JP2002522079A - Gene switch - Google Patents

Abstract

(57) Abstract The present invention specifically relates to a method of initiating transcription of a target gene in a eukaryotic cell, comprising the steps of: (a) providing a eukaryotic cell capable of producing a response protein; And (b) inserting into the genome of the cell a polynucleotide operably linked and defining an inducible promoter sequence that, when induced, is capable of initiating transcription of the target gene; and (c). Providing a chemical inducer capable of binding to the response protein to the cell, whereby the chemical inducer binds to the response protein to form an inducible complex, which binds to and induces the inducible promoter; Thereby, transcription of the target gene is started.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention is particularly directed to inducing gene expression in eukaryotes by providing a chemical inducer to the eukaryote. Such a system is called a "gene switch".

In particular, the invention relates to a method for regulating the expression of a target gene in a plant, animal or yeast. Bacterial cells have the ability to respond to the surrounding environment. Responses to cues from different environments are essential for bacterial survival. Individual bacteria in the population can also feel the density of the population of which they are a member and the status of the local bacterial population ("quorum"). That is, individual bacteria can detect the presence of similar bacteria in the surrounding environment. Quorum susceptibility allows synchronized growth of the bacteria, and when development reaches a minimum population level, a concerted response from the population is initiated.

In the case of Photobacterium fischeri (Photobacterium fish eri), N- ( 3- oxo) hexanoyl -L- homoserine lactone or autoinducer is adjusted bioluminescence at a cell density-dependent manner. P. Two major genes in Fischer's lux operon are involved in signal generation and signal detection. Although luxI is involved in homoserine lactone biosynthesis, the mechanism by which this occurs is not clear. Acyl carrier protein adduct of S-adenosylmethionine and coenzyme A or 3-oxohexanoic acid is It has been reported to be a substrate for the luxI gene in Fischerries .

[0004] In bacteria, autoinducers regulate the expression of the luxI gene, thus creating positive autoregulation of autoinducer synthesis. LuxR (Response Modulator or Autoinducer Receptor) Proteins involved in the response to the presence of N- (3-oxohexanoyl) -L-homoserine lactone (OHHL) in Fischerries. LuxR at the C-terminus contains a DNA binding domain and a transcriptional activator. The LuxR C-terminus has shown amino acid homology to transcription activators known as binary environmentally sensitive systems such as UhpA, FixJ and NarL. LuxR is thought to interact with DNA in the palindrome as a homodimer, where the luxI operator sequence is termed the lux box. The N-terminus of the protein is called a receptor module because it has no similarity to the two-component environmentally sensitive system.

[0005] A quorum-sensitive system has also been observed in other bacteria and may be activated by different homoserine lactones. Such an example is described in Aeruginosa (aerugin osa) is PAO1, LasI instructs the synthesis of autoinducer N- (3- oxododecanoyl) -L- homoserine lactone (OdDHL), which is a positive transcriptional activator, LasR (Winson et al. , 1995). Furthermore, the same P. In Aeruginosa, PAO1, a second signaling pathway, named vsm , containing the vsmR and vsmI genes has been isolated. The vsmI gene products are N-butanoyl-L-homoserine lactone (BHL) and N-hexanoyl-L-homoserine lactone (HHL).
Is involved in the generation of These compounds are described in When BHL or HHL is given to PAN067 (a polytransgenic P. aeruginosa mutant that cannot synthesize either of these autoinducers), which is present in the supernatant after the culture of Aeruginosa, elastase, chitinase and cyanide Production was restored (Winson et al., 1995). Another evidence Vibrio Anguirarumu which suggests the presence of different homoserine inducer in one species (Vibrio ang uillarum) (Milton et al., 1997) and P. It has recently been observed in Aeruginosa (Pesci et al., 1997). Further, Table 1 shows examples of characterized systems in which different compounds are known to be inducers of different receptor molecules in different bacteria.

[0006]

[Table 1]

[0007]

[Table 2]

[0008]

[Table 3]

Accordingly, the present invention seeks in particular to provide methods and materials for inducing gene expression in eukaryotes by providing the eukaryote with a chemical inducer. According to the present invention there is provided a method of initiating transcription of a target gene in a eukaryotic cell comprising the steps of: (a) providing a eukaryotic cell capable of producing a responsive protein; (b) an inducible promoter sequence. (Operably linked to the target gene,
And inserting a polynucleotide into the genome of the cell which, when induced, can initiate transcription of the target gene); and (c) providing the cell with a chemical inducer capable of binding to the responsive protein. Whereby the chemical inducer binds to the responsive protein to form an inducible complex, which binds to and induces the inducible promoter, thereby initiating transcription of the target gene. .

[0010] The eukaryotic cell may already contain a mechanism for producing the response protein, or may use a technique well known in the art to transfer a polynucleotide provided for the production of the response protein into the cell. To provide that mechanism. An inducible promoter for use in the above method would include the nucleotide sequence set forth in SEQ ID NO: 2, and the responsive protein would include the amino acid sequence set forth in SEQ ID NO: 16. Alternatively, the inducible promoter is 0.
Functional variants such as nucleotides that are complementary to those that bind to SEQ ID NO: 2 at a temperature between 60 ° C and 65 ° C in 0.3 strength citrate buffer containing 1% SDS. 0.1% SDS at the same temperature.
Even after washing with three strength citrate buffer, the nucleotide can still serve as an inducible promoter if it binds to the inducing complex. In particular, a response protein for use in the method of the invention is encoded by a polynucleotide comprising the sequence shown in SEQ ID NO: 5. Alternatively, the polynucleotide encoding the response protein binds to SEQ ID NO: 5 in a 0.3 strength citrate buffer containing 0.1% SDS at a temperature between 60 ° C and 65 ° C. Even after washing with a 0.3 strength citrate buffer containing 0.1% SDS at the same temperature, the polynucleotide will be able to bind the chemical inducer and the inducer complex at the same temperature. It still encodes a protein that can be formed. It is particularly preferred that the polynucleotide defining the inducible promoter according to the invention comprises a region as set forth in SEQ ID NO: 21. The method of the invention is particularly applicable for initiating transcription in plant cells; more particularly, melons, mangos, soy, cotton, tobacco, sugar beet, oilseed rape, canola, flax, sunflower, potato, Tomato, alfalfa, lettuce, corn, wheat, sugar corn, rye, banana, barley, oats, turfgrass, magsa, sugar cane, peas, beans, rice, pine, poplar, apple, peach, grape, strawberry, carrot, lettuce, In cells of cabbage, onion, citrus or nut plant. In particular, the method of the present invention comprises the steps of:
It will be used to initiate transcription in a variety of tissues, including leaves, stems and reproductive tissues. The chemical inducer that will be used in the above method is N- (3-oxo) hexanoyl-L-homoserine lactone or a functional equivalent thereof, which is used to produce plant cells as part of an agriculturally acceptable formulation. Given. Alternatively, a chemical inducer may be produced in a plant by inserting a polynucleotide encoding a protein that provides for the production of the chemical inducer in the plant into the genome of the plant. The polynucleotide can be, for example, a constitutive promoter, gene switch (alcA / R, Heliothis (Heli Othis) such as ecdysone and GST-27 switch), wound-induced, under the transcriptional control of a tissue or transient promoter You may. The advantage of producing chemical inducers in plants is that there is no need to spray or externally treat plants to induce gene expression.

