CA2335651A1 - Gene switch - Google Patents

Abstract

The present invention relates inter alia, to a method of initiating transcription of a target gene in a eukaryotic cell comprising: (a) providin g a eukaryotic cell which is capable of producing a response protein; and (b) inserting into the genome of said cell a polynucleotide defining an inducibl e promoter sequence operably linked to and capable when induced of initiating transcription of said target gene; and (c) applying to said cell a chemical inducer capable of binding to said response protein whereby said chemical inducer binds to said response protein to form an inducing complex which bin ds to and induces said inducible promoter thereby initiating transcription of said target gene.

Description

GENE SWITCH
The present invention relates inter alia, to the induction of gene expression in a eukaryote by the application of a chemical inducer to the eukaryote and to materials and methods for achieving induction. Such systems are referred to as "gene switches".
In particular, the present invention relates to a method of controlling expression of a target gene in a plant, animal or yeast.
Bacterial cells have the ability to respond to the surrounding environment.
The response to different environmental cues is essential for survival of bacteria. It is apparent that individual bacteria in a population are also able to sense the density and state of the local bacterial population (the "quorum") of which they are members.
That is, an individual bacterium can detect the presence of like bacteria in the surrounding environment. Quorum sensing allows bacteria to synchronise growth, development which when a minimal population level is reached initiates a concerted response from the population.
In the case of Photobacterium frscheri, N (3-oxohexanoyl)-L-homoserine lactone or autoinducer regulates bioluminescence in a cell density-dependent manner.
There are two main genes in the lux operon of P. frscheri involved in the signal production and signal detection. Luxl is the gene involved in the biosynthesis of the homoserine lactone but the mechanism by which this takes place is unclear. It has been proposed that S-adenosylmethionine and coenzymeA or the acyl carrier protein adduct of 3-oxohexanoic acid are substrates for the luxl gene in P. fischeri.
In bacteria, the autoinducer regulates expression of the luxl gene and thus creates a positive autoregulation of autoinducer synthesis. LuxR, the response regulator or autoinducer receptor, is a protein involved in responding to the presence of N (3-oxo)hexanoyl-L-homoserine lactone (OHHL) in P. fischeri. At the C-terminal end LuxR contains a DNA binding domain and a transcriptional activator.
LuxR C-terminal end shows amino acid homology to transcriptional activators known as the two component environmental-sensing systems such as UhpA, FixJ and NarL.
LuxR is thought to interact with DNA as a homodimer to a palindrome within the luxl operator sequence termed lux box. The N-terminal end of the protein is called the _7_ receptor module as it has no similarity to the two-component environmental sensing systems.
Quorum sensing systems are found in other bacteria and may be activated by different homoserine lactones. Such is the case in P. aeruginosa PAOI, Lasl directs the synthesis of the autoinducer N (3-oxadodecanoyl)-L-homoserine lactone (OdDHL), which activates the positive transcriptional activator, LasR (Winson et al., 1995). Moreover, in the same P. auruginosa, PAO1, a second signalling pathway termed vsm containing vsmR and vsml genes was isolated. The vsml gene product is involved in production of N butanoyl-L-homoserine lactone (BHL) and N hexanoyl-L-homoserine lactone (HHL). These compounds are present in the spent culture supernatants of P. aeruginosa and when either BHL or HHL to PAN067, a pleiotropic P. aeruginosa mutant unable to synthesize either of these autoinducers, restored elastase, chitinase, and cyanide production (Winson et al., 1995). Other evidence suggesting the presence of different homoserine inducers in one species has recently been observed in Vibrio anguillarum (Milton et al., 1997) and P. aeroginosa (Pesci et al., 1997). Furthermore, Table I, shows examples of characterised systems where different compounds are known to be inducers of different receptor molecules in different bacteria.

~ v -b o, r.

O v' (Y1 . cCf G d _a 3 ~ ~ ~, o ' m 4~" a 3 a1 ~ 3 x ~ ~ b Q' 0 ~ (~
G~ . ~ U cC
w ~ ~
3 co N
a x a ,o ~ _ ~ N o ~ ~ ~ M
p m ~ p N O~Ov pp v ~ o~'oo ~ ~ ~ ~ N
C7 d c ~C ..a ~ ~ >C>C ..'~',.~

c a ~

_ o ~ o V '' U ~ ~ O
C a r ~ U I1 a ..U"N ~1 O x a a ~. ~ o 0 ~L
O 1-.na ~ '/ ~ a r ~ N ~ ~, o ~; x x ~ ~ o .~ ~ ~ ~ x fx ~ ~ t~C
d E- U ~ U W

L

O

v r C~

C C ~, ~ - ~b0 bD U W
ridaio d E~ U W

a m o '1 ~ ;.
~ o ..' o . o a a o d r'.. o a o ~ o ~
..o a > cs ea o 0 o a '~
E~s, L s. V ~. -,' .~ o W
O ~C '~ ~~ W W a 'n '~ ~ a~
.r c~ a ~ ~M~"~ ~_ ~
,~ ~ ,r ,~ c 'n ~, ~s .,:
a ~ ~-o~ a w o~ ' s ~ Vl -o~O
,.0C ~ N C 0~
r" C7C C ~ ~ ft~
O N O O c~f G G1 .~G1 C ~, .U .N ~ N L ~ --~4..w O
O N .-.~ U O W .cs ~ a 3 ~,~. 3 3 ~ 0 3 ~O
N
M

M

M ~ ~ N '.
O o0 i~
D_\~ r~

N

O
U C x ~ c x a, o o C o ~ ,~ a a C ~ 1.a 0 x ~ c 0 ~ L..aT oo "L~ ~
O ~ k 4 O w..~ 3 a1. x a ~ ~ x ~ ~ ~, ~ V
x O .. C O x 'C~ N r4 '/ ~ C O O
x C .O U ~ z .~ ~ m o z .~~ ~ ~ ~ x .~

Q k ~ ~ ~ 04 ''c~
v a a > i d _ o _ -sex ~ E
a ca a Q ~ C ~ ~ .C
- ~ ~, do '1 a ~ ~ 'r c.
U 0 0 :,, C O
~ '':~ .O
O G
O p~ y ~1 a m ~.
., a~

o, a m c o~, C O
c~ 0 , .~:
:0 H

O N

n i >, ,...7 O
O O ~ O p O
:~ U ~ r-~..~>> x x C ~ C ~ C x x x ~~
o o -~a m m m ~ ~ ~ a ~ ~ x x z ~ z .~ x o ~.../~ ~ X
W .

d > a J-a 0 0 ~ o a ~' v ' c a o -~ a a R~-V_ Vn1!: =P.4 MCJE\CHE~_ tIF : 11- 8- U : 10:5:3 : CCITT_ G_3-_. +49 89 ?-~~~a~~ ~ ~
11-08-2000 . ~ - ~ ~ y GB 009902653 The present invention therefore seeks to provide inter olio, methods and materials for the induction of bene expression in eukaryotes by the application of chemical inducers to the eukaryote.
According to a first aspect of the present invention there is provided a method of controlling expression of a target gene in a eukaryote, comprising integrating, preferably stably integrating, within the genome of the eulcaryote an expression system comprising a first poly~nucleotide comprising the target gene operabl3r linked to and under the control of a promoter comprising an 1v=aryl-homoserine lactone inducible promoter, wherein the eukaryotic cell is capable of producing a response regulator protein and whereby expression of the target gene depends upon the presence of both N aryl-homoseiine Iactone and the response regulator protein.
The eulatyotic ce1! may already contain the mechanisms to produce the said response protein or may alternatively be provided with them by inserting into the said cell, a polynucleotide which provides far the production of the response protein using techniaues well known within the art_ The expression system may $irther comprise a second polynucleofide which comprises a DhTA sequence encoding a response regulator protein. The sequence encoding the response regulator protein is preferably Lux R.
The expression of the target gene may be controllable by application of exogenous N-acyl-homoserine lactone. Alternatively, the expression system may further comprise a third polynucleotide which comprises a DNA sequence encoding a proiein involved in the biosynthesis ofN acyl-homoserine lactone. The sequence is preferably Lwc 1 or yen 1.
The inducible promoter ,for use in the above mentioned method may comprise the nucleotide sequence depicted as SEQ ID No_ 2 or SEQ ID No. 1 and the response protein may cornprisc the amino acid sequence depicted in SEQ ID No. 19, 10 or 8, Alternatively the irlducible promoter may comprise a functional variant such as a polyrtuclevtide which is the complement of orie which binds to SEQ ID No. 2 or SEQ
1D f:~o. 1 at a temperature of between 60°C and 65°C in U.3 strength citrate buffered saline containing 0.1°ro SDS followed by rinsing at the same temperature with 0.3 stren;th citrate buffered saline containing 0.1% SDS wherein the said polynucleotide is still capable of acting as an inducible promoter upon binding wiih the said inducin' AMENDED SHEET

