 485 490 495 Gly Ser Arg Ser Asp Cys Thr His Ile Leu 500 505 <210> 2 <211> 3499 <212> DNA <213> Lepomis centrarchidae <220> <221> CDS <222> (424) ... (1944) <400> 2 caggcagagc ccagcgcaga gcagacagcc ttgtggaaca gtactcagac ccaggatcag 60 ctcagccttc acagagctgg agaccctctc cccacaacgt ccctcgcctc cgctgcgtgc 120 ccctctcagt gacatgtacc ctgaagagag cagggggtcc ggaggggtag ccactgtgga 180 ctttctggaa gggacctccgcctccgcctcccctccgcctccgcctccgcc 0 ccagtctggc tactactctg tacctctgga cgcccaaggg ccaccctcag atggcagcct 300 tcagtccctg ggcagcgggc ctaccagtcc tcttgtgttt gtgccgtcca gccccagact 360 cagccccttt atgcacccgc ccagccacca ctatctggaa accacctcaa cacccgtcta 420 cag atg agt ctg aaa gac tgg tta tta gga aaa gaa agg acg gtg gtg 468 Met Ser Leu Lys Asp Trp Leu Leu Gly Lys Glu Arg Thr Val Val 1 5 10 15 acc atg gag gag ctg agg tct agt gtc cca tcc agc cag cag cca gtt 516 Thr Met Glu Glu Leu Arg Ser Ser Val Pro Ser Ser Gln Gln Pro Val 20 25 30 ccc aga gag gac cag tgt gcc acc agt gat gag tcc tat agt gtg ggg 564 Pro Arg Glu Asp Gln Cys Ala Thr Ser Asp Glu Ser Tyr Ser Val Gly 35 40 45 gag tca ggg gct gga gcc agg ggg ttt gag atg gcc aag gag atg cgt 612 Glu Ser Gly Ala Gly Ala Arg Gly Phe Glu Met Ala Lys Glu Met Arg 50 55 60 ttc tgt gct gtg tgc agt gac tat gcc tct ggg tac cac tac ggg gtg 660 Phe Cys Ala Val Cys Ser Asp Tyr Ala Ser Gly Tyr His Tyr Gly Val 65 70 75 tgg tcc tgt gaa ggc tgt aag gcc ttc ttt aag agg agc atc cag ggt 708 Trp Ser Cys Glu Gl y Cys Lys Ala Phe Phe Lys Arg Ser Ile Gln Gly 80 85 90 95 cac aat gac tat atg tgc cca gca acc aat cag tgt act att gac agg 756 His Asn Asp Tyr Met Cys Pro Ala Thr Asn Gln Cys Thr Ile Asp Arg 100 105 110 aat cgg aga aag agc tgc cag gct tgc cgt ctt agg aag tgt tat gaa 804 Asn Arg Arg Lys Ser Cys Gln Ala Cys Arg Leu Arg Lys Cys Tyr Glu 115 120 125 gtg ggc atg atg aaa gga ggt gtt cgc gag ggc cgt gtt ttg 852 Val Gly Met Met Lys Gly Gly Val Arg Lys Asp Arg Gly Arg Val Leu 130 135 140 cgc cgt gat aaa cga cgt gct gga acc aat gac cga gag aag gcc tct 900 Arg Arg Asp Lys Arg Arg Ala Gly Thr Asn Asp Arg Glu Lys Ala Ser 145 150 155 aag gac ctg gag tac aaa aca gtg ccc cct cag gac agg agg aaa cac 948 Lys Asp Leu Glu Tyr Lys Thr Val Pro Pro Gln Asp Arg Arg Lys His 160 165 170 175 agc agc agc agc agt gcc ggt ggt gga gga gga aaa tca tca gtg acc 996 Ser Ser Ser Ser Ser Ala Gly Gly Gly Gly Gly Lys Ser Ser Val Thr 180 185 190 ggg atg tct cct gac cag gtg ctc ctc ctg ctc cag ggt gcc gag ccc 1044 Gly M et Ser Pro Asp Gln Val Leu Leu Leu Leu Gln Gly Ala Glu Pro 195 200 205 cca atg ctg tgc tcc cgt cag aag ctg agc cga ccg tac acc gag gtc 1092 Pro Met Leu Cys Ser Arg Gln Lys Leu Ser Arg Pro Tyr Thr Glu Val 210 215 220 acc ata atg aca cta ctc acc agc atg gcc gat aag gag ctg gtc cac 1140 Thr Ile Met Thr Leu Leu Thr Ser Met Ala Asp Lys Glu Leu Val His 225 230 235 atg atc acc tgg gcc aag aag ctt cca ggt ttc ctg cag ctg tct ctc 1188 Met Ile Thr Trp Ala Lys Lys Leu Pro Gly Phe Leu Gln Leu Ser Leu 240 245 250 255 cat gac cag gtg cag ctg ctg gag agc tcg tgg ctg gag gtg ctg atg 1236 His Asp Gln Leu Glu Ser Ser Trp Leu Glu Val Leu Met 260 265 270 att ggg ctc ata tgg agg tcc atc cac tgc ccc ggc aaa ctc atc ttc 1284 Ile Gly Leu Ile Trp Arg Ser Ile His Cys Pro Gly Lys Leu Ile Phe 275 280 g cag gac ctc ata ctg gac agg aat gaa ggt gac tgt gtg gaa ggc 1332 Ala Gln Asp Leu Ile Leu Asp Arg Asn Glu Gly Asp Cys Val Glu Gly 290 295 300 ttt gtt gag atc ttc gac atg ctg ctg gcc act ttc cgc 1380 Phe Val Glu Ile Phe Asp Met Leu Leu Ala Thr Ala Ser Arg Phe Arg 305 310 315 atg ctc aaa ctc aaa cct gag gag ttt gtc tgc ctc aaa gct atc atc 1428 Met Leu Lys Leu Lys Pro Glu Glu Phe Leu Lys Ala Ile Ile 320 325 330 335 ctg ctc aac tct ggt gcc ttc tct ttc tgc acc ggc aca atg gag ccc 1476 Leu Leu Asn