[0011] Additional inducible promoters, response proteins and chemical inducers that may be used in the methods of the present invention are listed in Table 1. For example, a promoter sequence or a portion thereof can be obtained from vanI gene from Vibrio Anguirarumu (Vibrio anguilla rum), response proteins encoded by vanR gene Chemicals N- (3- oxo - decanoyl) -L- It will be used with homoserine lactone (ODHL) or a functional variant thereof.

In the method referred to above, the polynucleotide encoding the response protein may be linked by a promoter and a terminator sequence, and in particular, the promoter may be an AlcA / R switch system, a GST switch system and an ecdysone. It may be inductive, such as a switch. Or, the promoter is specified in cauliflower mosaic virus 35S / 19S, may be a promoter which is constitutively as corn ubiquitin and Arabidopsis (Arabidopsis) Ubiquitin 3, or cysteine proteinases (our WO WO97 / thirty-five thousand nine hundred and eighty-three And developmentally regulated specific promoters such as those regulating gene expression required during seed formation, germination, such as malate synthase.

In the method referred to above, the target gene is, for example, β-glucuronidase;
Bacillus thuringenesis
) Toxin; may be any gene of interest, such as burnase or burster.

[0014] In another aspect of the invention, there is provided a method of providing a plant comprising an inducible target gene comprising the steps of: (a) a plant cell, wherein the cell provides for production of a response protein. Inserting therein a polynucleotide defining an inducible promoter sequence (operably linked to the target gene); and (b) regenerating the morphologically normal reproductive plant; and (C) providing a chemical inducer capable of binding to the response protein or a functional variant thereof to a population of regenerates, whereby the chemical inducer binds to the response protein to form an induction complex and induce The complex binds to and induces the inducible promoter, thereby initiating transcription of the target gene; and (d) transforming the plant expressing the target gene. To-option. The inducible promoter sequence referred to in the previous paragraph may comprise the nucleotide sequence shown as SEQ ID NO: 2 or a functional variant thereof, and the responsive protein is the amino acid sequence shown in SEQ ID NO: 16 or its function. Sex variants may be included, and the chemical inducer is N- (3-oxo) hexanoyl-L-homoserine lactone or a functional variant thereof. In particular, the inducible promoter sequence has the sequence ID
No. 10 or a functional variant thereof, the response protein may comprise the amino acid sequence set forth in SEQ ID NO: 17 or a functional variant thereof, and the chemical inducer is N- It may be (3-oxo) dodecanoyl-L-homoserine lactone or a functional variant thereof. Alternatively, the inducible promoter sequence may comprise SEQ ID NO: 12 or a functional variant thereof,
The response protein may comprise the amino acid sequence set forth in SEQ ID NO: 18 or a functional variant thereof, and the chemical inducer is N- (3-oxo) octanoyl-L-homoserine lactone or a functional derivative thereof. It may be a mutant.

The present invention also provides a plant produced according to the method of the preceding paragraph, wherein the plant comprises melon, mango, soy, cotton, tobacco, sugar beet, oilseed rape, canola,
Flax, sunflower, potato, tomato, alfalfa, lettuce, corn, wheat, sugar corn, rye, banana, barley, oats, turfgrass, magsa, sugar cane, peas, beans, rice, pine, poplar, apple, peach, grape, It may be selected from the group consisting of strawberry, carrot, lettuce, cabbage, onion, citrus or nut plant.

The method used for the transformation of the plant cells is not particularly closely related to the present invention.
Any method suitable for the plant can be used. For example, a transgenic plant has a trait
Obtained by regeneration from transformed cells. Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) Or its Ti plus
Agricultural infection, electroporation, microinjection using mid
Or plant cells and protoplasts, microprojectile transformation
Many transformation methods are known in the literature, including: All of these methods are
Is well known. The present invention also provides for the use of transformation techniques (or
May be applied to any plant.

In another embodiment of the present invention, it comprises an inducible promoter sequence (operably linked to a target gene, which, when induced, can initiate transcription of the target gene). A DNA construct is provided that includes a first polynucleotide region and a second polynucleotide region provided for the production of a response protein, wherein contacting the response protein with a chemical inducer causes the response protein to become chemically reactive. It binds to the inducer to form an inducible complex, which binds to the inducible promoter sequence and initiates transcription of the target gene. The first polynucleotide of the DNA construct may comprise the nucleotide sequence set forth in SEQ ID NO: 2 or a functional variant thereof, and the second polynucleotide region has the sequence ID number:
A polynucleotide encoding the amino acid sequence shown in No. 16 or a functional variant thereof may be included. Alternatively, the first polynucleotide may comprise the nucleotide sequence set forth in SEQ ID NO: 10 or a functional variant thereof, and the second polynucleotide region comprises the amino acid set forth in SEQ ID NO: 17 It may include a polynucleotide encoding a sequence or a functional variant thereof. Alternatively, the first polynucleotide may comprise the nucleotide sequence set forth in SEQ ID NO: 12 or a functional variant thereof, and the second polynucleotide region comprises the amino acid set forth in SEQ ID NO: 18 It may include a polynucleotide encoding a sequence or a functional variant thereof. The second polynucleotide region referred to above may include a promoter operably linked to the polynucleotide encoding the response protein. The promoter may be inducible and constitutively or developmentally regulated.

[0018] The present invention still further provides a DNA as described above in the production of a plant containing a target gene whose expression will be controlled by the application of a chemical inducer to the plant.
Provide use of the construct.

In another embodiment of the present invention, comprising a polynucleotide comprising an inducible promoter (operably linked to a region encoding a reporter protein), and producing a reporter protein. Plants that can
A method is provided for screening compounds in a biological test (bioassay), which comprises providing a quantity of a chemical and testing the plant for production of the reporter protein. Chemicals can be provided to plants, for example, to monitor activity of a reporter gene with improved activity, mobility or stability, or to inhibit the effect of a chemical on a response protein that results in a decrease in the activity of a reporter gene. Evaluate if you have.