RCS'. VON : EPA A9UENCHEN 06 : 11 - 8- U : 1 a : ~4 : ~ CC,1 TT .G3 = +~.9 89 33~3~J44R5 : ~ 6 11-08-2000 ~ ' ' - . _ ........ ... . . ., . ~ . . . . _ G B 009902853 comply. tn. particular the response protein for use in the method of the present invention may be encoded by the polynucleotide comprises the sequence depicted in SEQ ID No. 5. Alternatively the polynucleotide encoding the said response protein may comprise the complement of one which binds to SEQ ID No. 5 at a temperature of between. 60°C and 65°C in 0_3 strength citrate buffered saline containing 0.1 % SDS
followed by rinsing at the same temperature with 0.3 strength citrate buffered saline containing 0.1 % SDS wherein the said polynuclcotide still encodes a protein which is capable of forming an inducing complex with the said chemical inducer. It is particularly preferred tb~at the polynucleotide defining the inducible promoter according to the present invention contains the region depicted as SEQ ID No.l . T he method ofpresent invention is particularly applicable to initiating transcription in cells of plants, more particularly in ihc eclLs of melons, mangoes, soybean, cotton, tobacco, sugarbeet, oilseed rape. canola, flax, sunflower, potato, tomato, alfalfa, lettuce, maize, wheat, sorghum, rye, bananas, barley, oat, turf grass, forage grass, sugar cane, pea., field bean, rice, pine, poplar, apple, peaches, grape, strawberries, carrot, lettuce, cabbage, anions citrus or nut plants. In particular the method of the present invention may be used to initiate transcription in a variety of tissues, including roots, leaves, ste,~ns and reproductive tissues- The chemical indueer which may be used in the above mentioned method is N-(3-oxo)hexanoyl-L-homoserinc la.ctone or a functional equivalent thereof and may be applied to the plant cell as part of an.
agriculturally acceptable formulation. Alternatively the chemical inducer may be produced within the plant by inserting into the genome of the plant a polynucleotide encoding a protein which provides for the production of the cltenuical inducer within the plant. This polynucleotide may, fox example, be under the transcriptional control of a constitutive promoter, a gene swiich (such as the alcAlR, Heliothis ecdysone and GST-27 gene switch), wound inducible, tissue or temporal promoters. The advantage of producing the chemical inducer in planta is that there is no need to spray or exogenously treat plants to induce gene expression.
Further alternative inducibte promoters, response proteins arid chemical inducers which may be used in the method of the present invention are referenced in Tabl a 1. For example, the promoter sequence or a past thereof may obtainable from the vanl gene of v~biro an~illarum and the response protein encoded by the vanR
AMENDED SHEET

hC.V. VO!v : EF'A rtc~E~iCtiEN uE ~~., ~ ~ ., : 11- F3- C) . m : a~r . ~ . CC
I T1~ G_:3 - +48 88 2399446 : #~ 7 i 1-08-2000 ~ . ~ V ~ . - G B 009902653 gene may be used with th:~ chemical IvT-(3-oxo-decanoyfr-L-homoserine lactose {ODHL) or a functional variant thereof.
Tire polynucleotide encoding the said response protein in the method referred to above may be bounded by a promoter and a terminator sequence and in particular the promoter may be induciblc such as the Alt Al R switch system, the GST
switch system and the ecdysone switch. Altemaiively the promoter may be constitutive such as cauliflower mosaic virus 35S/195, maim Ubiquitin and Arab:dopsis'lJbiquitin 3 or raay be devclopmemally regulated specific promoter such as those controlling expression of the gene required during seed formation, germination such as cysteine proteinases (as specified in our International Publication No WO 97135983 ) and malale synthase.
The target pane in the method referred to about may be any gene of interest, for example, p-glueuronidase; Baci.lus thuringenesis toxin; barnase or barstar.
Also provided is a method of providing plants containing an inducible target gene comprising=
{a) inserting into a plant cell, which cell provides for production of a response protein a polynucleotide defining an inducible promoter sequence operably linked to said target gene; and (b) regenerating morphologically normal fertile plants thereof, and (c) applying to the population of regenerants a cb.emical inducer or a functional variant thereof capable of binding to said response protein, wisereby said chemical inducer binds to said response protein to form an inducing complex which binds tv and induces said urducible promoter thereby initiating transcription of said target gene;
and (d) selecting those pants which are expressing the said target gene. TIZe inducible promoter sequence referred to in the preceding paragraph may comprise the nucleotide sequence depicted as SEQ ID No. 2 or SEQ ):D No. 1 or a functional variant thereof amd the response protein comprises the amino acid sequence depicted as SEQ DJ No. : 9, SEQ TD No. 10 ar SEQ ID No. 8 or a functional variarft thereof and the said chemical indu~.er is N-(3-oxo)hexanoyi-G-homoserine Lactone or a functional equivalent thereof. In particular the inducible promoter sequence may :.ontain the nucleotide sequence depicted as SEQ ID No_ 13 or a ruictional variant Hereof and the response protein may comprises the amino acid sequence depicted as SBQ 1D No 2a or a functional variant thereof and the said chemical inducer tnay be AMENDED SHEET

RCV. 1.'UN : ~Pr1 YfUEPJ_CHEiV U6 : 1 1- 8- 0 ~ ~ ~ .~~ - ~ CC 1 Tl~ G3 ~ +49 89 ?:39y4.4.RF : # R
11-08-2000 ~ ~ ~ ' ~ ~~~ --.. .. _ ' - ' ' ' ' ' ' GB 009902653 ?V-(~-oxo)dodecanoyl-L-homoserine lactone or a functional equivalent thereof.
Alternatively, the said inducible promoter sequence may contain the nucleotide sequence depicted as SEQ ID Iv'o. 1~ or 17 or a functionai_ variant thereof and the response protein rnay comprise the amino acid sequence depicted as SEQ ID No 21 or a functional variant themof and the said chcxnical inducer may be trT-(3-oxo~octanovl-L-homoserine iaetone or a functional equivalent thereof.
The eukaryote is preferably a plant, mannmal or yeast.
The present invention also provides plants produced according to the method of the preceding paragraph which plants may be selected from the group consisting or":
melons, mangoes, svy'vean, cotton, tobacco, sugarbeet, oilseed rape, canola, flax sunflower, potato. tomato. alfalfa, lettuce, maize, wheat, sorghum, rye, bananas, barley, oat, turf grass, forage grass, sugar cane, pea, feld bean, rice, pine, poplar, apple, peaches, grape, strawberries, carrot, lettuce, cabbage, onion, citrus or nut plants.
Tlie method employed for transformation of plant cells is not especially germane to the present invention and any method suitable for the target plant may be employed. For example, transgenic plants are abiained by regeneration from the transformed cells. Nmnerous transformation procedures are h~nown from the literature including agroinfectivn using ~grubaetsrium tumejaeiens or its Ti plasnaid, electroporation, microinjection or plants cells atxd prvtvplasts, microprojectile transformation. All of these methods are well kaovvn within the art. The present invention may also be applied to any plant fvr which transformation techniques are, or become, available.
Tn a Furtlier aspect of the present invention there is provided a polynucleotide comprising a DNA sequence comprising a target gene vperably linked to and under the control of an inducible promoter sequence and an operator sequence which is responsive to exposure to an inducer compound, wherein the inducrr compound is ~1r=
aryl-homoser:.ne lactone and wherein the polynucleotide further comprises a DNr'1 sequence encoding a response regulator protein.The said first poiynucleotide of the D~IA construct may comprise the nucleotide sequence depicted as SEQ ID No. 2 or SEQ ID No. 1 or a functional variant thereot'and the secondpolynucleotide region may comprise a polynucleotide which encodes the amino acid sequence depleted as AMENDED SHEET

y' vnn~ ~'FF~n Mt If'NCliI;N 06 . : 11- 8- U : l U : v6 : ~ . CC I TT G3 ; +49 89 '_>34~-4.x;5 : ~ 4 71-08-2000 " . . . ..... _ _ . ., _ . . . . . . G B 009902653 SEQ ID loo. 19, SEQ ID No. 10 or SEQ ID No. 8 or a functional variant thereof.
Alternatively the said first polynucleotide may comprise the nucleotide sequence depi~-ted as SEQ ID No. 13 or a functional variant thereof and the second polynucleotide region may oompri.se a polynueleotide which encodes the amino acid sequence depicted as SEQ ID N~o. 20 or a functional variant thereof.
Alternatively, the said first polynucleotide may comprise the mzcleotide sequence depicted as SEQ
ID No. 15 or 17 or a functional variant thereof and the second polynucleotide region may comprise a polynucleotidc which encodes the amino acid sequence depicted as SEQ ID No. 21 or a functional variant thereof. The said second polynucleotide region referred to above niay comprise a promoter operably linked to the polymicleotide encoding the said response protein. The said promoter may be inducible and constitutive or developmentally controlled In a fiuther aspect of the present invention there is provided a polynucleotide having two or morn regions tech expressing a protein, each region being operably linked to and under the control of separate inducible promoter regions wherein one of the inducible promoter regions is controllable by application of an exogenous N acyl-homoserine lactone. Preferably, the regions expressing a protein are controlled by different inducible promoter regions.
According to a further aspect there is provided plant tissue transformed with the polynucleotide of the present invention, morphologically normal fertile whole plants comprisinb such tissue and the progeny of such plants.
The present invention still further provides the use of a polynucleotide according to any one of claims 23 to 26 in the inducible expression of a target gene wh::rcin the protein encoding regions are expressed in a eukaryote.
In a further aspect of the present iaveution there is provided a method of screening compounds for bioactivity comprising monitoring the activity of a reporter gene driven Lry a N-aryl-homoserine lactone regulator promoter in response to exposure to the compounds in transgenic plants in the presence of a response reoulaxor protein which forms au inducing complex with the compound being screened. The chemical could be applied to the plant and the activity of the reporter gene monitored for e.G. improved activity, mobility or stability or to assess if the chemical had an AMENDED SHEET

,v ~; r.r.i v ~P d MI iHNCHEN 06 : 11- 8- 0 : 10 : 56 : CC I TT G3-~ +~9 89 2?~~' " ~r ~ " , 11-08-2000' ~~ .' .--....._.. ..., . _._.. ....._ GB 009902653 inhibitorrr effect on the response protein which resulted in a decrease i.n activity of the reporter gene.
In a further aspect of the present invention there is provided a method of selectively controlling pests in a field which f eld comprises crop plants and pests wherein the plants are those obtained according to the methods referred to above and the said target gene encodes a target protein which is capable of controlling the said pests said method comprising applying to the plants an amount of a chemical inducer which is sufficient to bind to the said response protein to produce the said inducing complex which is capable of initiating transcription of the target gene which p;ovdes for the production of the target protein in an amount which is cuff cient to control the said pests.
In a further aspect of the present invention there is provided a method of providing a plant which cornains a target gene which is inducibly controlled comprising:
(a) inserting into a first plant cell a polvnucleotide comprising a first inducible promoter operably linked to a target gene and regenerating a f rst morphologically normal fertile plant therefrom;
(b) inser~'ing into a second plant cell a poIynueleotide comprising a promoter operably linked to a region encoding a. response protein which is capable of binding to a chemical inducer to produce an inducinb complex which is then capable of binding the said educible promoter to allow for the initiation of transcription of the said target gene and regenerating a second morphologically normal fertile plant therefrom;
(c) cross pollinating said first plant with the said second plant or said second plant with said first plant and harvesting the seed therefrom;
(d) growing said seed and applying to the resultant plants an amount of said chemical inducer which provides an inducing complex capable of binding the said inducible promater to allow for the initiation of transcription of the said target gene.
1'he term "functional variant" with respect to a polynucleotide encoding the inducible prornoteT of the present invention includes variant sequences which are the complement of a sequence which hybridises to the indueible promoter sequence at a temperature oFhetween b0°C and 65°C in 0_3 strength citrate buffered saline containing 0.1% SDS followed by rinsing at the same temperature with 0.3 strength AMENDED SHEET