Ser Gly Ala Phe Ser Phe Cys Thr Gly Thr Met Glu Pro 340 345 350 350 ctc cac aac ag atc gca gtg cag aac atg ctg gac acc atc aca gac 1524 Leu His Asn Ser Met Ala Val Gln Asn Met Leu Asp Thr Ile Thr Asp 355 360 365 gct ctc ata cat cat atc agc caa tca gga tgc tcg gct cag cag cag 1572 Ala Leu Ile His His Ile Ser Gln Ser Gly Cys Ser Ala Gln Gln Gln 370 375 380 tcg agg cgg cag gcc cag ctg ctg ctc ctg ctc tcc cac atc agg cac 1620 Ser Arg Arg Gln Ala Gln Leu Leu Leu Leu Leu Ser His Ile Arg His 385 390 395 atg agc aac aaa ggc atg gag cat ctc tac agc atg aag tgc aag aac 1668 Met Ser Asn Lys Gly Met Glu His Leu Tyr Ser Met Lys Cys Lys Asn 400 405 410 415 aaa gtg cct ctt tac gac ctt ctg ctg gag atg ttg gac gct cac cgt 1716 Lys Val Pro Leu Tyr Asp Leu Leu Leu Glu Met Leu Asp Ala His Arg 420 425 430 ata cac cgc cca gac aga cca gct cag ttc tgg tcc cag gct gac gga 1764 Ile His Arg Pro As Arg Pro Ala Gln Phe Trp Ser Gln Ala Asp Gly 435 440 445 gag cct ccc ttc att aac aac aac aac agc agc aac agt ggc agc aat 1812 Glu Pro Pro Phe Ile Asn Asn Asn Asn Ser Ser Asn Ser Gly Ser Asn 450 455 460 ggc ggc gtc tcc tct tca gtc ggt tcc agt tca gga ccc cga gtc aac 1860 Gly Gly Val Ser Ser Ser Val Gly Ser Ser Ser Gly Pro Arg Val Asn 465 470 475 cac gag agc ccg agc aga gga ccc aca ggt cca gga gtc cag tac 1908 His Glu Ser Pro Ser Arg Gly Pro Thr Gly Pro Gly Val Leu Gln Tyr 480 485 490 495 gga ggg tcc cgc tct gac tgc acc cac atc cta tga ggccgagcac aacaaa 1960 Gly Gly Ser Arg Ser Asp Cys Thr His Ile Leu 500 505 catctgaagg tcaaaagtaa tttttacaga tgatgtgtgt tgtacagaat gaaagctaaa 2020 ggttgtattt taattaattt catgagataa ttatttataa attaagtgat tttatagttg 2080 taactgtttt agggagtttt ttttcctttg cacta atcta gttcactaca acacgagctt 2140 caatgcaggc aatctactat gctgcctttc ataatatctg tgattctgag tgagtacagc 2200 ttaatttttc caggtgttag gtcatattgt ggcactcagc tatggtgatt tgaaatgaca 2260 agcagctaat ttgcctttgt atttgcctca accaaagtgc acttcttctt gggtttattg 2320 ggcattgttt ttacttttac atattgggat taggatgatc agacactaaa ctatgataaa 2380 aaacaggttc aaatgaatgt gtgatttatt ttgtgtttaa attccaacat cattaaagag 2440 cctgaacgtc aggtattgtg tcttaagcgt gcacgcaaac tttaaacttc tggaaaacaa 2500 atatttctat gatgaaatta taaaattaac agtgattgag gatgtatgtt gaattcagag 2560 tagatacaat ttgcacaatc aaatcctaga gcactgatca cattatgaaa gaagcaaagc 2620 tttcacaact ttattgttgg gtaacttcac cacatccagc tttttgtgaa tggtaggttt 2680 gttctgtagg cttacatgca caagagtttt ttttctgaat ttgagatatt ttatgtgtgt 2740 ctgcaagaga aagactgaga aatctgagga aatttgctat aagtggccct aagctttcta 2800 tcttgatgca gttcagaatt tcaaaatgtt actattcatc cactaattca gtgattacat 2860 gttgagtttg gcttgattta cacaactcca aaagcctagt tatcattaaa tatgtgcata 2920 tgcaattgtt tttattttgt ttaaatggaa caaatttaat ctaaatctaa tatggacctg 2980 accaggtgtt ttctttatta gctgctatac actgctaagc accattgtta atagtttggt 3040 ttatatagct aaatagcttt ttccatgacc atcaaaggcc tccaaaagaa agctaatgtt 3100 ctttcctaat tctgtgataa acagactcca aaatcacact ggatggtcac tgaacaagtc 3160 ctgcttcatg tttgtttaca tgtcaaccag caacgtcagc acacctgtgc tgttttgtat 3220 cctcccatga acagttgttc agtcacaggt ttgtcacaca ggtagaacaa tctgttaata 3280 tactgaaaaa aaggccagag gttgacgtgt agagaatgtt gccagaatac aaatgataaa 3340 caaagatctg tgccacttaa acaagaatgg aaagcctcta tacagggtca ggaaactgga 3400 tttggacact tgaagtgcaa gtcaaacctg acctgtcatc tgtttactgt gcataaaaat 3460 aaaaacatta attgggaaaa aaaaaaaaaa aaaaaaaaa 3499 <210> 3 <211> 996 <212> DNA <213> Lepomis centrarchidae <400> 3 aggagcatcc aaggtcacaa tgactacatg tgcccagcaa ccaatcagtg tactattgac 60 aggaatcgga gaaagagctg ccaggcttgc cgtcttagga agtgttatga agtgggcatg 120 atgaaaggag gtgttcgcaa ggaccgtggc cgtgttttgc gccgtgataa acgacgtgct 180 ggaaccaatg accgagagaa ggcctctaag gacctggagt acaaaacagt gccccctcag 240 gacaggagga aac acagcag cagcagcagt gccggtggtg