In yet another embodiment of the present invention, the area (fi) comprising crop plants and pests
eld), there is provided a method for selectively controlling a pest, wherein the plant is obtained according to the method mentioned above, wherein the target gene encodes a target protein capable of controlling the pest. The method comprises providing a plant with a chemical inducer in an amount sufficient to bind to the response protein to form the induction complex, wherein the complex is sufficient to control the pest. Transcription of a target gene that provides for the production of a quantity of the target protein can be initiated.

In yet another aspect of the present invention, there is provided a method of providing a plant comprising an inducibly regulated target gene comprising the steps of: (a) operably linked to a target gene. Inserting a polynucleotide comprising the first inducible promoter into a first plant cell and regenerating a first morphologically normal fertile plant from them; (b) a response protein—this response The protein encodes｝, which can bind to a chemical inducer to form an inducible complex, which can subsequently bind to an inducible promoter to allow transcription of the target gene. Inserting a polynucleotide comprising a promoter operably linked to the region into a second plant cell and from them a second morphologically normal fertile plant (C) cross-pollinating said first plant with said second plant or said second plant with said first plant, and harvesting seeds therefrom; Growing and giving the resulting plant an amount of the chemical inducer that provides a complex that can bind to the inducible promoter that enables transcription initiation of the target gene.

With respect to a polynucleotide encoding an inducible promoter of the present invention, the term “functional variant” refers to a polynucleotide at 60 ° C. in 0.3 strength citrate buffer containing 0.1% SDS. Is the complement of the sequence that hybridizes to the inducible promoter sequence at a temperature between and 65 ° C., even after washing with 0.3 strength citrate buffer containing 0.1% SDS at the same temperature. It still contains a mutated sequence that can serve as an inducible promoter.

With respect to a response protein, the term “functional variant” refers to a mutant protein obtained by a conservative substitution within an amino sequence that does not have a significant deleterious effect on the ability of the response protein to bind to a chemical inducer. Contains. In particular, substitutions may be made between the following amino acids: (a) alanine, serine, glycine and threonine (b) glutamic and aspartic acids (c) arginine and lysine (d) isoleucine, leucine, valine and methionine (E) Phenylalanine, tyrosine and tryptophan.

The term “transgenic” in the context of the present invention does not include a native environmental wild-type regulated promoter in combination with a related native environmental functional gene. The term “target gene” in the context of the present invention means any gene of interest. The target gene can be any gene that is foreign or natural to the eukaryote in question.

The term “construct”, which is synonymous with terms such as “cassette”, “hybrid” and “conjugate”, is directly or indirectly linked to a regulated promoter (eg, a cassette). Contains the target gene (as it forms). An example of indirect attachment is the provision of a suitable spacer group, such as an intron sequence intervening between the promoter and the target gene. The term "fused" in the context of the present invention is the same, and includes direct or indirect association. Such constructs also include plasmids and phages suitable for transforming the cell of interest.

The term “expression system” means that the system as defined above can be expressed in a suitable organism, tissue, cell or medium. The system may include one or more constructs, and may also include additional components that ensure increased expression of the target gene through the use of a regulated promoter.

[0027] One possible use of the inducible promoter of the invention is in controlling male sterility. Anthers are male reproductive processes in flowering plants (male reprodu)
active process). It is composed of several tissues and cell types and is involved in pollen grains, including sperm cells. Tapete tissue is a specialized tissue that plays a crucial role in pollen formation. It surrounds the pollen sac early in pollen development and degenerates later in development, and is not present in an organized form in mature anthers. Tapetate tissue produces many compounds that either help pollen development or are incorporated into pollen outer walls, indicating that many natural male sterile mutations impair anther differentiation or function. ing.

Thus, the tapetate tissue is critical for the formation of functional pollen grains. Many genes specifically expressed in tapetate tissues have been identified and cloned. These include Osg6B, Osg4B (Tsuchiya et al. 1994, Y
okoi, S et al. 1997), pE1, pT72 (WO92 / 139)
57), pCA55 corn (WO92 / 13956), TA29, TA1
3, (Seurinck et al. 1990), RST2 corn (
WO9713401), A6 from MS14,18,10 and Brassica napus (Br assica napus), A9 ( Hird et al.199
3). Anther-specific clones have been isolated from many species, including B
p4A and C (Albani et al. 1990), chs petunia (
Koes et al. 1989), rice (Xu et al. 1993, Zou).
et al. 1994). In higher plants, female reproductive organs are represented by pistils composed of ovary, style and stigma. The pistil group has been shown to contain up to 10,000 different mRNAs that are not present in other organs (
Kamalaya and Goldberg 1980). These include regulatory genes involved in controlling pistil development, as well as "downstream" genes encoding proteins associated with the different cell types in the pistil. The genes governing self-incompatibility and their homologs are a set of genes with pistil expression patterns (Nasrallah et al. 1993). Other cloned genes that can be used as target genes in the present invention include transmissible tissues (transmit
β-glucanase expressed in Ting tissue (Ori et al.
1990), pectate degrading enzyme (Budelier et al. 1990).
And chitinase (Lotan et al. 1989), and proteinase inhibitors expressed in style (Atkinson et al. 1993).
) Is included. Others are homologs of genes that are involved in pathogenesis or are involved in glycosidic bond cleavage. These enzymes facilitate pollen tube growth by digesting proteins in the tissue in which the tube grows. Many female sterilities (f
emale sterile) mutants have been identified in Arabinodopushisu (Arabidopsis PSIS). For example, sin1 (short ovule) (Robinso
n-Beers et al. 1992) and bell (corolla) (Robin
son-Beers ef al. 1992) affects ovule development. In short ovule, the mutation prevents macrospore formation at the quadrant chromosome stage (Elliot)
, R .; C, et al. 1996, Klucher, K .; M, 1996). A lethal ovule 2 mutation has been observed in maize but has not been cloned (
Nelson et al. 1952). Pistil-specific basic endochitinase has been cloned from many species (Ficker et al. 1997,
Dzelzkarns et al. 1993, Harikrishna et
al. 1996, Wemmer et al. 1994), and extensin-like genes have been shown to be expressed in the style of Nicotiana alata (Chen CG, et al. 1992).
Ovule-specific clones ZmOV23, 13, (Greco R., et al., Unpublished), OsOsMAB3A (Kang HG, et al. 1995),
ZmZmM2 (Theissen G., et al. 1995) and stigma specific stig1 (Goldman, MH et al. 1994), STG0
8, STG4B12 (EP-412006-A) has been reported. Maria
ni et al. Activates S to drive the expression of barnase in the stigma secretory zone
The promoter from TIG1 was used.

In summary, the present invention provides a gene switch operably linked to a foreign gene or set of foreign genes, whereby the expression of the foreign gene or set of foreign genes is an effective exogenous gene. It will be controlled by providing an inducer. Therefore, the gene switch of the present invention, when linked to an exogenous or foreign gene and introduced into a eukaryote by transformation, provides a means for controlling the expression of the foreign gene from outside.