-v; wnr;.c-nn ~a,~\~~~j UE, :I1- 8- U : 10:5? : CCITT G3-i +49 89 ~~;.__...._ _ 11-08-2000 ' -"'~ "-- ~~ ~ ~ "' ' ' " ' - G B 009902653 - 11a citrate buffered saline containing 0.1% SDS and ~~hich are still capable of acting as an inducible promoter.
The term ''functional variant" vrith respect to the response protein includes variant proteins obtained by conservative subsi~tutions within the amh~o acid sequeacc which substitutions do not significantly advcrseiy a~eci the ability of the response protein to bind the chemical inducer. In particular substitutions may be made between the following amino acid graups niz.
(a) Alanine, Serine. Glyeine and Threon.ine (b) Glutarnic acid aad Aspartic acid (c) Arginine and Lysine (d) Isoleucine, Lcucinc, ~Jaline and Methionine (e) Phcnylalanine, Tyrosine and Tryptophan AMENDED SHEET

The term "transgenic" in relation to the present invention does not include a wild type regulator promoter in its natural environment in combination with its associated functional gene in its natural environment.
The term "target gene" with reference to the present invention means any gene of interest. A target gene can be any gene that is either foreign or natural to the eukaryote in question.
The term "construct" - which is synonymous with terms such as "cassette", ''hybrid" and "conjugate" - includes a target gene directly or indirectly attached to the regulator promoter, such as to form a cassette. An example of an indirect attachment is the provision of a suitable spacer group such as an intron sequence intermediate the promoter and the target gene. The same is true for the term "fused" in relation to the present invention which includes direct or indirect attachment. Such constructs also include plasmids and phage which are suitable for transforming a cell of interest.
The term "expression system" means that the system defined above can be expressed in an appropriate organism, tissue, cell or medium. The system may comprise one or more constructs and may also comprise additional components that ensure to increase expression of the target gene by use of the regulator promoter.
One possible use of the inducible promoters of the present invention is in the control of male sterility. The anther is the site of male reproductive processes in flowering plants. It is composed of several tissues and cell types and is responsible for producing pollen grains that contain the sperm cells. The tapetum is a specialised tissue which plays a critical role in pollen formation. It surrounds the pollen sac early in pollen development, degenerates during the latter stages of development and is not present in an organised form in the mature anther. The tapetum produces a number of compounds which aid pollen development or are incorporated into the pollen outer wall and it has been demonstrated that many of the natural male sterility mutations have impaired tapetum differentiation or function.
Tapetal tissue is therefore critical to the formation of functional pollen grains.
A number of genes have been identified and cloned that are specifically expressed in tapetal tissue. They include Osg6B, Osg4B..(Tsuchiya et al. 1994, Yokoi, S et al.
1997), pEl, p T72 (W09213957), p CA55 corn (W092/13956) , TA29, TA13,(Seurinck et al. 1990), RST2 corn ( W09713401), MS14,18,10 and A6, A9 from Brassica napus (third et al. 1993). Anther specific clones have been isolated from a number of species Bp4A and C (Albani et al. 1990), chs petunia (Koes et al.
1989), rice (Xu et al. 1993, Zou et al. 1994), amongst others. In higher plants the female reproductive organ is represented by the pistil, composed of the ovary, style and stigma. The gynoecium has been shown to contain up to 10,000 different mRNAs not present in other organs (Kamalay and Goldberg 1980). These include regulatory genes responsible for controlling pistil development as well as "downstream" ones encoding proteins associated with differentiated cell types in the pistil. Genes governing self incompatibility and their homologues are one class of gene with pistil predominant expression patterns (Nasrallah et al. 1993).
Other cloned genes which are applicable as target genes in the present invention include ~i glucanase (Ori et al. 1990), pectate lyase ( Budelier et al. 1990) and chitinase (Lotan et al. 1989) which are expressed in the transmitting tissue and a proteinase inhibitor (Atkinson et al. 1993) which are expressed in the style. Others are pathogenesis related or are homologues of genes involved in the cleavage of glycosidic bonds.
These enzymes may facilitate pollen tube growth by digesting proteins in the tissue through which the pollen tube grows. A number of female sterile mutants have been identified in Arabidopsis. For example, sinl (short integument) (Robinson-Beers et al. 1992) and bei I (bell) (Robinson-Beers et al. 1992) affect ovule development. In the short integument a mutation blocks megasporogenesis at the tetrad stage (Elliot,R.C, et al. 1996, Klucher,K.M, 1996). A lethal ovule 2 mutation has been observed but not cloned in maize (Nelson et al. 1952). Pistil specific basic endochitinases have been cloned from a number of species (Ficker et al. 1997, Dzelzkalns et al. 1993, Harikrishna et al. 1996, Wemmer et al. 1994) and extensin-like genes have been shown to be expressed in the styles of Nicotiana alata (Chen C-G, et al. 1992). The following are ovule specific clones ZmOV23,13, (Greco R., et al.
unpublished), OsOsMAB3A (Kang H.G., et al. 1995), ZmZmM2 (Theissen G., et al.
1995) and stigma specific stigl (Goldman, M.H et al. 1994) , STG08, STG4B12 (EP-412006-A). Mariani et al. used the promoter from the STIG1 gene to drive expression of barnase in the stigmatic secretory zone.
In summary then, the present invention therefore provides a gene switch which is operably linked to a foreign gene or a series of foreign genes whereby expression of WO 00/09704 _ 14 _ PCT/GB99/02653 said foreign gene or said series of foreign genes may be controlled by application of an effective exogenous inducer. The gene switch of the present invention, therefore, when linked to an exogenous or foreign gene and introduced into a eukaryote by transformation, provides a means for the external regulation of expression of that foreign gene.
It is possible to use one, two or more of these inducible promoter regions according to the present invention to activate different processes in plant cells, thereby obtaining a plant which will have multiple inducible cassettes all controlled by for example, different homoserine lactones. Also, a plant may contain, for example, an inducible promoter according to the present invention in conjunction with other switch type mechanisms examples of which include inducible promoters include the Alc A/ R switch system described in International Publication No. WO.
93/21334, the GST switch system described in International Publication Nos WO 90/08826 and WO
93/031294 and the ecdysone switch described in our International Publication No.
WO 96/37609.
The methods and products of the present invention may also be used to control expression of foreign proteins in eukaryotes such as yeast and mammalian cells.
Many heterologous proteins for different applications may be produced by expression in such eukaryotic cells. The present invention is advantageous in that it provides control over the expression of foreign genes in such cells. It also provides a further advantage, particularly in yeast and mammalian cells, where accumulation of large quantities of a heterologous protein can damage the cells, or where the heterologous protein is damaging such that expression for short periods of time is required in order to maintain the viability of the cells. The inducible system of the present invention also has applicability in gene therapy as it allows the timing of the therapeutic gene to be controlled. The present invention is therefore not only advantageous in transformed mammalian cells but also to mammals per se. Furthermore, the present invention may be used to switch on genes which produce potentially damaging or lethal proteins. Such a system may be employed in the treatment of cancer in which cells are transformed with genes which express proteins which are lethal to the cancer.
The timing of the action on such proteins on the cancer cells may be controlled using the switch of the present invention.

Various preferred features and embodiments of the present invention will now be described by way of non-limiting examples with reference to the accompanying Figures of which:-Figure 1 shows a schematic representation of the general structure of the response regulator protein of the bacterial quorum sensing system.
Figure 2 shows a schematic representation of the homoserine lactone gene switch system.
Figure 3 is a plasmid map of the reporter gene construct, p221.91ux6.
Figure 4 is a plasmid map of p221.91ux2.
Figure 5 Plasmid map of p221.91ux3.
Figure 6 Plasmid map of p221.91uxC.
Figure 7 Plasmid map of p221.9Lpro.
Figure $ Depicts the expression vector containing the LuxR gene in the pDHS 1 LuxR
plasmid.
Figure 9 Shows the expression cassette containing the enhanced N-terminal fusion protein of SV40-NLS-Gal4-LuxR in the plasmid pDH5ISVLuxR.
Figure 10 Shows the expression cassette containing the enhanced C-terminal fusion of LuxR-SV40-NLS-Gal4 in the plasmidDHSILuxRSV.
Figurel 1 is the plasmid map of p221.9lasbox. Containing one copy of the LasR
Box.
Figure 12 is a plasmid map of the transient expression construct containing LasR, pSinLASR. _ Figure 13 expression plasmid pFunLuxR for expression in monocotyledon protoplasts.
Figure 14 expression plasmid pFunLasR for expression in monocot protoplasts.
Figure 15 expression plasmid pFunTraR for expression in monocot protoplasts.
Figure 16 reporter plasmid p221.9traboxl containing tra box sequence 1 described by Zhu and Winans, (1999) Figure 17 reporter plasmid p221.9trabox2 containing tra box of sequence 2 described by Zhu and Winans, ( 1999).