gaggaggaaa atcatcagtg 300 accgggatgt ctcctgacca ggtgctcctc ctgctccagg gtgccgagcc cccaatgctg 360 tgctcccgtc agaagctgag ccgaccgtac accgaggtca ccataatgac actactcacc 420 agcatggccg ataaggagct ggtccacatg atcacctggg ccaagaagct tccaggtttc 480 ctgcagctgt ctctccatga ccaggtgcag ctgctggaga gctcgtggct ggaggtgctg 540 atgattgggc tcatatggag gtccatccac tgccccggca aactcatctt cgcacaggac 600 ctcatactgg acaggaatga aggtgactgt gtggaaggct ttgttgagat cttcgacatg 660 ctgctggcca ctgcctcccg cttccgcatg ctcaaactca aacctgagga gtttgtctgc 720 ctcaaagcta tcatcctgct caactctggt gccttctctt tctgcaccgg cacaatggag 780 cccctccaca acagcatggc agtgcagaac atgctggaca ccatcacaga cgctctcata 840 catcatatca gccaatcagg atgctcggct cagcagcagt cgaggcggca ggcccagctg 900 ctgctcctgc tctcccacat caggcacatg agcaacaaag gcatggagca tctctgcagc 960 atgaagtgca agaacaaagt gcctctgtac gacctg 996 <210> 4 <211> 582 <212> PRT <213> Lepomis centrarchidae <400> 4 Met Tyr Pro Glu Glu Ser Arg Gly Ser Gly Gly Val Ala Thr Val Asp 1 5 10 15 Phe Leu Glu Gly Thr Tyr Asp Tyr Ala Ala Pro Thr Pro Ala Pro Thr 20 25 30 Pro Leu Tyr Ser Gln Ser Gly Tyr Tyr Ser Val Pro Leu Asp Ala Gln 35 40 45 Gly Pro Pro Ser Asp Gly Ser Leu Gln Ser Leu Gly Ser Gly Pro Thr 50 55 60 Ser Pro Leu Val Phe Val Pro Ser Ser Pro Arg Leu Ser Pro Phe Met 65 70 75 80 His Pro Pro Ser His His Tyr Leu Glu Thr Thr Ser Thr Pro Val Tyr 85 90 95 Arg Ser Ser Val Pro Ser Ser Gln Gln Pro Val Pro Arg Glu Asp Gln 100 105 110 Cys Ala Thr Ser Asp Glu Ser Tyr Ser Val Gly Glu Ser Gly Ala Gly 115 120 125 Ala Arg Gly Phe Glu Met Ala Lys Glu Met Arg Phe Cys Ala Val Cys 130 135 140 Ser Asp Tyr Ala Ser Gly Tyr His Tyr Gly Val Trp Ser Cys Glu Gly 145 150 155 160 Cys Lys Ala Phe Phe Lys Arg Ser Ile Gln Gly His Asn Asp Tyr Met 165 170 175 Cys Pro Ala Thr Asn Gln Cys Thr Ile Asp Arg Asn Arg Arg Lys Ser 180 185 190 Cys Gln Ala Cys Arg Leu Arg Lys Cys Tyr Glu Val Gly Met Met Lys 195 200 205 Gly Gly Val Arg Lys Asp Arg Gly Arg Val Leu Arg Arg Asp Lys Arg 210 215 220 Arg Ala Gly Thr Asn Asp Arg Glu Lys Ala Ser Lys Asp Leu Glu Tyr 225 230 235 240 Lys Thr Val Pro Pro Gln Asp Arg Arg Lys His Ser Ser Ser Ser Ser 245 250 255 Ala Gly Gly Gly Gly Gly Gly Lys Ser Ser Val Thr Gly Met Ser Pro Asp 260 265 270 Gln Val Leu Leu Leu Leu Gln Gly Ala Glu Pro Pro Met Leu Cys Ser 275 280 285 Arg Gln Lys Leu Ser Arg Pro Tyr Thr Glu Val Thr Ile Met Thr Leu 290 295 300 Leu Thr Ser Met Ala Asp Lys Glu Leu Val His Met Ile Thr Trp Ala 305 310 315 320 Lys Lys Leu Pro Gly Phe Leu Gln Leu Ser Leu His Asp Gln Val Gln 325 330 335 Leu Leu Glu Ser Ser Trp Leu Glu Val Leu Met Ile Gly Leu Ile Trp 340 345 350 Arg Ser Ile His Cys Pro Gly Lys Leu Ile Phe Ala Gln Asp Leu Ile 355 360 365 Leu Asp Arg Asn Glu Gly Asp Cys Val Glu Gly Phe Val Glu Ile Phe 370 375 380 Asp Met Leu Leu Ala Thr Ala Ser Arg Phe Arg Met Leu Lys Leu Lys 385 390 395 400 Pro Glu Glu Phe Val Cys Leu Lys Ala Ile Ile Leu Leu Asn Ser Gly 405 410 415 Ala Phe Ser Phe Cys Thr Gly Thr Met Glu Pro Leu His Asn Ser Met 420 425 430 Ala Val GlnAsn Met Leu Asp Thr Ile Thr Asp Ala Leu Ile His His 435 440 445 Ile Ser Gln Ser Gly Cys Ser Ala Gln Gln Gln Ser Arg Arg Gln Ala 450 455 460 Gln Leu Leu Leu Leu Leu Ser His Ile Arg His Met Ser Asn Lys Gly 465 470 475 480 Met Glu His Leu Tyr Ser Met Lys Cys Lys Asn Lys Val Pro Leu Tyr 485 490 495 Asp Leu Leu Leu Glu Met Leu Asp Ala His Arg Ile His Arg Pro Asp 500 505 510 510 Arg Pro Ala Gln Phe Trp Ser Gln Ala Asp Gly Glu Pro Pro Phe Ile 515 520 525 Asn Asn Asn Asn Ser Ser Asn Ser Gly Ser Asn Gly Gly Val Ser Ser 530 535 540 Ser Val Gly Ser Ser Ser Gly Pro Arg Val Asn His Glu Ser Pro Ser 545 550 555 560 Arg Gly Pro Thr Gly Pro Gly Val Leu Gln Tyr Gly Gly Ser Arg Ser 565 570 575 Asp Cys Thr His Ile Leu 580 <210> 5 <211> 