It is possible to use one, two or more of these inducible promoter regions according to the invention to activate different processes in plant cells,
This gives, for example, plants which will have a multi-inducible cassette all controlled by different homoserine lactones. The plant may also contain, for example, an inducible promoter according to the invention in combination with other switch-type mechanisms, such as the Alc A / A described in WO 93/21334. R switch system, International Patent Nos. WO90 / 08826 and WO93 /
GST switch system described in U.S. Pat.
An inducible promoter containing the ecdysone switch described in 96/37609 is included.

[0031] The methods and products of the present invention will also be used to control the expression of foreign genes in eukaryotes such as yeast and mammalian cells. Many heterologous proteins for different applications have been produced with expression in such eukaryotic cells. The invention advantageously provides for control of the expression of a foreign gene in such cells. In particular, the present invention is further directed to yeast and mammalian cells, where accumulation of large amounts of heterologous proteins harms the cells and where short-term expression is required to maintain cell viability because the heterologous proteins are detrimental. Provide certain advantages.
The inducible system of the present invention also has utility in gene therapy as it allows for the timing of the therapeutic gene to be controlled. Thus, the present invention is advantageous not only for transformed mammalian cells, but also for the mammal itself. In addition, the present invention may be used to switch on genes that produce potentially damaging or lethal proteins. Such a system would be used to treat cancer where cells have been transformed with a gene that expresses a protein that is lethal to the cancer. The timing of the action of such proteins on cancer cells will be controlled using the switches of the present invention.

Various preferred features and embodiments of the present invention will now be described by way of non-limiting examples, with reference to the accompanying figures. Sequence SEQ ID NO: 1 is the LuxI box promoter region. SEQ ID NO: 2 is a LuxI promoter region. SEQ ID NO: 3 & 4 is a LuxR BamHI fragment. SEQ ID NOs: 5 & 6 are LuxR sequences / protein sequences. SEQ ID NOs: 7 & 8 are NVLuxR fusions flanked by BamHI and PstI sites / protein sequences. SEQ ID NOs: 9 & 10 are LuxRNV sequences / protein sequences. Sequence ID number: 11 is a TraR1 fragment. Sequence ID number: 12 is a TraR2 fragment. Sequence ID number: 13 is the LasBox1 region. Sequence ID number: 14 is the LasBox2 region. SEQ ID NOs: 15, 16, 17, and 18 are TraBox 1, 2, 3, 4,
Area. SEQ ID NO: 19 is a LuxR responsive protein sequence. SEQ ID NO: 20 is the LasR responsive protein sequence. SEQ ID NO: 21 is a TraR responsive protein sequence. Sequence ID numbers: 22 & 23 are reading frames for LasR and TraR , respectively.
SEQ ID NO: 24 is a Lux Box promoter region.

Embodiment 1 Six copies of Preparation 20bp palindrome lux box sequence in transient expression reporter gene expression cassette of LuxR and reporter plasmids in tobacco mesophyll protoplasts -60CaMV
It is fused upstream of the minimal promoter, which is then fused to the reporter gene GUS. The sequence 5 ′ GATCACCTGTACGATCCGTACAGGT 3 ′ (
The palindrome of SEQ ID NO: 1) is self-annealed and BamHI pB
lucscript vector. Significant recombinant sequencing identified a plasmid with six copies of the palindrome. The identified plasmid was cut with HindIII and SalI to release six copies of the palindrome and introduced into the HindIII / SalI p221.9 vector. The p221.9 plasmid contains a -60CaMV minimal promoter fused to GUS downstream of a HindIII and SalI specific cloning site. A recombinant plasmid was identified and named p221.9lux6 (FIG. 3).
. Identical oligonucleotides were p221.9LuxR2 (FIG. 4), p221.9
LuxR3 (FIG. 5) and p221.9 LuxC (FIG. 6) were used to generate. p221.9lpro was generated using a bacterial promoter containing a Lux box sequence (Figure 7, SEQ ID NO: 2).

Preparation of LuxR Expression Vector The lux receptor was modified at both ends of the coding sequence. At the 5 'end, the plant Kozak consensus sequence was placed with an NcoI site at the ATG start of the coding sequence. A BamHI- specific site was introduced using PCR upstream of the Kozak consensus sequence.
The sense oligonucleotide was luxrbamhl 5'CCCGGATCCCTA
ACAATGGGTATGAAAGACATAAATG 3 ′ (SEQ ID NO:
3), and the antisense primer is luxrbamh2 5′CGAACT
CGGTCATGATTTTAAAGTATGGGCAA-TCAATTG 3 ′ (SEQ ID NO: 4). The PCR reaction was performed with 100 ng of template DNA,
Taq polymerase (2.5 U) in a reaction buffer containing 100 ng of each oligonucleotide, 20 mM TRIS-HCl pH 8.4, 50 mM KCl, 10 mM MgCl ₂ , 50 mM dNTPs, was used, followed by heating starting conditions. Denaturation (94 ° C. for 1 minute), annealing (66 ° C. for 1 minute) and synthesis (7
(3 minutes at 2 ° C.) for 15 cycles. The fragment was purified and cleaved using BamHI / Xh oI, pDH51 BamHI / SalI vector in is introduced into pDH51luxR was obtained (XhoI and SalI restriction enzymes produce termini that matches) (Figure 8). The sequence in question was determined and compared to the reported LuxR sequence (SEQ ID NO: 5) (Devine et al., 1988).

Transformed tobacco mesophyll tobacco shoot culture cv. Samsun was maintained on a solidified MS medium + 3% sucrose in an environmental control room (25 ° C. for 16 hours day / 8 hour night, 55% RH) and used as protoplast source material. The leaves are sliced parallel to the central vein, the large veins are discarded and the thin fragments are subjected to 1 hour CPW13M (13
% Mannitol, pH 5.6,860 mmol / kg). This solution was mixed with an enzyme mixture (CPW of 0.2% cellulase R10, 0.05% macerozyme R10).
9M (CPW13M with 9% mannitol) solution, pH 5.6,600 mmol
/ Kg) and incubated at 25 ° C overnight (16 hours) in the dark.
The enzyme mixture was passed through a 75 μm sieve, and the filtrate was centrifuged at 600 rpm for 3.5 minutes and the supernatant was discarded. The pellet was resuspended in a 0.6 M sucrose solution and
Centrifuged at pm for 10 minutes. The protoplasts were removed and CPW9M (pH5.
6, 560 mmol / kg) and centrifuged at 600 rpm for 3.5 minutes to pelletize. Protoplasts were resuspended in CPW9M, counted, diluted to 2 × 10 ⁶ / ml in MaMg medium (Negrutui et al., 1987) and split into 4 × 10 ⁵ protoplasts per treatment. 200 μl of PEG solution followed by 20 μg each of effector and reporter plasmid DNA (1 n
g / ml) was added (Negrutui et al., 1987). Ligand (N- (3-oxo-hexanoyl) -L-homoserine lactone (OHHL)
)) Incubate the protoplasts in the presence or absence for 10 minutes at room temperature, and then add 5 ml of MSP19M medium (MS medium, 3% sucrose, 9%
mg / l NAA, 0.5 mg / l BAP, pH 5.6, 700 mmol / k
g) was added. Protoplasts were cultured horizontally in tubes at 25 ° C. and harvested 24 hours later for GUS assay.