Figure 18 is a plasmid map of binary vectors containing the effector and reporter cassettes, pAHL 1.
Figure 19. is a plasmid map of binary vectors containing the effector and reporter cassettes, pAHL2.
Figure 20. is a plasmid map of binary vectors containing the effector and reporter cassettes, pAHL3.
Figure 21 is a plasmid map of binary vector containing luxl gene, pBDHELI.
Figure 22 is a plasmid map of pSB401 containing the Lux operon.
Figure 23 shows the root of a transgenic tobacco plant that was grown in tissue culture under aseptic conditions was placed on an LB agar plate and overlain with top agar containing E. coli with the plasmid pSB401 (Figure 22). This strain expresses the lux operon and will bioluminesce in response to OHHL and HHL. Bioluminescence in the region around the root was clearly seen with the naked eye.
Figure 24. Shows a leaf of a transgenic tobacco plant that was grown in tissue culture under aseptic conditions. The leaf was excised from the plant and placed on an LB
agar plate and overlaid with top agar containing Chromobacterium violaceum indicator strain. The violet colour detected represent the induction of the indicator stain gene showing the extrusion of OHHL from the plan tissue into the bacterial medium.
Sequences SEQ ID No. 1 is the Luxl box promoter region.
SEQ ID No. 2 is the Luxl promoter region.
SEQ ID No. 3 & 4 are the LuxRBamhl fragment.
SEQ ID No. S & 6 are the LuxR sequence/protein sequence.
SEQ ID No. 7 & 8 are the NVLuxR fusion flanked by BamHI and PstI sites/protein sequence.
SEQ ID No. 9 & 10 are the LuxRNV sequence/protein sequence.
SEQ ID No. 11 is a TraRl fragment.
SEQ ID No. 12 is the TraR2 fragment.
SEQ ID No. 13 is the LasBoxl region.
SEQ ID No. 14 is the LasBox2 region.
SEQ ID No. 15, 16, 17 and 18 are the TraBox1,2,3,4 regions respectively.

SEQ ID No. 19 is the Lw~;R response protein sequence.
SEQ ID No. 20 is the LasR response protein sequence.
SEQ ID. No. 21 is the TrasR response protein sequence.
SEQ ID No. 22 & 23 are the open reading frames of LasR and TraR respectively.
SEQ ID No.24 is the Lux Box promoter region.
Example 1. Transient expression of LuxR and reporter plasmid in Tobacco mesophyll protoplasts.
Preparation of Reporter gene expression cassette.
Six copies of the 20bp palindromic lux box sequence will be fused upstream of the -60CaMV minimal promoter which in tum is fused to the reporter gene GUS.
The palindrome of sequence 5' GATCACCTGTACGATCGTACAGGT 3' (Sequence ID.
1) was self annealed and introduced into a BamHI pBluescript vector. Sequence determination of a number of recombinants lead to the identification of a plasmid with 6 copies of the palindrome. The identified plasmid was digested with HindIII
and SaII to release the in 6 copies of the palindrome and introduced into a HindIIIlSaII
p221.9 vector. p221.9 plasmid contains a -60CaMV minimal promoter fused to GUS
downstream of the HindIII and SaII unique cloning sites. A recombinant plasmid was identified and named p221.91ux6 (Figure 3). The same oligonucleotide was used to generate p221.9LuxR2 (Figure 4), p221.9LuxR3 (Figure 5) and p221.9LuxC (Figure 6). p221.91pro was generated using the bacterial promoter containing the Lux box sequences (Figure 7 Sequence ID 2).
Preparation of LuxR expression vector.
The lux receptor was altered at both ends of the coding sequence. At the Fend a plant Kozac consensus sequence was placed with an NcoI site at the ATG start of the coding sequence. Upstream from the Kozac consensus sequence a BamHI unique site was introduced using PCR. The sense oligonucleotide was luxrbamhl 5' CCCGGATCCTAACAATGGGTATGAAAGACATAAATG 3' (Sequence ID.3 )and the antisense primer was luxrbamh2 S' CGAACTCGAGTCATGATTTTAAAGTATGGGCAA-TCAATTG 3' (Sequence ID.4 ). The PCR reaction was carned out using Taq polymerase (2.5 U) in a reaction WO 00/09?04 PCT/GB99/02653 buffer containing IOOng of template DNA, 100 ng of each oligonucleotide, 20 mM
TRIS-HCI pH 8.4, SO mM KCI, 10 mM MgClz, 50 mM dNTPs and using hot start conditions followed by 15 cycles of denaturing (94°C for I minute), annealing (66°C
for 1 min) and synthesis (72°C for 3 min). The fragment was purified and digested using BamHIlXhoI and was introduced into pDH~ 1 BamHIlSaII vector to give pDH51 luxR (fYhoI and SaII restriction enzymes produce compatible ends) (Figure 8).
The sequence of the insert was determined and compared to the published LuxR
sequence (Sequence ID. 5) (Devine et al., 1988).
Tobacco mesophyll transformation.
Tobacco shoot cultures cv. Samsun, were maintained on solidified MS medium + 3% sucrose in a controlled environment room (i 6 hour day / 8 hour night at 25°C, 55% R.H), were used as the source material for protoplasts. Leaves were sliced parallel to the mid-rib, discarding large veins and the slices were placed in (13% mannitol, pH5.6, 860mmol/kg) for 1 hour to pre-plasmolyse the cells. This solution was replaced with enzyme mixture (0.2% cellulase R10, 0.05%
macerozyme R10 in CPW9M (CPWI3M but 9% mannitol), pH5.6, 600mmo1/kg) and incubated in the dark at 25°C overnight ( I 6 hours). The enzyme mixture was passed through a 75pm sieve and the filtrate was centrifuged at 600rpm for 3.5 minutes, discarding the supernatant. The pellet was resuspended in 0.6M sucrose solution and centrifuged at 600rpm for 10 minutes. The protoplasts were removed and diluted with CPW9M
(pH5.6, 560mmol/kg) and pelleted by centrifuging at 600rpm for 3.5 minutes.
The protoplasts were resuspended in CPW9M, counted, diluted to 2x106/ml in MaMg medium (Negrutui et al., 1987) and aliquoted at 4x105 protoplasts per treatment.
20pg each of effector and reporter plasmid DNA (lmg/ml) were added followed by 200p1 PEG solution (Negrutui et al., 1987). The protoplasts were incubated at room temperature for 10 minutes before addition of Sml MSP19M medium (MS medium, 3% sucrose, 9% mannitol, 2mg/1 NAA, O.Smg/1 BAP, pH5.6, 700mmol/kg) in the presence or absence of ligand (N-(-3-oxohexanoyl)-L-homoserine lactone (OHHL)).
The protoplasts were cultured in their tubes lying horizontally at 25°C
and they were harvested for the GUS assay after 24 hours.

Transient Expression in Nicotiana pumbaginifolia suspension cells derived protoplasts Protoplasts isolation Protoplasts were isolated from Nicotiana plumbaginifolia suspension cells.
Suspension cells were sub-cultured once a week in Np suspension medium in 250 ml Erlenmeyer flasks that were shaken at 100 RPM , at 25°C with I6h/8h lightldark regime. Protoplasts were isolated 2 or 3 days after subculture. Two or 2.5 g fresh weight of cells were incubated with 20 ml filter-sterilised enzyme solution and shaken at 40 rpm at 25°C. The enzyme solution comprised 1 % cellulysin (Calbiochem 219466), 1 % Macerozyme RIOT"' (Yakult, Tokyo), and 1 % Driselase (SigmaTM D-9515) dissolved Artificial Sea Water Mannitol. After 3 h cell digestion in enzyme solution, they were washed through 100-, 50-um diameter sieves with W5 solution before being collected by centrifugation at 80 x g for 4 min. This method is also used for the isolation of wheat protoplasts.
Protoplasts transformation.
Protoplasts were resuspended in W5 medium at densities ranging from 0.1 to 0.2 x I06 /ml and sedimented for 4 min at 80 g. They were then taken up in 0.2 to 0. 5 ml of: 0.4 M mannitol, 15 mM MgCIZ, 0.1 % MES, 2 % glucose, pH 5.6 containing p,g plasmid DNA. Five minutes later poly-ethylene glycol (PEG) 4000 (FlukaT"') at 40% (wlv) in 0.4 M mannitol and 0. 1 M Ca(N0,).4H20 pH 9.0 was added to give final PEG concentrations of 20%. After half an hour 1 ml 0.2 M CaCl,.2Hz0 were added, and the protoplasts centrifuged for 4 min at 40 g. The protoplasts were then cultured in transformation buffer at 0.1-0.2 x 106 protoplasts per ml during 48h at 25°C in the dark. This method is also applicable to the transformation of wheat protoplasts.
GUS Assays Transient transformed tobacco protoplasts were harvested by centrifugation at 3000 rpm. by collecting them by centrifugation at 3000 rpm. The supernatant was discarded and the protoplasts resuspended in GUS extraction buffer (Jefferson et al., 1987) for preparation of (3-glucoronide extracts. The tubes were vortexed for 1 minute and then spun at 13000rpm for 2 minutes. The supernatant was collected and placed in a fresh eppendorf tube. 201 of the extract were used in the GUS assays.
Fluorometric assays for GUS activity were performed with the substrate 4-methylumbelliferyl-D-glucuronide (Sigma'"'') using a Perkin-ElmerT"'' LS-35 fluorometer (Jefferson et al., 1987). Protein concentration of tissue homogenates were determined by the Bio-Rad'~'''' protein assay (Bradford, 1976).
Example 2. Transient expression of enhanced LuxR.
The transient expression experiments were carried out as described above.
The same reporter plasmid was used but different effector constructs were produced.
In order to address whether the presence of a strong activator such as VP 16 would enhance transcriptional efficacy of the receptor, it was introduced in both the N- and C- terminal ends of LuxR. The VP 16 was also fused to the nuclear localisation signal {NLS) from SV40. Both the NLS of SV40 and VP16 were obtained from the yeast two hybrid plasmid pPC86 as a fused fragment which meant that it could be fused as one on to LuxR. The N-terminal fusion was constructed by isolating and introducing into pBluescript a CIaIlNotI fragment of pPC86 containing the SV40 NLS and Gal4 activation domain. The resulting pBluescriptSV40V was digested with HindIII
and filled in followed by BgIII digestion. The fragment was introduced into SmaIlBamHI
pDH~ lluxR vector (BamHI and BgIII enzymes produce compatible ends) to produce the N-terminal fusion in LuxR and yield plasmid pDH5INVLuxR {Figure 10). The methionine start site is provided by the SV40 fragment.
The C-terminal end fusion was carried out by placing at the RcaI site in LuxR
the blunted fragment of NLS/VP 16. pDH51 LuxR was digested with RcaI, blunt ended and ligated to the CIaIlNotI SV40-Gal4 blunt ended fragment. The fusion resulted in plasmid pDHS 1 LuxRNV which contains four linking amino acids, C A
K
L, between the end of LuxR and the start of the nuclear locating sequence.
The plasmids were tested in tobacco mesophyll protoplasts as described in Example l, where p221.91ux6 was introduced with or without either of the expression vectors containing the enhanced luxR. GUS assays were carried out as described above.