1824 <212> DNA <213> Lepomis centrarchidae <220> <221> CDS <222> (74) ... (1822) <400> 5 ctcagccttc acagagctgg agaccctctc cccacaacgt ccctcgcctc cgctgcgtgc 60 ccctctcagt gac atg tac cct gaa gag agc agg ggg tcc gga ggg gta 109 Get Serly Gyr Gly Gly Gly Val 1 5 10 gcc act gtg gac ttt ctg gaa ggg acc tac gat tat gcc gcc ccc acc 157 Ala Thr Val Asp Phe Leu Glu Gly Thr Tyr Asp Tyr Ala Ala Pro Thr 15 20 25 cct gcc ccg act cct ctt tac agc cag tct ggc tac tac tct gta cct 205 Pro Ala Pro Thr Pro Leu Tyr Ser Gln Ser Gly Tyr Tyr Ser Val Pro 30 35 40 ctg gac gcc caa ggg cca ccc tca gat ggc agc ctt cag tcc ctg ggc 253 Leu Asp Ala Gln Gly Pro Pro Ser Asp Gly Ser Leu Gln Ser Leu Gly 45 50 55 60 agc ggg cct acc agt cct ctt gtg ttt gtg ccg tcc agc ccc aga ctc 301 Ser Gly Pro Thr Ser Pro Leu Val Phe Val Pro Ser Ser Pro Arg Leu 65 70 75 agc ccc ttt atg cac ccg ccc agc cac cac tat ctg gaa acc acc tca 349 Ser Pro Phe Met His Pro Pro Ser His His Tyr Leu Glu Thr Thr Ser 80 85 90 aca ccc gtc tac agg tct agt gtc cca tcc agc cag cag cca gtt ccc 397 Thr Pro Val Tyr Arg Ser Ser Val Pro Ser Ser Gln Gln Pro Val Pro 95 100 105 aga gag gac cag tgt gcc acc agt gat gag tcc tat agt gtg ggg gag 445 Arg Glu Asp Gln Cys Ala Thr Ser Asp Glu Ser Tyr Ser Val Gly Glu 110 115 120 tca g gg gct gga gcc agg ggg ttt gag atg gcc aag gag atg cgt ttc 493 Ser Gly Ala Gly Ala Arg Gly Phe Glu Met Ala Lys Glu Met Arg Phe 125 130 135 140 tgt gct gtg tgc agt gac tat gcc tct ggg tac cac tac gtg tgg 541 Cys Ala Val Cys Ser Asp Tyr Ala Ser Gly Tyr His Tyr Gly Val Trp 145 150 155 tcc tgt gaa ggc tgt aag gcc ttc ttt aag agg agc atc cag ggt cac 589 Ser Cys Glu Gly Cys Lys Ala Phe Phe Lys Ar Ser Ile Gln Gly His 160 165 170 aat gac tat atg tgc cca gca acc aat cag tgt act att gac agg aat 637 Asn Asp Tyr Met Cys Pro Ala Thr Asn Gln Cys Thr Ile Asp Arg Asn 175 180 185 cgg aga aag agc tgc cag gct tgc cgt ctt agg aag tgt tat gaa gtg 685 Arg Arg Lys Ser Cys Gln Ala Cys Arg Leu Arg Lys Cys Tyr Glu Val 190 195 200 ggc atg atg aaa gga ggt gtt cgc aag gac cgt ggc cgt gtt Mgt 733 Lys Gly Gly Val Arg Lys Asp Arg Gly Arg Val Leu Arg 205 210 215 220 cgt gat aaa cga cgt gct gga acc aat gac cga gag aag gcc tct aag 781 Arg Asp Lys Arg Arg Ala Gly Thr Asn Asp Arg Glu Lys Ala Ser Lys Two 25 230 235 gac ctg gag tac aaa aca gtg ccc cct cag gac agg agg aaa cac agc 829 Asp Leu Glu Tyr Lys Thr Val Pro Pro Gln Asp Arg Arg Lys His Ser 240 245 250 agc agc agc agt gcc ggt ggt gga gga ggaaaa tca tca gtg acc ggg 877 Ser Ser Ser Ser Ala Gly Gly Gly Gly Gly Lys Ser Ser Val Thr Gly 255 260 265 atg tct cct gac cag gtg ctc ctc ctg ctc cag ggt gcc gag ccc cca 925 Met Ser Pro Asp Gln Val Leu Leu Leu Leu Gln Gly Ala Glu Pro Pro 270 275 280 atg ctg tgc tcc cgt cag aag ctg agc cga ccg tac acc gag gtc acc 973 Met Leu Cys Ser Arg Gln Lys Leu Ser Arg Pro Tyr Thr Glu Val Thr 285 290 290 295 300 ata atg aca cta ctc acc agc atg gcc gat aag gag ctg gtc cac atg 1021 Ile Met Thr Leu Leu Thr Ser Met Ala Asp Lys Glu Leu Val His Met 305 310 315 atc acc tgg gcc aag aag ctt cca ggt ttc ctg cag ctg tct ct 1069 Ile Thr Trp Ala Lys Lys Leu Pro Gly Phe Leu Gln Leu Ser Leu His 320 325 330 gac cag gtg cag ctg ctg gag agc tcg tgg ctg gag gtg ctg atg att 1117 Asp Gln Val Gln Leu Leu Glu Ser Ser Trp Leu Glu l Leu Met lIe 335 340 345 ggg ctc ata tgg agg tcc atc cac tgc ccc ggc aaa ctc atc ttc gca 1165 Gly Leu Ile Trp Arg Ser Ile His Cys Pro Gly Lys Leu Ile Phe Ala 350 355 360 cag gac ctc atag aat gaa ggt gac tgt gtg gaa ggc ttt 1213 Gln Asp Leu Ile Leu Asp Arg Asn Glu Gly Asp Cys Val Glu Gly Phe 365 370 375 380 gtt gag atc ttc gac atg ctg ctg gcc act gcc tcc cgc ttc cgc ttc cgc ttc cgc ttc cgg Phe Asp Met Leu Leu Ala Thr Ala Ser Arg Phe Arg Met 385 390 395 ctc aaa