Transiently expressed protoplast isolation in protoplasts from Nicotiana pumbagini folia suspension cells Protoplasts were isolated from Nicotiana pumbaginifolia suspension cells .
Suspended cells are subcultured once a week in Np suspension medium in 250 ml Erlenmeyer flasks and the flasks are incubated at 25 ° C. for 100 hours at 16 ° C./8 hour light / dark cycle.
Shake with PM. Protoplasts were isolated 2 or 3 days after subculture. 2
Alternatively, 2.5 g of freshly weighed cells were incubated with 20 ml of the filter-sterilized enzyme solution and shaken at 25 ° C. and 40 rpm. The enzyme solution was 1% cellulysin (Calbiochem 219466) dissolved in artificial seawater mannitol, 1
% Macerozyme RIO ^™ (Yakult, Tokyo) and 1% D
riselase (Sigma ^™ D-9515). After digestion for 3 hours in the enzyme solution, the solution was passed through a 100-, 50 μm diameter sieve with
xg was collected by centrifugation for 4 minutes. This method was also used to isolate wheat protoplasts.

Protoplast Transformation Protoplasts were resuspended in W5 medium at densities ranging from 0.1 to 0.2 × 10 ⁶ / ml and sedimented at 80 g for 4 minutes. They are 0.21 to 0.5 ml:
0.4 M mannitol containing 15 μg of plasmid DNA, 15 mM Mg
Cl ₂ , 0.1% MES, 2% glucose, pH 5.6. After 5 minutes, 40% (w / v) polyethylene glycol (PEG) 4000 (Fluk)
containing a ^TM) 0.4 M mannitol and 0.1M Ca (NO _3). 4H ₂ O
A pH 9.0 solution was added to a PEG concentration of 20%. 30 minutes later, 1 ml of 0
. 2M CaCl ₂ . 2H ₂ O was added and the protoplasts were centrifuged at 40 g for 4 minutes. Protoplasts were then added in transformation buffer at 0.1-0.2 x 1 / ml.
0 ⁶ protoplasts, the dark, were cultured for 48 hours at 25 ℃. This method was also used to isolate wheat protoplasts.

GUS Assay Transiently transformed tobacco protoplasts were harvested by centrifugation at 3000 rpm (they were collected by centrifugation at 3000 rpm). The supernatant was discarded and the protoplasts were resuspended in GUS extraction buffer (Jefferson et al., 1987) for the preparation of β-glucuronide extract. One tube
Vortexed for 1 minute and centrifuged at 13000 rpm for 2 minutes. The supernatant was collected and added to a new Eppendorf tube. 20 μl of the extract was used for the GUS assay. Fluorescence assays for GUS activity were performed using a substrate, 4-methylumbelliferyl-D-glucuronide, using a Perkin-Elmer ^™ LS-35 fluorimeter (Jefferson et al., 1987).
The protein concentration of the tissue homogenate was measured using the Bio-Rad ^™ protein assay (
Bradford, 1976).

[0039]Embodiment 2. FIG. Enhanced LuxR transient expression Transient expression experiments were performed as described above. Use the same reporter plasmid
However, different effector constructs were generated. Powerful like Vp16
Whether the presence of various activators enhances the transcription efficiency of the receptor
For,LuxRAt both the N- and C-termini. Vp16 is also SV
Also fused to the nuclear localization signal (NLS) from 40. SV40 NLS and
And VP16 are fusion fragments from the yeast two-hybrid plasmid pPC86.
And it is obtained as oneLuxRMeaning that you can fuse up
I have. The N-terminal fusion contains the SV40 NLS and Gal4 activation domain
PPc86ClaI/NotIIsolate fragment into pBluescript
It was built by introducing. The obtained pBluescript SV40V is HindIII Cut and buried, followed byBglIIdisconnected. This fragment
Is the SmaI / BamHI pDH51luxR vector (BamHIandBg II The enzyme produces a matching end) and is introduced into the N-terminal fusion of LuxR
Was generated to obtain the plasmid pDH51NVLuxR (FIG. 10). Methio
The nin start site is provided by the SV40 fragment.

The C-terminal fusion is performed by replacing the RcaI site of LuxR with a blunt-ended fragment of NLS / VP16. The pDH51LuxR cut with RcaI, then blunted, was coupled to a ClaI / NotI SV40-Gal4 blunted fragment.
The fusion resulted in the plasmid pDH51 LuxRNV containing the four connecting amino acids, CAKL, between the end of LuxR and the start of the nuclear localization sequence.

The plasmid was tested in tobacco mesophyll protoplasts as described in Example 1, where p221.9lux6 was introduced (with or without) an expression vector containing the enhancer luxR. The GUS assay was performed as described previously.

Embodiment 3 FIG . Transient expression of LuxR, LasR and TraR in monocot protoplasts Expression plasmid construction The choice of vector for expression in the monocot transient system was pFun containing the ubiquitin promoter region and Nos terminator. There are many specific cloning sites between the two. LuxR is expressed as pam as a BamHI fragment.
Moved into Fun. pLasR was transferred as a BamHI / KpnI fragment.
TraR is the oligonucleotide TraR1 5′AATTGGTACCACCC
ATGCAGCACTGGCTGGACAAGTTGACC 3 '(SEQ ID NO: 11) and TraR2 5' AATTGGATCCCAGATCAGCT
TTCTTCTGCTTGGCGAGG 3 '(SEQ ID NO: 12) isolated from Agrobacterium tumefaciens (Agrobacter ium tumefaciens) by PCR using. Purified fragment was restriction enzyme digested with BamH I, it was introduced into PFUN BamHI vector within. In each case, the expression vector was named as follows: pFunLuxR (FIG. 13)
, PFunLasR (FIG. 14) and pFunTra (FIG. 15).