Cxamplc 3. Transient expression of LuxR, LasR and TraR in monocot protoplasts.
Expression plasmid construction.
The vector of choice for expression in monocot transient system was pFun which contains ubiquitin promoter region and the Nos terminator. In between the two there is multiple unique cloning sites. LuxR was transferred into pFun as a BamHI
fragment. pLasR was transferred as a BamHI/KpnI fragment. TraR was isolated from Agrobacterium tumefaciens by PCR using oligonucleotides TraRl 5' AATTGGTACCCACCATGCAGCACTGGCTGGACAAGTTGACC 3'(Sequence ID. 11) and TraR2 5' AATTGGATCCCAGATCAGCTTTCTTCTGCTTGGCGAGG
3' (Sequence ID 12). The purified fragment was restriction enzyme digested with BamHI and introduced into pFun BamHI vector. On each case the expression vectors were named as follows: pFunLuxR (Figure 13), pFunLasR (Figure 14) and pFunTra (Figure 15).
Reporter plasmid construction Reporter plasmid used with the expression vector encoding for LuxR is the same as that used in the transient experiments carried out in Tobacco (Examples 1 and 2). In the case of reporter vectors for both the expression of LasR and TraR
the parental plasmid p221.9 was used. In both cases oligonucleotides encoding the LasBox and the two TraBoxes were synthetically made. The LasBox oligonucleotides are as follows LasBoxl 5' TCGACACCTGCGAGTTCTCCGAGGTG 3' (Sequence ID 13) and LasBox2 is 5' TCGACACCTCGGAGAACTCGCAGG TG 3' (Sequence ID 14). The TraBoxes as described by Zhu and Winans, (1999} were used and the oligos are as follows, TraBoxl 5 ' TCGACTACACGTCTAGACGTGTAGG 3' (sequence ID 15), TraBox2 5' TCGACCTACACGTCTAGACGTGTAG 3'(Sequence ID 16) (first pair), TraBox3 5' TCGACTACACGTCTAGACGTGTAAG 3' (Sequence ID 17) and trabox4 5' TCGACTTACACGTCTAGACGTGTAG 3' (second pair) (Sequence ID 18). Equimolar amounts of each pair oligo in the pair were mixed denatured and allow to cool down slowing to form double stranded DNA
which had SaII cohesive ends. The double stranded DNA was then ligated into a SaII
digested p221.9 vector. Recombinants were screened by colony hybridisation and sequenced to ascertain number of elements incorporated into the vector. The vectors were named as follows p221.9Traboxl (Figure 16), p2219Trabox2 (Figure 17) and p221.9Lasbox (Figure 11 ).
Example 4. Stable expression of LuxR in Tobacco plants Binary vector construction The reporter cassette was isolated from p221.91ux6 by digesting with EcoRI
and HindIII to yield a 2.Okb fragment. The fragment was purified and introduced into pain 19 EcoRI/HindIII vector to produce pBinrepAHL. The three different variants of the LuxR receptor, that is LuxR and the two enhanced versions were restriction enzyme digested with EcoRI (site flanking both sides of the effector cassette) and introduced into a dephosphorylated EcoRI pBinl9repAHL vector to produce either pAHLI (LuxR) (Figure 18), pAHL2 (SVLuxR) (Figure 19) or pAHL3 (LuxRSV) (Figure 20).
Plant transformation The plant transformation construct pAHL 1 (Figure 18), pAHL2 (Figure 19) and pAHL3 (Figure 20), containing LuxR or chimeric LuxR and a reporter gene cassette, were transformed into Agrobacterium tumefaciens LBA4404 using the freeze/thaw method described by Holsters et al. ( 1978). Tobacco (Nicotiana tabacum cv Samsun) transformants were produced by the leaf disc method (Horsch et al., 1988). Shoots were regenerated on medium containing 100mg/1 kanamycin. After rooting, plantlets were transferred to the glasshouse and grown under 16 h light/ 8 h dark conditions PCR analysis Analysis of transgenic tobacco plants by PCR was carried out using leaf sample extracted in 300p,1 of extraction buffer. The DNA was precipitated with isopropanol at 4°C for 10 minutes and then centrifuged. The pellet was dried and resuspended in . 100p,1 of TE (IOmM Tris HCl pH 8.0, 1mM EDTA):~2.5 pl were placed in a 500 p.l eppendorf tube and a master mix containing buffer, dNTPs and oligonucleotides was added. The Taq polymerase (Gibco-BRL~) was added afrer samples were denatured for 3 minutes.
Chemical treatments OHHL was dissolved in methanol (Sigma) and the stock maintained at -20°C.
The compound was diluted in growth media used to germinate seedlings.
Uninduced seedlings were treated with equivalent amount of methanol. Seeds were germinated in MS media supplemented with 0.8% (w/v) agar. Seedlings were collected 2 days post-germination (two cotyledon stage).
GUS Assay In seedling induction experiments 10 two day old seedlings were collected and flash frozen in liquid nitrogen. The seedlings were homogenised in 300 p,l of GUS
extraction buffer and centrifuged for 5 minutes at 13000rpm. The supernatant was used for both GUS and Bio-Rad~'~"' protein assays.
Example 5 Stable constitutive expression of yenl gene in tobacco plants Binary vector construction.
pBDHELI (Figure 21) was constructed by fusing the alfalfa mosaic virus (AMV) translation enhancer sequence from pBi526 (Dada et al., Plant Science 94, 139-140 (1993)) to the yenl coding sequence from Yersinia enterocolitica. AMV-Luxl gene fusion was directional cloned into pDHS 1 (Pietrzak et al.,1986) vector to produce pDHELI. A l.8kb fragment of pDHELI was cloned into pBinl9 {Bevan, 1994) to give pBDHELI (Figure 21). The plasmid was introduced into Agrobacterium as described above. A tobacco plant population of was produce and screened as detailed above. A high expressor of yenl gene was selected by their ability to synthesised OHHL. The assay consists of placing a leaf of the transgenic plant on an agar plate overnight. The leaf was then removed and the cvil mutant of C>zromobacterium violaceum spread over the plate. Violacein (a purple pigment) production by the bacterium can be seen when OHHL had diffused out of the leaf and into the agar (Figure 24).

Example 6. LuxR is activated by compounds produced by yenl plants.
The root of a transgenic tobacco plant containing the yenl expression cassette, that was grown in tissue culture under aseptic conditions, was placed on an LB
agar plate and overlain with top agar containing E. coli with the plasmid pSB401 (Figure 22). This strain expresses the lux operon (i.e. IuxR, lux ABCDE) and will bioluminesce in response to OHHL and HHL. Figure 24 shows that acyl-homoserine lactones produced by yenl introduction into tobacco plants are capable of activating LuxR harboured in E.coli and activate reporter gene expression. These data suggest that introduction of LuxR expression and reporter cassettes into plants harbouring the yenl gene will result in activation of reporter gene expression.
Example 7. Cross of LuxR tobacco high expressor plant with yenl tobacco plant.
Plants are produced by crossing the yenl expressing plant with the AHL switch plants. The seed of the progeny was collected and assayed for GUS activity as described above. GUS activity was assayed for in all tissues and different ages as the expectation was that GUS protein would be present in all tissues expressing the yenl gene. yenl is under control of the 35S CaMV promoter as is the LuxR protein in the AHL switch. Initially, progeny seedlings were grown in 1/2MS and were collected 2 days post-germination or when cotyledons were fully extended.
Other modifications of the present invention will be apparent to those skilled in the art without departing from the scope of the invention.