ctc aaa cct gag gag ttt gtc tgc ctc aaa gct atc atc ctg 1309 Leu Lys Leu Lys Pro Glu Glu Phe Val Cys Leu Lys Ala Ile 405 410 ctc aac tct ggt gcc ttc tct ttc tgc acc ggc aca atg gag ccc ctc 1357 Leu Asn Ser Gly Ala Phe Ser Phe Cys Thr Gly Thr Met Glu Pro Leu 415 420 425 cac aac agc atg gca gtg cag aac atg ctg atc aca gac gct 1405 His Asn Ser Met Ala Val Gln Asn Met Leu Asp Thr Ile Thr Asp Ala 430 435 440 ctc ata cat cat atc agc caa tca gga tgc tcg gct cag cag cag tcg 1453 Leu Ile His His Ile Ser Gln Ser Gly Cys Ser Ala Gln Gln Gln Ser 445 450 455 460 agg cgg cag gcc cag ctg ctg ctc ctg ctc tcc cac atc agg cac atg 1501 Arg Arg Gln Ala Gln Leu Leu Leu Leu Leu Ser His Ile Arg His Met 465 470 ag aaa ggc atg gag cat ctc tac agc atg aag tgc aag aac aaa 1549 Ser Asn Lys Gly Met Glu His Leu Tyr Ser Met Lys Cys Lys Asn Lys 480 485 490 gtg cct ctt tac gac ctt ctg ctg gag atg ttg gac atg 1597 Val Pro Leu Tyr Asp Leu Leu Leu Glu Met Leu Asp Ala His Arg Ile 495 500 505 cac cgc cca gac aga cca gct cag ttc tgg tcc cag gct gac gga gag 1645 His Arg Pro Asp Arg Pro Ala Gln Phe Trp Ser Gln Ala Asp Gly Glu 510 515 520 cct ccc ttc att aac aac aac aac agc agc aac agt ggc agc aat ggc 1693 Pro Pro Phe Ile Asn Asn Asn Asn Ser Ser Asn Ser Gly Ser Asn Gly 525 530 535 535 540 ggc gtc gtc tct tca tcc agt tca gga ccc cga gtc aac cac 1741 Gly Val Ser Ser Ser Val Gly Ser Ser Ser Gly Pro Arg Val Asn His 545 550 555 gag agc ccg agc aga gga ccc aca ggt cca gga gtc ctg cag tac gga 1789 Glu Ser Pro Ser Arg Gly Pro Thr Gly Pro Gly Val Leu Gln Tyr Gly 560 565 570 ggg tcc cgc tct gac tgc acc cac atc cta tga gg 1824 Gly Ser Arg Ser Asp Cys Thr His Ile Leu 575 580 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 6 cccagcgcag agcagacagc cttgtggaac 30 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223 > Designed oligonucleotide primer for PCR <400> 7 cttttgacct tcagatgttt gttgtgctcgg 31 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 8 aggagcatcc aaggtcacaa tgactac 27 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 9 caggtcgtac agaggcactt tgttcttg 28 <210> 10 <211> 24 <212> DNA <213 > Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 10 tctggctact actctgtacc tctg 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide prim er for PCR <400> 11 ccccacacta taggactcat catc 24 <210> 12 <211> 62 <212> DNA <213> Lepomis centrarchidae <400> 12 atgagtctga aagactggtt attaggaaaa gaaaggacgg tggtgaccat ggaggagctg 60 ag 62 <210> 13 <211> 24 < 212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 13 gagcagacag ccttgtggaa cagt 24 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 14 gcctctagac caccatgagt ctgaaagact ggttattag 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 15 gcctctagag ttgtgctcgg cctcatagga tgtgggtgc 39 <210> 16 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 16 ggcaagcttc caccatgtac cctgaagaga gcaggggg 38 <210> 17 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide for synthesis of promoter DNA <400> 17 gatctcgact ataaagaggg caggctgtcc tctaagcgtc accacgact t ca 52 <210> 18 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide for synthesis of promoter DNA <400> 18 agcttgaagt cgtggtgacg cttagaggac agcctgccct ctttatagtc ga 52 <210> 19 <211 > 34 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 19 ggccgaattc ggcatgatga aaggaggtgt tcgc 34 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220 > <223> Designed oligonucleotide primer for PCR <400> 20 ggccgtcgac gtgctcggcc tcataggatgt ggg 33 <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 21 gccgaattcg agagagctga cgggcagagc aga 33 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Designed oligonucleotide primer for PCR <400> 22 gccagatctg ctcatagttg ctggcatacc act 33