Reporter Plasmid Construction The reporter plasmid used with the expression vector encoding LuxR was the same as that used in the transient experiments performed on tobacco (
Examples 1 and 2). For both the LasR and TraR expression reporter vectors, the parent plasmid p221.9 was used. In both cases, Las
Oligonucleotides encoding the Box and the two TraBoxes were made synthetically. The LasBox oligonucleotides are as follows:
Box 1 is 5 'TCGAACCCTGCGAGTTCTCCGAGGGTG 3'
(SEQ ID NO: 13) and LasBox2 is 5'TCGACACCT.
CGGAGAACTCGCAGGTG 3 ′ (SEQ ID NO: 14). Z
TraBox as described by Hu and Winans, (1999).
Is used and the oligos are as follows: TraBox1 5′TCGACTA
CACGTCTAGACGGTGTAGG 3 ′ (SEQ ID NO: 15), Tra
Box2 5'TCGACCTACCAGCTCTAGACGGTGTAG 3 '(
SEQ ID NO: 16) (first pair), TraBox3 5'TCGACTACA
CGCTCTAGACGTGTAAAG 3 ′ (SEQ ID NO: 17) and Tra
box4 5 'TCGACTTACACGCTCTAGACGTGTAG 3' (
Second pair) (SEQ ID NO: 18). Mix equal amounts of each counter oligo in the pair, denature and allow to cool. Double-stranded DNA with SalI sticky ends was formed.
The double-stranded DNA was then ligated into the SalI cut p221.9 vector. Recombinants were screened by colony hybridization to confirm the number of elements incorporated into the vector. The vector was named as follows: p22
1.9Trabox1 (FIG. 16), p221.9Trabox2 (FIG. 17) and p221.9Lasbox (FIG. 11).

Embodiment 4 FIG . A stable expression reporter cassette for LuxR in the construction of a two-component vector of tobacco plants was isolated by cutting p221.9lux6 with EcoRI and HindII I to obtain a 2.0 kb fragment. The fragment was purified and pB
Introduced into the in 19 EcoRI / HindIII vector and pBinrep
AHL was generated. Three different variants of the LuxR receptor (i.e., Lu xR and two promotion body) was restriction digest with EcoRI (site adjacent to both sides of the effector cassette), EcoRIpBin19rep dephosphorylated
PAHL1 (LuxR) (FIG. 18) and pAHL2 (
SVLuxR) (FIG. 19) or pAHL3 (LuxRSV) (FIG. 20).

Plant transformation constructs pAHL1 (FIG. 18), pAHL2 (FIG. 19) and pA containing plant-transformed LuxR or chimeric LuxR and a reporter gene cassette
HL3 (FIG. 20) is described in Holsters et al. Agrobacterium tumefaciens LB using the freeze / thaw method described by (1978)
A4404 was transformed. Tobacco (Nicotiana tabacum (Nicotia na tabacum) cv Samsun) transformants leaf disc method (Ho
rsch et al. , 1988). Shoots 100mg / l
It was regenerated in a medium containing kanamycin. After rooting, the small plants were transferred to a greenhouse and grown under 16 hours light / 8 hours dark conditions.

[0046]PCR analysis Analysis of transgenic tobacco plants by PCR requires 300 μl of extraction buffer
This was carried out using the leaf samples extracted in Step 1. DNA is isoproduced at 4 ° C for 10 minutes.
Precipitated with panol and centrifuged. The pellet is dried and 100 μl of TE (
Resuspended in 10 mM Tris HCl pH 8.0, 1 mM EDTA). 2.5
Transfer the μl to a 500 μl Eppendorf tube and add buffer, dNTPs and
A main mixture containing the lignonucleotides was added. After denaturing the sample for 3 minutes Taq Polymerase (Gibco-BRL)^TM) Was added.

The chemically treated OHHL was dissolved in methanol (Sigma), and the stock solution was maintained at -20 ° C. Compounds were diluted in the growth medium used to seed young plants. Uninduced seedlings were treated with an equal volume of methanol. Seeds were germinated in MS medium supplemented with 0.8% (w / v) agar. The seedlings were collected 2 days after sprouting (2 cotyledon stage).

GUS Assay In a seedling induction experiment, ten 2-day-old seedlings were collected and snap frozen in liquid nitrogen. The seedlings are homogenized in 300 μl of GUS extraction buffer,
Centrifuged at 13000 rpm for 5 minutes. The supernatant was used for both GUS and Bio-Rad ^™ protein assays.

Embodiment 5 FIG . Stable and constitutive expression of the yenI gene in tobacco plants The two-component vector construction pBDHELI (FIG. 21) is an alfalfa mosaic virus (AMW) translation enhancer sequence from pBiS26 (Datala et al., Plant Science 94, 139-140 (1993)). It was constructed by fusing the y ENI coding sequence from Yersinia enterocolitica (Yersinia enterocolitica). The AMV- LuxI gene fusion was directionally cloned into the pDH51 (Pietrzak et al., 1986) vector to generate pDHHELI. 1.8 of pDHELI
The kb fragment was cloned into pBin19 (Bevan, 1994) and the pBD
HELI (FIG. 21) was obtained. The plasmid was introduced into Agrobacterium as described above. A population of tobacco plants was produced and screened as detailed above. Those that highly expressed the yenI gene were selected for their ability to synthesize OOHL. The assay involved placing the leaves of the transgenic plant on an agar plate overnight. Leaves removed, covered and spread cviI mutants of Chromobacterium violaceum (Ch romobacterium violaceum) and on the plate. When OHHL is diffused from the leaves into the agar, biolines (purple pigment) produced by the bacteria can be observed (FIG. 24).

Embodiment 6 FIG . LuxR the compound produced by yenI plants grown by tissue culture under sterile conditions that will be activated by placing the roots of transgenic tobacco plants containing yenI expression cassette on LB agar plates, plasmid p
Top agar containing E. coli with SB401 (FIG. 22) was overlaid. This strain l ux operon (i.e., luxR, lux ABCDE) expressed, would bioluminescence in response to OHHL and HHL. FIG. 24 shows that yenI in tobacco plants
The acyl-homoserine lactone produced by the introduction is L-form contained in E. coli.
uxR can be activated, indicating that it activates reporter gene expression. These data suggest that introduction of LuxR expression and a reporter cassette into a plant containing the yenI gene will result in activation of reporter gene expression.

Embodiment 7 FIG . Crossing of LuxR tobacco high-expressing plant and yenI tobacco plant A plant was produced by crossing a henI expressing plant with an AHL switch plant. Progeny seeds were collected and assayed for GUS activity as described above. Since GUS protein was expected to be present in all tissues expressing the yenI gene, GUS activity was assayed in all tissues and at different ages. AH
Like the LuxR protein in the L-switch, yenI is under the control of the 35S CaMV promoter. Initially, progeny seedlings were grown in ＭＳMS and collected 2 days after sprouting or when cotyledons were fully spread.