References Aarts et al., Nature, 363:715-717 Albani D., Robert L.S., Donaldson P.A., Altosaar L, Arnison P.G., Fabijanski S.F.
(1990) Plant Mol. Biol. 15:605-622 Bassler, B.L., Wright, M. and Silverman, M.R. ( 1994) Molecular Microbiology 12, 403-412.
Bevan, M (1984).Nucl. Acids Res. 12, 8711-8721.
Bradford, M.M. (1976). 72, 248-254.
Beck von Bodman, S and Farrand, S.K. (1995) Journal of Bacteriology 177, 5000-5008.
Budelier, K.A., Smith, A.G., and Gasser, C.S. (1990). Mol. Gen. Genet 224, 183-I92.
Christou, P. Plant Mol Biol 35: 197-203 (1997) De Block, M., Debrouwer, T., Moens, T. (1997). Theor Appl Genet. 95, 125-131.
Devine , J.H., Countryman, C and Baldwin, T.O. (1988) Biochemistry 27, 837-842.
Ficker, M., Wemmer, T., and Thompson, R.D (1997). Plant Mol Biol 35, 425-431 Fuqua, W.C. and Winans , S.C. (1994) Journal of Bacteriology I76, 2796-2806.
Fuqua, W.C., Winans , S.C. and Greenberg, E.P. (1994) Journal of Bacteriology 176, 269-275.
Gilson, L., Kuo, A and Dunlap, P.V. (1995) Journal of Bacteriology 177, 6946-6951.
Goldman, M.H., Goldberg, R.B., Mariane, C. (1994). EMBO J 13: 2976-2984.
Gray, K.M. et al., (1996) Journal of Bacteriology 178, 372-376.
Hamilton, D.A., Bashe, D.M., Stinson, J.R., Mascarenhas, J.P. (1989). Sex Plant R, e~~rod 2, 208-212.
Hanson, D.H., Hamilton, D.A., Travis, J.L., Bashe, D.M., Mascarenhas, J.P.
(12989).
The Plant Cell 1, 173-179 Hasselhof. J and Gerlach W.L, 1988) Nature Vol 334: 585-591.
Hird, D.L., Worrall, D., Hodge, R., Smartt, S., Paul, W and Scott, R (1993).
The Plant Journal 4(6), 1023-1033.
Hwang, L, Cook, D.M. and Farrad, S.K. (1995) J.Biotechnology 177, 449-458.
Izawa T, Ohnishi T, Toshitsugu N, Ishida N, Hiroyuki E, Hashimoto H, Itoh K, Terada R, Wu C, Miyazaki C, Endo T, Iida S and Shimaamoto K (1997 Plant Mol Biol 35: 219-229 Jefferson, R.A., Kavanagh, T.A. and Bevan, M. W. (1987) EMBO J. 6, 3901-3907.
Jepson, I, Lay, V., Holt, D.C., Bright, W.J., and Greenland, A.J.,(1994)..
Plant Molecular Biology 26: 1855-1866.
Kamalay, J.C., and Goldberg, R.B. (1980). Cell 19, 935-946 Kang H.G., Noh Y.S., Chung Y.Y., Costa M.A., An K., An G. (199 Plant Mol.
Biol.
29:1-10 Kempin , S.A., Liljigren, S.J., Block, L.M., Rounsley, S.D., and Yanofsky, M.F.
(1997).. Nature Vol 389 Kilian A, Chen J, Han F, Steffenson B and Kleinhofs A (1997 Plant Mol Biol 35:
187-195.
Koes R.E:, Spelt C.E., van Den Elzen P.J.M., Mol J.N.M.. (1989. Gene 81:245-Latifi, A, et al (1995) Molecular Microbiology 17, 333-343.
Lotan,T., Ori, N., and Fluhr, R. (1989). Plant Cell 1, 881-887 Mariani, C., Gossele, V., De Beuckeleer, M., De Block, M., Goldberg, R.B., De Greef, W. and Leemans, J. (1992). Nature Vol 357, 384-387.
McGowan, S et al (1995) Microbiology 141, 541-550.
Meighen, E.A. (1994) Annual Reviews of Genetics 28, 117-139.
Milton, D.L., Hardman, A., Camara, M., Cdhabra, S-R., Bycroft, B.W., Steward, G.S.A.B. and William, P (1997) Journal of Bacteriology 179, 3004-3012.
Moore G, Devos K.M, Wang Z, and Gale M.D. (1995) Current Biol 5: 737-739 Nadeau, J .A., Zhang, X.S., Li, J and O'Neill, S.D. (1996 The Plant Cell 8, Nasrallah, J.B., and Nasrallah, M.E. (1993)Plant Cell 5., 1325-1335.
Negrutiu, L, Shillito, R., Potrykus, L, Biasini, G., Sala, F. (1987) Plant Molecular Biology, 8, 363-373.
Nelson, O.E., and Clary, G.B. (1952) J Hered. 43, 205-210 Ochsner, U.A. and Reiser, J. (1995) Proc. Natl. Acad. Sci. USA 92, 6424-6428.
Ori, N., Sessa, G., Lotan, T., Himmelhoch, S., and Fluhr, R. (1990). EMBO J 9, 3436.
Pesci, E.C., Pearson, J.P., Seed, P.C. and Iglewski, B.H. (1997) Journal of Bacteriology 179, 3127-3132.
Pieterzak, M. et al., (1986) Nucl. Acids Res. 14, 5857-5868 Robinson-Beers, KK., Pruitt, R. E., and Gasser, C. S. (1992). Plant Cell 4, WO 00/09704 - 27 - PC'T/GB99/02653 Seurinck J., Truettner J., Goldberg R.B. (1990). Nucleic Acids Res. 18:3403-Sitnokov, D.M., Schineller, J.B. and Baldwin, T.O. (1995) Molecular Microbiology 17, 801-812.
Spena, A., Estruch, J.J., Prensen, E., Nacken, W., Van Onckelen, H., Sommer, H.
(1992). Theor Appl Genet 84, 520-527 Swift, S. et al (1993) Molecular Microbiology 10- 511-520.
Swift, S., Karlyshev, A.V., Fish, L., Durant, E.L., Winson, M.K., Chhadra, S-R., Williams, P, Macintyre, S. and Steward, G.S.A.B. (1997) Journal of Bacteriology 179, 5271-5281.
Theissen G., Strater T., Fischer A., Saedler H. (1995). Gene 156:155-166 Throup J.P et al., (1995) Molecular Microbiology 17, 345-356.
Tsuchiya T., Toriyama K., Ejiri S., Hinata K. (1994). Plant Mol. Biol. 26:1737-Tsuchiya, T., Toriyama, K., Yoshikawa, M., Ejiri, S., Hinata, K., (1995).
Plant Cell P~36, 487-494.
Twell, D., Wing, R.A., Yamaguchi, J., McCormick, S. (1989) MoI Gen Genet 217, 240-245.
Twell, D., Yamaguchi, J., McCormick, S. (1990) Development 109, 705-713.
Weeks JT et al. (1993) 102:1077-1084 Williams, P. in Pseudomonas - Molecular Biology and Biotechnology (Nakazawa, T., Furukawa, K., Haas, D. and Silver, S, eds), ASM press.
Winson, M.K., et al (1994) in Proceedings of the 94'" annual meeting of the American Society for Microbiology (May, 1994, Las Vegas, USU) Abstract H-71 p 212.
Winson, M.K., et al (1995) Proc. Natl. Acad. Sci. USA 92, 9427-9431.
Wood, D.W. and Pierson, L.S. (1996) Gene 168, 49-53.
Wright,S.Y., Suner,M-M., BelI,P,J., Vaudin,M., and Greenland,A.J (1993) The Plant Journal 3, 41-49.
Xu, H., Davis, S.P., Kwan, B.Y.H., 0'Bries, A.P., Singh, M., Knox, R.P. (1993) Mol Gen Genet 239, 58-65.
Yokoi, S., Tsuchiya, T., Toriyama, K., Hinata, K (1997). Plant Cell Reports 16, 363-367.
Zhu, Jun and Winans, S.C. (1999) PNAS 96, p4832-4837 WO 00/09704 - 2g - PCT/GB99/02653 Zou. J.T., Zhan.X.Y., WU, H.M., Wang, H., Cheung, A.Y. (1994) Am J Bot 81, 552-561.