[Brief description of the drawings]

FIG. 1 shows the results of measurement of the estrogen receptor activating ability of E2 by a reporter assay using the gene bgerα of the present invention (N = 6). The horizontal axis indicates the concentration of E2 in each test plot. The leftmost 0 column is E2
A section where DMSO was added to a final concentration of 0.1% instead of the DMSO solution (E2 free section) is shown. On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the E2 non-added group is shown as 1.

FIG. 2 is a graph showing the results of measuring the estrogen receptor activating ability of bisphenol A by a reporter assay using the gene bgerα of the present invention (N = 6). The abscissa indicates the concentration of bisphenol A in each test plot. The 0 column at the left end shows a section in which DMSO was added to a final concentration of 0.1% in place of the DMSO solution of bisphenol A (bisphenol A-free section). On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the bisphenol A-free group was set to 1.

FIG. 3 shows the results of measuring the estrogen receptor activating ability of diethylstilbestrol (DES) by a reporter assay using the gene bgerα of the present invention (N = 6).
FIG. The horizontal axis indicates the DES concentration in each test plot. The column at the left end, 0, shows a section in which DMSO was added to a final concentration of 0.1% instead of the DES DMSO solution (DES-free section). The ordinate indicates the luciferase activity value, and the luciferase activity value in the DES-free group was 1
As shown.