Other variations of the invention that do not depart from the scope of the invention will be apparent to those skilled in the art. References

[0053]

[Table 4]

[0054]

[Table 5]

[0055]

[Table 6]

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows a schematic representation of the general structure of a response control protein in a bacterial quorum sensitive system.

FIG. 2 shows a schematic representation of the homoserine lactone gene switch system.

FIG. 3 is a plasmid map of the reporter gene construct, p221.9lux6.

FIG. 4 is a plasmid map of p221.9lux2.

FIG. 5 is a plasmid map of p221.9lux3.

FIG. 6 is a plasmid map of p221.9luxC.

FIG. 7 is a plasmid map of p221.9Lpro.

FIG. 8 depicts an expression vector containing LuxR in the pDH51 LuxR plasmid.

FIG. 9. SV40-NLS-Gal in plasmid pDH51SVLuxR.
Figure 9 shows an expression cassette containing an enhanced N-terminal fusion protein of 4-LuxR.

FIG. 10. LuxR-SV40-N in plasmid pDH51LuxRSV.
Figure 3 shows an expression cassette containing an enhanced C-terminal fusion of LS-Gal4.

FIG. 11 is a plasmid map of p221.9 lasbox. L
Contains one copy of the asR Box.

FIG. 12 is a plasmid map of a transient expression construct containing LasR, pSinLASR.

FIG. 13. Expression plasmid pFunLuxR for expression in monocotyledonous protoplasts.

FIG. 14: Expression plasmid pFunLasR for expression in monocot protoplasts.

FIG. 15: Expression plasmid pFunTraR for expression in monocot protoplasts.

FIG. 16: Reporter plasmid p221.9tr containing the tra box sequence 1 described by Zhu and Winans, (1999).
abox1.

FIG. 17: Reporter plasmid p221.9tr containing the tra box sequence 2 described by Zhu and Winans, (1999)
box2.

FIG. 18 shows a 2 containing effector and reporter cassette.
It is a plasmid map of a component vector, pAHL1.

FIG. 19 shows two vectors containing effector and reporter cassettes.
It is a plasmid map of a component vector, pAHL2.

FIG. 20 shows the two containing effector and reporter cassettes.
It is a plasmid map of a component vector, pAHL3.

FIG. 21 shows a two-component vector containing the luxI gene, pBDH.
It is a plasmid map of ELI.

FIG. 22 is a plasmid map of pSB401 containing the Lux operon.

FIG. 23. Transgenic tobacco plant roots grown in tissue culture under sterile conditions are placed on LB agar plates and plasmid pSB4
21 shows a stack of top agar containing E. coli with 01 (FIG. 22). This strain expresses the lux operon and will bioluminescent in response to OHHL and HHL. Bioluminescence in the area surrounding the root was clearly observed even with the naked eye.

FIG. 24 shows leaves of transgenic tobacco plants grown by tissue culture under aseptic conditions. Leaves are cut from the plant, placed on an LB agar plate,
Overlaid top agar containing the Chromobacterium violaceum indicator organism strain.
The purple color detected indicates the induction of the indicator organism strain gene, indicating that OHHL has been released from the plant tissue into the bacterial medium.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12R 1:91) C12N 15/00 ZNAA (C12Q 1/02 5/00 C C12R 1:91) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), E A (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, C N, CR, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR , KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (71) Applicant Fernhurst, Haslemere, Surrey GU27 3JE, United Kingdom (72) Inventor Jepson, Ian Berkshire RGS 426 England, Bracknell, Jerlots Hill International Research Center, Zeneca Agrochemicals (72) Invention Fry, Rupert George Leicester EL12 5 Ardie, UK, Loughborough, Sutton Boninton Campus, University of Nottingham, Faculty of Science, School of Bio-Musical Sciences Plant Sciences Division F-term (reference) 2B030 AA02 AB03 AD20 CA06 CA17 CA19 CB02 CD03 CD06 CD09 CD12 CD13 CD17 4B024 AA08 BA80 CA04 DA01 EA04 FA02 FA06 GA11 GA21 HA20 4B063 QA01 QA08 QQ09 QQ13 QR33 QR60 QR78 QR80 QS05 QS36 AQ02A02A BD32 CA53

Claims (34)