SEQUENCE LISTING
<110> ZENECA LIMITED
<120> GENE SWITCH
<130> PPD 50369 GENE SWITCH
<190>
<141>
<150> GB9817704.1 <151> 1998-08-13 <160> 24 <170> PatentIn Ver. 2.0 <210> 1 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Lux Box Promoter Region <400> 1 gatcacctgt acgatcgtac aggt 24 <210> 2 <211> 245 <212> DNA
<213> Photobacterium fischeri <400> 2 ggatccagaa ttcgtgattc cactgcagtg atcatctctt tatccttacc tattgtttgt 60 cgcaattttg cgtgttatat atcattaaaa cggtaatgga ttgacatttg attctaataa 120 attggatttt tgtcacacta ttgtatcgct gggaatacaa ttacttaaca taagcacctg 180 taggatcgta caggtttagc gaagaaaatg gtttgttata gtcgaataaa cgcaagggag 290 gatcc 245 <210> 3 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LuxrbamHI
Fragment <400> 3 cccggatcct aacaatgggt atgaaagaca taaatg 36 <210> 4 <211> 90 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LuxRBamH2 Fragment <400> 9 cgaactcgag tcatgatttt aaagtatggg caatcaattg 90 <210> 5 <211> 781 <212> DNA
<213> Photobacterium fischeri <220>
<221> CDS
<222> (12)..(770) <400> 5 ggatcctaac a atg ggt atg aaa gac ata aat gcc gac gac act tac aga 50 Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg ata att aat aaa att aaa get tgt aga agc aat aat gat att aat caa 98 Ile Ile Asn Lys ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln tgc tta tct gat atg act aaa atg gta cat tgt gaa tat tat tta ctc 146 Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu gcg atc att tat cct cat tcc atg gtt aaa tct gat att tca att cta 199 Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu gat aat tac cct aaa aaa tgg agg caa tat tat gat gac get aat tta 242 Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu ata aaa tat gat cct ata gta gat tat tct aac tcc aat cat tca cca 290 Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro att aat tgg aat ata ttt gaa aac aat get gta aat aaa aaa tct cca 338 Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro aat gta att aaa gaa gcg aaa tca tca ggt ctt atc act ggg ttt agt 386 Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser ttc cct att cat act get aat aat ggc ttc gga atg ctt agt ttt gca 434 Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala cat tca gag aaa gac aac tat ata gat agt tta ttt tta cat gca tgt 482 His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys atg aac ata cca tta att gtt cct tct cta gtt gat aat tat cga aaa 530 Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys ata aat ata gca aat aat aaa tca aac aac gat tta acc aaa aga gaa 578 Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu aaagaatgtttagcg tgggcatgcgaa ggaaagagctcttgg gatatt 626 LysGluCysLeuAla TrpAlaCysGlu GlyLysSerSerTrp.AspIle tcaaaaatattaggc tgcagtaagcgt acggtcactttccat ttaacc 679 SerLysIleLeuGly CysSerLysArg ThrValThrPheHis LeuThr aatgcgcaaatgaaa ctcaatacaaca aaccgctgccaaagt atttct 722 AsnAlaGlnMetLys LeuAsnThrThr AsnArgCysGlnSer IleSer aaagcaattttaaca ggagcaattgat tgcccatactttaaa tcatga 770 LysAlaIleLeuThr GlyAlaIleAsp CysProTyrPheLys Ser ctcgactgca g 781 <210> 6 <211> 252 <212> PRT
<213> Photobacterium fischeri <400> 6 Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser <210> 7 <211> 1190 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:NVLuxR Fusion <220>
<221> CDS
<222> (16)..(999) <400> 7 ggtacccagc ttatg ccc aag aag aag cgg aag gtc tcg agc ggc gcc aat 51 Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn ttt aat caa agt ggg aat att get gat agc tca ttg tcc ttc act ttc 99 Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe act aac agt agc aac ggt ccg aac ctc ata aca act caa aca aat tct 147 Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser caa gcg ctt tca caa cca att gcc tcc tct aac gtt cat gat aac ttc 195 Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe atg aat aat gaa atc acg get agt aaa att gat gat ggt aat aat tca 243 Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser aaa cca ctg tca cct ggt tgg acg gac caa act gcg tat aac gcg ttt 291 Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe gga atc act aca ggg atg ttt aat acc act aca atg gat gat gta tat 339 Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr aac tat cta ttc gat gat gaa gat acc cca cca aac cca aaa aaa gag 387 Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu ggt ggg tcg acc ccg gga att cag atc cta aca atg ggt atg aaa gac 935 Gly Gly Ser Thr Pro Gly Ile Gln Ile Leu Thr Met Gly Met Lys Asp ata aat gcc gac gac act tac aga ata att aat aaa att aaa get tgt 483 Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys aga agc aat aat gat att aat caa tgc tta tct gat atg act aaa atg 531 Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met gta cat tgt gaa tat tat tta ctc gcg atc att tat cct cat tcc atg 579 Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met gtt aaa tct gat att tca att cta gat aat tac cct aaa aaa tgg agg 627 Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg caa tat tat gat gac get aat tta ata aaa tat gat cct ata gta gat 675 Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp tat tct aac tcc aat cat tca cca att aat tgg aat ata ttt gaa aac 723 Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn aat get gta aat aaa aaa tct cca aat. gta att aaa gaa gcg aaa tca 771 Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser tca ggt ctt atc act ggg ttt agt ttc cct att cat act get aat aat 819 Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn ggc ttc gga atg ctt agt ttt gca cat tca gag aaa gac aac tat ata 867 Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile gat agt tta ttt tta cat gca tgt atg aac ata cca tta att gtt cct 915 Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu Ile Val Pro tct cta gtt gat aat tat cga aaa ata aat ata gca aat aat aaa tca 963 Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser aac aac gat tta acc aaa aga gaa aaa gaa tgt tta gcgtgggcat 1009 Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu gcgaaggaaa gagctcttgg gatatttcaa aaatattagg ctgcagtaag cgtacggtca 1069 ctttccattt aaccaatgcg caaatgaaac tcaatacaac aaaccgctgc caaagtattt 1129 ctaaagcaat tttaacagga gcaattgatt gcccatactt taaatcatga ctcgactgca 1189 g 1190 <210> 8 <211> 328 <212> PRT
<213> Artificial Sequence <400> 8 Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu Gly Gly Ser Thr Pro Gly Ile Gln Ile Leu Thr Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu <210> 9 <211> 1206 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LuxRNV Sequence <220>
<221> CDS
<222> (12)..(1187) <400> 9 ggatcctaac a atg ggt atg aaa gac ata aat gcc gac gac act tac aga 50 Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg ata att aat aaa att aaa get tgt aga agc aat aat gat att aat caa 98 Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln tgc tta tct gat atg act aaa atg gta cat tgt gaa tat tat tta ctc 146 Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu gcg atc att tat cct cat tcc atg gtt aaa tct gat att tca att cta 194 Ala Ile Ile Tyr Pro His Ser. Met Val Lys Ser Asp Ile Ser Ile Leu gat aat tac cct aaa aaa tgg agg caa, tat tat gat gac get aat tta 242 Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu ata aaa tat gat cct ata gta gat tat tct aac tcc aat cat tca cca 290 Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro att aat tgg aat ata ttt gaa aac aat get gta aat aaa aaa tct cca 338 Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro aat gta att aaa gaa gcg aaa tca tca ggt ctt atc act ggg ttt agt 386 Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser ttc cct att cat act get aat aat ggc ttc gga atg ctt agt ttt gca 434 Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala cat tca gag aaa gac aac tat ata gat agt tta ttt tta cat gca tgt 482 His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys atg aac ata cca tta att gtt cct tct cta gtt gat aat tat cga aaa 530 Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys ata aat ata gca aat aat aaa tca aac aac gat tta acc aaa aga gaa 578 Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu aaa gaa tgt tta gcg tgg gca tgc gaa gga aag agc tct tgg gat att 626 Lys Glu Cys Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile tca aaa ata tta ggc tgc agt aag cgt acg gtc act ttc cat tta acc 679 Ser Lys Ile Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr aat gcg caa atg aaa ctc aat aca aca aac cgc tgc caa agt att tct 722 Asn Ala Gln Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser aaa gca att tta aca gga gca att gat tgc cca tac ttt aaa agt atc 770 Lys Ala Iie Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser Ile gat aag ctt atg ccc aag aag aag cgg aag gtc tcg agc ggc gcc aat 818 Asp Lys Leu Met Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn ttt aat caa agt ggg aat att get gat agc tca ttg tcc ttc act ttc 866 Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe act aac agt agc aac ggt ccg aac ctc ata aca act caa aca aat tct 914 Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser caa gcg ctt tca caa cca att gcc tcc tct aac gtt cat gat aac ttc 962 Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe atg aat aat gaa atc acg get agt aaa att gat gat ggt aat aat tca 1010 Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser aaa cca ctg tca cct ggt tgg acg gac caa act gcg tat aac gcg ttt 1058 Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe gga atc act aca ggg atg ttt aat acc act aca atg gat gat gta tat 1106 Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr aac tat cta ttc gat gat gaa gat acc cca cca aac cca aaa aaa gag 1154 Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu ggt ggg tcg acc ccg gga att cag atc tac tag tgcggccgct cgactgcag 1206 Gly Gly Ser Thr Pro Gly Ile Gln Ile Tyr <210> 10 ' <211> 391 <212> PRT
<213> Artificial Sequence <400> 10 Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Ser Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile Leu Gly Cys Ser Lys Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Ser Ile Asp Lys Leu Met Pro Lys Lys Lys Arg Lys Val Ser Ser Gly Ala Asn Phe Asn Gln Ser Gly Asn Ile Ala Asp Ser Ser Leu Ser Phe Thr Phe Thr Asn Ser Ser Asn Gly Pro Asn Leu Ile Thr Thr Gln Thr Asn Ser Gln Ala Leu Ser Gln Pro Ile Ala Ser Ser Asn Val His Asp Asn Phe Met Asn Asn Glu Ile Thr Ala Ser Lys Ile Asp Asp Gly Asn Asn Ser Lys Pro Leu Ser Pro Gly Trp Thr Asp Gln Thr Ala Tyr Asn Ala Phe Gly Ile Thr Thr Gly Met Phe Asn Thr Thr Thr Met Asp Asp Val Tyr Asn Tyr Leu Phe Asp Asp Glu Asp Thr Pro Pro Asn Pro Lys Lys Glu Gly Gly Ser Thr Pro Gly Ile Gln Ile Tyr <210> 11 <211> 91 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:TraRl Fragment <400> 11 aattggtacc caccatgcag cactggctgg acaagttgac c 41 <210> 12 <211> 38 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:TraR2 Fragment <400> 12 aattggatcc cagatcagct ttcttctgct tggcgagg 38 <210> 13 <211> 26 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LasBoxl Fragment <400> 13 tcgacacctg cgagttctcc gaggtg 26 <210> 19 <211> 26 <212> RNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LasBox2 Fragment <900> 14 tcgacacctc ggagaactcg caggtg 26 <210> 15 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:TraBoxl Fragment <900> 15 tcgactacac gtctagacgt gtagg 25 <210> 16 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:TraBox2 Fragment <900> 16 tcgacctaca cgtctagacg tgtag 25 .
<210> 17 <211> 25 <212> DNA
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence:TraBox3 Fragment <400> 17 tcgactacac gtctagacgt gtaag 25 <210> 18 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:TraBox9 Fragment <900> 18 tcgacttaca cgtctagacg tgtag 25 <210> 19 <211> 250 <212> PRT
<213> Photobacterium fischeri <400> 19 Met Lys Asn Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile Lys Glu Ala Lys Thr Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile Leu Gly Cys Ser Glu Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Asn <210> 20 <211> 239 <212> PRT
<213> Pseudomonas aeruginosa <400> 20 Met Ala Leu Val Asp Gly Phe Leu Glu Leu Glu Arg Ser Ser Gly Lys Leu Glu Trp Ser Ala Ile Leu Gln Lys Met Ala Ser Asp Leu Gly Phe Ser Lys Ile Leu Phe Gly Leu Leu Pro Lys Asp Ser Gln Asp Tyr Glu Asn Ala Phe Ile Val Gly Asn Tyr Pro Ala Ala Trp Arg Glu His Tyr Asp Arg Ala Gly Tyr Ala Arg Val Asp Pro Thr Val Ser His Cys Thr Gln Ser Val Leu Pro Ile Phe Trp Glu Pro Ser Ile Tyr Gln Thr Arg Lys Gln His Glu Phe Phe Glu Glu Ala Ser Ala Ala Gly Leu Val Tyr Gly Leu Thr Met Pro Leu His Gly Ala Arg Gly Glu Leu Gly Ala Leu Ser Leu Ser Val Glu Ala Glu Asn Arg Ala Glu Ala Asn Arg Phe Met Glu Ser Val Leu Pro Thr Leu Trp Met Leu Lys Asp Tyr Ala Leu Gln Ser Gly Ala Gly Leu Ala Phe Glu His Pro Val Ser Lys Pro Val Val Leu Thr Ser Arg Glu Lys Glu Val Leu Gln Trp Cys Ala Ile Gly Lys Thr Ser Trp Glu Ile Ser Val Ile Cys Asn Cys Ser Glu Ala Asn Val Asn Phe His Met Gly Asn Ile Arg Arg Lys Phe Gly Val Thr Ser Arg Arg Val Ala Ala Ile Met Ala Val Asn Leu Gly Leu Ile Thr Leu <210> 21 <211> 234 <212> PRT
<213> Agrobacterium tumefaciens <400> 21 Met Gln His Trp Leu Asp Lys Leu Thr Asp Leu Ala Ala Ile Gln Gly Asp Glu Cys Ile Leu Lys Asp Gly Leu Ala Asp Leu Ala Glu His Phe Gly Phe Thr Gly Tyr Ala Tyr Leu His Ile Gln His Lys His Thr Ile Ala Val Thr Asn Tyr His Arg Asp Trp Arg Ser Ala Tyr Phe Glu Asn Asn Phe Asp Lys Leu Asp Pro Val Val Lys Arg Ala Lys Ser Arg Lys His Val Phe Ala Trp Ser Gly Glu Gln Glu Arg Ser Arg Leu Ser Lys Glu Glu Arg Ala Phe Tyr Ala His Ala Ala Asp Phe Gly Ile Arg Ser Gly Ile Thr Ile Pro Ile Lys Thr Ala Asn Gly Ser Met Ser Met Phe Thr Leu Ala Ser Glu Arg Pro Ala Ile Asp Leu Asp Arg Glu Ile Asp Ala Ala Ala Ala Ala Gly Ala Val Gly Gln Leu His Ala Arg Ile Ser Phe Leu Gln Thr Thr Pro Thr Val Glu Asp Ala Ala Trp Leu Asp Pro Lys Glu Ala Thr Tyr Leu Arg Trp Ile Ala Val Gly Met Thr Met Glu Glu Val Ala Asp Val Glu Gly Val Lys Tyr Asn Ser Val Arg Val Lys Leu Arg Glu Ala Met Lys Arg Phe Asp Val Arg Ser Lys Ala His Leu Thr Ala Leu Ala Ile Arg Arg Lys Leu Ile <210> 22 <211> 720 <212> DNA
<213> Pseudomonas aeruginosa <400> 22 atggccttgg ttgacggttt tcttgagctg gaacgctcaa gtggaaaatt ggagtggagc 60 gccatcctgc agaagatggc gagcgacctt ggattctcga agatcctgtt cggcctgttg 120 cctaaggaca gccaggacta cgagaacgcc ttcatcgtcg gcaactaccc ggccgcctgg 180 cgcgagcatt acgaccgggc tggctacgcg cgggtcgacc cgacggtcag tcactgtacc 240 cagagcgtac tgccgatttt ctgggaaccg tccatctacc agacgcgaaa gcagcacgag 300 ttcttcgagg aagcctcggc cgccggcctg gtgtatgggc tgaccatgcc gctgcatggt 360 gctcgcggcg aactcggcgc gctgagcctc agcgtggaag cggaaaaccg ggccgaggcc 420 aaccgtttca tggagtcggt~cctgccgacc ctgtggatgc tcaaggacta cgcactgcag 480 agcggtgccg gactggcctt cgaacatccg gtcagcaaac cggtggttct gaccagccgg 540 gagaaggaag tgttgcagtg gtgcgccatc ggcaagacca gttgggagat atcggttatc 600 tgcaactgct cggaagccaa tgtgaacttc catatgggaa atattcggcg gaagttcggt 660 gtgacctccc gccgcgtagc ggccattatg gccgttaatt tgggtcttat tactctctga 720 <210> 23 <211> 705 <212> DNA
<213> Agrobacterium tumefaciens <900> 23 atgcagcact ggctggacaa gttgaccgat cttgccgcaa ttcagggcga cgagtgcatc 60 ctgaaggatg gccttgccga ccttgccgaa catttcggct tcaccggcta tgcctatctc 120 catatccagc acaaacacac catcgcggtc accaattatc atcgtgactg gcgatcggct 180 tacttcgaga acaacttcga caagctcgat ccggtcgtca agcgcgcgaa atccaggaag 240 cacgtctttg cctggtccgg cgaacaggaa cgatcgcggc tatcgaagga agagcgtgcc 300 ttctacgcgc atgcggccga tttcggcatc cgctccggca tcaccattcc gatcaagacc 360 gccaacggat caatgtcgat gttcacgctg gcgtcggaaa ggccggcgat cgacctcgac 920 cgtgagatcg acgcggccgc agccgcgggc gccgtcgggc agctccatgc ccgcatctct 480 ttccttcaga ccactccgac agtggaagat gccgcctggc tcgatccgaa agaggcgacc 540 tatctcagat ggatcgccgt cggcatgaca atggaggaag tcgcagacgt ggagggcgtc 600 aagtacaaca gcgtccgtgt caagctccgc gaggccatga agcgcttcga cgttcgcagc 660 aaggcccatc tcaccgccct cgcaatcaga agaaagctga tctga 705 <210> 24 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:LuxI Box Promoter Region <400> 24 cacctgtagg atcgtacagg t 21