FIG. 4 shows the results of measurement of the estrogen receptor activating ability of genistein by a reporter assay using the gene bgerα of the present invention (N = 6). The abscissa indicates the genistein concentration in each test group.
Replace the column with 0 at the left end with the DMSO solution of genistein.
A section to which DMSO was added to a final concentration of 0.1% (a section without genistein) is shown. On the vertical axis, the luciferase activity value was 1 and the luciferase activity value in the genistein-free group was 1.
As shown.

FIG. 5 is a graph showing the results of measuring the estrogen receptor activating ability of o, p′-DDT by a reporter assay using the gene bgerα of the present invention (N = 6). The abscissa indicates the o, p'-DDT concentration in each test plot. In the column at the left end, 0 is replaced with DMSO solution of o, p'-DDT and the final concentration of DMSO is 0.
The section added to 1% (section without o, p'-DDT added) is shown. On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the o, p'-DDT-free group was set as 1.

FIG. 6: 4-Hydroxy tamoxifen (4-OH-HTM) by a reporter assay using the gene bgerα of the present invention
FIG. 9 is a view showing the results of measuring the estrogen receptor anti-activating ability (N = 6). The horizontal axis shows 1 for each test plot.
The concentration of 4-OH-HTM coexisting with 0 nM E2 is indicated. The column at 0 on the left end is a section where DMSO was added to a final concentration of 0.1% instead of 4-OH-HTM DMSO solution (4-OH-HTM-free section).
Is shown. On the vertical axis, the luciferase activity value is expressed as 4-OH-HTM.
The luciferase activity value in the non-added group is shown as 1.

FIG. 7 is a graph showing the results (N = 6) of measuring the estrogen receptor activating ability of E2 by a reporter assay using the gene bgerα2 of the present invention. The horizontal axis indicates the concentration of E2 in each test plot. The leftmost 0 column is
The section in which DMSO was added to a final concentration of 0.1% in place of the DMSO solution of E2 (E2 non-added section) is shown. On the vertical axis, the luciferase activity value was 1 and the luciferase activity value in the E2 non-added section was 1%.
As shown.

FIG. 8 is a graph showing the results of measuring the estrogen receptor activating ability of bisphenol A by a reporter assay using the gene bgerα2 of the present invention (N = 6). The abscissa indicates the concentration of bisphenol A in each test plot. Column 0 on the left is bisphenol A DMSO
A section in which DMSO was added to a final concentration of 0.1% instead of the solution (bisphenol A-free section) is shown. On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the bisphenol A-free group was set to 1.

FIG. 9 shows the results of measuring the estrogen receptor activating ability of diethylstilbestrol (DES) by a reporter assay using the gene bgerα2 of the present invention (N =
FIG. The horizontal axis shows the DE in each test plot.
The concentration of S was added. The leftmost 0 column is the DES DM
A section (DM-free section) in which DMSO was added to a final concentration of 0.1% instead of the SO solution is shown. On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the DES-free group was set to 1.

FIG. 10 shows the results of measurement of the estrogen receptor activating ability of genistein by a reporter assay using the gene bgerα2 of the present invention (N = 6). The abscissa indicates the genistein concentration in each test group. The 0 column at the left end shows a section in which DMSO was added to a final concentration of 0.1% in place of the genistein DMSO solution (a section without genistein). On the vertical axis, the luciferase activity value is shown, and the luciferase activity value in the group without genistein is set to 1.