[Claims] 1. A method for initiating transcription of a target gene in a eukaryotic cell, comprising: (a) providing a eukaryotic cell capable of producing a responsive protein; (b) operably linked to the target gene. And inserting a polynucleotide defining an inducible promoter sequence capable of initiating transcription of the target gene when induced into the genome of the cell; and (c) providing a chemical inducer capable of binding to the response protein. Feeding to the cell, whereby the chemical inducer binds to the responsive protein to form an inducible complex, which binds to and induces the inducible promoter;
A method thereby initiating transcription of said target gene. 2. The method of claim 1, wherein a polynucleotide is inserted into the genome of said eukaryotic cell, wherein said polynucleotide provides for production of said responsive protein. 3. The method of claim 1 or 2, wherein the inducible promoter comprises the nucleotide sequence shown as SEQ ID NO: 2, and the responsive protein comprises the amino acid sequence shown as SEQ ID NO: 16. 4. The method of claim 1 wherein said inducible promoter contains 0.1% SDS.
A polynucleotide that is the complement of, but binds to, SEQ ID NO: 2 at a temperature between 60 ° C. and 65 ° C. in 3 strength citrate buffer at 0.1% SD at the same temperature
4. The method of claim 3, wherein after washing with a 0.3 strength citrate buffer containing S, the polynucleotide can still serve as an inducible promoter upon binding to the inducing complex. 5. The method according to claim 3, wherein the polynucleotide encoding the response protein comprises the sequence shown in SEQ ID NO: 5. 6. The polynucleotide encoding the response protein,
60 ° C to 65 ° C in 0.3 strength citrate buffer containing 0.1% SDS
And the complement of that which binds to SEQ ID NO: 5 at a temperature between 0.
6. The polynucleotide of claim 5, wherein even after washing with 0.3 strength citrate buffer containing 1% SDS, the polynucleotide still encodes a protein capable of forming an inducing complex with the chemical inducer. Method. 7. The method according to any one of claims 2 to 6, wherein the polynucleotide encoding the inducible promoter comprises the region shown in SEQ ID NO: 21. 8. The method according to claim 1, wherein the eukaryotic cell is a plant cell. 9. The method according to claim 1, wherein the plant cells are melon, mango, soybean, cotton, tobacco, sugar beet, oilseed rape, canola, flax, sunflower, potato, tomato, alfalfa, lettuce, corn, wheat, sugar corn, rye, banana, barley. Oats, turfgrass, magsa, sugarcane, peas, beans, rice, pine, poplar, apple, peach, grape, strawberry, carrot, lettuce, cabbage, onion, citrus or nut plant 9. The method of claim 8, wherein 10. The method according to claim 1, wherein the chemical inducer is N- (3-oxo) hexanoyl-L-.
The method according to any one of claims 1 to 9, which is homoserine lactone or a functional equivalent thereof. 11. The method according to any one of claims 8 to 10, wherein the chemical inducer is provided to the plant cells as part of an agriculturally acceptable formulation. 12. The polynucleotide according to claim 2, wherein the polynucleotide encoding the response protein is linked by a promoter and a terminator sequence.
The method according to any of the paragraphs. 13. The method according to claim 12, wherein the promoter is inducible. 14. The method according to claim 13, wherein the promoter is selected from the group consisting of an AlcA / R switch system, a GST switch system, and an ecdysone switch. 15. The method of claim 12, wherein the promoter is constitutive or developmentally regulated. 16. The method wherein the promoter is cauliflower mosaic virus 35S / 1.
9S, corn ubiquitin and Arabidopsis
16. The method of claim 15, wherein the method is selected from the group consisting of: ubiquitin 3. 17. The method according to any one of claims 1 to 16, wherein the target gene encodes β-glucuronidase; Bacillus thuringenesis toxin; burnase or burster. 18. A method for providing a plant comprising an inducible target gene, comprising: (a) inducing operably linked to a target gene in a plant cell that provides for the production of a response protein. Inserting a polynucleotide defining a sex promoter sequence; and (b) regenerating the morphologically normal reproductive plant; and (c) a chemical inducer capable of binding to the response protein or a functional mutation thereof. The body to a population of regenerants, whereby the chemical inducer binds to the responsive protein to form an inducible complex, which binds to the inducible promoter and induces the inducible promoter. And thereby initiate transcription of said target gene; and (d) a method of selecting a plant expressing said target gene. 19. The inducible promoter sequence comprises the nucleotide sequence shown as SEQ ID NO: 2 or a functional variant thereof, and the responsive protein is the amino acid sequence shown as SEQ ID NO: 16 or its functionality 19. The method of claim 18, comprising a mutant, and wherein the chemo-inducing agent is N- (3-oxo) hexanoyl-L-homoserine lactone or a functional equivalent thereof. 20. The inducible promoter sequence comprises the nucleotide sequence shown as SEQ ID NO: 10 or a functional variant thereof, and the responsive protein is the amino acid sequence shown as SEQ ID NO: 17 or a functional thereof. 19. The method according to claim 18, comprising a mutant, and wherein said chemical inducer is N- (3-oxo) dodecanoyl-L-homoserine lactone or a functional equivalent thereof. 21. The inducible promoter sequence comprises the nucleotide sequence shown as SEQ ID NO: 12 or a functional variant thereof, and the responsive protein is the amino acid sequence shown as SEQ ID NO: 18 or a functional thereof. 19. The method according to claim 18, comprising a mutant, and wherein said chemical inducer is N- (3-oxo) octanoyl-L-homoserine lactone or a functional equivalent thereof. 22. A plant produced according to any one of claims 18 to 21. 23. The plant is made of melon, mango, soybean, cotton, tobacco, sugar beet,
Oilseed rape, canola, flax, sunflower, potato, tomato, alfalfa, lettuce, corn, wheat, sugar corn, rye, banana, barley,
23. The oat, turfgrass, magsa, sugar cane, peas, beans, rice, pine, poplar, apple, peach, grape, strawberry, carrot, lettuce, cabbage, onion, citrus or nut plant. The plant according to claim 1. 24. A first polynucleotide region comprising an inducible promoter sequence operably linked to a target gene and capable of initiating transcription of the target gene when induced, and a responsive protein. A DNA construct comprising a second polynucleotide region provided for the production of the responsive protein, wherein the responsive protein binds to a chemical inducer to form an inducible complex upon contact of the responsive protein with the chemical inducer The inducible complex binds to the inducible promoter sequence and initiates transcription of the target gene. 25. The amino acid sequence wherein the first polynucleotide comprises the nucleotide sequence shown as SEQ ID NO: 2 or a functional variant thereof, and the second polynucleotide region is shown as SEQ ID NO: 16 25. The DNA construct according to claim 24, comprising a polynucleotide encoding a functional variant thereof. 26. The method according to claim 26, wherein the first polynucleotide comprises the nucleotide sequence shown as SEQ ID NO: 10 or a functional variant thereof, and the second polynucleotide region is the amino acid sequence shown as SEQ ID NO: 17 or 25. The DNA construct according to claim 24, comprising a polynucleotide encoding a functional variant. 27. The amino acid sequence wherein the first polynucleotide comprises the nucleotide sequence shown as SEQ ID NO: 12 or a functional variant thereof, and the second polynucleotide region is shown as SEQ ID NO: 18. 25. The DNA construct according to claim 24, comprising a polynucleotide encoding a functional variant thereof. 28. The DNA of any one of claims 24 to 27, wherein said second polynucleotide region comprises a promoter operably linked to a polynucleotide encoding said response protein. Construct. 29. The DNA according to claim 28, wherein said promoter is inducible.
Construct. 30. The DNA construct according to claim 28, wherein said promoter is constitutive or developmentally regulated. 31. Any of claims 24 to 30 in the manufacture of a plant comprising a target gene, wherein the expression of the target gene may be controlled by providing a chemical inducer to the plant. Use of the DNA construct according to the above. 32. A polynucleotide comprising an inducible promoter operably linked to a region encoding a reporter protein,
And providing a plant that is also capable of producing a reporter protein with an amount of a chemical, and testing the plant for production of the reporter protein. 33. A method for selectively controlling pests in an area containing crop plants and pests, wherein said plants are obtained according to claim 18, wherein said target gene is capable of controlling said pests. Encoding a target protein, the method comprising providing a plant with a chemical inducer in an amount sufficient to bind to the response protein to form the inducing complex, wherein the inducing complex comprises the inducing complex. Transcription of a target gene can be initiated that provides for the production of a target protein in an amount sufficient to control the pest. 34. A method for providing a plant comprising an inducibly regulated target gene, comprising: (a) a polynucleotide comprising a first inducible promoter operably linked to the target gene. Is inserted into the first plant cells and regenerates the first morphologically normal fertile plant therefrom; (b) a response protein capable of binding a chemical inducer to form an inducible complex; The body comprises a promoter comprising a promoter operably linked to a region encoding a response protein, which is subsequently associated with an inducible promoter to allow initiation of transcription of the target gene. Inserting nucleotides into a second plant cell and regenerating a second morphologically normal fertile plant therefrom; (c) replacing the first plant with the second plant or Cross-pollinating a second plant with the first plant and harvesting seeds therefrom; (d) growing the seeds and allowing the resulting plants to initiate transcription of the target gene. Providing an amount of said chemical inducer that provides a complex capable of binding to a sex promoter.