Claims (32)

1. A method of controlling expression of a target gene in a eukaryote, comprising integrating, preferably stably integrating, within the genome of the eukaryote an expression system comprising a first polynucleotide comprising the target gene operably linked to and under the control of a promoter comprising an N aryl-homoserine lactone inducible promoter, wherein the eukaryotic cell is capable of producing a response regulator protein and whereby expression of the target gene depends upon the presence of both N-acyl-homoserine lactone and the response regulator protein.

2. A method according to claim 1 wherein the expression system further comprises a second polynucleotide which comprises a DNA sequence encoding a response regulator protein.

3. A method according to claim 1 or claim 2 wherein expression of the target gene is controllable by application of exogenous N-acyl-homoserine lactone.

4. A method according to claim 1 or claim 2 wherein the expression system further comprises a third polynucleotide which comprises a DNA sequence encoding a protein involved in the biosynthesis of N-acyl-homoserine lactone.

5. A method according to claim 4 wherein the sequence encoding a protein involved in the biosynthesis of N acyl-homoserine lactone is Lux I or yen I.

6. A method according to any one of the preceding claims 2 to 5 wherein the DNA sequence encoding the response regulator protein is Lux R.

7. A method according to any one of the preceding claims wherein the N-acyl-homoserine lactone promoter comprises the polynucleotide sequence shown in SEQ. ID.No. 2 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

8. A method according to any one of the preceding claims wherein the N-acyl-homoserine lactone promoter comprises the polynucleotide sequence shown in SEQ. ID.No.1 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

9. A method according to any one of claims 2 to 8 wherein the amino acid sequence encoding a response regulator protein is SEQ. ID. No. 19 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

10. A method according to any one of claims 2 to 8 wherein the ammo acid sequence encoding a response regulator protein is SEQ.ID. No. 10 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

11. A method according to any one of claims 2 to 8 wherein the amino acid sequence encoding a response regulator protein is SEQ. ID. No. 8 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

12. A method according to any one of claims 7 to 11 wherein the N-acyl-homoserine lactone is N-(3-oxo)hexanoyl-L-homoserine lactone.

13. A method according to any one of claims 1 to 6 wherein the N-acyl-homoserine lactose promoter comprises the polynucleotide sequence shown in SEQ. ID.No. 13 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

14. A method according to any one of claims 2 to 6 wherein the amino acid sequence encoding a response regulator protein is SEQ. ID. No. 20 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

15. A method according to claim 13 or claim 14 wherein the N-acyl-homoserine lactone is N-(3-oxo)dodecanoyl-L-homoserine lactone.

16. A method according to any one of claims 1 to 6 wherein the N-acyl-homoserine lactone promoter comprises the polynucleotide sequence shown in SEQ. ID.No. 15 or the polynucleotide sequence shown in SEQ. ID. No.17 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

17. A method according to any one of claims 2 to 6 wherein the amino acid sequence encoding a response regulator protein is SEQ. ID. No. 21 or at least part of a sequence having substantial identity therewith or a variant or fragment thereof.

18. A method according to claim 16 or claim 17 wherein the N-acyl-homoserine lac2one is N (3-oxo)octanoyl-L-homoserine lactone,

19. A method according to any one of the preceding claims wherein the first polynucleotide further comprises a 5' region which is regulatable by the response regulator protein, the polynucleotide optionally also comprising a 3' terminal region.

20. A method according to any one of claims 2 to 19 wherein the second polynucleotide further comprises a 5' promoter region operably linked to and under the control of the DNA sequence encoding the response regulator protein, the polynucleotide optionally also comprising a 3' terminal region.

21. A method according to any one of claims 4 to 20 wherein the sequence encoding a protein involved in the biosynthesis of N-acyl-homoserine lactone is under the control of a constitutive. inducible, tissue-specific or developmental promoter.

22. A method according to any one of the preceding claims wherein the eukaryote is a plant, preferably a transgenic plant, a mammal or yeast.

23. A polynucleotide comprising a DNA sequence comprising a target gene operably linked to and under the control of an inducible promoter sequence and an operator sequence which is responsive to exposure to an inducer compound, wherein the inducer compound is N-acyl-homoserine lactone and wherein the polynucleotide further comprises a DNA sequence encoding a response regulator protein.

24. A polynucleotide according to claim 23 wherein the polynucleotide further comprises a DNA sequence encoding a protein involved in the biosynthesis of N-acyl-homoserine lactone.

25. A polynucleotide having two or more regions each expressing a protein, each region being operably linked to and under the control of separate inducible promoter regions wherein one of the inducible promoter regions is controllable by application of an exogenous N-acyl-homoserine lactone.

26. A polynucleotide according to claim 24 or claim 25 wherein the regions expressing a protein are controlled by different inducible promoter regions.

27. Plant tissue transformed with the polynucleotide of any one of claims 23 to 26 and material derived from the transformed tissue.

28. Morphologically normal fertile whole plants comprising the tissue or material of the preceding claim.

29. Progeny of plants of the preceding claim, which progeny comprises the polynucleotide of any one of claims 23 to 26. stably incorporated into its genome, the seeds of such plants and such progeny.

30. The use of a polynucleotide according to any one of claims 23 to 26 in the inducible expression of a target gene wherein the protein encoding regions are expressed in a eukaryote.

31. A method of screening compounds for bioactivity comprising monitoring the activity of a reporter gene driven by a N-acyl-homoserine lactone regulator promoter in response to exposure to the compounds in transgenic plants in the presence of a response regulator protein which foams an inducing complex with the compound being screened.

32. A method or polynucleotide substantially as hereinbefore described with reference to the Figures.