FIG. 11 shows the results of measurement of the estrogen receptor activation ability of o, p′-DDT by a reporter assay using the gene bgerα2 of the present invention (N = 6). The abscissa indicates the o, p'-DDT concentration in each test plot. The column with 0 at the left end is a section where DMSO was added to a final concentration of 0.1% instead of the o, p'-DDT DMSO solution (o, p'-DDT-free section).
Is shown. On the vertical axis, the luciferase activity value is expressed as o, p'-DDT.
The luciferase activity value in the non-added group is shown as 1.

FIG. 12 is a graph showing the results of measuring the estrogen receptor activating ability of E2, estrone, and estriol using a two-hybrid system using the gene of the present invention (N = 4). The abscissa indicates the concentration of the compound. On the vertical axis, the β-galactosidase activity value is shown, and the β-galactosidase activity value in the group where no compound is added is shown as 1.

FIG. 13 is a graph showing the results of measuring the estrogen receptor activating ability of various compounds using a two-hybrid system using the gene of the present invention (N = 4). The abscissa indicates the β-galactosidase activity value in the β-added group of 1 nM E2.
The galactosidase activity value is shown as 1.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12Q 1/02 C12R 1: 645) // (C12N 1/19 1:91) C12R 1: 645) (C12P 21/02 C (C12N 5/10 C12R 1:91) C12R 1:91) (C12P 21/02 (C12P 21/02 C12R 1: 645) C12R 1:91) (C12Q 1/02 (C12P 21/02 C12R 1:91) C12R 1: 645) C12N 15/00 ZNAA (C12Q 1/02 5/00 B C12R 1:91) C12R 1:91)

Claims (21)

[Claims] 1. A gene encoding an estrogen receptor according to any one of the following (a) to (d). (A) An estrogen receptor having the amino acid sequence represented by SEQ ID NO: 1. (B) 95 amino acids relative to the amino acid sequence represented by SEQ ID NO: 1
An estrogen receptor having an amino acid sequence exhibiting at least 100% amino acid identity. (C) an estrogen receptor having the amino acid sequence represented by SEQ ID NO: 4. (D) 95 amino acids relative to the amino acid sequence represented by SEQ ID NO: 4
An estrogen receptor having an amino acid sequence exhibiting at least 100% amino acid identity. 2. An estrogen having a base sequence represented by base numbers 424 to 1941 in the base sequence represented by SEQ ID NO: 2 or a base sequence represented by base numbers 74 to 1819 in the base sequence represented by SEQ ID NO: 5. Receptor gene. 3. A vector containing the estrogen receptor gene according to claim 1 or 2. 4. The vector according to claim 3, wherein a promoter is operably linked to the estrogen receptor gene. 5. The vector according to claim 3, wherein the vector is a virus. 6. A virus particle containing the vector according to claim 5. 7. A method for producing a vector, comprising incorporating the estrogen receptor gene according to claim 1 or 2 into a vector capable of replicating in a host cell. 8. A transformant obtained by introducing the estrogen receptor gene according to claim 1 into a host cell. 9. A transformant obtained by introducing the vector according to any one of claims 3 to 5 into a host cell. 10. The transformant according to claim 8, wherein the estrogen receptor gene is introduced into a chromosome of a host cell. 11. The method according to claim 8, wherein the host cell is an animal cell.
0. The transformant according to any one of 0. 12. The transformant according to claim 8, wherein the host cell is a mammalian cell. 13. The transformant according to claim 8, wherein the host cell is an insect animal cell. 14. The host cell according to claim 8, wherein the host cell is a yeast cell.
0. The transformant according to any one of 0. 15. A method for producing a transformant, comprising introducing the gene according to claim 1 or 2 or the vector according to claim 3 into a host cell. 16. A method for producing an estrogen receptor, comprising culturing the transformant according to any one of claims 8 to 14 to produce an estrogen receptor. 17. An estrogen receptor having an amino acid sequence represented by any one of SEQ ID NO: 1 and SEQ ID NO: 4. 18. An estrogen receptor having an amino acid sequence showing 95% or more amino acid identity to the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 4. 19. A test substance is expressed by contacting a transformant which expresses the estrogen receptor gene according to claim 1 or 2 and into which a reporter gene linked downstream of a transcription control region containing an estrogen response element has been introduced. And measuring the expression level of the reporter gene in the transformant. 20. A transcription-coupling factor capable of binding to an estrogen receptor in a ligand-dependent manner or a receptor-binding region of the transcription-coupling factor and a ligand-dependent complex forming an estrogen receptor or a ligand-binding domain of the receptor. The use of the estrogen receptor gene according to any one of claims 1 and 2, for measuring the ability of a test substance to regulate estrogen receptor activity in a two-hybrid system in which transcription of a reporter gene is activated. 21. A receptor binding assay comprising a step of bringing the estrogen receptor according to claim 17 or 18 into contact with a test substance and keeping it warm.